ads:
UNIVERSIDADE FEDERAL DE PELOTAS
Programa de Pós-Graduação em
Biotecnologia Agrícola
Tese
Avaliação da Capacidade Imunomoduladora de Extratos de
Própolis Verde em Animais Vacinados com
Herpesvírus Suíno Tipo 1 (SuHV-1) ou
Herpesvírus Bovino Tipo 5 (BoHV-5)
Geferson Fischer
Pelotas, 2007
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
ii
GEFERSON FISCHER
Avaliação da Capacidade Imunomoduladora de Extratos de
Própolis Verde em Animais Vacinados com Herpesvírus Suíno
Tipo 1 (SuHV-1) ou Herpesvírus Bovino tipo 5 (BoHV-5)
Orientador: Prof. Dr. Telmo Vidor
Co-Orientador: Prof. Dr. Niraldo Paulino
Pelotas, 2007
Tese apresentada ao Curso de Pós-
Graduação em Biotecnologia Agrícola da
Universidade Federal de Pelotas, sob
orientação do Prof. Dr. Telmo Vidor, como
parte das exigências do Programa de Pós-
Graduação em Biotecnologia Agrícola,
para a obtenção do título de Doutor em
Ciências.
ads:
iii
Dados de catalogação na fonte:
Ubirajara Buddin Cruz – CRB-10/1032
Biblioteca de Ciência & Tecnologia - UFPel
F529a Fischer, Geferson
Avaliação da capacidade imunomoduladora de extratos de
própolis verde em animais vacinados com herpesvírus suíno
tipo 1 (SuHV-1) ou herpesvírus bovino tipo 5 (BoHV-5) /
Geferson Fischer ; orientador Telmo Vidor ; co-orientador
Niraldo Paulino. – Pelotas, 2007. – 76f. – Tese (Doutorado).
Programa de Pós-Graduação em Biotecnologia Agrícola.
Centro de Biotecnologia. Universidade Federal de Pelotas.
Pelotas, 2007.
1.Biotecnologia. 2.Própolis. 3.Sistema imunológico.
4.Imunomodulação. 5.Adjuvante. I.Vidor, Telmo. II.Paulino,
Niraldo. III.Titulo.
CDD: 6136.4089
iii
Banca examinadora:
Prof. Dr. Telmo Vidor (orientador)
Prof. Dr. Niraldo Paulino (co-orientador)
Prof. Dr. Odir Antônio Dellagostin (Centro de Biotecnologia/UFPel)
Prof. Dr. Fábio Pereira Leivas Leite (Instituto de Biologia/Departamento de
Microbiologia e Parasitologia/UFPel)
iv
À Chris, minha estrela guia,
e minha mãe Vera.
Em memória do meu amado
pai e da amiga Vivi.
v
Agradecimentos
Primeiramente à Deus, razão de tudo, por mais uma etapa vencida. Quando
poucos acreditavam, foi minha fonte de força, esperança.
À minha esposa Chris, que tornou a minha caminhada mais bela e
significativa, cujo amor, paixão e incentivo foram imprescindíveis.
À minha mãe Vera, pelo amor e carinho que a mim dedicou, pelo apoio e
incentivo.
Ao meu pai Joaquim. Infelizmente não pudeste presenciar o término desta
etapa. Mas foi o teu exemplo de vida que me norteou. Agora, como um anjo de
Deus, certamente continuarás nos amparando!
Ao professor Telmo Vidor. Mais do que orientador, foi amigo, exemplo de
persistência.
Ao professor Niraldo Paulino, meu co-orientador, e sua esposa, professora
Amarílis. Nossa parceria tornou este projeto possível. O entusiasmo de vocês com a
própolis me incentivou, deu forças.
Ao amigo José Carlos Rösler Sandrini, cuja paciência e presença constante
foram fundamentais. Os momentos de descontração também foram indispensáveis.
À amiga Marlete Brumm Cleff, pela inestimável ajuda na execução deste
trabalho. Pelo companheirismo e sempre achar que “a vida é bela”!
Aos demais colegas e amigos do Laboratório de Virologia e Imunologia da
Faculdade de Medicina Veterinária: Eliete Sandrini, Enilda Souza de Oliveira,
Andréia Peixoto, Silvia de Oliveira Hübner, Gilberto D´Avila Vargas, Caren
Quincozes, Camila Vilela, Luana Alves Dummer, Tiago Storch, Fabrício Campos,
pelo apoio sempre que necessário, pela amizade e companheirismo.
Aos amigos do Centro de Biotecnologia, em especial ao Fabricio Rochedo
Conceição.
vi
Aos professores Odir Antônio Dellagostin e Fábio Pereira Leivas Leite, pelo
apoio e incansável contribuição.
Ao professor José Vasconcelos Arnoni, pelo fornecimento dos bovinos.
À Universidade Federal de Pelotas, pela oportunidade de realização deste
curso de Pós-Graduação em Biotecnologia Agrícola.
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq),
pela concessão da bolsa de estudos e pelo financiamento de parte das pesquisas.
A todos os amigos não citados, mas que sabem que de alguma forma são
fundamentais na minha vida.
Por fim, agradeço a todos que colaboraram de alguma forma na execução
deste trabalho.
vii
“... porque são os passos
que fazem os caminhos...”
Mário Quintana
e
“porque o desejo, como a
esperança, são dois ventos
necessários para a viagem
da vida.”
Campoamor
viii
RESUMO
FISCHER, Geferson. Avaliação da Capacidade Imunomoduladora de Extratos de
Própolis Verde em Animais Vacinados com Herpesvírus Suíno Tipo 1 (SuHV-1)
ou Herpesvírus Bovino tipo 5 (BoHV-5). 2007. 76f. Tese (Doutorado) – Programa
de Pós-Graduação em Biotecnologia Agrícola. Universidade Federal de Pelotas,
Pelotas. Orientador: Telmo Vidor. Co-orientador: Niraldo Paulino.
A formulação de vacinas frequentemente requer o uso de adjuvantes que prolongam
ou potencializam as respostas imunes humoral e/ou celular. Atualmente, muitas
vacinas são formuladas a partir de substâncias como o hidróxido de alumínio ou
emulsões oleosas, específicas para uso veterinário. Contudo, tem sido crescente o
interesse pela avaliação de substâncias naturais com potencial adjuvante, como os
extratos derivados de plantas. A própolis, produzida pelas abelhas a partir de
exsudatos coletados de plantas, tem despertado o interesse de pesquisadores em
função das inúmeras propriedades bioativas relatadas, como ação antiviral,
antiinflamatória e antitumoral. Além disso, apesar de desconhecidos muitos dos
mecanismos de ação, a própolis apresenta atividade sobre o sistema imune. O
objetivo deste estudo foi avaliar a capacidade imunomoduladora de um extrato
etanólico da própolis verde brasileira, quando utilizado como adjuvante em vacinas
inativadas contra o herpesvírus suíno tipo 1 (SuHV-1) ou herpesvírus bovino tipo 5
(BoHV-5). A adição de 5 mg/dose do extrato a uma vacina com hidróxido de
alumínio contra o SuHV-1 incrementou a resposta imune humoral de camundongos,
quando comparado com a mesma vacina sem própolis (P<0,01). Este efeito foi mais
evidente quando a vacina foi diluída (1:4 e 1:8), podendo-se observar um aumento
no título de anticorpos neutralizantes, expresso em log
2
, que passou de 3 para 4,48
e de 2,18 para 4,48, respectivamente, sugerindo que quanto menor a massa
antigênica ou menos imunogênico o antígeno, mais pronunciado é o efeito adjuvante
da própolis. Quando a própolis foi utilizada isoladamente com o antígeno, não foi
observado aumento no título de anticorpos neutralizantes, determinado por
soroneutralização. Além de incrementar a resposta imune humoral, o uso da própolis
também aumentou a resposta celular, elevando a síntese de mRNA de IFN-γ nos
esplenócitos dos camundongos, mensurada pela técnica de RT-PCR. Este aumento
foi observado inclusive no grupo de animais imunizados somente com antígeno e
própolis, contrariando os resultados da resposta humoral. O efeito adjuvante da
própolis foi evidenciado também quando camundongos foram desafiados com 31,6
doses letais do SuHV-1, 21 após a segunda inoculação. A adição da própolis à
vacina com hidróxido de alumínio aumentou o percentual de animais protegidos,
especialmente nas maiores diluições, em comparação à vacina sem própolis.
Resultado semelhante foi observado no grupo de animas vacinados somente com
própolis e antígeno. A associação de 40 mg/dose do extrato etanólico de própolis
verde à vacina oleosa contra BoHV-5 aumentou o título de anticorpos neutralizantes
de bovinos (P<0,01), quando comparado à vacina sem própolis. Trinta dias após a
ix
segunda vacinação, o título passou de 35 para 54 e aumentou de 43 para 67, trinta
dias após a terceira vacinação. Além disso, houve aumento no percentual de
animais com títulos elevados, acima de 32. A inclusão de 20 mg/dose do extrato não
alterou a resposta humoral. A análise cromatográfica da própolis por HPLC revelou
altos níveis de compostos fenólicos como o artepillin C e derivados do ácido
cinâmico, que podem ter sido as principais substâncias com ação sobre o sistema
imunológico. Portanto, o extrato etanólico de própolis verde atuou como uma
substância adjuvante, incrementando as respostas imunes humoral e celular em
camundongos e humoral em bovinos, melhorando a eficiência das vacinas
experimentais.
Palavras-chave: própolis, sistema imunológico, imunomodulação, adjuvante
x
ABSTRACT
FISCHER, Geferson. Evaluation of the immunomodulator activity of green
propolis extract in animals vaccinated with swine herpesvirus type 1
(SuHV-1) or bovine herpesvirus type 5 (BoHV-5). 2007. 76f. Tese (Doutorado) –
Programa de Pós-Graduação em Biotecnologia Agrícola. Universidade Federal de
Pelotas, Pelotas. Adviser: Telmo Vidor. Co-adviser: Niraldo Paulino.
Vaccine formulation often requires the use of adjuvants which enhance or potentiate
humoral and/or cellular responses. Nowadays, many vaccines are formulated with
substances such as aluminum hydroxide or oily emulsions, specific for veterinary
use. However, the interest on the evaluation of natural substances with adjuvant
potential like plant extracts has grown. Propolis produced by honey bees from
exudates collected from plants has call the attention of researchers due to several
bioactive properties reported, such as antiviral, antiinflamatory and antitumoral
action. In addition, although the mechanism of action remains unknown, propolis
presents activity on the immune system. The aim of this study was to evaluate the
immunomodulator activity of an ethanolic extract of Brazilian green propolis, when
used as adjuvant in inactivated vaccines against swine herpesvirus type 1 (SuHV-1)
or bovine herpesvirus type 5 (BoHV-5). The addition of 5 mg/dose of the extract to a
vaccine with aluminum hydroxide against SuHV-1 increased the humoral immune
response of mice, when compared to the same vaccine without propolis (P<0,01).
This effect was more evident when the vaccine was diluted (1:4 and 1:8). The raise in
neutralizing antibodies titer, expressed in log
2
, went from 3 to 4.48 and 2.18 to 4.48,
respectively, suggesting that the smaller the antigenic mass or less immunogenic the
antigen, more pronounced is the adjuvant effect of propolis. When propolis was used
on its own with the antigen, an increase in the titer of neutralizing antibodies
determined by seroneutralization was not observed. Besides increasing the humoral
immune response, the use of propolis also increased the cellular response,
increasing mRNA synthesis of IFN-γ in mice splenocytes, measured by RT-PCR.
This increase was also observed in the group of animals immunized only with antigen
and propolis, unlike the effect observed on the humoral response. The adjuvant
effect of propolis was also demonstrated when mice were challenged with 31.6 lethal
doses of SuHV-1, 21 days after the second inoculation. The addition of propolis to
the vaccine with aluminum hydroxide increased the percentage of protected animals,
especially in the higher dilutions, comparing to the vaccine without propolis. Similar
result was observed in the group of animals vaccinated only with propolis and
antigen. The association of 40 mg/dose of ethanolic extract of green propolis to the
oily vaccine against BoHV-5 increased titer of bovine neutralizing antibodies
(P<0,01), when compared to a vaccine without propolis. Thirty days after the second
dose the titer went from 35 to 54, and after the third dose it increased from 43 to 67.
In addition, there was an increase in the percentage of animals with titer above 32.
The inclusion of 20 mg/dose of the extract did not alter the humoral response. The
xi
chromatographic analysis of propolis by HPLC showed high levels of phenolic
compounds as artepillin C and cynamic acid derived, which may be the main
substances with action on the immunologic system. Therefore, green propolis
ethanolic extract acted as an adjuvant substance, increasing humoral and cellular
immune responses in mice and humoral response in bovines, improving the
efficiency of experimental vaccines.
Key-words: propolis, immunological system, immunomodulation, adjuvant.
xii
SUMÁRIO
SUMÁRIO .................................................................................................................. xii
1 INTRODUÇÃO ......................................................................................................... 1
2 ARTIGO 1 ................................................................................................................. 6
RESUMO ................................................................................................................. 7
ABSTRACT .............................................................................................................. 8
INTRODUÇÃO ......................................................................................................... 8
IMUNOMODULAÇÃO ............................................................................................ 10
PRÓPOLIS E IMUNOESTIMULAÇÃO .................................................................. 11
PRÓPOLIS E IMUNOSSUPRESSÃO ................................................................... 15
CONCLUSÃO ........................................................................................................ 19
REFERÊNCIAS ..................................................................................................... 19
3 ARTIGO 2 ............................................................................................................... 29
Summary ............................................................................................................... 30
1. Introduction ........................................................................................................ 31
2. Material and methods ........................................................................................ 32
2.1 Ethanolic extract of green propolis ............................................................... 32
2.2 Vaccine preparations and inoculations ......................................................... 33
2.3 Humoral immunity and protection ................................................................. 34
2.4 Cellular immunity .......................................................................................... 35
2.5 Statistical Analysis........................................................................................ 37
3. Results ............................................................................................................... 37
3.1 Humoral immunity ........................................................................................ 37
3.2 Protection afforded by the vaccine preparations .......................................... 38
3.3 Cellular immunity .......................................................................................... 40
4. Discussion ......................................................................................................... 41
Acknowledgements ................................................................................................ 45
References ............................................................................................................ 46
4 ARTIGO 3 ............................................................................................................... 52
Abstract.................................................................................................................. 53
1. Introduction ........................................................................................................ 54
2. Material and methods ........................................................................................ 56
2.1. Preparation, botanical and chemical characterization of the propolis
ethanolic extract ................................................................................................. 56
2.2. Vaccines and inoculations ........................................................................... 56
2.3. Serology ...................................................................................................... 57
2.4. Statistical analysis ....................................................................................... 58
3. Results ............................................................................................................... 58
xiii
3.1. Chemical composition of the propolis extract .............................................. 58
3.2. Humoral Response ...................................................................................... 59
4. Discussion ......................................................................................................... 61
5. Conclusions ....................................................................................................... 64
Acknowledgments .................................................................................................. 65
References ............................................................................................................ 65
5 CONCLUSÕES ...................................................................................................... 71
6 REFERÊNCIAS ...................................................................................................... 72
1 INTRODUÇÃO
Ainda na idade média, quando o homem identificou a primeira doença
infecciosa através de sua sintomatologia, rapidamente percebeu que o indivíduo
acometido passava por um período subseqüente de proteção contra a mesma
enfermidade. Não raros eram os casos em que uma mesma pessoa não era
acometida pela mesma enfermidade uma segunda vez. Baseado nestes fatos, a
primeira forma de imunização consistia em transmitir determinada enfermidade de
um indivíduo a outro, na tentativa de reduzir a sua gravidade e os índices de
mortalidade. Assim, já no século XII, os chineses adotavam uma das primeiras
práticas de imunização na tentativa de evitar a ocorrência de doenças, a variolação,
que consistia na inalação de um pó preparado a partir da crosta da pústula da
varíola, como forma de proteção contra qualquer futura infecção (BAZIN, 2003). Este
processo reduzia o índice de mortalidade pela doença, porém para padrões
inaceitáveis atualmente. Em 1796, ao inocular o material das lesões de varíola
bovina em humanos, produzindo uma doença menos severa, Edward Jenner
percebeu que esse processo reduzia os riscos decorrentes da variolação, definindo
este processo como vacinação (do latim, vacca, vaca). Este termo ainda hoje
descreve a inoculação de cepas atenuadas ou inativadas de agentes causadores de
doenças em indivíduos sadios, a fim de obter proteção natural do organismo contra
uma enfermidade.
