ads:
Gustavo Oliveira Zoletti
ANÁLISE DA COMUNIDADE BACTERIANA E CARACTERIZAÇÃO
GENOTÍPICA E FENOTÍPICA DE Enterococcus faecalis ISOLADOS DE
CANAIS DENTÁRIOS TRATADOS
Orientadores: Prof
a
. Kátia Regina Netto dos Santos
Prof. José Freitas Siqueira Jr
!" # $ %&
'( $ )*"+) ,)+-).#) /0 ")
)+-).#) .% ")1) .
) ")0+$! 2))"+3)4
-"'( 5. $ )*"+) ).%#)+
,)+-).#) /
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
FICHA CATALOGRÁFICA
ZOLETTI, Gustavo Oliveira.
Análise da comunidade bacteriana e caracterização genotípica e
fenotípica de Enterococcus faecalis isolados de canais dentários tratados /
Gustavo Oliveira Zoletti. Rio de Janeiro, UFRJ, IMPPG 2010.
ix, 107.; il.
Tese (Doutorado em - Microbiologia) - Universidade Federal do Rio de
Janeiro, Instituto de Microbiologia Paulo de Góes, 2010.
Orientadores: Kátia Regina Netto dos Santos
José Freitas Siqueira Jr
1. Enterococcus faecalis. 2. infecção endodôntica. 3. fatores de virulência.
4. aspectos genotípicos. 5. tratamento endodôntico 6. eletroforese em gel com
gradiente de desnaturação
I. Santos, Kátia Regina Netto dos (orientador)
Siqueira, José Freitas Jr (orientador)
II. Universidade Federal do Rio de Janeiro, Instituto de Microbiologia
Professor Paulo de Góes.
III. Análise da comunidade bacteriana e caracterização genotípica e
fenotípica de Enterococcus faecalis isolados de canais dentários
tratados
ads:
Gustavo Oliveira Zoletti
ANÁLISE DA COMUNIDADE BACTERIANA E CARACTERIZAÇÃO
GENOTÍPICA E FENOTÍPICA DE Enterococcus faecalis ISOLADOS DE
CANAIS DENTÁRIOS TRATADOS
) ")0671)
7 893) #)" "00
78:) )2) 00
7 8;+) )")<) 00
78 != .>) 00
78;.): += .)1) 00
????????????????????????????????????????????????????????????
7 8 )@) 00
!" - .= 7) .)@ " - %) "7+'( >!) . 0
! $" )+-).#) :)+ 0 ") )+-).#) .
%0 " )*"+) ; ,/0 ")1) . )
")0- )" '( 7 93) #)" "7
:) )2) 8
Dedico esta Tese aos meus amigos do Laboratório de
Infecção Hospitalar e do Instituto de Microbiologia, em
especial aos meus amigos Eliezer e Ricardo, pessoas
especiais, desprovidas de qualquer interesse, ajudando
pelo nobre prazer de ensinar. O “corporativismo
discente” e a cumplicidade são fatores determinantes
para que o Laboratório de Infecção Hospitalar e o
Departamento de Microbiologia Médica contribuíram
para a produção científica tão desejada. Agradecimentos
são momentâneos, porém a gratidão é eterna. Serei
sempre grato a vocês.
Agradecimentos
Aos meus pais e minha Irmã que sempre foram meus maiores e grandes amigos. O
incentivo de vocês foi crucial para que minha carreira e principalmente minha vida seja
maravilhosa.
Aos amores de minha vida Debora e Laura, aprendi com vocês, que não preciso ser
perfeito o tempo todo para que me amem. Amo vocês.
À Prof
a
. Kátia Regina Netto dos Santos pela intensa e carinhosa orientação. Ratifico e
reforço que, sua forma de conduzir o aprendizado de seus alunos os torna pessoas
muito melhores;
Ao Prof. Siqueira Jr por fortalecer ainda mais minha carreira profissional e científica e
pela franqueza na condução de sua orientação;
Ao Laboratório do Professor Rosado, em particular à Flávia Carmo, pela gentil
contribuição em parte deste estudo;
Aos meus amigos “Dentistas”, Andréia, Antonio e Ronaldo, por acompanharem e
entenderem minha ausência nesta etapa de meu aprendizado. Em especial ao meu
amigo César, por continuar me dando o suporte que precisei, desta vez nos números e
no inglês;
Aos funcionários do Departamento de Microbiologia Médica que contribuem e muito
com o andamento de nossas dissertações e teses;
Aos Professores do Instituto de Microbiologia e em especial aos do Departamento de
Microbiologia Médica pelas encantadoras informações passadas nas aulas e corredores
do Departamento;
Aos queridos Professores dos Serviços de Endodontia das Faculdades de Odontologia
da UFRJ e UNESA por permitir a coleta dos espécimes clínicos;
Ao Instituto de Microbiologia Paulo de Góes, na pessoa de sua Diretora Prof
a
. Agnes
Marie;
À Prof
a
. Ana Paula Colombo na coordenação da Pós-Graduação do nosso Instituto;
Ao Prof.
Sérgio Fracallanzza na chefia do Departamento de Microbiologia Médica;
Às Instituições que contribuíram na execução desta dissertação: Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPq), Fundação de Amparo à Pesquisa do
Estado do Rio de Janeiro (FAPERJ) e Ministério da Ciência e Tecnologia (MCT-
PRONEX).
“A vida só pode ser compreendida, olhando-se para trás; mas só pode ser vivida,
olhando-se para frente.”
Soren Kierkergaard
RESUMO
ANÁLISE DA COMUNIDADE BACTERIANA E CARACTERIZAÇÃO
GENOTÍPICA E FENOTÍPICA DE Enterococcus faecalis ISOLADOS DE
CANAIS DENTÁRIOS TRATADOS
Gustavo Oliveira Zoletti
Orientadores: Professores Kátia Regina Netto dos Santos e José Freitas Siqueira Jr.
Resumo da Tese de Doutorado submetida ao Programa de Pós-Graduação em Ciências
(Microbiologia), Instituto de Microbiologia Paulo de Góes da Universidade Federal do Rio de
Janeiro, como parte dos requisitos necessários para a obtenção do Título de Doutor em
Ciências (Microbiologia).
A alta freqüência de Enterococcus faecalis em canais dentários tratados com
doença pós-tratamento endodôntico observada por técnicas moleculares e
tradicionais de cultivo sugere que esta espécie possa ser o protagonista no
insucesso do tratamento endodôntico. Este estudo objetivou identificar amostras
de E. faecalis por metodologias molecular e convencional e detectar fatores de
virulência e genes relacionados. Pesquisou a diversidade genômica de 20
amostras clínicas de E. faecalis isoladas de canais dentários tratados com (10
cepas) e sem (10 cepas) periodontite apical. Além disso, foi realizada a
comparação entre a comunidade bacteriana encontrada em canais dentários
tratados com (12 amostras) e sem (11 amostras) lesão periapical. A PCR do 16S
rRNA gene específico foi estatisticamente mais sensível na detecção de E.
faecalis do que a metodologia convencional (p<0,001). Todas as 20 amostras
apresentaram o gene gelE, porém apenas 10 hidrolisaram a gelatina. A presença
do gene esp foi detectado apenas nas amostras onde a produção de gelatinase
foi negativa, com exceção de três cepas isoladas de canais sem lesão, que
foram negativas para ambos os fatores de virulência. Os demais genes de
virulência pesquisados foram detectados em 90% (genes efaA e ace), 45% (gene
agg) e 95% (gene cpd) das amostras de E. faecalis isoladas. Todas as amostras
foram produtoras de biofilme. A tipificação das cepas por meio da técnica de rep-
PCR definiu 8 genótipos, sendo 2 destes relacionados a 10 amostras isoladas de
canais tratados com lesão. O PFGE apresentou um maior poder discriminatório
agrupando as 20 amostras em 14 diferentes genótipos. Uma grande diversidade
de comunidades microbianas foi observada através de DGGE, para ambos os
casos analisados com e sem periodontite apical. No entanto, o número de
bandas em amostras com lesão periapical foi estatisticamente superior (p=0,04)
em comparação com canais tratados sem a lesão perirradicular. Em função dos
resultados descritos concluímos que E. faecalis pode apresentar um papel
relevante em infecções persistentes e/ou secundárias, porém o aspecto
populacional e as interações bacterianas também devem ser considerados no
possível fracasso do tratamento endodôntico.
Palavras-chave: Enterococcus faecalis, infecção endodôntica, fatores de virulência,
perfis genotípicos, tratamento endodôntico, eletroforese em gel com gradiente de
desnaturação
Rio de Janeiro
Fevereiro/2010
ABSTRACT
COMPARISON OF BACTERIAL COMMUNITY STRUCTURES AND GENOTYPIC
AND PHENOTYPIC CHARACTERIZATION OF Enterococcus faecalis ISOLATES
FROM TREATED ROOT CANALS
Gustavo Oliveira Zoletti
Orientadores: Professores Kátia Regina Netto dos Santos e José Freitas Siqueira Jr.
Abstract da Tese de Doutorado submetida ao Programa de Pós-Graduação em Ciências
(Microbiologia), Instituto de Microbiologia Paulo de Góes da Universidade Federal do Rio de
Janeiro, como parte dos requisitos necessários para a obtenção do Título de Doutor em
Ciências (Microbiologia).
The high frequency of Enterococcus faecalis in root canal-treated teeth with post-
treatment disease as evidenced by molecular and traditional culturing methods suggests
that this species can be a key player in endodontic treatment failure. This study aimed to
estimate the frequency of E. faecalis by molecular and conventional culture procedures
and detect virulence factors and related genes. Evaluate the genomic diversity from 20
clinical strains of E. faecalis isolated from treated root canals of teeth with (10 strains) or
without (10 strains) apical periodontitis. Moreover, the community structures found in
root canal-treated teeth with (12 samples) and without (11 samples) apical periodontitis
lesions were compared. PCR 16S rRNA gene was significantly more effective than
culture in detecting this bacterial species (p<0,001). All the 20 strains presented the gelE
gene, but only 10 hydrolysed gelatin. The produce of protein Esp was detected only in
strains where gelatinase production was negative, except for three isolated from root
canals without lesion that were negative for both virulence factors. The other virulence
genes studied were found in 90% (efaA and ace genes), 45% (agg gene) and 95% (cpd
gene) of the E. faecalis isolates. All the strains were biofilm producers. Strain typing by
rep-PCR revealed 8 genotypes, and 2 of them were related to 10 strains isolated from
root canals treated with disease. The PFGE showed larger discriminatory power
including the 20 strains in 14 different genotypes. A great diversity of microbial
communities was observed by DGGE, in both cases analyzed with and without apical
periodontitis. However, the number of bands in samples from periapical lesions was
statistically higher than in samples from root canals-treated without apical periodontitis
(p=0,04). The results described here show that the E. faecalis may have a role relevant
in persistent infections and/or secondary, but the population aspect and bacterial
interactions should also be considered in the possible failure of endodontic treatment.
Key-words: Enterococcus faecalis, endodontic infection, virulence factors, genotype
patterns, endodontic treatment, denaturing gradient gel electrophoresis
Rio de Janeiro
Fevereiro/2010
Índice
Introdução............................................................................................................................
01
I. Microbiologia das doenças pulpares e perirradiculares............................................
01
II. Infecção persistente..................................................................................................
05
III. Comunidade bacteriana na endodontia...................................................................
10
IV. Gênero Enterococcus.............................................................................................
12
1. Fatores de virulência.........................................................................................
14
2. Epidemiologia molecular....................................................................................
19
Objetivo................................................................................................................................
22
Resultados...........................................................................................................................
23
Artigo 1...................................................................................................................
24
Artigo 2...................................................................................................................
29
Artigo 3...................................................................................................................
55
Discussão............................................................................................................................
74
Conclusão...........................................................................................................................
82
Referências Bibliográficas...................................................................................................
83
Anexo 1...............................................................................................................................
99
Anexo 2...............................................................................................................................
100
Anexo 3...............................................................................................................................
101
Anexo 4...............................................................................................................................
102
Anexo 5...............................................................................................................................
103
Anexo 6...............................................................................................................................
104
Anexo 7...............................................................................................................................
105
Anexo 8...............................................................................................................................
106
Anexo 9...............................................................................................................................
107
Introdução
I. Microbiologia das doenças pulpares e perirradiculares.
A endodontia possui como principais objetivos o tratamento e a prevenção
de infecções que acometem o sistema de canais radiculares. As patologias
pulpares e perirradiculares são de natureza inflamatória induzidas por fatores
físicos, químicos e microbianos (SIQUEIRA, RÔÇAS & LOPES, 2004). Contudo,
o envolvimento microbiano vem sendo indicado como o principal fator associado
à etiologia das doenças endodônticas (MILLER, 1894; KAKEHASHI, STANLEY &
FITZGERALD, 1965; SUNDQVIST, 1976; SIQUEIRA & RÔÇAS, 2004).
Miller, em 1894, analisando espécimes de canais radiculares, relatou a
ocorrência das três formas básicas de células bacterianas conhecidas: cocos,
bacilos e espirilos. Tal estudo é considerado o primeiro relato envolvendo a
associação de micro-organismos nas alterações pulpares e perirradiculares. No
entanto, apenas cerca de 70 anos depois foi realmente estabelecido o papel
essencial dos micro-organismos na etiopatogenia das doenças endodônticas. No
estudo realizado por Kakehashi, Stanley e Fitzgerald (1965), foi comparada a
resposta de polpas dentais de ratos germ-free com aquelas de ratos
convencionais após exposição ao meio bucal. Os animais convencionais, após
determinado período de tempo, desenvolveram alterações inflamatórias
irreversíveis ou necrose pulpar associada a lesões perirradiculares. Por sua vez,
nas polpas dentais dos ratos germ-free foi observado reparo tecidual, com
neoformação dentinária na área de exposição ao meio bucal, demonstrando
assim, o papel dos micro-organismos na patogenicidade das doenças pulpares.
Sundqvist, em 1976, investigou as condições bacteriológicas de canais
radiculares de dentes humanos que apresentavam necrose pulpar após trauma
dentário. Esses elementos dentários não apresentavam fratura coronária, cárie
ou restaurações, condições que favorecem uma possível contaminação pulpar
por patógenos orais. Dentre seus achados, destaca-se a prevalência de bactérias
anaeróbias obrigatórias, as quais representaram mais de 90% das amostras
isoladas. Micro-organismos foram encontrados apenas em canais de dentes com
lesão perirradicular associada, o que confirmou o papel essencial desempenhado
por micro-organismos na indução desta patologia. O autor ressaltou ainda a
correlação entre o tamanho da lesão perirradicular e o número de espécies e de
células bacterianas no canal radicular.
Mais recentemente, Siqueira e Rôças (2005a) investigaram, através de
nested-PCR 16S rRNA gene específico, a detecção de filotipos orais não
cultiváveis e de novas espécies em infecções endodônticas primárias e
persistentes. Em ambas infecções foi evidenciada a presença de doença
perirradicular através de imagem radiográfica. Em seus resultados, os autores
observaram a presença de, pelo menos, um filotipo nas infecções primárias e
detectaram três novas espécies nas infecções persistentes. Concluíram que
bactérias não cultiváveis e espécies recentemente nomeadas podem exercer um
papel na patogenicidade da doença perirradicular.
Uma vez determinada a estreita relação entre micro-organismos e as
patologias que acometem a polpa dental e os tecidos perirradiculares foi possível
a classificação das infecções radiculares. Tal classificação considera o momento
de estabelecimento microbiano no canal radicular: infecção primária, infecção
secundária e/ou persistente (SIQUEIRA, RÔÇAS & LOPES, 2004).
As infecções primárias são aquelas a qual o processo patológico
estabelecido intra-radicular não sofreu qualquer intervenção terapêutica. Tais
infecções são mistas e determinados grupos de espécies microbianas estão mais
relacionados a certos tipos de patologia perirradicular.
As infecções secundárias e/ou persistentes são aquelas relacionadas ao
fracasso do tratamento endodôntico. Tais infecções são decorrentes de
patógenos que invadem e colonizam novamente o canal dentário e/ou
sobrevivem e conseguem evadir dos procedimentos realizados durante o
tratamento endodôntico convencional (SIQUEIRA, 2002). Contudo, tais infecções,
classificadas como intra-radiculares, quando disseminadas para os tecidos
perirradiculares dão origem à infecção extra-radicular. Seu estabelecimento pode
resultar no fracasso da terapia endodôntica (SIQUEIRA, RÔÇAS & LOPES,
2004).
A microbiota comumente identificada por cultura ou por métodos
moleculares em cada tipo de infecção endodôntica encontra-se apresentada na
Tabela I.
Tabela I – Micro-organismos mais freqüentemente detectados nos diferentes
tipos de infecções endodônticas (SIQUEIRA, RÔÇAS & LOPES, 2004).
Infecção Primária Infecção secundária e/ou
persistentes
Infecção extra-radicular
Treponema Enterococcus Actinomyces
Tannerella Actinomyces Propionibacterium
Prevotella Streptococcus
Porphyromonas Cândida
Fusobacterium Propionibacterium
Peptostreptococcus Staphylococcus
Streptococcus Pseudomonas
Eubacterium
Actinomyces
Campylobacter
Propionibacterium
Selenomonas
Dialister
Filifactor
Um dos requisitos para que um determinado micro-organismo participe da
patogênese das doenças perirradiculares é estar espacialmente localizado no
sistema de canais radiculares de forma que ele ou seus fatores de virulência
tenham acesso aos tecidos perirradiculares. Tal sistema apresenta fatores
nutricionais, tensão de oxigênio e interações microbianas que favorecem o
crescimento de patógenos endodônticos. Além disso, fatores de virulência do
micro-organismo, como proteinases e componentes da superfície bacteriana
podem ser expressos e ter acesso aos tecidos perirradiculares resultando em
uma resposta inflamatória (SIQUEIRA, 2002).
Recentemente, estudos utilizando métodos moleculares, como o da reação
de polimerase em cadeia ou PCR (Polymerase Chain Reaction), a hibridização
DNA-DNA ou “checkerboard” e a eletroforese em gel com gradiente de
desnaturação ou DGGE (Denaturing Gradient Gel Electrophoresis) permitiram
reavaliar a composição da microbiota endodôntica. Muitas espécies bacterianas
que não eram isoladas anteriormente, através de testes convencionais de
identificação, em infecções endodônticas passaram a ser detectadas com a
utilização destes métodos moleculares. Alguns exemplos são: Tannerella
forsythia (CONRADS et al., 1997; SIQUEIRA, RÔÇAS, SOUTO et al., 2000;
RÔÇAS et al., 2001), Treponema denticola (SIQUEIRA, RÔÇAS, FAVIERI et al.,
2000), Prevotella tannerae (XIA, BAUMGARTNER & DAVID, 2000), Treponema
maltophilum (JUNG et al., 2001) e Olsenella spp. (FOUAD et al., 2002). Além
disso, foi possível observar que a detecção de algumas espécies, já identificadas
através de cultivo convencional em infecções endodônticas, ser mais elevada
quando utilizados métodos moleculares (ROLPH et al., 2001; SIQUEIRA et al.,
2001a; SIQUEIRA et al., 2001b;).
As infecções secundária e/ou persistente são caracterizadas pela
presença de micro-organismos dos gêneros descritos na Tabela I, podendo ainda
apresentar bactérias não-orais, como: Enterobacter spp., Klebsiella spp.,
Acinetobacter spp. e as espécies Pseudomonas aeruginosa e Escherichia coli
(HAAPASALO, RANTA & RANTA, 1983; RANTA, HAAPASALO & RANTA, 1988).
Além desses, fungos também têm sido encontrados nessas infecções
(PECIULIENE et al., 2001; SIQUEIRA & RÔÇAS, 2004).
Apesar de alguns estudos terem sugerido que fatores não microbianos
possam estar envolvidos com esse fracasso (LIN et al., 1991; SIQUEIRA, 2001),
a persistência de uma infecção intra ou extra-radicular parece ser o fato mais
relevante no desenvolvimento ou na perpetuação de uma patologia perirradicular
pós-tratamento (SIQUEIRA, 2001; NOIRI et al., 2002).
Os métodos convencionais de identificação microbiana, bem como os
métodos moleculares, têm revelado que a microbiota relacionada às infecções
intra-radiculares secundária e/ou persistente associadas a canais dentários
tratados é significativamente diferente daquela relacionada às infecções primárias
(MOLANDER et al., 1998; SUNDQVIST et al., 1998; HANCOCK et al., 2001;
FOUAD et al., 2002). Enquanto que as infecções primárias são compostas
preferencialmente por bactérias anaeróbias obrigatórias, principalmente
representadas por bacilos Gram-negativos (SUNDQVIST, 1992; GOMES et al.,
2004), as infecções secundária e/ou persistente são compostas por um número
menor de espécies microbianas, havendo equivalência entre a prevalência de
micro-organismos anaeróbios obrigatórios e facultativos (MOLANDER et al.,
1998; HANCOCK et al., 2001; ADIB et al., 2004). Os micro-organismos mais
associados ao fracasso da terapêutica endodôntica pertencem aos gêneros
Actinomyces e Enterococcus (MOLANDER et al., 1998; SUNDQVIST et al., 1998;
HANCOCK et al., 2001). No entanto, após a utilização dos métodos moleculares,
novas espécies passaram a serem identificadas em canais dentários tratados,
tais como bactérias do gênero Streptococcus e algumas espécies bacterianas
anaeróbias fastidiosas, como: Pseudoramibacter alactolyticus,
Propionibacterium propionicum, Fusobacterium alocis, Dialister
pneumosintes e Dialister invisus (SIQUEIRA & RÔÇAS, 2009b).
Dentre as espécies do gênero Enterococcus, aquela mais freqüentemente
associada ao fracasso da terapia endodôntica é Enterococcus faecalis
(MOLANDER et al., 1998; SUNDQVIST et al., 1998).
II. Infecção Persistente
As infecções persistentes e/ou secundárias, caracterizadas pela
permanência ou aparecimento de periodontite apical pós-tratamento endodôntico,
são o principal aspecto associado à falha do tratamento endodôntico (SIQUEIRA
& RÔÇAS, 2008).
Diferentemente das características de uma infecção endodôntica primária,
em casos de infecção endodôntica persistente ocorre um predomínio de micro-
organismos Gram-positivos anaeróbios facultativos (HANCOCK et al., 2001; ADIB
et al., 2004; GOMES et al., 2004), além do isolamento de um menor número de
espécies (PINHEIRO et al., 2003, SIQUEIRA & RÔÇAS, 2004). Canais dentários
que apresentam tratamento endodôntico satisfatório aparente podem conter de 1
a 5 espécies bacterianas, enquanto que em tratamentos considerados
insuficientes este número pode chegar a 30. Este número é próximo ao
observado em canais dentários de infecções primárias (SUNDQVIST et al.,
1998; PINHEIRO et al., 2003; ROÇAS et al., 2004a; SIQUEIRA & RÖÇAS,
2004). Tal diferença é observada também em relação à densidade
bacteriana. Em canais tratados foi descrita uma densidade entre 10
3
a 10
7
células bacterianas (PECIULIENE et al., 2001; SEDGLEY et al., 2006),
enquanto que em infecções primárias esse número é de 10
3
a 10
8
(SAKAMOTO et al., 2007; SIQUEIRA et al., 2007). Com relação a E.
faecalis, este tem sido detectado mais frequentemente em infecções
persistentes e/ou secundárias, onde pode ser identificado em até 90% das
vezes quando utilizados métodos moleculares, do que em infecções
primárias (RÖÇAS, SIQUEIRA & SANTOS, 2004; SEDGLEY et al., 2006;
ZOLETTI, SIQUEIRA & SANTOS, 2006).
Visto que um menor número de espécies microbianas pode ser encontrada
em infecções persistentes, ressalta-se a capacidade de algumas espécies em
resistir aos procedimentos de descontaminação do sistema de canais radiculares,
bem como às condições pós-tratamento, caracterizadas por um longo período de
escassez nutricional (SIQUEIRA et al., 1997; FIGDOR, DAVIES & SUNDQVIST
2003; RADCLIFFE et al., 2004).
Love, em 2001, estudou o mecanismo pelo qual E. faecalis consegue
sobreviver nos túbulos dentinários confinados pela obturação do canal. O estudo
demonstrou que o micro-organismo possui uma capacidade de manter o
potencial de invasão nos túbulos dentinários mesmo com a diminuição dos
nutrientes, sugerindo que o fluido tecidual proveniente das estruturas do
periodonto possa fornecer nutrição suficiente para sua sobrevivência.
Micro-organismos da espécie E. faecalis conseguem sobreviver ao
tratamento químico-mecânico realizado, uma vez que, possuem capacidade de
resistir a pH alcalino pelo funcionamento de uma bomba de prótons que regula o
pH citoplasmático (DISTEL et al., 2002; EVANS et al., 2002). Em função desta
capacidade, E. faecalis pode resistir ao tratamento com medicamentos
intracanais, como o hidróxido de cálcio (DAHLÉN et al., 2000; ABDULLAB et al.,
2004).