As primeiras vacinações realizadas por Jenner e Pasteur nos séculos XVIII e
XIX eram práticas totalmente empíricas e se confundiram com o surgimento da
própria imunologia como ciência (BAZIN, 2003). Aliás, as descobertas relacionadas
ao funcionamento do sistema imunológico foram fundamentais para o
desenvolvimento da vacinologia (SCHATZMAYR, 2003). Desde então, houve uma
grande evolução no desenvolvimento de vacinas. Além daquelas consideradas
2
tradicionais, compostas de patógenos vivos atenuados, de organismos inteiros
inativados ou de toxinas bacterianas inativadas, várias novas abordagens têm sido
propostas. Assim, surgiram as vacinas de subunidades, vacinas recombinantes e
vacinas de DNA.
Este recente progresso no desenvolvimento de vacinas tem permitido a sua
utilização não apenas de modo profilático, mas também no tratamento do câncer,
desordens imunológicas e infecções crônicas (BLOM; HILGERS, 2004). Contudo,
apesar do grande avanço tecnológico, muitas vacinas são pouco imunogênicas ou
não conferem uma resposta imune capaz de prevenir a enfermidade, necessitando
da associação com substâncias adjuvantes (SINGH; O´HAGAN, 2002).
O termo adjuvante (do latim, adjuvare, ajudar) foi primeiramente descrito na
década de 1920 como uma “substância que, usada em combinação com um
antígeno específico, produz mais imunidade que o antígeno sozinho” (SINGH;
O´HAGAN, 1999). Desde então, muitos outros conceitos foram formulados. No
entanto, parece correto afirmar que “cada molécula ou substância capaz de
favorecer ou amplificar um passo na cascata de eventos imunológicos (STORNI et
al., 2005), prolongando ou potencializando as respostas imunes humoral e/ou
celular” (LECLERC, 2003), pode ser definida como um adjuvante.
De acordo com Singh e O´Hagan (2003) os adjuvantes podem ser usados
para aperfeiçoar a resposta imune de vacinas de várias formas, incluindo: 1)
aumentar a imunogenicidade de antígenos fracos; 2) aumentar a velocidade e a
duração da resposta imune; 3) modular a atividade dos anticorpos a sua
especificidade; 4) estimular os linfócitos T citotóxicos; 5) promover a indução de
imunidade de mucosas; 6) aumentar a resposta imune em indivíduos imaturos
imunologicamente ou senescentes; 7) diminuir a dose de antígeno nas vacinas,
reduzindo os custos.
Embora várias substâncias tenham sido avaliadas quanto a sua capacidade
adjuvante, muitas vezes demonstrando alta potência imunológica (SINGH;
O´HAGAN, 2003), de um modo geral, a produção de vacinas continua atrelada à
utilização dos sais de alumínio (LECLERC, 2003) ou de emulsões oleosas,
especificas para vacinas de uso veterinário (JANSEN et al., 2006). Diversos fatores,
como a toxicidade e o desconhecimento a respeito dos mecanismos de ação,
contribuem para este fato (SINGH; O´HAGAN, 1999). Além disso, nenhuma
substância pode ser considerada como um adjuvante universal e a sua utilização
3
deve ser adaptada ao antígeno vacinal, ao tipo de resposta imune que se deseja
estimular, à duração da resposta, bem como à via de inoculação (SCHIJNS, 2000;
AUCOUTURIER; DUPUIS; GANNE, 2001). Desta forma, o desenvolvimento de
novas vacinas e o aperfeiçoamento de vacinas já existentes será altamente
beneficiado com a identificação de novas substâncias capazes de promover e
direcionar a uma resposta imune apropriada (COX; COULTER, 1997; SINGH;
O´HAGAN, 2002).
Além de produtos sintéticos como o hidróxido de alumínio e o óleo mineral, a
pesquisa por novos adjuvantes tem se direcionado na utilização de substâncias
derivadas de vegetais, como os extratos das plantas Quillaja saponaria
(DALSGAARD, 1974) e Quillaja brasiliensis (FLECK et al., 2006), que potencializam
a resposta imune através das saponinas. Paralelamente, a própolis vem
despertando o interesse de pesquisadores de todo o mundo em função de inúmeras
propriedades bioativas já relatadas, entre elas a capacidade imunomoduladora
(DIMOV et al., 1992; ORSI et al., 2000).
O nome própolis é derivado do grego pro “em defesa de”, e polis “a cidade”, o
que significa “em defesa da cidade ou da colméia” (MARCUCCI, 1996). Também
conhecida como “cola de abelha”, a própolis é uma complexa mistura de substâncias
resinosas e balsâmicas coletadas pelas abelhas em diferentes partes das plantas
(MARCUCCI, 1995; BURDOCK, 1998). Na colméia, estas substâncias são
transformadas através do acréscimo de secreções salivares e outros produtos das
abelhas, como a cera (PINTO et al., 2001; STRADIOTTI et al., 2004).
As abelhas utilizam a própolis para a construção e manutenção das colméias
(BURDOCK, 1998), no fechamento de frestas, redução do alvado para diminuição
da entrada de vento frio e inimigos naturais, além de embalsamento de pequenos
animais, mortos pelas próprias abelhas, que não puderam ser retirados da colméia,
evitando com isso a putrefação (MARCUCCI, 1995). A própolis também é utilizada
para envernizamento do interior dos alvéolos, permitindo que a rainha faça a postura
dos ovos em ambiente não contaminado, e contra a proliferação de
microorganismos como bactérias e fungos (BANKOVA; CASTRO; MARCUCCI,
2000).
A complexidade química da própolis é evidenciada por mais de 300
substâncias diferentes identificadas em amostras distintas (BURDOCK, 1998;
BANKOVA; CASTRO; MARCUCCI, 2000). Sua constituição pode variar de acordo
4
com a espécie de abelha, época de ano em que é coletada e, especialmente, origem
botânica (BANKOVA; CASTRO; MARCUCCI, 2000; BANKOVA, 2005).
Diferentemente dos países de clima temperado, onde a própolis é produzida
especialmente a partir de espécies de Populus sp. (BANKOVA; CASTRO;
MARCUCCI, 2000), no Brasil, a rica composição da flora oferece às abelhas um
grande número de plantas resiníferas, de onde coletam as secreções para a sua
produção. Assim, já foram identificados mais de 12 tipos diferentes de própolis no
Brasil (PARK et al., 2002). No sul do país, as espécies botânicas mais utilizadas
para a sua produção são as coníferas, como o pinheiro serrano (Araucária
angustifólia L.), além do Eucapito citriodora (BANKOVA et al., 1999; MIDORIKAWA,
2001). Já na região sudeste do Brasil, a principal fonte botânica utilizada para
produção de própolis é a planta Baccharis dracunculifolia L., conhecida
popularmente como alecrim do campo ou vassourinha. Esta espécie, não adaptada
às condições naturais existentes em outros países (MIYATAKA et al., 1997), dá
origem à própolis verde brasileira, com características químicas e biológicas
diferenciadas.
A complexidade química da própolis é reflexo da diversidade da flora utilizada
como fonte para a sua produção, dificultando a identificação das substâncias
responsáveis por suas atividades terapêuticas. Enquanto nas amostras européias o
grupo químico presente em concentrações majoritárias é o dos flavonóides, cujo
principal constituinte bioativo é o éster fenil etil do ácido caféico (CAPE), nas
amostras brasileiras predominam os compostos fenólicos como artepillin C e o ácido
hidroxicinâmico (PEREIRA, et al., 2003). Alguns pesquisadores afirmam que a
composição química heterogênea, além da combinação de diferentes substâncias
naturais, são essenciais para a atividade biológica da própolis (MATSUNO, 1996;
KUJUMGIEV et al., 1999).
Utilizada pelo homem para embalsamar cadáveres desde séculos antes de
Cristo (PEREIRA et al., 2002) a própolis apresenta várias propriedades bioativas,
dentre as quais se destacam a ação antiviral (BURDOCK, 1998; FISCHER et al.,
2005), antiinflamatória (ANSORGE; REINHOLD; LENDECKEL, 2003), antioxidante
(SCHELLER et al., 1989), antiparasitária (DECASTRO; HIGASHI, 1995; DANTAS et
al., 2006), antitumoral (ORSOLIC et al., 2004; ASO et al., 2004), entre outros.
Apesar de muitos mecanismos de ação continuarem desconhecidos, a própolis
também tem sido descrita como uma substância com atuação sobre o sistema
5
imunológico (DIMOV et al., 1992; ORSI et al., 2000), representando uma nova
alternativa para tratamentos imunoterápicos (BURDOCK, 1998).
O objetivo do presente estudo foi avaliar a capacidade imunomoduladora de
um extrato etanólico da própolis verde brasileira, quando associado a vacinas
inativadas contra o herpesvírus suíno tipo 1 (SuHV-1) ou herpesvírus bovino tipo 5
(BoHV-5), através da mensuração de parâmetros das imunidades humoral e celular
de camundongos e bovinos, respectivamente.
6
2 ARTIGO 1
Submetido à Revista Arquivos do Instituto Biológico
7
IMUNOMODULAÇÃO PELA PRÓPOLIS
G. Fischer
1
, S.O. Hübner
1
, G.D. Vargas
2
, T. Vidor
2
1
Laboratório de Virologia e Imunologia – LABVIR, Faculdade de Veterinária,
Universidade Federal de Pelotas – Rua Carlos de Carvalho, 372/401 96030-270
– Pelotas – RS. E-mail: [email protected]
RESUMO
A própolis, uma substância resinosa produzida pelas abelhas melíferas a
partir de exsudatos coletados em diferentes partes das plantas, tem sido utilizada há
séculos na medicina popular devido as suas propriedades terapêuticas. Esta
substância apresenta atividade antiinflamatória, antitumoral, antioxidante e
imunomoduladora, embora muitos dos seus mecanismos de ação sejam
desconhecidos. A imunomodulação pela própolis pode estar associada tanto com a
estimulação quanto com a supressão de determinados eventos da resposta imune.
Os efeitos antagônicos e muitas vezes não complementares sobre o sistema
imunológico podem ser decorrentes da grande variabilidade química existente entre
diferentes amostras de própolis, bem como das diferentes metodologias adotadas
nos estudos científicos, resultando em variada ação farmacológica. Este artigo teve
como objetivo revisar e discutir alguns aspectos relacionados à ação da própolis
sobre o sistema imunológico.
PALAVRAS-CHAVE: própolis, sistema imunológico, modulação.
1
LABVIR, Faculdade de Veterinária, Universidade Federal de Pelotas, Pelotas, RS.
8
IMMUNOMODULATION INDUCED BY PROPOLIS
ABSTRACT
Propolis is a resinous substance produced by honey bees from exudates
collected from different parts of the plants. It has been used for centuries in the
popular medicine due to its therapeutic characteristics. This substance presents anti-
inflammatory, anti-tumoral, anti-oxidant and immunomodulator activities, even though
many of its mechanisms of action are still unknown. Immunomodulation induced by
propolis can be associated with stimulation as well as supression of certain events of
the immune response. The antagonic and some times not complementing effects on
the immunological system can be attributed to the wide chemical variability present
among different propolis samples, as well as to the different methodologies used in
scientific studies, resulting in a varied pharmacological action. This work aims at
reviewing and discussing some aspects related to the mechanism of action of
propolis on the immunological system.
KEYWORDS: propolis, immunological system, modulation
INTRODUÇÃO
A própolis é um produto resinoso natural produzido pelas abelhas melíferas a
partir de substâncias coletadas em diferentes partes das plantas, como brotos,
casca, botões florais e exsudatos resinosos (MARCUCCI, 1995; BURDOCK, 1998).
As abelhas transportam estas substâncias até a colméia e as modificam através da
adição de cera, pólen e produtos do seu metabolismo, como a enzima salivar ß-
glicosidase, aumentando a sua ação farmacológica (PARK et al., 1998; PINTO et al.,
2001; PARK et al., 2002; STRADIOTTI et al., 2004).
9
A composição da própolis é extremamente complexa. Mais de 300 substâncias
diferentes já foram identificadas (BURDOCK, 1998; BANKOVA et al., 2000). Suas
características constitutivas podem variar de acordo com a espécie de abelha e
época do ano em que é coletada (BANKOVA, 2005). Contudo, a origem botânica
(BANKOVA et al., 2000; BANKOVA, 2005) parece ser o fator mais importante a ser
considerado na tentativa de explicar a variabilidade química entre diferentes
amostras de própolis. Em zonas temperadas, como na Europa, América do Norte e
regiões não tropicais da Ásia, a fonte dominante para a produção da própolis é o
exsudato do botão de álamo (Populus sp.) (BANKOVA et al., 2000). As amostras
originárias destas regiões são quimicamente similares, predominantemente
compostas por substâncias flavonóides como o éster feniletil do ácido cafeico
(CAPE) (BANKOVA et al., 2000). No entanto, nas regiões de clima tropical, há uma
grande variabilidade química entre as amostras de própolis, em conseqüência da
grande diversidade vegetal utilizada para a sua produção. PARK et al. (2002)
identificaram 12 tipos diferentes de própolis no Brasil. A mais conhecida e estudada
é a própolis verde, produzida a partir de uma planta conhecida popularmente por
alecrim do campo (Baccharis dracunculifolia). Esta espécie não é adaptada às
condições naturais existentes em outros países (MIYATAKA et al., 1997), o que
confere à própolis verde características químicas e biológicas diferenciadas. Mais ao
sul do país, as resinas de Araucária angustifólia L. e Eucalipto citriodora contribuem
decisivamente para a produção deste apiterápico (BANKOVA et al., 1999;
MIDORIKAWA, 2001). Nas amostras brasileiras de própolis os compostos fenólicos,
como o artepillin C e o ácido hidroxicinâmico, são as substâncias majoritárias
(PEREIRA et al., 2003).
10
Utilizada pelas abelhas contra a proliferação de microorganismos (BANKOVA
et al., 2000), a própolis apresenta várias outras propriedades bioativas. Dentre elas
destacam-se a ação antiviral (BURDOCK, 1998; FISCHER et al., 2005),
antiinflamatória (ANSORGE et al., 2003), antioxidante (SCHELLER et al., 1989) e
antiparasitária (DECASTRO & HIGASHI, 1995; DANTAS et al., 2006). Apesar de
demonstradas as suas atividades imunomoduladoras (DIMOV et al., 1992; ORSI et
al., 2000; FISCHER et al., 2007), muitos destes mecanismos de ação são
desconhecidos. O objetivo deste artigo foi revisar alguns aspectos relacionados à
ação da própolis sobre o sistema imunológico.
IMUNOMODULAÇÃO
A imunomodulação pode ser exercida mediante a potencialização ou através
de supressão de elementos do sistema imunológico (KIRKLEY, 1999) Este conceito
começou a ser formulado em 1796, quando Edward Jenner utilizou a primeira vacina
contra a varíola humana. Desde então, vários estudos têm sido conduzidos na busca
de substâncias capazes de auxiliar o sistema imune no combate a microorganismos
patogênicos, ou a problemas internos, tais como câncer e doenças autoimunes
(LABRO, 2000). Atualmente, a utilização de própolis como uma substância
imunomoduladora tem sido considerada uma alternativa para a prevenção e cura de
diversas enfermidades (ORSOLIC & BASIC, 2003).
A imunomodulação exercida pela própolis ocorre de forma contraditória, as
vezes sendo descrita como estimulante, e outras vezes como inibidora de
determinados eventos imunológicos. Provavelmente estes efeitos contraditórios se
devem, dentre outros fatores, à complexidade química da própolis. Para BANKOVA
(2005) comparar amostras de própolis de origens geográficas distintas é o mesmo
11
que comparar extratos de duas plantas que pertencem a famílias diferentes, tal a
sua variabilidade química e, conseqüentemente, suas propriedades farmacológicas.