Ë possível que a capacidade de E. faecalis persistir em dentes submetidos
a tratamento endodôntico, seja uma conseqüência da influência da produção de
alguns fatores de virulência. Hubble e colaboradores, em 2003, detectaram genes
que codificam fatores de virulência associados à adesão dentinária (Ace -
proteína de ligação ao colágeno, gelatinase e protease serina). Através da
análise de mutantes deficientes na produção de gelatinase, proteína serina e
Ace, os autores relataram que a colagenase e a protease serina realizam um
papel significante na ligação da célula bacteriana à dentina radicular. Contudo,
não foi possível descrever claramente um papel para a gelatinase.
Ainda com relação aos fatores de virulência, Sedgley, Lennan e Clewel
(2004) investigaram características fenotípicas e genotípicas de amostras de
Enterococcus isoladas da saliva de 100 pacientes que apresentavam tratamento
endodôntico, e de 100 estudantes de odontologia que não possuíam dentes
tratados endodonticamente. Onze amostras de E. faecalis foram isoladas no
primeiro grupo, das quais quatro produziam hemolisina, três gelatinase e cinco
bacteriocina, enquanto no grupo de estudantes, apenas uma amostra bacteriana
foi produtora de gelatinase e bacteriocina. O estudo apresentou como dado
significativo a presença oral de E. faecalis em pacientes com canais dentários
tratados.
Diante da possibilidade de fatores microbianos influenciarem no
prognóstico do tratamento endodôntico e no desenvolvimento da lesão
perirradicular, diversas análises da microbiota endodôntica, incluindo a presença
do E. faecalis em canais dentários, foram realizadas. Molander e colaboradores
(1998) examinaram a microbiota existente em 100 canais obturados com lesão
perirradicular, através de métodos convencionais de identificação. Em 68% dos
espécimes foram isolados micro-organismos, 47% dos quais eram E. faecalis.
Esse patógeno foi isolado em um dente sem a presença de lesão perirradicular,
entretanto, não era a espécie dominante.
Peciuliene e colaboradores (2001) também investigaram a ocorrência de
micro-organismos em canais previamente tratados com presença de lesão
perirradicular através de testes convencionais de identificação e observaram a
presença de E. faecalis em 21 (64%) dos 33 espécimes clínicos positivos em
cultura. Os autores comentaram o fato do tamanho da lesão perirradicular não
refletir a quantidade e a espécie microbiana envolvida na infecção, uma vez que
a virulência microbiana pode influenciar na agressividade do patógeno em
infecções endodônticas.
Ainda em 2001, Hancock e colaboradores investigaram a microbiota de
infecções endodônticas associadas ao fracasso do tratamento endodôntico
através de métodos convencionais de identificação e observaram a prevalência
de E. faecalis em 30% dos dentes com cultura positiva (33 dentes) dos 54 dentes
examinados. Em 2003, Pinheiro e colaboradores detectaram as espécies mais
comumente isoladas de canais tratados e que apresentavam lesão perirradicular
associada. Foram analisados 30 canais, dos quais 24 apresentaram cultura
positiva, sendo em 46% detectada a presença de E. faecalis. Observaram
também um predomínio de bactérias Gram-positivas anaeróbias facultativas.
Na última década, a partir da utilização de métodos moleculares para
identificação e detecção microbiana, foi possível observar uma maior incidência
de E. faecalis nos casos de infecções primária e persistente (RÔÇAS, SIQUEIRA
& SANTOS, 2004; SASSONE et al., 2007). Além disso, tais métodos permitiram
estreitar a associação entre o fracasso do tratamento endodôntico e a presença
de micro-organismos, uma vez que estes foram detectados em todos os casos
examinados (SIQUEIRA & RÔÇAS, 2004).
Siqueira e Rôças (2004) investigaram através de PCR a ocorrência de
várias espécies microbianas em casos refratários ao tratamento endodôntico e
observaram a presença de E. faecalis em 77% (17/22) dos casos, além da
presença de pelo menos um micro-organismo em todos os casos.
Ainda em 2004, Rôças, Siqueira e Santos analisando a associação de E.
faecalis com as diferentes formas de doenças perirradiculares através de PCR
16S rRNA gene específico, encontraram esta espécie em 67% (20/30) dos casos
refratários. Relataram também a associação deste micro-organismo com casos
assintomáticos, tanto em infecções persistentes, como em infecções primárias.
Willian e colaboradores (2006) pesquisaram a sensibilidade de três
metodologias distintas na identificação de E. faecalis em infecções primárias e
refratárias. Além de verificar uma significativa eficácia na identificação deste
micro-organismo pelo método molecular em relação à cultura, os autores
caracterizaram o estado viável, mas não cultivável (VBNC) em E. faecalis
presentes em canais radiculares. Esta capacidade de permanecer em estado
VBNC, descrita inicialmente em bactérias Gram-negativas (JIANS & CHAI, 1996),
é uma estratégia adotada pela bactéria quando exposta a um ambiente sob
condições desfavoráveis de crescimento e divisão celular (LLEÒ, TAFI &
CANEPARI, 1998).
A Tabela II apresenta a prevalência de E. faecalis nos casos de infecção
persistente em diferentes estudos realizados.
Tabela II – Prevalência de E. faecalis em casos de fracasso da terapia
endodôntica (SIQUEIRA, RÔÇAS & LOPES, 2004).
Estudo Método de
Identificação
No. de espécimes /
presença microbiana
% (n) de E. faecalis
Engström, 1964 Cultura 54 / 21 24% (5)
Möller, 1966 Cultura 54 / 31 29% (9)
Sundqvist et al., 1998 Cultura 54 / 24 38% (9)
Molander et al., 1998 Cultura 100 / 68 47% (32)
Hancock et al., 2001 Cultura 54 / 33 30% (10)
Peciuliene et al., 2001 Cultura 40 / 33 64% (21)
Pinheiro et al., 2003 Cultura 30 / 24 46% (11)
Siqueira & Rôças, 2004 PCR* 22 / 22 77% (17)
Rôças et al., 2004 PCR* 30 / 30 67% (20)
Kaufman et al., 2005 PCR* 58 / 52 12% (7)
Williams et al., 2006 Cultura 14 / 14 14% (2)
Williams et al., 2006 PCR** 14 / 14 43% (6)
Zoletti et al., 2006 Cultura 50 / 50 16% (8)
Zoletti et al., 2006 PCR 50 / 50 80% (40)
Blome et al., 2008 PCR** 20 / 20 10% (2)
*16S rRNA gene específico; **PCR em tempo real
III. Comunidade bacteriana na endodontia
A influência da persistência bacteriana em canais radiculares no resultado
do tratamento endodôntico é o aspecto determinante de seu fracasso, já que as
bactérias desempenham um papel crucial na perpetuação ou surgimento de
lesões perirradiculares em canais tratados (MOLANDER et al., 1998;
SUNDQVIST et al., 1998). Os procedimentos terapêuticos do tratamento
endodôntico que incluem o acesso, a instrumentação do canal, irrigação,
medicação intra-canal e obturação são realizados na tentativa de erradicar a
infecção do sistema de canais radiculares e eliminar o espaço passível de
reinfecção (SAKAMOTO et al., 2007; SIQUEIRA et al., 2007).
Porém, nem sempre esses procedimentos são eficazes na completa
eliminação desta infecção, pois as bactérias persistentes ao tratamento
endodôntico tradicional possuem a capacidade de sobreviver em canais tratados,
induzindo ou mantendo a inflamação dos tecidos perirradiculares (DISTEL et al.,
2002; ABDULLAH et al., 2004) . Desta maneira, o que se pode alcançar com tais
procedimentos é uma redução da população bacteriana dentro dos canais
dentários a um nível inferior ao necessário para a perpetuação da doença. Tal
fato se confirma uma vez que algumas lesões perirradiculares podem ser
curadas, mesmo quando bactérias são encontradas dentro do canal no momento
da obturação (SUNDQVIST et al., 1998; FABRICIUS et al., 2006).
Ainda que a persistência bacteriana desempenhe um papel determinante
no resultado do tratamento, não se pode afirmar que há uma espécie única
descrita como a responsável para o fracasso do tratamento, mesmo com os
diversos relatos envolvendo E. faecalis (RÔÇAS, SIQUEIRA & SANTOS, 2004;
ZOLETTI, et al., 2006). Sugere-se que o prognóstico do sucesso ou fracasso do
tratamento endodôntico esteja relacionado com um conjunto de fatores que
envolvem o número de espécies remanescentes no canal dentário, a virulência
bacteriana e os aspectos populacionais. Diante desse panorama, o desafio é
conseguir definir quais são os níveis e as populações bacterianas relacionadas
ao sucesso ou fracasso do tratamento (SIQUEIRA & RÔÇAS, 2008).
Rôças, Siqueira, Aboim e colaboradores (2004) pesquisaram a estrutura
da comunidade bacteriana de canais dentários tratados com lesão perirradicular
através da técnica de DGGE. Os resultados obtidos revelaram que a comunidade
bacteriana intrarradicular varia de dente para dente e confirmaram ainda que
infecções persistentes estão freqüentemente associadas ao fracasso
endodôntico. Os autores descreveram, também, que E. faecalis apesar de
identificado em 10 dos 14 casos através de PCR do 16S rRNA gene específico,
não foi a espécie dominante quando avaliados por DGGE.
A técnica de DGGE foi introduzida recentemente nos estudos de ecologia
molecular microbiana e permite analisar produtos de PCR do 16S rRNA gene
bacteriano de acordo com suas seqüências de pares de bases, independente do
tamanho dos produtos (MUYZER, DE WAAL & UITTERLINDEN, 1993). Isto
possibilita não só a avaliação da diversidade genética das comunidades
microbianas naturais, como também, através de seqüenciamento, a identificação
filogenética dos membros da comunidade (MUYZER, DE WAAL &
UITTERLINDEN, 1993; RÔÇAS, SIQUEIRA, ABOIM et al., 2004). Recentemente,
a técnica de DGGE passou a ser utilizada para a avaliação da comunidade
microbiana oral (LI et al., 2005; LI et al., 2006) e microbiota endodôntica (RÔÇAS,
SIQUEIRA, ABOIM et al., 2004). Rôças (2004) demonstrou que esta técnica pode
ser de grande valor para a análise da microbiota endodôntica, permitindo a
visualização da diversidade bacteriana em múltiplos espécimes clínicos e a
detecção de espécies fastidiosas ou não-cultiváveis.
IV. Gênero Enterococcus
Os enterococos são cocos Gram-positivos, catalase-negativos, cujas
células podem distribuir-se em arranjos simples, aos pares ou em pequenas
cadeias. São anaeróbios facultativos e possuem um ótimo crescimento a uma
temperatura de 35ºC (crescimento pode variar de 10ºC a 45ºC). Tais espécies
possuem ainda a capacidade de sobreviver ao aquecimento a 60ºC por 30
minutos (HARTKE et al., 1998). São micro-organismos fastidiosos, com
necessidades nutricionais variáveis e o crescimento requer meios complexos,
contendo soro ou sangue. Todas as espécies do gênero crescem em caldo
contendo 6,5% de NaCl, em pH abaixo de 9,6, além de hidrolisarem a esculina na
presença de 40% de sais biliares (FACKLAM & TEIXEIRA, 1998).
Os enterococos se apresentam como células de formato esférico, oval ou
cocobacilar, as quais podem se arranjar em pares ou em pequenas cadeias.
Colônias em ágar sangue possuem em média 1 a 2 mm de diâmetro, podendo
ser menores (PORTENIER et al., 2003). Aproximadamente, um terço das culturas
de E. faecalis pode ser -hemolítica em ágar contendo sangue de coelho, cavalo
ou humano, porém não-hemolítica em ágar sangue de carneiro (FACKLAM &
TEIXEIRA, 1998).
Os enterococos são micro-organismos comensais que habitam os tratos
gastrintestinal e vaginal, além da cavidade oral (JETT, HUYCKE & GILMORE,
1994). Dentre as espécies, E. faecalis é a mais comum, representando de 80 a
90% das amostras de enterococos isoladas de humanos (TEIXEIRA &
FACKLAM, 2007). Sua importância clínica está associada ao fato de ser um
patógeno oportunista, principalmente em pacientes com doenças que
comprometem o estado geral intensamente, imunocomprometidos e que tenham
permanecido hospitalizados por um longo período (ELSNER et al., 2000). Os
enterococcus são freqüentemente isolados de infecções intra-abdominais,
pélvicas e infecções de tecidos moles (PORTENIER et al., 2003) e responsáveis
por 5 a 15% das infecções do trato urinário e 8 a 15% dos casos de endocardites
(SHANKAR et al., 2001; NAKAYAMA, KARIYAMA & KUMON, 2002;
BALDASSARRI et al., 2004). E. faecalis está presente ainda na cavidade oral,
bem como em infecções endodônticas primárias e infecções que acometem as
estruturas periodontais (COLOMBO et al., 1998; RÔÇAS, SIQUEIRA & SANTOS,
2004; SEDGLEY, GWENDLYN & APPELBE, 2006). Como relatado
anteriormente, os enterococcus predominam dentre as espécies isoladas de
tratamentos endodônticos que fracassaram (SIQUEIRA & RÔÇAS, 2004).
Os enterococos foram fisiologicamente separados em cinco grupos, de
acordo com suas características fenotípicas de utilização do manitol, da sorbose
e quanto à hidrólise da arginina. Os grupos e suas respectivas espécies estão
listados na Tabela III (TEIXEIRA & FACKLAM, 2007). Esta divisão classifica o E.
faecalis no Grupo II, o qual possui ainda: E. faecium, E. casseliflavus, E. mundii,
E. sallinarum, E. haemoperoxidus, E. sanguinicola e Lactococcus sp. As oito
espécies apresentam como características fenotípicas comuns a formação de
ácido em caldo manitol e a hidrólise da arginina, porém não formam ácido em
caldo sorbose e possuem ainda variações quanto à utilização do sorbitol
(TEIXEIRA & FACKLAM, 2007).
Tabela III – Espécies de enterococos agrupados de acordo com características
fenotípicas comuns (TEIXEIRA & FACKLAM, 2007).
Grupo I Grupo II Grupo III Grupo IV Grupo V
E. avium E. faecalis E. durans E. sulfureus E. columbae
E. gilvus E. gallinarum E. ratti E. asini E. canis
E. pallens E. mundtii E. villorum E. cecorum E. moraviensis
E. malodoratus E. haemoperoxidus E. hirae E. phoeniculicola E. hermanniensis
E. raffinosus E. faecium E. díspar E. caccae E. italicus
E. pseudoavium E. casseliflavus
Vagococcus fluvialis
E. saccharolyticus E. sanguinicola
E. hawaiiensis
Lactococcus sp.
A prevalência da espécie E. faecalis em infecções endodônticas primárias
(SUNDQVIST, JOHANSSON & SJÖGREN, 1989) e em infecções persistentes do
sistema de canais dentários tem sido avaliada através da utilização do método de
cultura (MOLANDER et al., 1998, SUNDQVIST et al., 1998). Estudos moleculares
envolvendo detecção de enterococos a partir de infecções endodônticas têm
utilizado a PCR para a amplificação do gene tuf, responsável pela codificação do
fator de alongamento Tuf (FOUAD et al., 2002), além da amplificação da região
intergênica do 16S/23S do rRNA (MOLANDER et al., 2002). Outros métodos
utilizados são o método de checkerboard para hibridização DNA-DNA, utilizando
sondas genômicas totais (SIQUEIRA et al., 2001a), a amplificação do 16S rRNA
(SIQUEIRA & RÔÇAS, 2004); o PCR em tempo real (SEDGLEY, NAGEL et al.,
2005) e PCR com transcriptase reversa (WILLIAN et al., 2006).
1 Fatores de virulência
As espécies do gênero Enterococcus não são intrinsicamente tão
virulentos quanto outras espécies Gram-positivas, tais como Staphylococcus
aureus, Streptococcus pneumoniae ou Streptococcus pyogenes (KOCH et al.,
2004). Apesar da não comprovação de uma possível participação dos fatores de
virulência de enterococos em humanos, diversos destes fatores foram descritos
(JETT, HUYCKE & GILMORE, 1994; MUNDY et al., 2000; EATON & GASSON,
2001; PORTENIER, WALTIMO & HAAPASALO, 2003). Os fatores caracterizados
em E. faecalis incluem: citolisina e as enzimas proteolíticas gelatinase e protease
serina, adesinas enterocócicas (substância de agregação, proteína de superfície
enterocócica Esp, proteína de adesão ao colágeno Ace, antígeno A EfaA) e
polissacarídeos capsulares e da parede celular (JETT, HUYCKE & GILMORE,
1994; MORRISON, WOODFORD & COOKSON, 1997).
A citolisina enterocócica é uma toxina bacteriana expressa por algumas
cepas de E. faecalis, codificada por um operon formado por oito genes localizado
num plasmídeo (JETT, HUYCKE & GILMORE, 1994) ou no cromossomo (IKE &
CLEWELL, 1992), que responde a feromônio. Os genes cylM, cylB e cylA estão
envolvidos na síntese de citolisina (GILMORE et al., 1994). Essa toxina mostra
atividade citolítica contra eritrócitos humanos, de cavalo e de coelho e atividade
bacteriocida contra outros micro-organismos Gram-positivos, e parece
desenvolver um importante papel em infecções humanas (COQUE et al., 1995).
Foi demonstrado que a produção de citolisina é regulada por um mecanismo
“quorum-sensing”, envolvendo um sistema regulatório de dois componentes
(HAAS, SHEPARD & GILMORE, 2002), sendo que a presença da célula-alvo é
responsável pela ativação desse sistema (COLURN et al., 2004).
Além da citolisina, E. faecalis secreta também gelatinase, uma
metaloprotease fortemente hidrofóbica que pode clivar gelatina, insulina, caseína,
colágeno, fibrina e hemoglobina e outros peptídeos bioativos (MÄKINEN,
CLEWELL & MÄKINEN, 1989; WATERS et al., 2003). Com a sua purificação em
1989 (MÄKINEN, CLEWELL & MÄKINEN, 1989) e posterior determinação de sua
seqüência de nucleotídeos (SU et al., 1991), inúmeros estudos foram descritos
na tentativa de associar suas propriedades proteolíticas com a elevada incidência
dos enterococos nas endocardites (BALDASSARRI et al., 2004), bacteremias
(VERGIS et al., 2002), infecções urinárias (NAKAYAMA, KARIYAMA & KUMON,
2002) e infecções orais (HUBBLE et al., 2003). Apesar de contribuir para a
virulência do E. faecalis em modelo animal (DUPONT et al., 1998) e apresentar
participação na formação de biofilme (HANCOCK & PEREGO 2004; KRISTICH,
CVITKOVITCH & DUNNY, 2004), não foi possível comprovar ainda a ação da
gelatinase em infecções humanas. A gelatinase é co-transcrita juntamente com a
serina protease (SprE), pela ativação do gene gelE, e regulada pelo locus fsr.
Diversos fatores de adesão de Enterococcus têm sido relacionados com
a ligação do micro-organismo à mucosa e outras superfícies epiteliais, facilitando
a colonização e a formação de vegetações (KOCH et al., 2004). Nesse sentido, a
substância de agregação (AS) é um fator de virulência que parece mediar a
ligação específica ao epitélio intestinal, células epiteliais renais, neutrófilos e
macrófagos (SUSSMUTH et al., 2000). A AS é uma glicoproteína ligada à
superfície, codificada por um plasmídeo que responde a feromônio e que medeia
a agregação entre bactérias e facilita a transferência de plasmídeos (DUNNY,
LEONARD & HEDBERG 1995). Essa substância aumenta a internalização dos
Enterococcus e a sobrevida intracelular, e parece ser mais comum em amostras
de origem clínica do que em amostras da microbiota (CHOW et al., 1993).
Outra proteína de superfície descrita em E. faecalis é a adesina de
colágeno de (Ace), produto do gene ace. Identificada por Rich e colaboradores
(1999) é responsável pela ligação do patógeno com certos tipos de colágeno e
parece ter papel na patogênese da endocardite (KOCH et al., 2004). De forma
similar, o antígeno A de E. faecalis (EfaA) é uma proteína de superfície codificada
pelo gene efa, também associado à endocardite, além de apresentar um papel
biológico potencial em modelos animais de peritonite (SINGH et al., 1998). Por
sua vez, a proteína de superfície (Esp) de Enterococcus, codificada pelo gene
esp, é uma proteína associada à parede celular e parece contribuir para a
colonização e persistência de algumas cepas de E. faecalis durante infecções
(SHANKAR et al., 2001; KOCH et al., 2004). Possivelmente, apresenta um papel
determinante na interação primária dos Enterococcus spp. a superfícies e na
formação do biofilme através da interação entre as células bacterianas
(SHANKAR et al., 1999; MUNDY, SAHM & GILMORE, 2000; TENDOLKAR et al.,
2004). Estruturas que também passaram a ser consideradas fatores de virulência
são os feromônios sexuais encontrados em E. faecalis (cpd, cob, ccf, cad). Estes
feromônios são quimiotáticos para leucócitos polimorfonucleares in vitro e são
capazes de induzir a produção de superóxidos e secretar enzimas lisossomiais,
desencadeando uma resposta inflamatória (EATON & GASSON, 2001).
Coque e colaboradores (1995) investigaram o papel dos fatores de
virulência gelatinase, hemolisina e substância de agregação em amostras clínicas
de E. faecalis. As amostras foram obtidas de pacientes com endocardite e outros
tipos de infecção, de pacientes hospitalizados sem infecção e de voluntários
saudáveis da comunidade. A produção de gelatinase foi significativa em amostras
isoladas de casos clínicos quando comparada às amostras isoladas de
voluntários saudáveis. Contudo, tal fato não permitiu determinar sua participação
na doença, uma vez que sua expressão esteve ausente em 46% dos casos de
endocardite e presente em 62% das amostras hospitalares obtidas de indivíduos
sem infecção.
Vergis e colaboradores (2002) analisaram a associação entre a presença
de fatores de virulência produzidos por enterococos, como gelatinase, hemolisina
e proteína de superfície (Esp) e a mortalidade em pacientes com bacteriemia
enterocócica. Foram pesquisados 398 pacientes, sendo que em 219 amostras de
enterococos isoladas houve a produção da gelatinase e hemolisina em 64% e
11%, respectivamente. Em 32% foi observada a presença do gene esp. Contudo,
tais percentagens não apresentaram valores significativos quando avaliadas
como uma possível influência dos fatores de virulência na mortalidade do
paciente.
Da mesma forma, Roberts e colaboradores (2004) observaram em 215
amostras fecais coletadas de pacientes com endocardites e voluntários
saudáveis, que a produção de gelatinase era similar entre os enterococos
isolados dos diferentes grupos. Relataram também uma discrepância entre a
produção de gelatinase (60%) e a presença do gene gelE (92%). Tal discrepância
entre a presença do gene gelE e a expressão do fator de virulência pode ser
justificada pelo fato da transcrição do gene ser regulada pelo locus fsr (QIN et al.,
2000). O locus fsr composto pelos genes fsrA, fsrB e fsrC possui similaridade
com o locus agr/hld presente em S. aureus responsável pela regulação da
expressão de fatores de virulência através de sistema quorum-sensing (QIN et
al., 2000).
Nakayama, Kariyama e Kumon (2002) definiram a relação entre fenótipo e
genótipo na produção de gelatinase em amostras de E. faecalis isoladas de urina
através da regulação pelo locus fsr. Os autores descreveram uma deleção
cromossômica de 23,9 quilobases na região do locus fsr entre amostras que não
expressavam a gelatinase, apesar de apresentarem o gene gelE. Verificaram
ainda que um feromônio está associado com a ativação da biossíntese da
gelatinase pelo gene gelE. Esse peptídeo está relacionado a um sistema quorum-
sensing em E. faecalis dependente da densidade celular para expressão do locus
fsr e, conseqüentemente, o gene gelE (NAKAYAMA, CAO, HORII, SAKUDA &
NAGASAWA, 2001; NAKAYAMA, CAO, HORII, SAKUDA, AKKERMANS et al.,
2001; CARNIOL & GILMORE, 2004). Em função da importância do locus fsr na
expressão de fatores de virulência, sua identificação vem sendo considerada
importante na avaliação da patogenicidade do micro-organismo (QIN et al., 2000;
PILLAI et al., 2002; SIFRI et al., 2002; ENGELBERT et al., 2004).
Sedgley, Molander e colaboradores (2005) investigaram o fenótipo, o
genótipo e a virulência de 33 cepas de enterococos obtidas de canais dentários.
Entre as amostras, 31 eram de E. faecalis, das quais 23 (74%) produziam
gelatinase, 18 (58%) apresentavam o gene esp e em 4 (12%) foi detectado o
gene cylA, responsável pela ativação da citolisina. Todas as cepas apresentavam
o gene gelE que codifica a gelatinase e os genes asa, ace e efaA que codificam
fatores de virulência associados à adesão bacteriana. Para justificar a diferença
entre a detecção do gene gelE e a produção da gelatinase, os autores analisaram
as oito amostras que não expressavam gelatinase e verificaram que seis
apresentavam uma deleção cromossômica no locus fsr.
Archimbaud e colaboradores (2002) investigaram a presença dos fatores
de virulência Esp, AS, citolisina e gelatinase em amostras de enterococos
isoladas de pacientes com endocardites, bacteriemias e voluntários saudáveis.