A imunomodulação pela própolis também pode estar diretamente relacionada à
forma de extração dos seus compostos bioativos. O tipo de solvente empregado,
além do protocolo adotado, poderão resultar em maior ou menor eficiência de
extração de determinadas substâncias como os compostos fenólicos, nos quais se
concentra a maior parte da atividade farmacológica da própolis. Além disso, a
combinação das diferentes substâncias naturais que compõe a própolis,
provavelmente resultando em efeito sinérgico, é essencial para a sua atividade
biológica (KUJUMGIEV et al., 1999).
PRÓPOLIS E IMUNOESTIMULAÇÃO
Uma das formas de imunomodulação pela própolis ocorre através da ativação
de macrófagos (ORSOLIC & BASIC, 2003). Estas células desempenham um papel
fundamental na defesa do organismo, através da fagocitose, geração de radicais
livres, mediação de processos inflamatórios, e secreção de uma variedade de
substâncias bioquimicamente diferentes, como enzimas e componentes do sistema
complemento. A ação da própolis sobre os macrófagos resulta em aumento da
capacidade fagocítica (ORSI et al., 2000), estimulação da secreção de citocinas tais
como o fator de necrose tumoral α (TNF-α), e outras substâncias como o óxido
nítrico (NO) e metabólitos intermediários de oxigênio (DIMOV et al, 1992;
IVANOVSKA et al., 1995a; ORSI et al., 2000; KHAYAL, 2003). Os compostos da
própolis solúveis em água (WSPD) atuam estimulando a produção da proteína C1q
pelos macrófagos, um componente essencial para a ativação da via clássica do
sistema complemento (DIMOV et al., 1992).
12
Algumas amostras de própolis do Brasil e da Bulgária são capazes de
aumentar a atividade bactericida dos macrófagos (ORSI et al, 2005). No entanto,
estudos revelaram maior eficiência da própolis brasileira, provavelmente em função
de sua composição química diferenciada. Segundo os pesquisadores, metabólitos
intermediários de oxigênio (H
2
O
2
) e nitrogênio (NO) estavam envolvidos no aumento
da atividade funcional destas células.
A atividade imunomoduladora da própolis também pode ser observada
através do incremento das respostas imunes celular e humoral, o que foi constatado
pelos autores da presente revisão (FISCHER et al. 2007) ao estudarem a
capacidade adjuvante de um extrato etanólico da própolis verde brasileira. Quando a
própolis foi adicionada ao herpesvírus suíno tipo 1 (SuHV-1) em uma vacina
inativada, inoculada em camundongos, houve um incremento na resposta imune
celular, observado através do aumento da expressão de mRNA de interferon gama
(IFN-γ), sem no entanto, estimular a resposta humoral. A associação desse extrato
com o antígeno (SuHV-1) e hidróxido de alumínio, por sua vez, aumentou tanto a
resposta celular quanto a humoral, quando comparado com um tratamento em que o
SuHV-1 foi utilizado isoladamente com o hidróxido de alumínio. O efeito adjuvante
da própolis verde tornou-se ainda mais evidente no teste de capacidade de proteção
vacinal, pois a inclusão do extrato etanólico nas vacinas experimentais aumentou o
percentual de animais protegidos após desafio com o SuHV-1, mesmo no tratamento
em que a própolis foi utilizada isoladamente com o antígeno e não conferiu aumento
da resposta humoral. Neste caso, o incremento na resposta imune celular,
proporcionado pela própolis, foi suficiente para a proteção dos animais desafiados. A
análise química desta amostra de própolis, por cromatografia liquida de alta
eficiência (HPLC), revelou altos níveis de compostos fenólicos, tais como ácido
13
cinâmico e derivados. O incremento na proliferação de linfócitos é atribuído à
atividade imunoestimulante dos compostos fenólicos (IVANOVSKA et al., 1995b).
Os dados obtidos (FISCHER et al. 2007) estão de acordo com os conceitos
formulados por COX & COULTER (1997), permitindo classificar a própolis como um
adjuvante não particulado. Segundo estes pesquisadores, os adjuvantes não
particulados, considerados imunomoduladores, são aqueles cuja atividade não
depende de nenhuma partícula, e que se beneficiam da associação com um
adjuvante particulado. Estas substâncias, por não se combinarem ao antígeno, são
rapidamente processadas pelas células do sistema imune e induzem uma resposta
humoral fraca. Por outro lado, quando um antígeno é adsorvido em um adjuvante
particulado, como o hidróxido de alumínio, a partícula formada facilita o seu
direcionamento para as células apresentadoras de antígeno, permitindo uma
liberação lenta. Com o prolongamento da exposição antigênica às células do
sistema imune, a resposta é amplificada. Este fato pode explicar a elevação na
resposta humoral ao SuHV-1 nos animais imunizados com a própolis associada ao
hidróxido de alumínio (FISCHER et al., 2007). Resultado semelhante foi observado
quando a própolis verde foi utilizada como uma substância adjuvante associada a
vacinas inativadas contra o herpesvirus bovino tipo 5 - BoHV-5 (FISCHER et al.,
2006). Os bovinos que receberam a vacina com própolis apresentaram níveis
significativamente mais elevados de anticorpos (P<0,01) em relação a um grupo
controle, sem própolis. Segundo SFORCIN et al. (2005), a habilidade em modular a
síntese de anticorpos é parte da atividade imunoestimulante da própolis. Apesar do
mecanismo detalhado da sua ação sobre células do sistema imune ser
desconhecido, a estimulação de macrófagos à produção de citocinas, capazes de
14
amplificar a resposta imune humoral, pode ser um dos mecanismos adjuvantes
(ANSORGE et al., 2003).
A possibilidade de utilização da própolis como adjuvante (FISCHER et al.,
2006; 2007), é relevante se considerarmos que um dos principais problemas
encontrados na produção de vacinas é a disponibilidade de substâncias que possam
potencializar a ação de antígenos pouco imunogênicos, como os inativados e muitos
recombinantes. Embora novas substâncias sejam constantemente avaliadas quanto
a sua capacidade adjuvante, de um modo geral, a produção de vacinas de uso
veterinário continua atrelada à utilização dos sais de alumínio ou de emulsões
oleosas. Desta forma, a possibilidade do uso de própolis para promover e/ou
direcionar as respostas imunes para determinados antígenos, poderá resultar em um
grande benefício na aquisição de imunidade pelo uso de vacinas.
Ao pesquisarem os efeitos dos WSPD de uma amostra croata de própolis ou
do CAPE isoladamente, ORSOLIC et al (2004) detectaram aumento na produção de
NO pelos macrófagos e inibição na síntese de DNA de células tumorais da linhagem
HeLa. Em altas concentrações, o NO é responsável pela indução de apoptose
(VEEN et al., 1999), e os resultados obtidos são compatíveis com a capacidade
antitumoral da própolis. Segundo estes pesquisadores, esta propriedade pode ser
resultado de atividades sinérgicas dos compostos polifenólicos da própolis. Efeito
semelhante foi observado no crescimento de células tumorais malignas com a
utilização do artepillin C, uma substância bioativa da própolis brasileira. Além da
inibição do crescimento destas células (ORSOLIC & BASIC, 2003), foi observado um
aumento no número total de linfócitos T auxiliares, indicando ativação do sistema
imune (BANSKOTA et al., 2001; PARK et al., 2004). Para BANSKOTA et al. (2001) a
citotoxicidade do artepillin C parece ser atribuída à indução de apoptose celular. Os
15
compostos polifenólicos induzem à apoptose através de um aumento na
permeabilidade das membranas mitocondriais, liberação do citocromo C e a sua
conjugação com a proteína mitocondrial de choque Apaf-1 e procaspase 9, seguido
pela ativação da via das caspases (GALATI et al. 2000).
Similares aos macrófagos, as células exterminadoras naturais (NK), que
apresentam atividade lítica para várias células tumorais ou células infectadas por
vírus, são consideradas o primeiro mecanismo de defesa do organismo. Aumento na
atividade destas células foi observado no baço de camundongos tratados com uma
amostra brasileira de própolis (SFORCIN et al., 2002). Além disso, os macrófagos
ativados pela própolis produziram citocinas, tal como a IL-12, que atua sobre as
células NK, aumentando a sua atividade citotóxica.
A própolis, portanto, pode ser considerada uma importante substância com
atividade antitumoral. Apesar desta propriedade ter sido identificada com a utilização
de amostras de própolis de origens geográficas diferentes, o mecanismo de ação
parece ser semelhante em todos os estudos, com ativação de células imunes como
macrófagos e células NK e indução de apoptose por compostos polifenólicos. Desta
forma, os dados obtidos têm resultado em uma forte indicação do uso da própolis
como uma nova opção para o tratamento de doenças tumorais.
PRÓPOLIS E IMUNOSSUPRESSÃO
A supressão do sistema imunológico pode ter como conseqüência a
proliferação de microorganismos oportunistas que vivem nos organismos vivos ou no
ambiente que os cerca e, por este motivo, normalmente é tida como um evento
prejudicial. No entanto, há circunstâncias em que a atividade do sistema imune deve
ser reduzida ou suprimida. Em casos de transplante, por exemplo, a tendência
16
natural do sistema imune é desencadear uma reação de defesa e os indivíduos
transplantados correm o risco de ser acometidos por processos inflamatórios
crônicos e fibrose, que podem levar à insuficiência irreversível do órgão
transplantado e a sua rejeição. Nestes casos, potentes drogas imunossupressoras
são necessárias para inibir a ativação das células T e aumentar a taxa de sobrevida
dos enxertos. Também as doenças autoimunes devem ser controladas através do
uso de agentes imunossupressores.
As substâncias flavonóides encontradas na própolis podem inibir a
proliferação de linfócitos de camundongos in vitro (SÁ-NUNES et al., 2003). Uma
amostra brasileira de própolis se mostrou capaz de ativar macrófagos in vivo,
estimulando a produção de IFN-γ e NO e, conseqüentemente, reduzindo a
proliferação de linfócitos. Níveis suficientemente elevados de IFN-γ estimulam a
atividade da enzima óxido nítrico sintetase induzível (iNOS) por macrófagos
ativados, gerando concentrações de NO que prejudicam a proliferação de células T
(GHERARDI et al., 2000). O NO tem sido considerado o principal fator derivado de
macrófagos com atividade imunossupressora (MILLS, 1991).
A redução no número de células T também pode ocorrer através da ação de
um composto ativo da própolis, o CAPE (PARK et al., 2004). A ativação destas
células induz a expressão de fatores de transcrição como o NFκB, que regula a
expressão de genes envolvidos na resposta imune, estimulando a expressão de
citocinas inflamatórias, moléculas do complexo de histocompatibilidade principal e a
adesão de moléculas envolvidas na metástase de tumores (ORBAN et al., 2000;
BAEZA-RAJA & MUÑOZ-CÁNOVES, 2004). O CAPE é um inibidor específico do
NFκB e suprime a sua interação com o DNA dos linfócitos (NATARAJAN et al.,
1996; PARK et al., 2004) inibindo a resposta linfoproliferativa, provavelmente devido
17
à inibição da expressão gênica. (MÁRQUEZ et al., 2004). Além de inibir o NFκB, o
CAPE é capaz de inibir o fator nuclear de células T ativadas (NFAT), resultando em
inibição da transcrição do gene de IL-2 e da proliferação de células T.
Portanto, a própolis ou algumas de suas substâncias bioativas, como os
flavonóides, pode ser utilizada como droga imunossupressora em associação ou
substituição de outros imunossupressores, como os corticosteróides. O mecanismo
de ação da própolis, neste caso, é semelhante ao destas substâncias, inibindo o
NFκB, estimulando a produção de NO ou alterando a expressão de genes de
citocinas sem, no entanto, haver relato de efeitos adversos. A divergência destes
dados com os obtidos por FISCHER et al. (2006; 2007), que detectaram aumento
nas respostas imunes humoral e celular, provavelmente se deve à diferença na
composição das amostras de própolis utilizadas, bem como na metodologia
empregada.
A inibição do NFκB pela própolis também está estreitamente relacionada com
a sua propriedade antiinflamatória. A hipótese levantada por SONG et al. (2002),
utilizando uma amostra coreana de própolis, e reforçada por Paulino (comunicação
pessoal) que utilizou a própolis verde brasileira, é de que a atividade antiinflamatória
da própolis se deve à inibição na expressão do gene da iNOS, interferindo no sítio
NFκB do promotor iNOS. Neste caso, há uma redução na produção de NO, um
importante mediador biológico envolvido nos processos inflamatórios e imunológicos
(NUSSLER & BILLIAR, 1993). Segundo CHEN et al. (2005), substâncias flavonóides
como o CAPE inibem a ativação do NFκB, reduzindo a expressão de genes
envolvidos na resposta inflamatória aguda, incluindo os das citocinas pró-
inflamatórias IL-1β, IL-6 e TNF-α. Resultado semelhante foi obtido por BLONSKA et
al. (2004) que, utilizando um extrato etanólico de uma amostra polonesa de própolis,
18
detectaram inibição da expressão dos genes de IL-1β, em uma linhagem de
macrófagos (J774A.1).
O CAPE também pode atuar sobre os macrófagos inibindo a produção das
enzimas lipoxigenase e cicloxigenase (KHAYYAL et al., 2003) e a produção de
prostaglandina E
2
(PGE
2
), um importante mediador inflamatório (MIRZOEVA &
CALDER, 1996). Redução nos níveis de PGE
2
e das citocinas IL-6 e IL-8 foi
observada em processos inflamatórios crônicos das vias aéreas, como a asma
(KHAYYAL et al., 2003), após a administração de extratos de própolis de origens
geográficas diversas, demonstrando um grande potencial para tratamento dessas
alterações. Atualmente, substâncias imunossupressoras como os corticosteróides
tópicos ou sistêmicos são utilizadas para suprimir as alterações inflamatórias
crônicas observadas na asma. Entretanto, segundo ROMAGNANI (1997), o ideal é
que se possa converter a resposta das células T aos antígenos alérgenos, de uma
resposta predominantemente humoral (Th2) para celular (Th1). Neste sentido, a
ação antiinflamatória da própolis pode ser promissora para tratamento de indivíduos
asmáticos. Ao analisar-se os resultados dos estudos conduzidos por SY et al. (2006)
em um modelo para estudo de asma em camundongos, a utilização da uma solução
aquosa de própolis inibiu a produção de citocinas relacionadas à resposta humoral
(IL-10 e IL-5) e aumentou a resposta de células T CD4+, demonstrando tendência de
modulação do sistema imune para a resposta celular.
A ação antiinflamatória da própolis também ocorre através da inibição do
sistema complemento. A diminuição na atividade da via alternativa foi atribuída à
inibição da função da proteína C3 convertase, um dos alvos de ação dos WSPD no
sistema complemento (IVANOVSKA et al., 1995a). A interação da própolis com
proteínas do sistema complemento pode resultar em mudanças conformacionais e,
19
conseqüentemente, na perda de função. A hipótese destes autores é que os
flavonóides são as substâncias da própolis com atividade anti-complemento. Apesar
de ser um dos principais mecanismos pelos quais o reconhecimento do antígeno é
convertido em uma defesa efetiva contra uma infecção, o sistema complemento
pode estar envolvido em resposta inflamatórias indesejáveis. Desta forma, a ação
anti-complemento da própolis pode ser altamente benéfica, pois através da inibição
de importantes mediadores da inflamação derivados do sistema complemento, reduz
os efeitos adversos de determinados processos inflamatórios.
CONCLUSÃO
A imunomodulação causada pela própolis tem sido observada tanto na
estimulação como na supressão de determinados eventos da resposta imune,
tornando-a potencialmente aplicável como uma substância imunoestimulante, ou no
combate a processos inflamatórios indesejáveis ou tumores. Apesar de vários
estudos abordarem a influência da própolis sobre o sistema imunológico, muitos
resultados não são complementares ou tornam-se antagônicos, provavelmente em
função de diferenças metodológicas ou da grande diversidade química entre as
amostras de própolis utilizadas. Os dados indicam a necessidade de ampliação dos
estudos relacionados às propriedades bioativas da própolis, visando o
esclarecimento destas contradições.
REFERÊNCIAS
ANSORGE, S.; REINHOLD, D.; LENDECKEL, U. Propolis and some of its
constituents down-regulate DNA synthesis and inflammatory cytokine production but
20
induce TGF-β1 production of human immune cells. Zeitschrift für Naturforschung,
v.58c, p.580-589, 2003.
BAEZA-RAJA, B.; MUÑOZ-CÁNOVES, P. p38 MAPK-induced nuclear factor-kB
activity is required for skeletal muscle differentiation: role of interleukin-6. Molecular
Biology of the Cell, v.15, p.2013-2026, 2004.
BANKOVA, V.; KRASTEVA, G.B.; SFORCIN, J.M.; FRETE, X.; KUJUMGIEV, A.;
RODELLA, R.M.; POPOV, S. Phytochemical evidence for the plant origin of Brazilian
propolis from São Paulo State. Zeitschrift für Naturforschung, v.54, p.401-405, 1999.
BANKOVA, V.S.; CASTRO, S.L.; MARCUCCI, M.C. Propolis: recent advances in
chemistry and plant origin. Apidologie, v.31, p.3-15, 2000.
BANKOVA, V. Chemical diversity of propolis and the problem of standardization.
Journal of Ethnopharmacology, v.100, p.114-117, 2005.
BANSKOTA, A.H.; TESUKA, Y.; KADOTA. S. Recent progress in pharmacological
research of propolis. Phytotherapy Research, v.15, p.561-571, 2001.
BLONSKA, M.; BRONIKOWSKA, G.; PIETSZ, G.; CZUBA, Z.P.; SCHELLER, S.;
KROL, W. Effects of ethanol extract of propolis (EEP) and its flavones on inducible
gene expression in J774A.1 macrophages. Journal of Ethnopharmacology, v.91,
p.25-30, 2004.
21
BURDOCK, G.A. Review of the biological properties and toxicity of bee propolis
(propolis). Food and Chemical Toxicology, v.36, n.4, p.347-363, 1998.
CHEN, M.; KENG, P.C.; LIN, P.Y.; YANG, C.; LIAO, S.; CHEN, W. Caffeic acid
phenethyl ester decreases acute pneumonitis after irradiation in vitro and in vivo.
BMC Cancer, v.5, n.158, p.1-9, 2005.
COX, J.C.; COULTER, A.R. Adjuvants – a classification and review of their modes of
action. Vaccine, v.15, n.3, p.248-256, 1997.
DANTAS, A.P.; OLIVIERI, B.P.; GOMES, F.H.M.; DE CASTRO, S.L. Treatment of
Trypanosoma cruzi-infected mice with propolis promotes changes in the immune
response. Journal of Ethnopharmacology, v.103, p.187-193, 2006.
DE CASTRO, S.L.; HIGASHI K. Effect of different formulation of propolis on mice
infected with Trypanossoma cruzi. Journal of Ethnopharmacology, v.46, p.55-58,
1995.
DIMOV, V.; IVANOVSKA, N.; BANKOVA, V.; POPOV, S. Immunomodulatory action
of propolis: IV. Prophylactic activity against Gram-negative infections and adjuvant
effect of the water-soluble derivate. Vaccine, v.10, n.12, p.817-823, 1992.
FISCHER, G.; DUMMER, L.A.; VIDOR, T.; PAULINO, N.; PAULINO, A.S. Avaliação
da ação antiviral de uma solução de própolis sobre o Herpesvírus Bovino e o Vírus
22
da Diarréia Viral dos Bovinos. In: ENCONTRO DE PÓS-GRADUAÇÃO, 7, 2005,
Pelotas, RS. Anais. Pelotas, 2005.
FISCHER, G.; CONCEIÇÃO, F.R.; LEITE, F.P.L.; DUMMER, L.A.; VARGAS, L.D.;
HÜBNER, S.O.; DELLAGOSTIN, O.A.; PAULINO, N.; PAULINO, A.S.; VIDOR, T.
Immunomodulation produced by a green propolis extract on humoral and cellular
responses of mice immunized with SuHV-1, Vaccine, v.25, p.1250-1256, 2007.
FISCHER, G.; CLEFF, M.B.; DUMMER, L.A.; CAMPOS, F.S.; STORCH, T.;
QUINCOZES, C.G.; VILELA, C.; PAULINO, N.; PAULINO, A.S.; VIDOR, T. Avaliação
da capacidade coadjuvante de um extrato alcoólico de própolis verde em bovinos
vacinados contra o Herpesvírus Bovino tipo 5. In: CONGRESSO BRASILEIRO DE
APICULTURA, 2006, Aracaju, SE. Anais. Aracaju, 2006.
GALATI, G.; TENG, S.; MORIDANI, M.Y.; CHAN, T.S.; O´BRIEN, P.J. Câncer
chemoprevention and apoptosis mechanisms induced by dietary polyphenolics. Drug
Metabolism and Drug Interactions, v.17, p.311-349, 2000.
GHERARDI, M.M.; RAMIREZ, J.C.; ESTEBAN, M. Interleukin-12 (IL-12)
enhancement of the cellular immune response against human immunodeficiency
virus type 1 env antigen in a DNA prime/vaccinia virus boost vaccine regimen is time
and dose dependent: suppressive effects of IL-12 boost are mediated by nitric oxide.
Journal of Virology, v.74, n.4, p.6278–6286, 2000.
23
HWANG, D. Essential fatty acids and immune response. The FASEB Journal, v.3,
p.2052-2061, 1989.
IVANOVSKA, N.D.; DIMOV, V.B.; PAVLOVA, S.; BANKOVA, V.S.; POPOV, S.S.
Immunomodulatory action of propolis. V. Anticomplementary activity of a water-
soluble derivate. Journal of Ethnopharmacology, v.47, p.135-143, 1995.
IVANOVSKA, N.; NEYCHEV, H.; STEFANOVA, Z.; BANKOVA, V.; POPOV, S.
Influence of cinnamic acid on lymphocyte proliferation, cytokine release and
Klebsiella infection in mice. Apidologie, v.26, p.73-81, 1995.
KHAYYAL, M.T.; EL-GHAZALY, M.A.; EL-KHATIB, A.S.; HATEM, A.M.; VRIES,
P.J.F.; EL-SHAFEI, S.; KHATTAB, M.M. A clinical pharmacological study of the
potential beneficial effects of a propolis food product as an adjuvant in asthmatic
patients. Fundamental & Clinical Pharmacology, v.17, p.93-102, 2003.
KIRKLEY, S.A. Proposed mechanisms of transfusion-induced immunomodulation.
Clinical and Diagnostic Laboratory Immunology, v.6, n.5, p.652-657, 1999.
KUJUMGIEV, A.; TSVETKOVA, I.; SERKEDJIEVA, Y.; BANKOVA, V.; CHRISTOV,
R.; POPOV, S. Antibacterial, antifungal and antiviral activity of propolis of different
geographic origin. Journal of Ethnoparmacology, v.64, p.235-240, 1999.
24
LABRO, R. Interference of antibacterial agents with phagocyte functions:
immunomodulation or “immuno-fairy tales”? Clinical Microbiology Reviews, v.13, n.4,
p.615-650, 2000.
MARCUCCI, M.C. Propolis: chemical composition, biological properties and
therapeutic activity. Apidologie, v.26, p.83-99, 1995.
MÁRQUEZ, N.; SANCHO, R.; MACHO, A.; CALZADO, M.A.; FIEBICH, B.L.;
MUNOZ, E. Caffeic acid phenethyl ester inhibits T-cell activation by targeting both
nuclear factor of activated T-cells and NF-kappaB transcriptions factors. The Journal
of Pharmacology and Experimental Therapeutics, v.308, n.3, p.993-1001, 2004.
MIDORIKAWA, K.; BANSKOTA, A.H.; TEZUKA, Y.; NAGAOKA, T.; MATSISHIGE,
K.; MESSAGE, D.; HUERTAS, A.A.; KADOTA, S. Liquid chromatography-mass
spectrometry analysis of propolis. Phytochemical Analisys, n.12, p.366-373, 2001.
MILLS, CD. Molecular basis of "suppressor" macrophages. Arginine metabolism via
the nitric oxide synthetase pathway. The Journal of Immunology, v.146, p.2719-2723,
1991.
MIRZOEVA, O.K.; CALDER, P.C. The effect of propolis and its components on
eicosanoid production during the inflammatory response. Prostaglandins,
Leukotrienes and Essencial Fatty Acids, v.55, n.6, p.441-449, 1996.
25
MIYATAKA, H.; NISHIKI, M.; MATSUMOTO, H.L.; FUJIMOTO, T.; MATSUKA, M.L.;
SATOH T. Evaluation of propolis. I: Evaluation of Brazilian and Chinese propolis by
enzymatic and physico-chemical methods. Biological and Pharmaceutical Bulletin,
v.20, n.5, p.496-501, 1997.
NATARAIAN, K.; SINGH, S.; BURKE, T.R.; GRUNBERGER, D.; AGGARWAL, B.B.
Caffeic acid phenethyl ester is a potent and specific inhibitor of activation of nuclear
transcription factor NF-kB. Proceedings of National Academy of Sciences of the
United States of America, v.93, p.9090-9095, 1996.
NUSSLER, A.K.; BILLIAR, T.R. Inflammation, immunoregulation and inducible nitric
oxide synthase. Journal of Leukocyte Biology, v.54, n.2, p.171-178, 1993.
ORBAN, Z.; MITSIADES, N.; BURKE, T.R.; TSOKOS, M.; CHROUSOS, G.P.
Caffeic acid phenethyl ester induces leukocyte apoptosis, modulates nuclear factor-
kappa B and suppresses acute inflammation. Neuroimmunomodulation, v.7, p.99-
105, 2000.
ORSI, R.O.; FUNARI, S.R.C.; SOARES, A.M.V.C.; CALVI, S.A.; OLIVEIRA, S.L.;
SFORCIN, J.M.; BANKOVA, V. Immunomodulatory action of propolis on macrophage
activation. Journal of Venomous Animals and Toxins, v.6, n.2, p.205-219, 2000.
ORSI, R.O.; SFORCIN, J.M.; FUNARI, S.R.; BANKOVA, V. Effects of Brazilian and
Bulgarian propolis on bactericidal activity of macrophages against Salmonella
Typhimurium. International Immunopharmacology, v.5, n.2, p.359-368, 2005.
26
ORSOLIC, N. & BASIC, I. Immunomodulation by water-soluble derivative of propolis:
a factor of antitumor reactivity. Journal of Ethnopharmacology, v.84, p.265-273,
2003.
ORSOLIC, N.; KNEZEVI, A.H.; SVER, L.; TERZI, S.; BASIC, I. Immunomodulatory
and antimetastatic action of propolis and related polyphenolic compounds. Journal of
Ethnopharmacology, v.94, p.307-315, 2004.
PARK, Y.K.; IKEGAKI, M.; ABREU, J.A.S. Estudo da preparação dos extratos de
própolis e suas aplicações. Ciência e Tecnologia de Alimentos, v.18, n.3. p.313-318,
1998.
PARK, Y.K.; ALENCAR, S.M.; SCAMPARINI, A.R.P.; AGUIAR, C.L. Própolis
produzida no sul do Brasil, Argentina e Uruguai: evidências fitoquímicas de sua
origem vegetal. Ciência Rural, v.32, n.6, p.997-1003, 2002.
PARK, J.H.; LEE, J.K.; KIM, H.S.; CHUNG, S.T.; EOM, J.H.; KIM, K.A.; CHUNG,
S.J.; PAIK, S.Y.; OH, H.Y. Immunomodulatory effect of caffeic acid phenethyl ester in
Balb/c mice. Internacional Immunopharmacology, v.4, p.429-436, 2004.
PEREIRA, A.S.; PEREIRA, A.F.M.; TRUGO, L.C.; AQUINO NETO, F.R. Distribution
of quinic acid derivatives and other phenolic compounds in Brazilian propolis.
Zeitschrift für Naturforschung, v.58c, p.590-593, 2003.
27
PINTO, M.S.; FARIA, J.E.; MESSAGE, D.; CASSINI, S.T.A.; PEREIRA, C.S.;
GIOSO, M.M. Efeito de extratos de própolis verde sobre bactérias patogênicas
isoladas do leite de vacas com mastite. Brazilian Journal of Veterinary Research and
Animal Science, v.38, n.6, p.278-283, 2001.
ROMAGNANI, S. The Th1/Th2 paradigm. Immunology Today, v.18, n.6, p.263-266,
1997.
SÁ-NUNES, A.; FACCIOLI, L.H.; SFORCIN, J.M. Propolis: lymphocyte proliferation
and IFN-γ production. Journal of Ethnopharmacology, v.87, p.93-97, 2003.
SCHELLER, S.; OWCZAREK, S.; KROL, W.; MALINOWSKA, B.; NIKODEMOWICS,
E.; ALEKSANDROWICZ, J. Immunisierungsversuche bei zwei fallen von alveolitis
fibroticans bei abnehmender leistungsfahigkeit des immunsystems unter anwendung
von propolis-athanolextrakt (EEP), esberitox N und eines calcium-magnesium-
praparates (dolomit.). Heikunst, v.102, p.249-255, 1989.
SFORCIN, J.M.; KANENO, R.; FUNARI, S.R.C. Absence of seasonal effect on the
immunomodulatory action of brazilian propolis on natural killer activity. Journal of
Venomous Animals and Toxins, v.8, n.1, p.19-29, 2002.
SFORCIN, J.M.; ORSI, R.O.; BANKOVA, V. Effect of propolis, some isolated
compounds and its source plant on antibody production. Journal of
Ethnopharmacology, v.98, n.3, p.301-305, 2005.
28
SONG, Y.S.; PARK, E.; HUR, G.M.; RYU, Y.S.; KIM, Y.M.; JIN, C. Ethanol extract of
propolis inhibits nitric oxide synthase gene expression and enzyme activity. Journal
of Ethnopharmacology, v.80, p.155-161, 2002.
STRADIOTTI, D.; QUEIROZ, A.C.; LANA, R.P.; PACHECO, C.G.; EIFERT, E.C.;
NUNES, P.M.M. Ação da própolis sobre a desaminação de aminoácidos e a
fermentação ruminal. Revista Brasileira de Zootecnia, v.33, n.4, p.1086-1092, 2004.
SY, L.B.; WU, Y.; CHIANG, B.; WANG, Y.; WU, W. Propolis extracts exhibit
immunoregulatory activity in an OVA-sensitized airway inflammatory animal model.
Internacional Immunopharmacology, v.6, p.1053-1060, 2006.
VEEN, R.C.; DIETLIN, T.A.; PEN, L.; GRAY, J.D. Nitric oxide inhibits the proliferation
of T-helper 1 and 2 lymphocytes without reduction in cytokine secretion. Cellular
Immunology, v.193, p.194–201, 1999.
29
3 ARTIGO 2
Vaccine, v.25, p.1250-1256, 2007.
30
Summary
Despite recent technological advances in vaccine production, most the
vaccines depend on the association with adjuvant substances. This work evaluated
the adjuvant capacity of an ethanol extract of green propolis associated to inactivated
Suid herpesvirus type 1 (SuHV-1) vaccine preparations. Mice inoculated with SuHV-1
vaccine plus aluminum hydroxide and 5 mg/dose of propolis extract presented higher
levels of antibodies when compared to animals that received the same vaccine
without propolis. The use of SuHV-1 vaccine with propolis extract alone did not
induce significant levels of antibodies, however it was able to increase the cellular
immune response, evidenced by the increase in the expression of mRNA to IFN-γ.
Besides, propolis increased the percentage of protected animals against challenge
with a lethal dose of SuHV-1. The effect of green propolis extract on the humoral and
cellular immune responses may be exploited for the development of effective
vaccines.
Keywords: green propolis; adjuvant; vaccines
31
1. Introduction
Vaccination has been a common practice for preventing or minimizing
symptoms of diseases caused by infectious or parasitic agents in humans or animals.