Analisaram também a capacidade dessas amostras aderirem a células humanas
in vitro. A produção de gelatinase foi demonstrada em 100% das amostras
coletadas de sangue (pacientes com bacteremia), em 55% dos voluntários e em
apenas 20% dos pacientes com endocardite. O gene asa1 que codifica o fator de
virulência AS foi detectado em 48% das amostras, das quais 50% eram de
sangue e 40% de pacientes com endocardites. Relataram que todas as amostras
produtoras de citolisinas (17%) produziam também a gelatinase. Quanto à
presença do gene esp, este foi detectado em todas as amostras de sangue e de
endocardite avaliadas. Contudo, não foi observada correlação da presença deste
gene, bem como dos demais fatores de virulência, com a aderência bacteriana
em células humanas in vitro.
2 Epidemiologia molecular
O uso de técnicas moleculares tem contribuído de forma significativa na
definição da distribuição clonal de Enterococcus, tornando possível a
demonstração da transmissão destes micro-organismos por contato direto e
indireto entre pacientes.
Os métodos de tipagem molecular, dependendo da metodologia
empregada, apresentam diferentes graus de reprodutibilidade e de poder de
discriminação. Vários desses métodos foram utilizados para a discriminação de
amostras de Enterococcus, incluindo a análise do polimorfismo eletroforético de
isoenzimas (MLEE Multilocus Enzyme Electrophoresis) (TOMAYKO & MURRAY,
1995); análise de padrões plasmidiais (ZERVOS et al., 1987); análise do DNA
cromossômico após clivagem com endonucleases de elevada freqüência de corte
com posterior análise através de eletroforese convencional (REA restriction
endonuclease analysis) (HALL et al., 1992); análise dos perfis de fragmentação
do DNA cromossômico através das diferentes variantes da técnica de
eletroforese em campo pulsado (PFGE Pulsed Field Gel Electrophoresis)
(MURRAY, 1990); técnicas de amplificação do DNA baseados na metodologia da
reação da polimerase em cadeia (PCR Polymerase Chain Reaction) com as suas
diferentes variantes como a análise do polimorfismo de segmentos de DNA
amplificados de forma aleatória (AP-PCR Arbitrary primed PCR) (VAN BELKUM
et al., 1995) e a análise do polimorfismo das seqüências repetitivas palindrômicas
extragênicas (rep-PCR Repetitive Extragenic Palindromic-PCR) (MALATHUM et
al., 1998). Mais recentemente, somaram-se a essas, as técnicas de tipagem por
seqüenciamento de multi-locus enzimáticos (MLST Multilocus Sequence Typing)
(NALLAPAREDDY et al., 2002)
e análise da variação de múltiplos loci de
sequências repetidas (MLVA Multiple-locus Variable-number Tandem Repeat
Analysis) (TOP et al., 2004).
Quando comparada com outros métodos moleculares, a análise do DNA
cromossômico através de PFGE mostrou-se com elevado poder discriminatório
para correlacionar amostras, sendo recomendada para estudos epidemiológicos
envolvendo amostras enterocócicas (GORDILLO et al., 1993; MALATHUM et al.,
1998).
O desenvolvimento de sistemas de tipagem genética contribuiu de forma
marcante para o rastreamento e compreensão da disseminação de amostras de
Enterococcus. Tais sistemas são baseados na observação de que amostras de
uma mesma espécie podem apresentar ampla variabilidade no DNA decorrente
de eventos genéticos, tais como mutações pontuais, inserções, deleções e
recombinações (TENOVER et al., 1995; STRUELENS et al., 1996). Em
contrapartida, os sistemas de tipagem fenotípica, tais como biotipagem,
sorotipagem e fagotipagem são de valor limitado para o estudo de Enterococcus,
devido ao baixo poder discriminatório, uma vez que não detectam diferenças
significativas entre amostras da mesma espécie (MURRAY, 1990).
O método de PFGE vem sendo empregado na tipagem de E. faecalis
isolados de canais dentários (PINHEIRO, GOMES & DRUCKER, 2006). Contudo,
estudos utilizando rep-PCR, obtiveram excelentes resultados na caracterização
de amostras de Enterococcus de uma mesma espécie e entre espécies diferentes
(NAMDARI & DELVECCHIO, 1998). Tais resultados e o menor tempo para a
obtenção dos dados, quando comparado ao PFGE (MALATHUM et al., 1998),
têm indicado a amplificação de padrões de seqüências repetidas como um
método adequado para a análise do polimorfismo entre amostras de
Enterococcus.
Uma vez que já foi descrita a elevada detecção do E. faecalis em casos de
fracasso do tratamento endodôntico, mesmo em casos sem lesão perirradicular,
torna-se relevante caracterizar aspectos de virulência e clonalidade relacionados
a amostras desta espécie isoladas de canais dentários tratados. Tal
caracterização bacteriana busca detectar aspectos que justifiquem a
permanência e agressividade deste micro-organimo na patologia perirradicular,
assim como conhecer a composição microbiana dentro de canais dentários
tratados com e sem a presença de lesão perirradicular.
Objetivo
I. Analisar a comunidade bacteriana associada a canais dentários com e sem
lesão perirradicular e caracterizar amostras clínicas (n=20) de Enterococcus
faecalis isoladas de canais dentários tratados com e sem lesão perirradicular e a
comunidade bacteriana associada.
II. Estratégias
1- Comparar a eficácia da técnica de PCR do 16S rRNA gene espécífico com
a de cultura na detecção e identificação de E. faecalis em dentes com canais
dentários tratados;
2- Determinar por meio de testes fenotípicos e Western-blotting a produção de
fatores de virulência, e detectar a presença de genes relacionados por meio de
PCR com iniciadores específicos para cada um dos fatores de virulência;
3- Utilizar a análise dos perfis de fragmentação do DNA cromossômico após
eletroforese em campo pulsado e do polimorfismo a partir da amplificação de
padrões de seqüências repetidas (rep-PCR, repetitive extragenic palindromic
PCR) para determinar a diversidade genômica das amostras isoladas;
4- Utilizar a metodologia de eletroforese em gel com gradiente de
desnaturação (DGGE Denaturing Gradient Gel Electrophoresis) para descrever a
comunidade presente em canais dentários tratados com e sem lesão
perirradicular.
Resultados
A análise dos dados obtidos permitiu a redação dos seguintes
manuscritos:
1) ZOLETTI, G.O.; SIQUEIRA, J. F. & SANTOS, K.R.N. 2006. Identification of
Enterococcus faecalis in root-filled teeth with or without periradicular lesions by
culture dependent and—independent approaches. J Endod 32: 722-726 (artigo
publicado durante o Mestrado);
2) ZOLETTI, G.O.; PEREIRA, E.M.; SCHUENCK, R.P.; TEIXEIRA, L.M.;
SIQUEIRA Jr., J.F.; dos SANTOS, K.R.N. Characterization of virulence factors
and molecular diversity of Enterococcus faecalis isolates from persistent
endodontic infections. J Clin Microbiol (Submetido).
3) ZOLETTI, G.O.; CARMO, F.L; PEREIRA, E.M.; ROSADO, A.S.; SIQUEIRA Jr,
J.F.; dos SANTOS, K.R.N. Comparison of endodontic bacterial community
structures in root canal-treated teeth with or without apical periodontitis. J Med
Microbiol (Submetido);
22 jan 2010
Prof Gustavo O. Zoletti
Laboratory of Hospital Infections
Federal University of Rio de Janeiro
Department of Medical Microbiology, Institute of Microbiology Prof. Paulo de Góes,
Bloco I, Cidade Universitária - Ilha do Fundão
Rio de Janeiro, RJ 21941-590
Brazil
Re: CHARACTERIZATION OF VIRULENCE FACTORS AND CLONAL
DIVERSITY OF Enterococcus faecalis ISOLATES FROM TREATED DENTAL
ROOT CANALS (JCM00139-10 Version 1)
Dear Dr. Zoletti:
You have successfully submitted your manuscript via the Rapid Review system. The
control number of your manuscript is JCM00139-10 Version 1. Take note of this
number, and refer to it in any correspondence with the Journals Department or with
the editor. You may log onto the Rapid Review system at any time to see the current
status of your manuscript and the name of the editor handling it. The URL is
http://www.rapidreview.com/ASM2/author.html, and your user name is drzoletti. To
find contact information for the editor handling your manuscript, go to the following
URL:
http://www.asm.org//components/com_php/files/editors.php
In submitting your manuscript to the Journal of Clinical Microbiology (JCM), the
author(s) guarantees that a manuscript with substantially the same content has not
been submitted or published elsewhere and that all of the authors are aware of and
agree to the submission.
Thank you for submitting your manuscript for consideration.
Charles Brown
Production Editor
Journal of Clinical Microbiology (JCM)
CHARACTERIZATION OF VIRULENCE FACTORS AND CLONAL DIVERSITY 1
OF Enterococcus faecalis ISOLATES FROM TREATED DENTAL ROOT 2
CANALS 3
4
Gustavo O. Zoletti
1
5
Eliezer M. Pereira
1,3
6
Ricardo P. Schuenck
1
7
Lúcia M. Teixeira
1
8
José F. Siqueira Jr
2
9
Kátia Regina N. dos Santos
1
10
11
1
Institute of Microbiology Prof Paulo de Góes, Federal University of Rio de Janeiro, Rio de Janeiro; 12
2
Department of Endodontics, Estácio de Sá University, Rio de Janeiro;
3
Federal Institute of 13
Education, Sciences and Technology of Rio de Janeiro, Rio de Janeiro, Brazil. 14
15
Author´s address: 16
Kátia Regina Netto dos Santos, Laboratory of Hospital Infections, Department of Medical 17
Microbiology, Institute of Microbiology Prof. Paulo de Góes, Bloco I, Cidade Universitária - Ilha do 18
Fundão, Rio de Janeiro Federal University, Rio de Janeiro, RJ 21941-590, Brazil. Tel.: +55-21-19
2560-8344; Fax: +55-21-2560-8028. E-mail: [email protected].br 20
21
Key words: Enterococcus faecalis; endodontic infection; virulence factors; 22
genotype patterns 23
ABSTRACT 24
The high prevalence of Enterococcus faecalis in root canal-treated teeth with post-25
treatment disease as evidenced by both molecular and traditional culturing 26
methods suggests that this species can be a key player in endodontic treatment 27
failure. This study aimed to detect virulence factors by phenotypic and western-28
blotting tests, and virulence genes by PCR from 20 clinical strains of E. faecalis 29
isolated from treated root canals of teeth with (10 strains) or without (10 strains) 30
apical periodontitis. Moreover, genomic diversity of these strains was assessed by 31
pulsed-field gel electrophoresis (PFGE) and rep-PCR. All the 20 strains presented 32
the gelE gene (gelatinase), but 10 of them, which had the ef1841/fsrC gene, did 33
not hydrolyse gelatin. Seven of the 10 gelatinase-producing isolates were 34
recovered from root canals with lesion, which may suggest a role for this virulence 35
factor in the pathogenesis of post-treatment disease. The esp gene was 36
expressed only in cases where gelatinase production was negative, except for 37
three strains isolated from root canals without lesion that were negative for both 38
virulence factors. The other virulence genes were found in 90% (efaA and ace 39
genes), 45% (agg gene) and 95% (cpd gene) of the E. faecalis isolates. All the 40
strains were biofilm producers and had at least three of the virulence genes 41
investigated. As for PFGE and rep-PCR, no specific clonal type of E. faecalis was 42
found in association with teeth with or without disease, revealing an interindividual 43
clonal diversity for endodontic infections. 44
INTRODUCTION 45
Traditional methods of microbial identification in endodontic infections have 46
evidenced the presence of Enterococcus faecalis, especially in association with 47
persistent/secondary infections (20, 30). The consequent assumption that this 48
species could play a major role in endodontic treatment failures resulted in various 49
in vitro and ex vivo studies testing protocols to eliminate E. faecalis from root 50
canals (6). 51
Although molecular studies have shown that it is not a predominant species 52
in cases of endodontic retreatment (22, 24), E. faecalis has been confirmed as the 53
most commonly found microorganism in persistent/secondary infections (22, 28). 54
However, E. faecalis has also been identified in cases with no apical periodontitis 55
lesion (15). Such finding was confirmed by molecular studies and led to the 56
hypothesis that it may not necessarily be the main pathogen associated with post-57
treatment disease (9, 37). The reason why E. faecalis is found in cases with and 58
without disease remains to be clarified but it may be related to differences in 59
virulence abilities among strains of the species. 60
Since Enterococcus is not as virulent as other Gram-positive bacteria, such 61