Traditionally, vaccines have been developed from live attenuated or inactivated
pathogens [1], however synthetic peptides and recombinant proteins constitute the
basis of new generation vaccines [2,3]. Despite representing an important
technologic advance, the success of many of these subunit vaccines depends on
their association with potent adjuvants, aiming at increasing their immunogenicity. In
order to have an effective protection against the pathogen, it is necessary an efficient
activation of specific effectors of the immune system, such as antibodies, cytotoxic or
auxiliary T cells (Th1/Th2) [4]. Adjuvant substances when associated to an antigen
modify or increase the potency of the humoral and/or cellular immune responses
against that antigen [5,3]. Besides, they can be used to prolong the immune
response or to promote mucosal immunity [4]. Even though a large number of
adjuvants of several origins has been evaluated, most commercial vaccines
continues to rely on the used of aluminum salts. This way, the development of new
vaccines will be highly benefited if new substances capable of promoting and
directing to an appropriate immune response were identified [4].
Propolis is a natural resinous substance, harvested by honeybees from different
parts of plants such as shoots, buds and resinous exudates [6,7]. Chemically
complex, propolis is composed by more than 300 different substances [7,8]. The
combination of these substances, probably resulting in a synergic effect, is essential
for its biological activity [9]. Its constitutive characteristics, however, can vary
according to the bee species, period of the year in which it is collected and,
especially botanic origin [10]. Green propolis, characteristic from Brazil, is produced
32
from a plant commonly known as “Alecrim do Campo” (Baccharis dracunculifolia).
This species is not adapted to the natural conditions of other countries [11], which
confers to the green propolis chemical and biological characteristics different from
the European propolis, produced predominantly from the exudates of buds of aspen
(Populus sp.) [8].
Used by bees against microorganisms like bacteria, virus and fungi [7,8],
propolis has several other bioactive properties such as anti-inflammatory [12,13],
antioxidant [14], antiparasitary [15] and anticarcinogenic action [16]. Although its
immune-stimulant and immune-modulator activities have been demonstrated [17-19],
the mechanism of action remains unknown.
Suid Herpesvirus type 1 (SuHV-1), from Herpesviridae family,
Alphaherpesvirinae subfamily, is the causing agent of Aujeszky disease, an infecto-
contagious disease responsible for high economical losses in the swine production
due to high mortality and reproductive disorder [20]. The pathogenicity of this virus in
mice allows its experimental use in tests to certify the efficiency of the vaccines [21].
The aim of this work was to evaluate the adjuvant properties of an ethanolic
extract of green propolis, when added to inactivated SuHV-1 vaccine, used to
immunize mice. Parameters of the humoral (neutralizing antibodies titer) and cellular
immunity (levels of IFN-γ mRNA), as well as the protection (experimental challenge)
afforded by vaccine preparations were determined.
2. Material and methods
2.1 Ethanolic extract of green propolis
Green propolis was obtained from Nectar Farmacêutica Ltda (Brazil) and
stored at -20 °C. The ethanolic extract was prepared as previoulsy described [13].
33
Briefly, the propolis was ground and macerated with an extract solution containing
absolute ethanol, with 10 min daily agitation, for 10 days. Then, the solvent was
evaporated and the resulting dried matter was dissolved in phosphate buffer solution
(pH 6.2), in a final concentration of 40 mg/ml.
2.2 Vaccine preparations and inoculations
Two experiments were carried out: the first one aimed at evaluating the
adjuvant capacity of the ethanolic extract of green propolis through neutralizing
antibody titration and determination of 50% protective dose of experimental vaccine
preparations. The second experiment was carried out to determine the levels of IFN-
γ mRNA expression by reverse transcription-PCR (RT-PCR). All experimental
vaccine preparations were produced from a SuHV-1 isolate obtained from an
outbreak of Aujeszky disease and maintained in the Virology and Immunology
Laboratory, UFPel (Pelotas – Brazil). After growing the virus in Rabbit Kidney cell line
- RK
13
(ATCC), viral suspensions with titer of 10
5.75
CCID
50
/25 µl (cell culture
infections dose 50%/25 µl), were inactivated with bromoethylamine – BEI (C
2
H
7
Br
2
N,
- Merck), 20 mM, pH 7.5.
In the first experiment, 120 female BALB/c mice, 6-8 week-old, allocated into
three groups, were inoculated at day 0 and 14, subcutaneously (SC) with 0.5 ml of
the inactivated vaccine preparations. Group 1 received vaccine with aluminum
hydroxide (Al(OH)
3
), group 2 received vaccine with Al(OH)
3
and propolis extract (5
mg/dose) and group 3 received vaccine with propolis (5 mg/dose). In the fourth group
(negative control), 10 animals were kept without vaccination. In order to estimate
protection afforded by each treatment, using the statistic method of Reed & Muench
[22], each vaccine preparation was diluted two, four, eight and sixteen times and
34
inoculated in 10 individually identified mice. In all cases the initial titer of the virus
suspension was the same.
In the second experiment, 25 mice distributed into five groups were
subcutaneously inoculated with 0.5 ml at day 0 and 14. Group one received 5
mg/dose of propolis extract (positive control); group two was inoculated with saline
solution (PBS, pH 7.2 - negative control); group three received vaccine with Al(OH)
3
;
group four received vaccine with propolis extract (5 mg/dose), and group five
received vaccine with Al(OH)
3
and propolis extract (5 mg/dose). All animals, supplied
by Biotério Central of UFPel (Pelotas-Brazil), remained isolated, in controlled
environment with temperature between 22-24 ºC, receiving feeding and water ad
libitum. The experiment was approved by the UFPel Committee of Ethics in Animal
Experimentation.
2.3 Humoral immunity and protection
For titering neutralizing antibodies against SuHV-1, blood samples were
collected from four animals from each experimental group, 21 days after the second
inoculation. After total bleeding, the blood was processed and the serum was stored
at -20 ºC. Antibodies were titered by the serum neutralization method [21]. Briefly,
each serum was serially diluted from 1:2 to 1:256, and distributed (25 µl) in
quadruplicate in polystyrene plate (TPP). A volume of 25 µl of SuHV-1 virus
suspension containing 100 CCID50% was then added. After incubation for 1 hour at
37 ºC in an environment with 5% CO
2
, approximately 30,000 RK
13
cells were added
per well. The microplates were then returned to the incubator until being read in an
inverted microscope when the 100 CCID50% was observed in the control cells. The
absence of cytopathic effect was indication of viral neutralization, while its presence
35
resulted from the absence of neutralizing antibodies. Antibody titers were calculated
by the Behrends & Kärber method [22].
In order to evaluate protection afforded by the experimental vaccine
preparations, 21 days after the second vaccination the remaining animals were
inoculated subcutaneously with 0.1 ml containing 31.6 lethal doses (LD) of SuHV-1
(strain used in vaccine preparation) [21]. Daily, until the tenth day after the
challenge, the number of dead animals in each experimental group was recorded for
analysis by the statistical method of Reed & Muench [22]. For the LD calculation,
starting from a viral suspension with 10
5.75
CCDI
50
/25µl, the same statistical
methodology was used.
2.4 Cellular immunity
The IFN-γ mRNA level in splenocytes from mice inoculated in the second
experiment was used as a parameter for cellular immunity evaluation. The
splenocytes were processed according to Bastos et al. [23]. Briefly, a splenocyte
suspension was obtained from a pool of spleens of mice from each treatment, 21
days after the second inoculation. After lysing the red blood cells with NH
4
Cl, the
spleen cells were counted and 10
7
cells/ml were then suspended in Minimum
Essential Medium – MEM (Gibco-BRL), supplemented with 10% of bovine fetal
serum (Gibco-BRL) and plated in a 96 well plate. After 24 h of incubation at 37 ºC in
an environment with 5% CO
2
, the supernatant was removed and the cells were
stimulated in triplicate, with MEM (negative control), 0.1 multiplicity of infection (MOI)
of SuHV-1 or 5 µg/ml of Concanavalin A (Sigma). Twenty-four or 48 h after
stimulation, total RNA was extracted with Trizol (Invitrogen), according to the
manufacturer’s protocol. The cDNA synthesis was performed from 5 µg of total RNA,
36
in a 25 µl reaction containing 0.5 µl (150 ng) of random primers (Invitrogen), 1 µl of
desoxynucleoside triphosphates (dNTP - 10 mM), 1 × First Strand buffer (New
England Biolabs), 0.1 M DDT, 40 U of RNaseOUT (Invitrogen) and 50 U of M-MuLV
Reverse Transcriptase (New England Biolabs), following previously described
methodology [24]. After incubating for 10 min at 25 ºC, the samples were incubated
at 42 ºC for 50 min, followed by 70 ºC for 15 min, in an thermocycler (Eppendorf
Mastercycler Gradient). The resulting cDNA was stored at -20 ºC. PCR reactions
were carried out in triplicate with 2 µl of cDNA, 200 µM of dNTPs, 1 × reaction buffer
, 1.5 U of Taq DNA polymerase (Invitrogen), 1 µM of each primer, 3 mM MgCl
2
for
IFN-γ or 1.5 mM for β-actin, and RNase free water (Gibco-BRL) in a final volume of
25 µl. The thermocycler parameters were as follows: 95 ºC for 2 min, followed by 30
cycles of 94 ºC for 50 sec, 60 ºC for 50 sec and 72 ºC for 1 min, with a final extension
of 72 ºC for 7 min. The primers used in this experiment, described in the literature
[24] and synthesized by MWG-Biotech Inc. (USA), were: IFN-γ forward 5’-
AGCGGCTGACTGAACTCAGATTGTAG; IFN-γ reverse 5’-
GTCACAGTTTTCAGCTGTATAGGG; β-actin forward 5’-
TGGAATCCTGTGGCATCCATGAAAC; β-actin reverse 5’-
TAAAACGCAGCTCAGTAACAGTCCG. PCR reactions using primers for β-actin and
PCR reaction without cDNA was carried out as a controls. PCR products were
visualized under UV light after electrophoresis in 2% agarose gel containing ethidium
bromide. Analysis of the data was done using Scientific Imaging System software
(Kodak).
37
2.5 Statistical Analysis
Antibody titers, expressed in Log
2
, were compared using variance analysis
(ANOVA). The LSD test was used to determine significant differences (p<0.05)
among the mean of each treatment using the SAS program. The protection afforded
by the experimental vaccine preparations was evaluated through the statistical
method of Reed & Muench [22].
3. Results
3.1 Humoral immunity
The mean ± S.E.M. of the antibody titers of each experimental group are
presented in Figure 1. As it can be observed, the association of 5 mg/dose of
ethanolic extract of green propolis to an inactivated vaccine against SuHV-1
containing aluminum hydroxide showed significant adjuvant effect. In all the dilutions
of this vaccine preparation there was an increment in the antibody titers when
compared to the vaccine with aluminum hydroxide alone. This effect was more
evident in the intermediate dilutions (p<0.05) where the titer went from 3 to 4.49
when the vaccine was diluted 4 times and doubled, going from 2.18 to 4.48 in the 1:8
dilution. In the 1:16 dilution, probably due to the low quantity of antigen present in
each dose, antibody titers were similar in all treatments.
Association of the propolis extract on its own with inactivated SuHV-1,
however, did not induce a significant production of antibodies (Fig. 1). The lowest
titers in this experiment were obtained from mice inoculated with this vaccine
preparation.
38
1
2
3
4
5
6
7
1:2 1:4 1:8 1:16
Dilutions
Antibody titers (Log2)
Al(OH)3 Al(OH)3 + Propolis Propolis
Fig. 1. Antibody titers (Log
2
) of mice immunized with SuHV-1 associated to Al(OH)
3
,
Al(OH)
3
+ 5 mg/dose of ethanolic extract of green propolis or 5 mg/dose of ethanolic
extract of green propolis. The titer was determined by the serum neutralization test,
21 days after the second inoculation. All the vaccines were diluted 2, 4, 8 or 16 times.
The data represents the mean ± S.E.M. Different letters indicate significant statistical
difference (p<0.05).
3.2 Protection afforded by the vaccine preparations
The percentage of animals protected after inoculation with the experimental
vaccine preparations in the different dilutions, and challenged with 31.6 DL of SuHV-
1, can be observed in Figure 2. Only the vaccine preparation with aluminum
hydroxide, in the 1:2 dilution, protected 100% of the animals. However the
association of green propolis extract to this vaccine preparation increased the
percentage of animals protected in the higher dilutions (1:4, 1:8 e 1:16). In this case,
the higher the dilution of the vaccine, the bigger the percent difference of animals
39
protected, suggesting immunostimulant action of the propolis extract. These data is
compatible with the antibody titers of the same animals. Surprisingly, the vaccine
preparation in which propolis was associated on its own with the antigen allowed
good levels of protection in all the dilutions evaluated (1:2 – 92%; 1:4 – 85%; 1:8 –
80% and 1:16 – 68%), contrary to the serologic results. By the tenth day after
challenge, all animals from the control group were dead, suggesting that the
protection in the other groups occurred due to the immunizations.
40
50
60
70
80
90
100
Al(OH)3 Al(OH)3 +
Propolis
Propolis
% mice protected
1:2
1:4
1:8
1:16
Fig. 2. Percentage of mice protected in the test of protection capacity afforded by the
experimental vaccines. Each animal was immunized with two doses of a vaccine
containing SuHV-1 associated to Al(OH)
3
, Al(OH)
3
+ 5 mg/dose of ethanolic extract of
green propolis or 5 mg/dose of ethanolic extract of green propolis, diluted from 1:2 to
1:16. Twenty-one days after the second inoculation the animals were challenged with
31.6 LD of SuHV-1. All animals from the negative control (non-vaccinated) died
(result not shown). The number of dead and alive in each experimental group was
analyzed by the Reed & Muench [22] statistical method.
40
3.3 Cellular immunity
In order to evaluate the effect of the ethanolic extract of green propolis on the
cellular immune response, a semi-quantitative method of measurement (RT-PCR) of
the IFN-γ mRNA expression was used. As it can be observed in Figure 3A, 24 h after
splenocyte stimulation with 0.1 MOI of SuHV-1, there was a significant increase in
the IFN-γ mRNA expression in the animals inoculated with the vaccine preparation
containing aluminum hydroxide and propolis (sample 3), in relation to the vaccine
preparation without propolis (sample 2). In addition, when propolis alone was
associated with the antigen, expression of IFN-γ mRNA was even higher, superior
then the other treatments (sample 4). The expression of β-actin mRNA did not vary in
the different treatments, indicating a specific stimulus in the IFN-γ expression. Forty-
eight hours after splenocyte stimulation, the results remained the same (Fig. 3B). The
highest IFN-γ mRNA expression occurred when propolis alone was inoculated with
the antigen, followed by the association of propolis and aluminum hydroxide. The
lowest expression was when aluminum hydroxide alone was used with the antigen,
suggesting an immunostimulant effect of propolis on the cellular immune response to
SuHV-1.
41
1 2 3 4 1 2 3 4
(A) (B)
Fig. 3. Agarose gel electrophoresis of RT-PCR products resulting from the
amplification of IFN-γ mRNA from mice splenocytes collected 21 days after the
second inoculation with the different experimental vaccine preparations. (A). Twenty-
four hours after stimulating the splenocytes with 0.1 MOI of SuHV-1: (a) β-actin used
as internal control; (b) IFN-γ – 1. GeneRuler 100 pb DNA Ladder Plus (Invitrogen); 2,
Al(OH)
3
; 3, Al(OH)
3
+ propolis (5 mg/dose); 4, propolis (5 mg/dose). (B) Forty-eight
hours after stimulating the splenocytes; (a) β-actin used as internal control; (b) IFN-γ
– 1, GeneRuler 100 pb DNA Ladder Plus (Invitrogen); 2, Al(OH)
3
; 3, Al(OH)
3
+
propolis (5 mg/dose); 4, propolis (5 mg/dose).
4. Discussion
Several strategies have been pursued aiming at inhibiting the growth and
dissemination of pathogenic microorganisms due to economical losses caused in
different productive systems. Priority has been given to the development of vaccines
bp
300
400
500
200
200
300
500
400
(a)
(b)
(a)
(b)
500
400
300
200
bp
200
300
400
500
42
which generate an appropriate immune response [26]. Despite technological
advances in molecular biology and in genetic engineering, allowing identification of
antigens with immunogenic potential [3], the majority of vaccines requires association
with adjuvants capable of increasing the potency or stimulating the appropriate
immune response [5,3].