as Staphylococcus aureus, Streptococcus pneumoniae or Streptococcus 62
pyogenes, the study of its pathogenicity is more difficult (11). Although no study 63
has so far evidenced the specific role of virulence factors of enterococci in human 64
infections, several of these factors have been described and studied (5, 8). 65
Candidate virulence factors of E. faecalis include: cytolysin and proteolytic 66
enzymes (gelatinase and serine protease), adhesins (aggregation substance, 67
enterococci surface protein - Esp, collagen adhesion protein – Ace, antigen A – 68
EfaA) and capsular and cellular wall polysaccharides (8). 69
Gelatinase is a hydrophobic metalloprotease with the capacity of cleaving 70
insulin, casein, hemoglobin, collagen, gelatin and fibrin (36). Studies have been 71
performed in an attempt to associate its proteolytic properties to a higher 72
occurrence of enterococci in endocarditis and bacteremia (1), urinary infections 73
(17) and oral infections (25). However, the microorganism may not express 74
gelatinase even in the presence of the gelE gene due to a chromosomal deletion 75
of 23,9 kilobases in the locus fsr region (21). 76
The enterococci surface protein (Esp) is encoded by the esp gene and can 77
be involved with colonization and persistence of E. faecalis during infections (11, 78
27). It is likely that it mediates the primary interaction of the pathogen with host 79
surfaces during biofilm formation (31). 80
Since E. faecalis is highly prevalent in root canal-treated teeth with apical 81
periodontitis, it seems to be relevant to analyze a possible involvement of 82
virulence genes and factors, including gelatinase and enterococci surface protein, 83
with the occurrence of this species in previously treated root canals associated or 84
not with post-treatment disease, as well as, to verify the biofilm formation ability of 85
endodontic isolates. The observation of clonal differences among these isolates 86
may also shed a light on their participation in disease causation. 87
88
MATERIAL AND METHODS 89
Case description 90
Twenty strains of E. faecalis isolated from root canal-treated teeth of 18 adult 91
patients (ages ranging from 19 to 75 years) were used in this study. Among the 92
isolates, 10 were from teeth that had no radiographic evidence of apical 93
periodontitis and were referred to endodontic retreatment because of long 94
exposure of the root canal filling material to the oral cavity due to loss of the 95
coronal restoration or when an extensive coronal restoration had to be replaced 96
and the technical quality of the endodontic treatment was considered inadequate. 97
The other 10 isolates were from teeth with post-treatment apical periodontitis as 98
revealed by radiographs. Clinical samples were collected from 85 patients who 99
had been referred to the Endodontic Clinic at two universities (Federal University 100
of Rio de Janeiro and Estácio de Sá University) for root canal retreatment. All the 101
root canal-treated teeth had endodontic therapy completed more than 1 year 102
previously, and termini of the root canal filling ranging from 0 to 5 mm short of the 103
radiographic root apex. Selected teeth showed an absence of periodontal pockets 104
deeper than 4 mm. 105
Sampling procedures 106
All root canal samples were collected by one highly experienced endodontist after 107
supragingival plaque removal by scaling, cleanliness with pumice and isolation 108
with a rubber dam of each tooth. The tooth and the surrounding field were 109
cleansed with 3% hydrogen peroxide and disinfected with a 2.5% sodium 110
hypochlorite (NaOCl) solution. After isolation and disinfection of the operative field, 111
coronal restorations were removed when present. For this purpose, sterile high-112
speed carbide burs were used until the root filling was exposed. If a post was 113
present, removal was attempted through ultrasonic vibration; if unsuccessful, post 114
removal was performed with a sterile high-speed carbide bur. After completion of 115
the endodontic access, the tooth, clamp, and adjacent rubber dam were once 116
again disinfected with 2.5% NaOCl. For sterility control, 2 paper points were 117
scrubbed on the disinfected tooth crown surface and transferred to a tube 118
containing Enterococcosel broth (Becton Dickinson Microbiology Systems, 119
Cockeysville, MD, USA). 120
Coronal gutta-percha was removed by means of sterile Gates-Glidden burs, 121
and the apical material was retrieved by using K-type or Hedström files, or both. 122
Removal of root fillings was always performed without the use of chemical 123
solvents. Radiographs were taken to ensure that all filling material had been 124
removed. A small amount of sterile 5% sodium thiosulfate solution was placed into 125
the root canal and a sterile endodontic file was introduced to a level approximately 126
1 mm short of the root apex and a gentle filing motion was applied. The root canal 127
contents were absorbed into at least three paper points, which were then 128
transferred to tubes containing Enterococcosel broth. 129
Culture and identification procedures 130
After incubation for 72 hours at 35
o
C, samples that showed growth in 131
Enterococcosel broth were plated onto blood agar plates (Plast Labor, Rio de 132
Janeiro, RJ, Brazil) and incubated at 35
o
C for 72 hours. Pure colonies were 133
subjected to conventional tests for identification of enterococcal species (33). E. 134
faecalis was identified by Gram staining, colony morphology, catalase test, growth 135
in NaCl broth, hydrolysis of esculin in the presence of bile salts, hydrolysis of PYR 136
and LAP, hydrolysis of arginine, pyruvate utilization, motility, pigmentation 137
production and carbohydrate fermentation tests (arabinose, mannitol, metil -D-138
glucopyranoside, raffinose, sucrose, sorbitol and sorbose). Identification was 139
confirmed by PCR using E. faecalis-specific primers (see below). 140
Production of gelatinase 141
Production of gelatinase was determined on Todd-Hewitt agar (Difco, 142
Laboratories, Le Pont de Claix, France) containing 30 g/L of gelatin (3). Colonies 143
were spotted onto plates after overnight growth at 35
o
C, and placed at 4
o
C for 5 144
hours. Appearance of zones of turbidity around the colonies was indicative of 145
hydrolysis. E. faecalis OG1RF was used as positive control. 146
SDS-PAGE and Western blotting analysis 147
SDS-7.5% polyacrylamide gel electrophoresis (PAGE) was performed by the 148
method of (12). After electrophoresis, the gels were stained with Coomassie blue, 149
destained, dried, and transferred to nitrocellulose membranes (Hybond-C extra 150
Amersham, GE Healthcare, Piscataway, NJ, USA) (34). Membranes were 151
incubated with anti-Esp rabbit immune serum (kindly provided by Dr. Nathan 152
Shankar, University of Oklahoma, USA) diluted 1:250. Bound antibodies were 153
detected as described by (7) with DAB (3,3’ Diaminobenzidine Tetrahydrochloride 154
Dihydrate, 97%) (Sigma Chemical Co., St Louis, MO, USA). 155
Quantification of bacterial biofilm on polystyrene surface (Microtiter-plate 156
adherence – MPA) 157
The MPA assay was performed according to (29), with modifications. A 0.5 158
McFarland standard bacterial suspension was diluted 1:100 (v/v) in Tryptic 159
Soy Broth -TSB (Becton, Dickinson and Company, Sparks, MD, USA) 160
supplemented with 1% glucose (Merck, New Jersey, USA). Subsequently, 161
200 L aliquots were distributed in wells of a microtiter plate of 96 wells 162
(model 92096 TPP - "Techno Plastic Products”, Trasadingen, Switzerland), 163
and incubated for 24 h at 35°C. Then, the content of each well was aspirated, and 164
the well was washed four times with 100 µ L of phosphate-buffered saline (pH 7.2). 165
The adherent bacteria were stained for 1 min with 150 µL of 0.1% violet crystal 166
solution. Excess stain was rinsed off by placing the plate under running tap water. 167
Staphylococcus epidermidis strains ATCC 35984 (biofilm-producer) and ATCC 168
12228 (non-biofilm producer) were used as controls. After the plates were 169
overturned and air dried, the dye bound to the adherent cells was resolubilized 170
with 150 µL of 95% ethanol. The results were obtained using an ELISA reader 171
model 680 (Bio-Rad Laboratories, Hercules, CA, USA) at a wavelength of 570 nm. 172
Comparative analysis were performed according to (29) using the wells containing 173
S. epidermidis ATCC 12228 (non-biofilm producer) as negative controls. 174
PCR procedures 175
One milliliter aliquots from positive cultures in selective Enterococcosel broth were 176
transferred to microtubes and DNA was extracted by boiling (28). Primer 177
sequences used for identification of E. faecalis and its virulence genes are shown 178
in Table 1. Genes that encode for 16S rRNA of E. faecalis, aggregation substance 179
(agg), enterococci surface protein (esp), gelatinase (gelE), gelatinase-negative 180
phenotype determinant (ef1841/fsrC), endocarditis antigen (efaA), sex 181
pheromones (cpd) and collagen binding antigen (ace) were targeted. 182
Aliquots of 5 µl of the DNA extracts were used as template in the PCR that 183
was performed in the final volume of 25 µl containing 1 µM of each primer, 2.5 µl 184
of 10×PCR buffer, 2 mM of MgCl
2
, 1.25 U of Taq DNA polymerase (Biotools, 185
Madrid, Spain) and 0.2 mM of each deoxynucleoside triphosphate (Biotools). PCR 186
amplicons were separated by electrophoresis in a 1.5% agarose gel and 187
visualized on an UV transilluminator. 188
Genotyping by rep-PCR 189
The repetitive-sequence PCR (rep-PCR) was performed as follows. Endodontic 190
isolates of E. faecalis were grown overnight at 35°C, in 5 ml of Brain Heart Infusion 191
broth (Difco). The bacterial suspension was diluted 1:10 in water and adjusted to 192
an optical density of 600 nm. Afterwards, it was transferred to microtubes and the 193
DNA was obtained as described by (19). Aliquots of 1 µL of the DNA extracts was 194
used as a template for PCR amplification with the primer RW3A (18) (Table 1). 195
Genotyping by PFGE 196
The E. faecalis isolates were analyzed for clonal diversity by pulsed-field gel 197
electrophoresis (PFGE) after SmaI (New England Biolabs, Inc., Beverly, MA, USA) 198
digestion as described by (16) and (32). Differences between isolates were 199
determined by visual inspection of the bands, as recommended by (35) and by the 200
Molecular Analyst Fingerprinting Plus software package (version 1.12) of the 201
Image Analysis System (Bio-Rad, Hercules, CA, USA), using the Dice index and 202
the unweighted pair group method with arithmetic averages for estimation of 203
similarity and clustering. 204
205
RESULTS 206
Isolation of E. faecalis 207
Of the 85 teeth included in the present study, four cases with lesion and one 208
without lesion were excluded from the study because of contamination of the tooth 209
crown by Enterococcus species as revealed by sterility controls. Results showed 210
that, of the 80 teeth analyzed by culture, E. faecalis was detected in 20 (25%) - 10 211
from treated root canals with apical periodontitis and the other 10 from treated 212
teeth without disease. 213
Detection of virulence genes 214
Virulence genes possibly related to the persistence of E. faecalis in endodontic 215
infections were analyzed in the 20 E. faecalis strains isolated from root canals with 216
or without apical periodontitis (Table 2). The gelE gene was found in all isolates; 217
the cpd gene was detected in 19 (95%); efaA and ace genes were found in 18 218
(90%); agg gene in 9 (45%); and the esp gene in 8 (40%) out of the 20 isolates 219
analyzed. 220
Phenotypic characterization of gelatinase production 221
A difference between carriage of the gelatinase gene and its expression was 222
noticed. Although all isolates had this gene, only one-half of them exhibited an 223
opaque halo that is indicative of positiveness for the gelatinase phenotypic test 224
(Table 2). Of the positive cases, seven (70%) were from root canal-treated teeth 225
with lesion and only three (30%) were from cases without lesion. Gelatinase 226
expression was confirmed by the absence of detection of the ef1841/fsrC gene in 227