In this study, the adjuvant capacity of an ethanolic extract of Brazilian green
propolis was evaluated when associated to inactivated SuHV-1 with or without
aluminum hydroxide, in BALB/c mice. The addition of 5 mg/dose of this extract
[26,27] to the vaccine with aluminum hydroxide increased the potency of the humoral
immune response when compared to the vaccine without propolis, determined by
neutralizing antibody titers, 21 days after the second dose. This adjuvant effect was
more evident when the vaccine was diluted (1:4 and 1:8 – p<0.05), suggesting that
the lowest the antigenic mass in the vaccine or less immunogenic the antigen, more
pronounced is the propolis effect. According to Sforcin et al. [28], the ability of
modulating the synthesis of antibodies is part of the propolis adjuvant activity.
Despite the fact that the precise mechanism of action of propolis on the immune
system cells remains unknown [12], stimulation of macrophages to produce cytokines
such as IFN-γ, with further general amplification of the immune response [16,29], can
be one of its main adjuvant mechanisms.
The increase in the potency of the humoral immune response, however, was
not detected when propolis alone was associated to inactivated SuHV-1. The
neutralizing antibody titers, in this case, were the lowest among all experimental
groups, compared only to the highest dilutions (1:16) of the other treatments. This
fact can be understood if the propolis is classified as a nonparticulate adjuvant, as
suggested by Cox and Coulter [30]. According to these authors, nonparticulate
43
adjuvants acting as immunomodulators are those which the activity does not depend
on any particle, and benefit from the association with a particulate adjuvant. These
substances, as they do not attach to the antigen, are rapidly processed by the
immune system cells (inducing a weak response) and do not impair the loss of their
conformational integrity [30]. On the other hand, when the antigen is absorbed in a
particulate adjuvant, such as aluminum hydroxide, the particle formed facilitates its
direction to antigen present cells. Besides, this association allows a slow liberation of
the antigen, increasing the exposure time to the immune system, extending the
response [30,31]. This fact might explain the increase in the neutralizing antibody
titers to SuHV-1 of the vaccine preparation in which propolis plus aluminum
hydroxide were associated to the antigen.
The evaluation of humoral and/or cellular responses induced by a vaccine or
even an adjuvant substance should not be the only parameter analyzed for its
validation [32]. It is necessary an effective protection of the immunized animal in the
event of exposition to the pathogen. In this sense, six animals from each
experimental group were challenged with 31.6 LD of SuHV-1 [21], 21 days after the
last vaccination. The results obtained highlight the adjuvant capacity of the Brazilian
green propolis extract used. Comparing the vaccines with aluminum hydroxide, the
addition of the extract resulted in an increase percentage of protected animals,
especially in the higher dilutions. The high percentage of animals which survived the
challenge in the immunized group with the antigen and the propolis extract was also
surprising. The lack of correlation with the results obtained in the serological tests
suggest the role of cellular immunity in the protection against SuHV-1. It is likely that
activation of macrophages was one of the main adjuvant mechanisms in this case.
44
Activation of T lymphocytes causes a series of ordered interactions and
events, including activation of transmembrane signals and expression of cytokine
genes. Attributes such as stability and rate of synthesis of mRNA and proteins are
altered. The result of this process is the proliferation and differentiation of T cells and
production of cytokines [33]. An important functional attribute of the immune system
cells is the capacity of synthesizing and secreting cytokines, which bind to specific
receptors in the surface of a target cell. After binding, the cytokines act regulating the
growth and/or the differentiation of these cells, optimizing the immune response [12].
The development of a cellular or humoral immune response depends on a wide
range of cytokines produced by several cells, including CD4+ (Th1 and Th2) and
CD8+ T cells. The IFN-γ produced by Th1 cells is an essential cytokine in the cellular
immune response, classically described as a defense mechanism against viral
infections [34].
Besides increasing the potency of the humoral immune response, the use of
green propolis extract also allowed an increase in the cellular response, increasing
the synthesis of mRNA of IFN-γ. The IFN-γ expression was higher in splenocytes of
mice immunized with SuHV-1 plus propolis, explaining the higher percentage of
animals protected in this group after challenge. These results are similar to the ones
obtained by Blonska et al. [35] working with a European propolis sample, for whom
the ethanolic extract acts regulating gene expression at transcriptional level. Other
authors, using either propolis of Brazilian or European origin, also reported increase
in cytokine secretion in animals receiving propolis [29,35,36]. Ansorge et al. [12],
using a Polish sample, reported that propolis has a regulatory effect directly on the
basic functional properties of the immune system, which can be mediated by the
ErK2 MAP-kinase signal involved in mechanisms that promote cellular growth.
45
In a previous study, multivariate analysis associating ethanol extracts of
different samples with the levels of bioactive compounds determined by high
performance liquid chromatography (HPLC) allowed the typing of Brazilian propolis
[37]. Green propolis showed high levels of phenolic compounds such as artepillin C,
in addition to cinnamic acid and flavonoids such as pinobanksin and kaempferol. The
precise mechanism of action of propolis remains unknown [12], however, these
compounds may have stimulated the immune system cells to produce cytokines like
IL-1, IL-6, IL-8, IL-12 and IFN-γ [26,29,36], promoting an increase in the humoral as
well as the cellular immune response.
In our study, an ethanolic extract of green propolis acted as a modulator of the
immune system. In mice immunized with SuHV-1, the association of propolis and
aluminum hydroxide increased the potency of the humoral and cellular responses. In
addition, when used on its own with SuHV-1, green propolis extract promoted an
increment of the cellular immune response which resulted in increased protection.
The use of green propolis extract as an adjuvant might contribute for the efficacy of
vaccines, especially those which depend on the cellular immune response for
protective response. It can also increase the potency of vaccines when associated to
particulate adjuvants such as aluminum hydroxide.
Acknowledgements
We are grateful to Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq) for finantial support; Nectar Pharmaceutical Ltda., Belo
Horizonte, MG – Brazil, for supplying the propolis, and Mr José Carlos Rösler
Sandrini for technical support.
46
References
[1] Singh M, O’hagan DT. Recent advances in vaccine adjuvants. Pharm Res
2002;19(6):715-28.
[2] Scott P, Trinchieri G. IL-12 as an adjuvant for cell-mediated immunity.
Immunology 1997;9:285-91.
[3] Barr TA, Carlring J, Heath AW. Co-stimulatory agonists as immunological
adjuvants. Vaccine 2006;24:3399-407.
[4] Leclerc C. New approaches in vaccine development. Comp Immunol Microbiol
Infect Dis 2003;26:329-41.
[5] Storni T, Kündig TM, Senti G, Johansen P. Immunity in response to particulate
antigen-delivery systems. Adv Drug Deliv Rev 2005;57:333-55.
[6] Marcucci MC. Propolis: chemical composition, biological properties and
therapeutic activity. Apidologie 1995;26:83-99.
[7] Burdock GA. Review of the biological properties and toxicity of bee propolis
(propolis). Food Chem Toxicol 1998;36:347-63.
[8] Bankova VS, Castro SL, Marcucci MC. Propolis: recent advances in chemistry
and plant origin. Apidologie 2000;31:3-15.
47
[9] Kujumgiev A, Tsvetkova I, Serkedjieva Y, Bankova V, Christov R, Popov S.
Antibacterial, antifungal and antiviral activity of propolis of different geographic origin.
J Ethnoparmacol 1999;64:235-40.
[10] Bankova V. Recent trends and important developments in propolis research.
Evid Based Complement Alternat Méd 2005;2(1):29-32.
[11] Miyataka H, Nishiki M, Matsumoto HL, Fujimoto T, Matsuka ML, Satoh T.
Evaluation of propolis. I: Evaluation of Brazilian and Chinese propolis by enzymatic
and physico-chemical methods. Biol Pharmaceut Bull 1997;20(5):496-501.
[12] Ansorge S, Reinhold D, Lendeckel U. Propolis and some of its constituents
down-regulate DNA synthesis and inflammatory cytokine production but induce TGF-
β1 production of human immune cells. Z Naturforsch 2003;58c:580-9.
[13] Paulino N, Scremin FM, Raichaski LB, Marcucci MC, Scremin A, Calixto JB.
Mechanisms involved in the relaxant action of the ethanolic extract of propolis in the
guinea-pig trachea in-vitro. J Pharm Pharmacol 2002;54:1-9.
[14] Simões LM, Gregorio LE, Da Silva Filho AA, De Souza ML, Azzolini AE, Bastos
JK, et al. Effect of Brazilian green propolis on the production of reactive oxygen
species by stimulated neutrophils. J Ethnopharmacol 2004;94:59-65.
[15] Decastro SL, Higashi K. Effect of different formulation of propolis on mice
infected with Trypanossoma cruzi. J Ethnopharmacol 1995;46:55-8.
48
[16] Orsolic N, Basic I. Immunomodulation by water-soluble derivative of propolis: a
factor of antitumor reactivity. J Ethnopharmacol 2003;84:265-73.
[17] Scheller S, Owczarek S, Krol W, Malinowska B, Nikodemowicz E,
Aleksandrowicz J. Immunisierungsversuche bei zwei fallen von alveolitis fibroticans
bei abnehmender leistungsfahigkeit des immunsystems unter anwendung von
propolis-athanolextrakt (EEP), esberitox N und eines calcium-magnesium-praparates
(dolomit.). Heikunst 1989;102:249-55.
[18] Orsi RO, Funari SRC, Soares AMVC, Calvi SA, Oliveira SL, Sforcin JM, et al.
Immunomodulatory action of propolis on macrophage activation. J Venom Anim
Toxins 2000;6(2):205-19.
[19] Dimov V, Ivanovska N, Bankova V, Popov S. Immunomodulatory action of
propolis: IV. Prophylactic activity against Gram-negative infections and adjuvant
effect of the water-soluble derivate. Vaccine 1992;10(12):817-23.
[20] Piatti RM, Ikuno AA, Cunha ES, D´ambros R, Gregori F, Soares RM, et al.
Characterization of Aujeszky’s Disease virus isolates from south and southeast Brazil
by RFLP analysis. Braz J Microb 2001;32:144-6.
[21] Vidor T, Cunha AC, Guizzardi II, Salvo EO, Martins RM, Fernandes GV. Doença
de Aujeszky: II. Uso do camundongo em teste de eficiência de vacina inativada. Arq
Bras Med Vet Zoot 1991;43(5):387-96.
49
[22] Mayr A, Bachmann PA, Bibrack BM, Withmann G. Virologische Arbeitsmethoden
- Band IV - Sicherheit bei virologischen arbeiten - Biometrische Methoden. Stutgart :
Gustav Fischer Verlag, 1982.
[23] Bastos RG, Dellagostin OA, Barletta RG, Doster AR, Nelson E, Osorio FA.
Construction and immunogenicity of recombinant Mycobacterium bovis BCG
expressing GP5 and M protein of porcine reproductive respiratory syndrome virus.
Vaccine 2002;21:21-9.
[24] Ulett GC, Ketheesan N, Hirst RG. Cytokine gene expression in innately
susceptible Balb/c mice and relatively resistant C57BL/6 mice during infection with
virulent Burkholderia pseudomallei. Infect Immun 2000;68(4):2034-42.
[25] Curfs JHAJ, Meis JFGM, Hoogkamp-Korstanje JAA. A primer on cytokines:
sources, receptors, effects, and inducers. Clin Microbiol Rev 1997;10(4):742-80.
[26] Sá-Nunes A, Faccioli LH, Sforcin JM. Propolis: lymphocyte proliferation and IFN-
γ production. J Ethnopharmacol 2003;87:93-7.
[27] Mishima S, Narita Y, Chikamatsu S, Inoh Y, Ohta S, Yoshida C, et al. Effects of
propolis on cell growth and gene expression in HL-60 cells. J Ethonopharmacol
2005;99:5-11.
[28] Sforcin JM, Orsi RO, Bankova V. Effect of propolis, some isolated compounds
and its source plant on antibody production. J Ethnopharmacol 2005;98(3):301-5.
50
[29] Orsolic N, Terzic S, Sver L, Basic I. Polyphenolic compounds from propolis
modulate immune responses and increase host resistence to tumor cells. Food Agric
Immunol 2005;16:165-79.
[30] Cox JC, Coulter AR. Adjuvants – a classification and review of their modes of
action. Vaccine 1997;15(3):248-56.
[31] Lindblad EB. Aluminium adjuvants – in retrospect and prospect. Vaccine
2004;22:3658-68.
[32] Schlegel M, Vernazza PL. Immune response and vaccine efficiency. Vaccine
1998;16(13):1256.
[33] Fan J, Nishanian P, Breen EC, Mcdonald M, Fahey J. Cytokine gene expression
in normal human lymphocytes in response to stimulation. Clin Diagn Lab Immunol
1998;5(3):335-40.
[34] Pinto RA, Arredondo SM, Bono MR, Gaggero AA, Díaz PV. T Heper 1/T Helper
2 cytokine imbalance in respiratory syncytial vírus infection as associated with
increased endogenous plasma cortisol. Pediatrics 2006;117:878-86.
[35] Blonska M, Bronikowska G, Pietsz G, Czuba ZP, Scheller S, Krol W. Effects of
ethanol extract of propolis (EEP) and its flavones on inducible gene expression in
J774A.1 macrophages. J Ethnopharmacol 2004;91:25-30.
51
[36] Sforcin JM, Kanero R, Funari SRC. Absence of seasonal effect on the
immunomodulatory action of Brazilian propolis on natural killer activity. J Venom
Anim Toxins 2002;8(1):19-29.
[37] Marcucci MC, Ferreres F, García-Viguera C, Bankova VS, De Castro SL, Dantas
AP, et al. Phenolic compounds from Brazilian propolis with pharmacological activities
2001. J Ethnopharmacol 2001;74:105-112.
52
4 ARTIGO 3
Veterinary Immunology and Immunophatology, 116, p.79-84, 2007.
53
Abstract
Despite recent technological advances in vaccine production, most vaccines
depend on the association with adjuvant substances. In this study, propolis, which
has been attracting the attention of researchers due to its bioactive properties, was
evaluated as an immunological adjuvant. The association of 40 mg/dose of an
ethanolic extract of green propolis with an inactivated oil vaccine against bovine
herpesvirus type 5 (BoHV-5), resulted in a significant increase (P<0.01) in the
neutralizing antibody levels, comparing to the bovines that received the same
vaccine without propolis. Besides, propolis increased the percentage of animals with
high antibody titers (above 32). Phenolic compounds such as artepillin C (3,5-
diprenyl-4-hydroxycinnamic acid) and the derivatives of cinnamic acid besides other
flavonoid substances were abundant in the propolis extract used, and they could be
the main substances with adjuvant action. The effect of the green propolis extract on
the humoral immune response can be exploited in the development of new vaccines.
Keywords: Green propolis; Immunological adjuvant; Antibodies; Bovines
54
1. Introduction
The recent progress in the development of vaccines has allowed their use not
only as a prophylactic product, but also in the treatment of cancer, immunological
disorders and chronic infections (Blom and Hilgers, 2004). However, many of them
require association with adjuvant substances which, when combined with an antigen,
increase its immunogenicity, potentiating the humoral and/or cellular immune
responses (Storni et al., 2005; Barr et al., 2006). Besides, immunological adjuvants
can be used to extend the duration of the immune response or to stimulate mucosal
immunity (Leclerc, 2003).
Even though several substances have been evaluated regarding their adjuvant
capabilities, as a general rule, production of vaccines is still dependent on the use of
aluminum salts (Leclerc, 2003) or oil emulsions, specific for vaccines of veterinary
use (Jansen et al., 2006). This way, the development of new vaccines will be highly
benefited with the identification of new substances capable of promoting and
directing to a proper immune response (Cox and Coulter, 1997; Singh and O’Hagan,
2002).
Oil adjuvants, which are no longer in use for humans due to their adverse
effects (Lindblad, 2000), are still largely used in vaccines for veterinary use. These oil
emulsions, used specially in association with inactivated antigens (Jansen et al.,
2006), potentiate the immune system through the formation of a deposit at the
inoculation site, with slow and long release of the antigen (Cox and Coulter, 1997).
However, these inactivated vaccines need periodic revaccinations to produce an
efficient immunological response (Fenner et al., 1993).
Propolis is a resinous material produced by bees that displays a variety of
biological activities against viruses, bacteria, fungi, pathogenic protozoa, and also
55
tumor cells (De Castro et al., 2001). This natural product also behaves as anti-
hyperalgesic and anti-inflammatory agent (De Campos et al., 1998). Despite the
demonstration of its immunomodulator activities (Dimov et al., 1992; Orsi et al.,
2000), many of the mechanisms of action are still unknown.
Chemical studies revealed the complex composition of propolis, with more
than 300 constituents, including several bioactive phenolic compounds such as
flavonoids and derivatives of hydroxycinnamic acids (Bankova et al., 2000). These
constitutive characteristics can vary according to the bee species and the period of
the year (Bankova, 2005). Nevertheless, the botanical origin (Bankova et al., 2000;
Bankova, 2005) seems to be the most important factor to be considered when trying
to explain the chemical variability among different propolis samples. Green propolis,
only found in Brazil, is produced from a plant commonly known as “Alecrim do
Campo” (Baccharis dracunculifolia). This species is not adapted to the natural
conditions of other countries (Miyataka et al., 1997), which confers to the green
propolis chemical and biological characteristics different from the European propolis,
produced predominantly from the exudates of buds of aspen (Populus sp. –
Bankova et al., 2000).
The aim of this work was to evaluate the adjuvant capability of a green
propolis extract when associated with an inactivated oil vaccine against bovine
herpesvirus type 5, through determination of neutralizing antibody titers, and
characterization of the chemical composition of this extract by high performance
liquid chromatography (HPLC).
56
2. Material and methods
2.1. Preparation, botanical and chemical characterization of the propolis ethanolic
extract
The green propolis sample was collected in the State of Minas Gerais (South
East region of Brazil) by Nectar Farmacêutica Ltda (sample number SBN-54), and
stored at -20 °C. The ethanolic extract was prepared as previoulsy described
(Paulino et al., 2002). Briefly, the propolis was ground and macerated with an extract
solution containing absolute ethanol, using 10 min daily agitation, for 10 days. Then,
the solvent was evaporated and the resulting dried matter was dissolved in
phosphate buffer solution (pH 6.2), in a final concentration of 40 mg/ml (4% w/v) and
called GP1. The chemical composition of the green propolis extract was determined
by high performance liquid chromatography (HPLC), using a Merck-Hitachi
chromatographer (Germany), equiped with the L-7100 pressure pump and the L-
7455 diode array detector. Separation was carried out in a Lichrochart 125-4 (Merck,
Darmstadt, Germany) column as previously described (Marcucci et al., 2001). The
detection of components was monitored at 280 nm and standard compounds were
co-chromatographed with the extract. Analysis of the data was carried out using the
Merck-Hitachi D-7000 (Chromatography Data Station - DAD Manager).
2.2. Vaccines and inoculations
Evaluation of adjuvant properties of the green propolis extract was made
through its association with an inactivated oil vaccine against bovine herpesvirus type
5. This virus, supplied by the Virology and Immunology Laboratory, UFPel (Pelotas –
Brazil), was propagated in Madin Darby Bovine Kidney (MDBK - ATCC) cell line.
After inactivation with bromoethylamine BEI (C
2
H
7
Br
2
N, - Merck), in a final
57
concentration of 0.02 M and pH 7.5, the viral suspension with titer of 10
8
CCID
50
/ml
(cell culture infections dose 50%/ml) was emulsified in mineral oil (Marcol 52 - Esso
Standart Oil Co.), together with the propolis extract.
In this study, sixty randomly selected Hereford cattle, male and female,
weighting approximately 150 kg and seronegative for BoHV-5 determined by serum
neutralization (House and Baker, 1971), were used. The animals were kept in
pasture rotation together with other cattle of the farm. They were allocated into three
groups of 20 animals (control, G1 and G2) and vaccinated intramuscularly (IM) at
days 0, 30 and 60. The volume inoculated was adjusted according to the
concentration of the propolis solution used per dose, varying from 3 to 5 ml, however
the antigen concentration was constant in all the treatments (10
8
CCID
50
/ml per
dose). The control group received 3 ml of vaccine without propolis, the group G1
received 5 ml of the same vaccine with 20 mg/dose of propolis, whereas group G2
received 5 ml of this vaccine with 40 mg/dose of propolis. The animals were
observed daily until the tenth day after each inoculation in order to observe the
occurrence of adverse effects due to vaccination. The experiment was approved by
the UFPel Committee of Ethics in Animal Experimentation.
2.3. Serology
For titering neutralizing antibodies against BoHV-5, individual serum samples
were collected 30 days after each inoculation and stored at -20 °C. Antibodies were
titered by the serum neutralization method (House and Baker, 1971). Briefly, each
serum was individually diluted in logarithmic base 2 from 1:2 to 1:256. After
distribution (25 µl) in quadruplicate in polystyrene plates (TPP), 25 µl of BoHV-5 virus
suspension containing 100 CCID 50% was added. After incubation for 1 h at 37 ºC in
58
an environment with 5% CO
2
, approximately 30,000 MDBK
cells were added per
well. The microplates were then returned to the incubator until being read in an
inverted microscope when the 100 CCID50% was observed in the control cells. The
absence of cytopathic effect was an indication of the viral neutralization by
neutralizing antibodies. The antibody titer was calculated by Behrends & Kärber
(Mayr et al., 1982) statistical method, and it was represented by the highest serum
dilution capable of neutralizing 100 CCID 50% of the virus.
2.4. Statistical analysis
Antibody titers were compared using variance analysis (ANOVA) with
repeated measurements. The LSD test was used to determine significant differences
(P<0.05) among the mean of each treatment using the SAS program.
3. Results
3.1. Chemical composition of the propolis extract
As can be observed in Table 1, the HPLC analysis of the green propolis
sample utilized in this experiment showed high levels of the phenolic compounds 3,5-
diprenyl-4-hydroxycinnamic acid (artepillin C), 2,2-dimethyl-6-carboxyethenyl-2H-1-
benzopiran, 3-prenyl-4-hydroxycinnamic acid, p-coumaric acid, caffeic acid, ferulic
acid, besides cinnamic acid and the flavonoids pinobanksin and kaempferol. In this
sample of green propolis, the flavonoids corresponded to 22.37% of the dried extract.
59
Table 1: Chemical characterization of green propolis determined by high
performance liquid chromatography - HPLC
Component identified in propolis mg/g dry extract
2,2-Dimethyl-6-carboxyethenyl-2H-1-benzopiran 3.17
2.2-Dimethyl-8-prenyl-2H-1-benzopyran-6-propenoic acid 9.77
3.5-Diprenyl-4-hydroxycinnamic acid (derivative 1-9) 17.75
3.5-Diprenyl-4-hydroxycinnamic acid (Artepillin C) 27.77
3-Prenyl-4-hydroxycinnamic acid 5.71
Caffeic acid 2.43
Caffeic acid (derivative 1) 11.35
Cinnamic acid derivative 65.98
Ferulic acid 7.21
Kaempferol (derivative 1) 20.45
p-Coumaric acid 18.03
Pinobanksin 31.48
Total (mg/g of crude resin) 221.10
Total (%) 22.11
3.2. Humoral Response
In this work, the adjuvant properties of an ethanolic extract of green propolis
when associated with an inactivated oil vaccine against BoHV-5 was evaluated. A
dose dependent effect was demonstrated. The inclusion of 40 mg/dose of this extract
in the experimental vaccine increased the humoral immune response (P<0.01),
measured by antibodies titers, compared to the control group (vaccine without
propolis) (Figure 1). Sixty days after the first inoculation, the titer increased from 35
60
(negative control, without propolis) to 54 in the treatment with 40 mg/dose of propolis.
This difference remained the same 90 days after the first inoculation, when the
antibody titers were 43 and 67, respectively. However, the addition of 20 mg/dose of
the propolis extract did not result in a statistically significant alteration, when
compared to the control group. Besides increasing antibody titers of cattle vaccinated
with BoHV-5, the use of 40 mg/dose of green propolis solution also increased the
percentage of animals with antibody titers equal or higher than 32, especially 30 days
after the third vaccination (Table 2).
30
35
40
45
50
55
60
65
70
75
Control G1 G2
Antibody titers
collection 1
collection 2
Fig 1. Mean titer ± S.E.M of neutralizing antibodies (expressed as reciprocal of the
serum dilution) of cattle immunized with an inactivated oil vaccine against BoHV-5
without propolis (control), with 20 mg/dose of an ethanolic extract of green propolis
(G1) or 40 mg/dose of propolis (G2). The titer was determined by the serum
neutralization test, 30 days after the second inoculation (collection 1) or 30 days after
the third inoculation (collection 2). ** P <0.01 compared to the control group.
**
**
61
Table 2. Accumulated percent distribution of neutralizing antibodies titers in bovines
vaccinated with BoHV-5
Titer
a
30 days after second dose 30 days after third dose
Control
b
G1
c
G2
d
Control G1 G2
0 – 7,9 100 100 100 100 100 100
8 – 15.9 100 100 100 100 93.7 100
16 – 31.9 72.3 100 100 81.3 77.9 100
32 – 63.9 44.6 61.2 72.2 43.8 51.6 70.6
≥ 64 22.3 27.8 33.4 31.3 21.0 58.8
a
Titers expressed by the reciprocal
b
Vaccine without propolis
c
Vaccine with 20 mg/dose of ethanolic extract of green propolis
d
Vaccine with 40 mg/dose of ethanolic extract of green propolis
Adjuvants are used in several types of vaccine aiming at the optimization of
the humoral and/or cellular responses. However many substances with adjuvant
properties cannot be used in vaccines for human or veterinary use due to their
adverse effects (Estrada et al., 2000). In this study, conducted in cattle, no adverse
effect was observed due to the association of propolis with the oil vaccine against
BoHV-5.
4. Discussion
Due to the high chemical complexity of propolis, it is extremely difficult to
identify which substances are responsible for its biological activities. Some
researchers state that it is indeed the heterogeneous composition, besides the
62
combination of natural substances that confers to propolis its bioactive properties
(Kujumgiev et al., 1999; Ozkul et al., 2005). According to Sforcin et al. (2005) the
action of propolis on the immunological system results from the synergism of several
substances. The elements detected in the green propolis extract utilized in this
experiment, determined by HPLC analysis, show that its botanical origin is the
Bacharis dracunculifolia plant (Marcucci, 1995; Bankova et al., 2000). In a previous
study, multivariate analysis associating ethanol extracts of different samples with the
levels of bioactive compounds determined by HPLC allowed the typing of Brazilian
propolis (Marcucci et al., 2001). The results were similar to the ones found in this
experiment, with predominance of phenolic compounds and cinnamic acid
derivatives. In these extracts, the flavonoids corresponded to 22.37% of the dried
extract. These substances are known to stimulate humoral as well as cellular
immunity (Havsteen, 2002). Although the precise mechanism of action remains
unknown, it is possible that the flavonoids stimulate production of cytokines,
particularly interleukin 1 (IL-1) and IL-2, which have mitogenic action for B and T
lymphocytes (Havsteen, 2002). Artepilin C seems to perform its immunostimulating
activity through increase in the number of auxiliar T lymphocytes (Kimoto et al.,
1998).
The association of different adjuvant substances aims at combining their
properties responsible for the stimulation of the immune system. Complete Freund
adjuvant, for example, combines the immunomodulator properties of Mycobacterium
tuberculosis with the activity of the oil emulsion (Cox and Coulter, 1997). In this
experiment, the association of 40 mg/dose of an ethanolic extract of green propolis
whith an inactivated oil vaccine against BoHV-5 increased the humoral immune
response (P<0.01), measured by neutralizing antibodies titers. It is conceivable that
63
the combination of oil with propolis allowed the formation of a deposit in the
inoculation site, resulting in a slow and extended antigen (BoHV-5) and propolis
release (Cox and Coulter, 1997), allowing a constant stimulus of the immunological
system. According to Jansen et al. (2006), the continuous release of non replicative
antigens results in extended humoral immunity. The propolis extract may have acted
as an auxiliary adjuvant substance, potentiating the humoral response triggered by
the antigen associated to the oil. According to Sforcin et al. (2005), propolis ability in
modulating antibody synthesis is part of its adjuvant action. The propolis
immunostimulating capacity, through an increase in the immunoglobulin levels has
already been reported in patients with fibrosing alveolitis (Scheller et al. 1989).
The precise mechanism of action of propolis on cells from the immune system
remains unknown (Ansorge et al., 2003). However, it is known that artepillin C, found
in large scale in the green propolis sample used, acts on macrophages stimulating
the production of IL-12 (Sforcin et al., 2002), which potentiates immunoglobulin
production by B cells. Other phenolic compounds, such as cinnamic acid derivatives
found in the propolis sample used, also induce production and releasing of cytokines
like IL-1, IL-6 and IL8 by activated macrophages, stimulating antibody production
(Orsolic et al., 2005). Such mechanisms can explain the increment in the humoral
response observed in the present study. Another hypothesis suggests that propolis
can reduce lipid peroxidation and stimulate the immune system by means of direct
lymphocyte activation (Kimoto et al., 1998).
Besides increasing humoral immune response of cattle vaccinated with BoHV-
5, the use of 40 mg/dose of an ethanolic green propolis extract also increased the
percentage of animals with titers higher than 32 (Table 2). According to Lazarowicz
et al. (1983), bovines with titer equal or higher than 32 resist challenge with field
64
virus. This fact is yet more relevant considering that many farmers do not use
vaccines in a prophylactic way, but only after positive diagnosis of the disease in the
farm, which implies the presence of the virus in the herd. Even though cellular
immunity is more important in the case of BoHV primary infection, humoral immunity
is more effective in preventing the resurgence of the disease, once BoHV remains
latent in the animal after infection (Babiuk et al., 1996). As comparative parameter,
the United States Department of Agriculture considers as immunized a herd which
has 80% of vaccinated animals with titer equal or above 8 (USDA, 2005).
Due to the increase of neutralizing antibody titers, in addition to the
percentage of animals with high titers, further studies in the development of this
vaccine can take into consideration the possibility of increasing the interval between
vaccinations, as well as decreasing the amount of antigen per dose. These
approaches, besides lowering the cost of the vaccine, could allow a reduction in the
handling of the animals.
5. Conclusions
The data presented in this study showed that an ethanolic extract of green
propolis increased the potency of the humoral immune response in cattle when
associated with an inactivated oil vaccine against BoHV-5, showing adjuvant action.
Besides the increment in neutralizing antibody titers, there was an increase in the
percentage of animals with titers higher than 32. Propolis compounds responsible for
the immunostimulating activities have not yet been determined, but the flavonoids
and other phenolic compounds, like artepillin C, found in large quantity in the sample
studied, could have been the main substances with action on the immune system.
65
The use of ethanolic extract of green propolis can contribute for the efficacy of
inactivated vaccines, acting as an immunostimulant.
Acknowledgments
The authors would like to thank the Conselho Nacional de Desenvolvimento
Científico e Tecnológico (CNPq) for financial support; Nectar Pharmaceutical Ltd.
Belo Horizonte, MG – Brasil, (for supplying the propolis); Prof. José Vasconcelos
Arnoni, for supplying the animals; Mr José Carlos Rösler Sandrini and Ms Enilda
Souza de Oliveira for the technical support.
References
Ansorge S., Reinhold D., Lendeckel U., 2003. Propolis and some of its constituents
down-regulate DNA synthesis and inflammatory cytokine production but induce TGF-
β1 production of human immune cells. Z. Naturforsch. 58c, 580-589.
Babiuk, L.A., Hurk, S.D.L., Tikoo, S.K., 1996. Immunology of bovine herpesvirus 1
infection. Vet. Microbiol. 53, 31-42.
Bankova, V.S., Castro, S.L., Marcucci, M.C., 2000. Propolis: recent advances in
chemistry and plant origin. Apidologie 31, 3-15.
Bankova, V., 2005. Recent trends and important developments in propolis research.
Evid. Based Complement. Alternat. Méd. 2, 29-32.
66
Barr, T.A., Carlring, J., Heath, A.W., 2006. Co-stimulatory agonists as immunological
adjuvants. Vaccine 24, 3399-3407.
Blom, A.G., Hilgers, L.A., 2004. The sucrose fatty acid sulphate esters as novel
vaccine adjuvants: effect of the chemical composition. Vaccine 23, 743-754.