the positive isolates. 228
Expression of the Esp virulence factor 229
Western blotting using anti-Esp polyclonal rabbit serum showed that 7 of 8 230
(87.5%) isolates in which the esp gene was identified reacted with the antibody, 231
indicating production of this adhesin by the isolates (Table 2). All strains positive 232
for esp gene expression were negative for gelatinase production, except for 3 233
strains from teeth without lesion, which expressed neither. 234
Biofilm formation 235
All strains of E. faecalis isolated from treated root canals were biofilm producers. 236
There was no correlation between the intensity of biofilm production by strains 237
detected in the presence or absence of disease. In cases with apical periodontitis, 238
E. faecalis strains were classified as follows: 3 weak, 4 moderate and 3 strong 239
biofilm producers. In cases without disease, strains were classified as follows: 4 240
weak, 3 moderate and 3 strong biofilm producers. 241
Rep-PCR 242
Genetic polymorphism was performed using rep-PCR with the clinical strains 243
isolated from root canal-treated teeth and the control strains E. faecalis DS16, E. 244
faecalis V583 and E. faecalis OG1RF. Banding profile for these strains showed 6 245
to 9 bands and revealed a large clonal diversity. The 20 strains were distributed 246
into 8 different clonal groups: genotypes a and b corresponded to 7 and 3 isolates, 247
respectively; genotypes c, d, e and h were represented by 2 isolates each; and 248
genotypes f an g comprised one isolate each. The isolates included in the same 249
genotype had an identical profile, being classified in another genotype according 250
to the identification of at least one different band. 251
PFGE 252
PFGE analysis of genomic DNA from the 20 E. faecalis endodontic isolates 253
revealed 18 restriction profiles clustered in 14 different genotypes, with 50% of the 254
isolates included in five genotypes (Fig. 1). Genotype A included isolates 35RW 255
and 37RW, whereas genotype B comprised isolates 50RN and 55RN; both strains 256
of each genotype were isolated from the same patient and were considered as 257
indistinguishable. Isolates 45RN (subtypes C1) and 66RN (subtype C2) differed by 258
four bands; 77RW (subtype D1) and 44RN (subtype D2) also differed by four 259
bands; 12RW (subtype E1) and 73 RN (subtype E2) differed by two bands. The 260
remaining strains were considered unrelated because they differed by more than 5 261
bands, and were classified in genotypes F to O. 262
263
DISCUSSION 264
A higher prevalence of E. faecalis has been observed in both primary and 265
persistent endodontic infections through the use of molecular methods (22, 23). 266
However, the role of the E. faecalis in the pathogenicity of apical periodontitis is 267
still uncertain. Studies evaluating its prevalence in root canal-treated teeth with or 268
without post-treatment disease allowed to conclude that even though E. faecalis 269
has been associated with treated root canals, a causal relationship with post-270
treatment disease remains undetermined (9, 37). 271
In addition to the characteristics of resistance and capacity of surviving to 272
endodontic treatment (13, 26), E. faecalis presents virulence traits that, in 273
sufficient concentrations, may enable the microorganism to remain in the root 274
canal and either directly or indirectly inflict damage to the periradicular tissues. 275
Among such virulence factors, gelatinase and enterococci surface protein (Esp) 276
have greater potential to participate in colonization and disease causation (10, 25). 277
In the present study, all 20 isolates of E. faecalis recovered from treated 278
root canals carried the gelE gene, but only 10 of them (50%) hydrolyzed gelatin in 279
the phenotypic test. It is important to emphasize that gelatinase expression 280
occurred in 70% (7/10) of the strains isolated from teeth with disease, as 281
compared to only 30% (3/10) of the isolates from teeth without lesion. This may 282
suggest a role for this virulence factor in the pathogenesis of post-treatment apical 283
periodontitis. 284
Moreover, it is possible to infer a relationship between gelatinase production 285
and the biofilm-forming ability, and with the perpetration of the infectious process 286
and bacterial persistence in the root canal, since 5 of the 7 gelatinase-producing 287
strains found in disease cases were moderate to strong biofilm producers. 288
Although the role of gelatinase in enhancing biofilm formation is still unknown, (10) 289
described possible models: gelatinase might participate in the production of an 290
extracellular signaling peptide by proteolytically processing an inactive secreted 291
peptide precursor to a mature component or it might proteolytically activate 292
another surface protein involved in some aspects of the regulation or process of 293
biofilm development, such as a protein that participates in the secretion of 294
extracellular polymeric matrix material. 295
Expression of gelatinase is regulated by a quorum sensing system encoded 296
by a chromossomial deletion of 23,9 kilobases in locus fsr region (21). This fact 297
was also supported by our results, since the ef1841/fsr gene was detected only in 298
strains with negative phenotypes for gelatinase production. 299
The esp gene that encodes a surface protein was found in 8 (40%) of the 300
strains analyzed, 5 from teeth without lesion and 3 from teeth with disease. 301
Expression of this enterococci surface protein was confirmed by western-blotting 302
tests and the results showed that only one of the eight esp gene-positive isolates 303
did not express this factor. Interestingly, the Esp factor was expressed only by 304
strains that did not produce gelatinase. Three isolates expressed neither of these 305
virulence factors. However, these strains were from cases without lesion, and two 306
of them belonged of the same PFGE genotype (strains RN45 and RN66). 307
Although the gene esp have occurred similarly in cases without (40%) and with 308
(30%) post-treatment apical periodontitis, a relationship between this virulence 309
factor and the presence of E. faecalis in the root canal may be possible. The Esp 310
factor could act as an alternative tool to gelatinase as for root canal colonization by 311
E. faecalis. 312
Recent studies have shown that the presence of Esp is not a determinant 313
for the formation of biofilm, even when associated with other virulence factors (2, 314
10). Our results obtained for the analysis of biofilm production by endodontic 315
strains of E. faecalis reinforce this observation since 5 of the 7 strains that 316
expressed Esp were classified as weak biofilm producers. 317
The analysis of polymorphism through rep-PCR enabled the distribution of 318
strains in eight different genotypes. Two bands of about 1.200 and 1.300 bp were 319
found in all strains of E. faecalis analyzed (18). According to rep-PCR analysis, 10 320
strains recovered from cases with disease were included in two major groups 321
(genotypes a and b). However, rep-PCR analysis showed a lower discriminatory 322
power when compared to PFGE. Actually, some of the clinical strains presenting 323
the same genotype by rep-PCR showed distinct genotypic profiles by PFGE (Fig. 324
1). These differences can be related to the low number of bands generated and 325
the poor reproducibility of the rep-PCR method as already reported by (14). 326
PFGE analysis of the 20 E. faecalis strains resulted in 18 restriction profiles 327
clustered in 14 different genotypes. About 50% of the strains were included in five 328
genotypes (A to E). In spite of the large clonal diversity found among E. faecalis, 329
four isolates from two genotypes (A and B) were classified as similar by both rep-330
PCR and PFGE methods. In fact, isolates 35RW and 37RW were from different 331
teeth, but the same patient. A similar finding was obtained for isolates 50RN and 332
55RN. Three other genotypes presented closely related PFGE subtypes. These 333
relationships occurred between isolates from genotypes C and D, from root canals 334
with or without apical periodontitis, and genotype E, comprising isolates from 335
cases without disease. Furthermore, except for strains from genotype E, the other 336
strains classified within clonal groups showed distinct virulence and biofilm 337
patterns, although have presented similar profiles for the gelE and esp genes 338
expression, demonstrating the clonal variability of the E. faecalis strains isolated 339
from treated root canals. 340
In conclusion, the present study provides information on the genetic and 341
phenotypic aspects of virulence traits of clinical strains of E. faecalis isolated from 342
root canal-treated teeth with or without apical periodontitis. No prevalent genotype 343
was identified, which was a result of the high interindividual variability observed. 344
Some of the virulence characteristics detected in this study may help to explain the 345
involvement of E. faecalis in the establishment of post-treatment disease, probably 346
as part of a mixed microbial community presenting complex interactions that may 347
influence disease progression and outcome. 348
Acknowledgments 349
The authors thank Dr. Nathan Shankar of the University of Oklahoma (USA) who 350
kindly provided the anti-Esp polyclonal rabbit serum. This study was supported by 351
grants from CAPES, CNPq, and FAPERJ, Brazilian Governmental Institutions. 352
References 353
1. Baldassarri, L., R. Creti, C. R. Arciola, L. Montanaro, M. Venditti, and R. Di 354
Rosa. 2004. Analysis of virulence factors in cases of enterococcal endocarditis. 355
Clin. Microbiol. Infect. 10:1006-1008. 356
2. Carniol, K., and M. Gilmore. 2004. Signal transduction, quorum-sensing, and 357
extracellular protease activity in Enterococcus faecalis biofim formation. J. 358
Bacteriol. 186:8161-8163. 359
3. Coque, T. M., J. E. Patterson, J. M. Stecklberg, and B. E. Murray. 1995. 360
Incidence of hemolysin, gelatinase, and aggregation substance among 361
enterococci isolated from patients with endocarditis and other infections and from 362
feces of hospitalized and community-based persons. J. Infect. Dis. 171:1223-363
1229. 364
4. Duprè, I., A. M. Zanetti, G. Schito, G. Fadda, and L. A. Sechi. 2003. 365
Incidence of virulence determinants in clinical Enterococcus faecium and 366
Enterococcus faecalis isolates collected in Sardinia (Italy) J. Med. Microbiol. 367
52:491–498. 368
5. Eaton, T. J., and M. J. Gasson. 2001. Molecular screening of Entercoccus 369
virulence determinants and potential for genetic exchanges between food and 370
medical isolates. Appl. Environ. Microbiol. 67:1628-35. 371
6. Gomes, B. P. F. A., C. C. R. Ferraz, F. D. Garrido, P. L. Rosalen, A. A. Zaia, 372
F. B. Teixeira, and F. J. Souza-Filho. 2002. Microbial susceptibility to calcium 373
hidroxide pastes and their vehicles. J. Endod. 28:758-761. 374
7. Jaffe, C. L., E. Bennett, J. R. Grimaldi, and D. McMahon-Pratt. 1984. 375
Production and characterization of species-specific monoclonal antibodies against 376
Leishmania donovani for immunodiagnostics. J. Immunol. 133:440-447. 377
8. Jett, B. D., M. M. Huycke, and M. S. Gilmore. 1994. Virulence of enterococci. 378
Clin. Microbiol. Reviews 7:462-478. 379
9. Kaufman, B., L. Spängberg, J. Barry, and A. F., Fouad. 2005. Enterococcus 380
spp. in endodontically treated teeth with and without periradicular lesions. J. 381
Endod. 31:851-856. 382
10. Kristich, C. J., Y. H. Li, D. G. Cvitkovitch, and G. M. Dunny. 2004. Esp-383
independent biofilm formation by Enterococcus faecalis. J. Bacteriol. 186:154-384
163. 385
11. Koch, S., M. Hunfnagel, C. Theilacker, and J. Huebner. 2004. Enterococcal 386
infections: host response, therapeutic and prophylatic possibilities. Vaccine 387
22:822-830. 388
12. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of 389
the head of bacteriophage T4. Nature 333:330–334. 390
13. Love, R. M. 2001. Enterococcus faecalis – a mechanism for its role in 391
endodontic failure. Int. Endod. J. 34:399-405. 392
14. Malathum, K., K. V. Singh, G. M. Weinstock, and B. E. Murray. 1998. 393
Repetitive sequence-based PCR versus pulsed-field gel electrophoresis for typing 394