Cox, J.C., Coulter, A.R., 1997. Adjuvants – a classification and review of their modes
of action. Vaccine 15, 246-256.
De Campos, R.O., Paulino, N., da Silva, C.H., Scremin, A., Calixto, J.B., 1998. Anti-
hyperalgesic effect of an ethanolic extract of propolis in mice and rats. J. Pharm.
Pharmacol. 50, 1187-1193.
De Castro S.L., 2001. Propolis: biological and pharmacological activities. Therapeutic
uses of this bee-product. Ann. Rev. Biom. Sci. 3, 49-83.
Dimov, V., Ivanovska, N., Bankova, V., Popov, S., 1992. Immunomodulatory action of
propolis: IV. Prophylactic activity against Gram-negative infections and adjuvant
effect of the water-soluble derivate. Vaccine 10, 817-823.
Estrada, A., Katselis, G.S., Laarveld, B., Barl, B., 2000. Isolation and evaluation of
immunological adjuvant activities of saponins from Polygala senega L. Comp.
Immunol. Microbiol. Infect. Dis. 23, 27-43.
67
Fenner, F. J., Gibbs, E. P., Murphy, F. A., Rott, R., Studert, M. J., White, D., 1993.
Veterinary Virology. Academic Press, San Diego, p. 666.
Havsteen, B.H., 2002. The biochemistry and medical significance of the flavonoids.
Pharmacol. Ther. 96, 67-202.
House, J.A., Baker, J.A., 1971. Bovine herpesvirus IBR-IPV. The antibody virus
neutralization reaction. Cornell Vet. 61, 320-335.
Jansen, T., Hofmans, M.P.M., Theelen, M.J.G., Manders, F., Schijns, V.E.J.C., 2006.
Structure and oil type-based efficacy of emulsion adjuvants. Vaccine 24, 5400-5405.
Kimoto, T., Arai, S., Kohguchi, M., Aga, M., Nomura, Y., Micallef, M.J., Kurin, M.,
Mito, K., 1998. Apoptosis and suppression of tumor growth by artepillin C extracted
from brazilian propolis. Cancer Detect. Prev. 22, 506-515.
Kujumgiev, A., Tsvetkova, I., Serkedjieva, Yu., Bankova, V., Christov, R., Popov, S.,
1999. Antibacterial, antifungal and antiviral activity of propolis of different geographic
origin. J. Ethnoparmacol. 64, 235-240.
Lazarowics, M., Steck, F., Ackermann, M., Kihm, U., 1983. Prüfung von zwei
Impfstoffen gegen die Infektiöse Bovine Rhinotracheitis. Schweiz. Arch. Tierheilk.
125, 797-808.
68
Leclerc C., 2003. New approaches in vaccine development. Comp. Immunol.
Microbiol. Infect. Dis. 26, 329-341.
Lindblad, E.B., 2000. Freund´s adjuvants. In: O´Hagan D.T. (Ed.), Vaccine adjuvants,
Humana Press, Totowa,New Jersey, pp. 49-63.
Marcucci, M.C., 1995. Propolis: chemical composition, biological properties and
therapeutic activity. Apidologie 26, 83-99.
Marcucci, M.C., Ferreres, F., García-Viguera, C., Bankova, V.S., De Castro, S.L.,
Dantas, A.P., Valente, P.H.M., Paulino, N., 2001. Phenolic compounds from Brazilian
propolis with pharmacological activities. J. Ethnopharmacol. 74, 105-112.
Mayr, A., Bachmann, P.A., Bibrack, B.M., Withmann, G., 1982. Virologische
Arbeitsmethoden - Band IV - Sicherheit bei virologischen arbeiten - Biometrische
Methoden. Gustav Fischer Verlag, Stutgart, p. 666.
Miyataka, H., Nishiki, M., Matsumoto, H., Fujimoto, T., Matsuka, M., Isobe, A., Satoh,
T., 1997. Evaluation of propolis. I: Evaluation of Brazilian and Chinese propolis by
enzymatic and physico-chemical methods. Biol. Pharmaceut. Bull 20, 496-501.
Orsi, R.O., Funari, S.R.C., Soares, A.M.V.C., Calvi, S.A., Oliveira, S.L., Sforcin, J.M.,
Bankova, V., 2000. Immunomodulatory action of propolis on macrophage activation.
J. Venom. Anim. Toxins 6, 205-219.
69
Orsolic, N., Terzic, S., Sver, L., Basic, I., 2005. Polyphenolic compounds from
propolis modulate immune responses and increase host resistence to tumor cells.
Food Agric. Immunol. 16, 165-179.
Ozkul, Y., Silici, S., Eroglu, E., 2005. The anticarcinogenic effect of propolis in human
lymphocytes culture. Phytomedicine 12, 742-747.
Paulino, N., Scremin, F.M., Raichaski, L.B., Marcucci, M.C., Scremin, A., Calixto,
J.B., 2002. Mechanisms involved in the relaxant action of the ethanolic extract of
propolis in the guinea-pig trachea in-vitro. J. Pharm. Pharmacol. 54, 1-9.
Scheller, S., Owczarek, S., Krol, W., Malinowska, B., Nikodemowicz, E.,
Aleksandrowicz, J., 1989. Immunisierungsversuche bei zwei fallen von alveolitis
fibroticans bei abnehmender leistungsfahigkeit des immunsystems unter anwendung
von propolis-athanolextrakt (EEP), esberitox N und eines calcium-magnesium-
praparates (dolomit.). Heikunst 102, 249-255.
Sforcin, J.M., Kanero, R., Funari, S.R.C., 2002. Absence of seasonal effect on the
immunomodulatory action of brazilian propolis on natural killer activity. J. Venom.
Anim. Toxins 8, 19-29.
Sforcin, J.M., Orsi, R.O., Bankova, V., 2005. Effect of propolis, some isolated
compounds and its source plant on antibody production. J. Ethnopharmacol. 98,
301-305.
70
Singh, M., O’Hagan, D.T., 2002. Recent advances in vaccine adjuvants. Pharm. Res.
19, 715-728.
Storni, T., Kündig, T.M., Senti, G., Johansen, P., 2005. Immunity in response to
particulate antigen-delivery systems. Adv. Drug Deliv. Rev. 57, 333-355.
USDA, 2005. Animal and plant health inspection service. pp. 683-684.
71
5 CONCLUSÕES
- O extrato etanólico de própolis verde atuou como um modulador do sistema
imunológico.
- A associação do extrato etanólico com hidróxido de alumínio ou emulsões oleosas
propiciou incremento nas respostas imunes humoral e celular de camundongos e
humoral de bovinos.
- Utilizado isoladamente com o antígeno, o extrato etanólico de própolis incrementou
a resposta celular de camundongos e o percentual de proteção durante desafio, mas
não alterou a resposta humoral.
- A própolis verde pode ser utilizada como uma substância adjuvante para vacinas
inativadas.
72
6 REFERÊNCIAS
ANSORGE, S.; REINHOLD, D.; LENDECKEL, U. Propolis and some of its
constituents down-regulate DNA synthesis and inflammatory cytokine production but
induce TGF-β1 production of human immune cells. Zeitschrift für Naturforschung,
v.58c, p.580-589, 2003.
ASO, K.; KANNO, S.; TADANO, T.; SATOH, S.; ISHIKAWA, M. Inhibitory effect of
propolis on the growth of human leukemia U937. Biological and Pharmaceutical
Bulletin, n.27, p.727-730, 2004.
AUCOUTURIER, J.; DUPUIS, L.; GANNE, V. Adjuvants designed for veterinary and
human vaccines. Vaccine, v.19, p.2666-2672, 2001.
BANKOVA, V.; KRASTEVA, G.B.; SFORCIN, J.M.; FRETE, X.; KUJUMGIEV, A.;
RODELLA, R.M.; POPOV, S. Phytochemical evidence for the plant origin of Brazilian
propolis from São Paulo State. Zeitschrift für Naturforschung, v.54, p.401-405,
1999.
BANKOVA, V.S.; CASTRO, S.L.; MARCUCCI, M.C. Propolis: recent advances in
chemistry and plant origin. Apidologie, v.31, p.3-15, 2000.
BANKOVA, V. Chemical diversity of propolis and the problem of standardization.
Journal of Ethnopharmacology, v.100, p.114-117, 2005.
73
BAZIN, H. A brief history of the prevention of infectious diseases by immunizations.
Comparative Immunology, Microbiology & Infectious Diseases, v.26, p.293-308,
2003.
BLOM, A.G., HILGERS, L.A. The sucrose fatty acid sulphate esters as novel vaccine
adjuvants: effect of the chemical composition. Vaccine, v.23, p.743-754, 2004.
COX, J.C., COULTER, A.R. Adjuvants – a classification and review of their modes of
action. Vaccine, v.15, p.246-256, 1997.
BURDOCK, G.A. Review of the biological properties and toxicity of bee propolis
(propolis). Food and Chemical Toxicology, v.36, n.4, p.347-363, 1998.
DALSGARD, K. Saponin adjuvants III. Isolation of a substance from Quillaja
saponaria Molina with adjuvant activity in food-and-mouth disease vaccines. Archiv
für die Gesamte Virusforschung, v.44, p.243-254, 1974.
DANTAS, A.P.; OLIVIERI, B.P.; GOMES, F.H.M.; DE CASTRO, S.L. Treatment of
Trypanosoma cruzi-infected mice with propolis promotes changes in the immune
response. Journal of Ethnopharmacology, v.103, p.187-193, 2006.
DE CASTRO, S.L.; HIGASHI K. Effect of different formulation of propolis on mice
infected with Trypanossoma cruzi. Journal of Ethnopharmacology, v.46, p.55-58,
1995.
DIMOV, V.; IVANOVSKA, N.; BANKOVA, V.; POPOV, S. Immunomodulatory action
of propolis: IV. Prophylactic activity against Gram-negative infections and adjuvant
effect of the water-soluble derivate. Vaccine, v.10, n.12, p.817-823, 1992.
FISCHER, G.; DUMMER, L.A.; VIDOR, T.; PAULINO, N.; PAULINO, A.S. Avaliação
da ação antiviral de uma solução de própolis sobre o Herpesvírus Bovino e o Vírus
da Diarréia Viral dos Bovinos. In: ENCONTRO DE PÓS-GRADUAÇÃO, 7, 2005,
Pelotas, RS. Anais. Pelotas, 2005.
74
FLECK, J.D.; KAUFFMANN, C.; SPILKI, F.; LENCINA, C.L.; ROEHE, P.M.;
GOSMANN, G. Adjuvant activity of Quillaja brasiliensis saponinas on the immune
responses to bovine herpesvirus type 1 in mice. Vaccine, v.24, p.7129-7134, 2006.
JANSEN, T.; HOFMANS, M.P.M.; THEELEN, M.J.G.; MANDERS, F.; SCHIJNS,
V.E.J.C. Structure and oil type-based efficacy of emulsion adjuvants. Vaccine, v.24,
p.5400-5405, 2006.
KUJUMGIEV, A.; TSVETKOVA, I.; SERKEDJIEVA, Y.; BANKOVA, V.; CHRISTOV,
R.; POPOV, S. Antibacterial, antifungal and antiviral activity of propolis of different
geographic origin. Journal of Ethnoparmacology, v.64, p.235-240, 1999.
LECLERC, C. New approaches in vaccine development. Comparative Immunology,
Microbiology & Infectious Diseases, v.26, p.329-341, 2003.
MARCUCCI, M.C. Propolis: chemical composition, biological properties and
therapeutic activity. Apidologie, v.26, p.83-99, 1995.
MARCUCCI, M.C. Biological and therapeutic properties of chemical propolis
constituents. Química Nova, n.19, p.529-536, 1996.
MATSUNO, T. Isolation and characterization of the tumoricidal substances from
Brazilian propolis. Honeybee Science, n.13, p.49-54, 1992.
MIDORIKAWA, K.; BANSKOTA, A.H.; TEZUKA, Y.; NAGAOKA, T.; MATSISHIGE,
K.; MESSAGE, D.; HUERTAS, A.A.; KADOTA, S. Liquid chromatography-mass
spectrometry analysis of propolis. Phytochemical Analisys, n.12, p.366-373, 2001.
MIYATAKA, H.; NISHIKI, M.; MATSUMOTO, H.L.; FUJIMOTO, T.; MATSUKA, M.L.;
SATOH T. Evaluation of propolis. I: Evaluation of Brazilian and Chinese propolis by
enzymatic and physico-chemical methods. Biological and Pharmaceutical Bulletin,
v.20, n.5, p.496-501, 1997.
75
ORSI, R.O.; FUNARI, S.R.C.; SOARES, A.M.V.C.; CALVI, S.A.; OLIVEIRA, S.L.;
SFORCIN, J.M.; BANKOVA, V. Immunomodulatory action of propolis on macrophage
activation. Journal of Venomous Animals and Toxins, v.6, n.2, p.205-219, 2000.
ORSOLIC, N.; KNEZEVI, A.H.; SVER, L.; TERZI, S.; BASIC, I. Immunomodulatory
and antimetastatic action of propolis and related polyphenolic compounds. Journal
of Ethnopharmacology, v.94, p.307-315, 2004.
PARK, Y.K.; ALENCAR, S.M.; SCAMPARINI, A.R.P.; AGUIAR, C.L. Própolis
produzida no sul do Brasil, Argentina e Uruguai: evidências fitoquímicas de sua
origem vegetal. Ciência Rural, v.32, n.6, p.997-1003, 2002.
PEREIRA, A.S.; SEIXAS, F.R.M.S.; AQUINO NETO, F.R. Propolis: 100 anos de
pesquisa e suas perspectives futuras. Química Nova, v.25, n.2, p.321-326, 2002.
PEREIRA, A.S.; PEREIRA, A.F.M.; TRUGO, L.C.; AQUINO NETO, F.R. Distribution
of quinic acid derivatives and other phenolic compounds in Brazilian propolis.
Zeitschrift für Naturforschung, v.58c, p.590-593, 2003.
PINTO, M.S.; FARIA, J.E.; MESSAGE, D.; CASSINI, S.T.A.; PEREIRA, C.S.;
GIOSO, M.M. Efeito de extratos de própolis verde sobre bactérias patogênicas
isoladas do leite de vacas com mastite. Brazilian Journal of Veterinary Research
and Animal Science, v.38, n.6, p.278-283, 2001.
SCHATZMAYR, H.G. Novas perspectives em vacinas virais. História. Ciências,
Saúde, v.10 (suplemento 2), p.655-669, 2003.
SCHELLER, S.; OWCZAREK, S.; KROL, W.; MALINOWSKA, B.; NIKODEMOWICS,
E.; ALEKSANDROWICZ, J. Immunisierungsversuche bei zwei fallen von alveolitis
fibroticans bei abnehmender leistungsfahigkeit des immunsystems unter anwendung
von propolis-athanolextrakt (EEP), esberitox N und eines calcium-magnesium-
praparates (dolomit.). Heikunst, v.102, p.249-255, 1989.
76
SCHIJNS, V.E.J.C. Immunological concepts of vaccine adjuvant activity. Current
Opinion in Immunology, n.12, p.456-463, 2000.
SINGH, M.; O´HAGAN, D.T. Advances in vaccine adjuvants. Nature Biotechnology,
v.17, p.1075-1081, 1999.
SINGH, M; O’HAGAN DT. Recent advances in vaccine adjuvants. Pharmaceutical
Research, v.19, n.6, p.715-728, 2002.
SINGH, M.; O´HAGAN, D.T. Recent advances in veterinary vaccine adjuvants.
International Journal of Parasitology, v.33, p.469-478, 2003.
STORNI, T.; KÜNDIG, T.M.; SENTI, G.; JOHANSEN, P. Immunity in response to
particulate antigen-delivery systems. Advanced Drug Delivery Reviews, v.57,
p.333-355, 2005.
STRADIOTTI, D.; QUEIROZ, A.C.; LANA, R.P.; PACHECO, C.G.; EIFERT, E.C.;
NUNES, P.M.M. Ação da própolis sobre a desaminação de aminoácidos e a
fermentação ruminal. Revista Brasileira de Zootecnia, v.33, n.4, p.1086-1092,
2004.
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