of Enterococcus faecalis at the subspecies level. J. Clin. Microbiol. 36:211-5. 395
15. Molander, A., C. Reit, G. Dahlen, and T. Kvist. 1998. Microbiological status 396
of root-filled teeth with apical periodontitis. Int. Endod. J. 31:1-7. 397
16. Mondino, S. S. B., A. C. D. Castro, P. J. Mondino, M. G. Carvalho, K. M. 398
Silva, and L. M. Teixeira. 2003. Phenotypic and genotypic characterization of 399
clinical and intestinal enterococci isolated from inpatients and outpatients in two 400
brazilian hospitals. Microbiol. Drug Resist. 9:167-74. 401
17. Nakayama, J., R. Kariyama, and H. Kumon. 2002. Description of a 23.9-402
kilobase chromosomal deletion containing a region encoding fsr genes which 403
mainly determines the gelatinase-negative phenotype of clinical isolates of 404
Enterococcus faecalis in urine. Appl. Environ. Microbiol. 68:3152-3155. 405
18. Namdari, H., and V. DelVecchio. 1998. Application of PCR for 406
characterization of Enterococci. Clin. Microbiol. Newsletter 20:91-98. 407
19. Pacheco, A. B. F., B. E. C. Guth, K. C. C. Soares, L. Nishimura, D. F. 408
Almeida, and L. C. S. Ferreira. 1997. Random amplification of polymorphic DNA 409
reveals serotype-specific clonal clusters among enterotoxigenic Escherichia coli 410
strains isolated from humans. J. Clin. Microbiol. 35:1521-1525. 411
20. Pinheiro, E. T., B. P. F. A. Gomes, C. C. R. Ferraz, F. B. Teixeira, A. A. 412
Zaia, and F. J. Souza-Filho. 2003. Evaluation of root canal microorganisms 413
isolated from teeth with endodontic failure and their antimicrobial susceptibility. 414
Oral Microbiol. Immunol. 18:100-103. 415
21. Roberts, J. C., K. V. Singh, P. C. Okhuysen, and B. E. Murray. 2004. 416
Molecular epidemiology of the fsr locus and of gelatinase production among 417
different subsets of Enterococcus faecalis isolates. J. Clin. Microbiol. 42:2317-418
2320. 419
22. Rôças, I. N., J. F. Siqueira Jr, and K. R. N. Santos. 2004. Association of 420
Enterococcus faecalis with different forms of periradicular diseases. J. Endod. 421
30:315-320. 422
23. Sassone, L., R. Fidel, L. Figueiredo, S. Fidel, M. Faveri, and M. Feres. 423
2007. Evaluation of the microbiota of primary endodontic infections using 424
checkerboard DNA-DNA hybridization. Oral Microbiol. Immunol. 22:390-397. 425
24. Sakamoto, M., J. F. Siqueira Jr, I. N. Rôças, and Y. Benno. 2008. 426
Molecular analysis of the root canal microbiota associated with endodontic 427
treatment failures. Oral Microbiol. Immunol. 23:275–281. 428
25. Sedgley, C. M., S. L. Lennan, and D. B. Clewell. 2004. Prevalence, 429
phenotype and genotype of oral enterococci. Oral Microbiol. Immunol. 19:95-101. 430
26. Sedgley, C. M., S. L. Lennan, and O. K. Appelbe. 2005. Survival of 431
Enterococcus faecalis in root canals ex vivo. Int. Endod. J. 38:735-742. 432
27. Shankar, N., C. V. Lockatell, A. S. Baghdayan, C. Drachenberg, M. S. 433
Gilmore, and D. E. Johnson. 2001. Role of Enterococcus faecalis surface protein 434
esp in the pathogenesis of ascending urinary tract infection. Infect. Immun. 435
69:4366-4372. 436
28. Siqueira Jr, J. F., and I. N. Rôças. 2004 Polymerase chain reaction-based 437
analysis of microorganisms associated with failed endodontic treatment. Oral 438
Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 97:85–94. 439
29. Stepanovic, S., D. Vulkovic, V. Hola, G. Di Bonaventura, S. Djukic, I. 440
Cirkovic, and F. Ruzicka. 2007. Quantification of biofilm in microtiter plates: 441
overview of testing conditions and practical recommendations for assessment of 442
biofilm production by staphylococci. APMIS 115:891-899. 443
30. Sundqvist, G., D. Figdor, S. Persson, and U. Sjogren. 1998. Microbiologic 444
analysis of teeth with failed endodontic treatment and the outcome of conservative 445
retreatment. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 85:86-93. 446
31. Tendolkar, P. M., A. S. Baghdayan, M. S. Gilmore, and N. Shankar. 2004. 447
Enterococcal surface protein, esp, enhances biofilm formation by Enterococcus 448
faecalis. Infect. Immun. 72:6032-6039. 449
32. Teixeira, L. M., M. G. S. Carvalho, V. L. C. Merquior, A. G. Steigerwalt, M. G. 450
M. Teixeira, D. J. Brenner, and R. R. Facklam. 1997. Recent approaches on the 451
taxonomy of the enterococci and some related microorganisms. Adv. Exp. Med. 452
Biol. 418:387-391. 453
33. Teixeira, L. M., and R. R. Facklam. 2003. Enterococcus, p 422-433. In: P. R. 454
Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, and R. H. Yolken. (eds). 455
Manual of Clinical Microbiology. 8
th
ed., ASM Press, Washington, DC. 456
34. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of 457
proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some 458
applications. Proc. Natl. Acad. Sci. USA 76:4350–4354. 459
35. Van Belkum, A., P. T. Tassios, L. Dijkshoom, S. Haeggman, B. Cookson, 460
N. K. Fry, V. Fussing, J. Green, E. Feil, P. Gemer-Smidt, S. Brisse, and M. 461
Struelens. 2007. Guidelines for the validation and application of typing methods 462
for use in bacterial epidemiology. Clin. Microbiol. Infect. Dis. 13:1–46. 463
36. Waters, C. M., M. H. Antiporta, B. E. Murray, and G. M. Dunny. 2003. Role 464
of the Enterococcus faecalis gelE protease in determination of cellular chain 465
length, supernatant pheromone levels, and degradation of fibrin and misfolded 466
surface proteins. J. Bacteriol. 185:3613-3623. 467
37. Zoletti, G. O., J. F. Siqueira Jr, and K. R. N. Santos. 2006. Identification of 468
Enterococcus faecalis in root-filled teeth with or without periradicular lesions by 469
culture dependent and—independent approaches. J. Endod. 32:722-726.470
TABLE 1 – Oligonucleotides used in this study for identification of Enterococcus faecalis and detection of 471
different virulence genes by PCR 472
473
Target
DNA
Sequence of
primers
Temperature
Conditions
Amplicon
size (pb)
Reference
16S rDNA E. faecalis
5’- GTT TAT GCC GCA TGG CAT AAG AG -3’
5’- CCG TCA GGG GAC GTT CAG -3’
95
o
C - 2 min; 36 cycles (95
o
C - 30 seg; 60
o
C -
60 seg; 72
o
C - 60 seg) and 72
o
C - 2 min
310 28
gelE
5´-ACCCCGTATCATTGGTTT-3´
5´-ACGCATTGCTTTTCCATC-3´
94
o
C - 2 min; 35 cycles (92
o
C - 30 seg; 52
o
C -
30 seg; 72
o
C - 60 seg) and 72
o
C - 2 min
419 5
esp
5´-TTGCTAATGCTAGTCCACGACCC-3´
5´-GCGTCAACACTTGCATTGCCGAA-3´
94
o
C - 2 min; 35 cycles (92
o
C - 30 seg; 52
o
C -
30 seg; 72
o
C - 60 seg) and 72
o
C - 2 min
933 5
agg
5’ – AAGAAAAAGAAGTAGACCAAC – 3’
5’ – AAACGGCAAGACAAGTAAATA – 3’
94
o
C - 2 min; 35 cycles (92
o
C - 30 seg; 56
o
C -
30 seg; 72
o
C - 60 seg) and 72
o
C - 2 min
1553 5
cpd
5’ – TGGTGGGTTATTTTTCAATTC – 3’
5’ – TACGGCTCTGGCTTACTA – 3’
94
o
C - 2 min; 35 cycles (92
o
C - 30 seg; 56
o
C -
30 seg; 72
o
C - 60 seg) and 72
o
C - 2 min
782 5
ace
5’ – AAAGTAGAATTAGATCACAC – 3’
TCTATCACATTCGGTTGCG – 3’
94
o
C - 2 min; 35 cycles (92
o
C - 30 seg; 56
o
C -
30 seg; 72
o
C - 60 seg) and 72
o
C - 2 min
320 4
efaA
5’ – CTGGAGAAAGAAATGGAGGA – 3’
5’ – CTACTAACACGTCACCAATG – 3’
94
o
C - 2 min; 35 cycles (92
o
C - 30 seg; 56
o
C -
30 seg; 72
o
C - 60 seg) and 72
o
C - 2 min
499 4
ef1841/fsrC
5’ - GATCAAGAAGGGAAGCCACC - 3’
5’ - CCAACCGTGCTCTTCTGGA - 3’
94
o
C - 2 min; 35 cycles (92
o
C - 30 seg; 56
o
C -
60 seg; 72
o
C – 2 min) and 72
o
C – 5 min
1050 17
TABLE 2 – Clinical characteristics and virulence and genotypic patterns associated with 20 Enterococcus faecalis isolates from 474
treated root canals 475
476
Virulence patterns
Gelatinase
Surface protein
Other genes
a
PFGE
patterns
rep-PCR
patterns
Case
Sex
Age
(y)
Tooth
Lesion
Lesion
Diameter
(mm)
Apical
Limit of the
Root Filling
(mm short)
Length of
Treatment
(y)
gelE
gene
a
gelatin
hidrolysis
b
ef1841/fsrC
gene
a
esp
gene
a
gene
expression
b
efaA
ace agg cpd
Biofilm
formation
d
RW12 F 28 25 Yes 1 1 5 + - + + + + + - - ++ C1
b
RW35* M 38 12 Yes 2 0 6 + + - - - + + - + +++ A
a
RW37* M 38 22 Yes 5 3 4 + + - - - + + + + ++ A
a
RW68 M 28 22 Yes 1 1 >10 + + - - - + + - + ++ F
a
RW72 F 41 25 Yes 3 0 10 + - + + + + + + + +++ G
a
RW77 F 28 36D Yes 3 0 8 + - + + + + + + + + D1
b
RW79 F 23 22 Yes 2 0 3 + + - - - + + + + + H
a
RW80 F 27 46D Yes 1 4 2 + + - - - + + - + +++ I
b
RW81 M 43 46M Yes 2 1 2 + + - - - + + - + + J
a
RW85 M 33 24V Yes 2 3 3 + + - - - + + + + ++ K
a
RN04 F 43 11 No - 1 5 + - + - - + + - + ++ L
c
RN18 M 45 22 No - 4 >5 + + - - - + + - + ++ M
d
RN29 M 26 15 No - 1 2 + + - + - + + - + +++ N
d
RN44 F 39 11 No - 0 >6 + - + + + + + - + + D2
f
RN45 F 45 25 No - 1 >5 + - + - - + + + + +++ E1
c
RN50** M 29 22 No - 3 >20 + - + + + - - - + + B
e
RN55** M 29 21 No - 2 >5 + - + + + - - - + + B
e
RN66 F 44 27P No - 0 5 + - + - - + + + + ++ E2
g
RN73 M 26 46D No - 1 6 + - + + + + + + + + C2
h
RN74 M 28 15 No - 0 3 + + - - - + + + + +++ O
h
(F) female; (M) male; (y) in years;
a
detected by PCR (Polymerase Chain Reaction);
b
phenotypic test performed in Todd-Hewitt agar with 30g/L of gelatin;
c
detected by Western blotting;
d
detected 477
by microtiter-plate adherence; gelE gene – encode a gelatinase; esp gene – encode a enterococci surface protein; fsr/ef1841 – encode a gelatinase-negative phenotype determinant; efaA – encode 478
a antigen A; ace – encode a collagen adhesion protein; agg – encode a aggregation substance; cpd – encode a sex pheromones; (*) (**) strains of E. faecalis isolated from de differents root canals-479
treated in a same patient.480
FIG 1. (A) PFGE genotypes of 20 strains of Enterococcus faecalis isolated from
root canal-treated with and without post-treatment disease. (B) Dendrogram
resulting from the computer-assisted analysis on the PFGE profiles. * control
strains
14 jan 2010
Dear Kátia Regina Netto dos Santos
JMM paper no. JMM/2010/018887: COMPARISON OF ENDODONTIC BACTERIAL
COMMUNITY STRUCTURES IN ROOT CANAL-TREATED TEETH WITH OR
WITHOUT APICAL PERIODONTITIS
Receipt of your submission to JMM is acknowledged. You will receive a confirmatory
message from the Editorial Office when your paper has been checked and assigned to an
Associate Editor.
Please note that future correspondence will be sent to the Corresponding author only.
IMPORTANT:
(i) Papers in Press
The journal has a Papers in Press feature where accepted manuscripts appear online in an
unedited format before they are scheduled to appear in print. Unless you inform us
otherwise, we will assume that you agree to your manuscript being used in this way.
Please make sure you check the details you have entered into the Bench>Press site very
carefully, particularly the manuscript title, subject category and author details, as these will
be used to generate the Papers in Press record. The final PDF used for the peer-review of a
paper that is subsequently accepted will be the version of the manuscript used for Papers in
Press.
(ii) Copies of files
If your paper is rejected, withdrawn or deleted the source files will automatically be deleted
from the system. Please make sure you keep your own copies of any files you upload to the
site.
Journal of Medical Microbiology Editorial Office
Society for General Microbiology, Marlborough House, Basingstoke Road, Spencers
Wood, Reading RG7 1AG, UK
http://jmm.sgmjournals.org/ http://www.sgm.ac.uk/
COMPARISON OF ENDODONTIC BACTERIAL COMMUNITY STRUCTURES IN
ROOT CANAL-TREATED TEETH WITH OR WITHOUT APICAL
PERIODONTITIS
Gustavo O. Zoletti
1
Flávia L. Carmo
1
Eliezer M. Pereira
1,3
Alexandre S. Rosado
1
José F. Siqueira Jr
2
Kátia R. N. Santos
1
1
Institute of Microbiology Prof Paulo de Góes, Federal University of Rio de Janeiro, Rio de Janeiro;
2
Department of Endodontics and Molecular Microbiology Laboratory, Estácio de Sá University, Rio
de Janeiro;
3
Federal Institute of Education, Sciences and Technology of Rio de Janeiro, Rio de
Janeiro, Brazil.
Author´s address:
Kátia Regina Netto dos Santos, Laboratory of Hospital Infections, Department of Medical
Microbiology, Institute of Microbiology Prof. Paulo de Góes, Bloco I, Cidade Universitária - Ilha do
Fundão, Rio de Janeiro Federal University, Rio de Janeiro, RJ 21941-590, Brazil. Tel.: +55-21-
2560-8344; Fax: +55-21-2560-8028. E-mail: [email protected].br
Key words: apical periodontitis; endodontic infection; endodontic treatment;
denaturing gradient gel electrophoresis
ABSTRACT
Bacterial occurrence in treated root canals even in cases without post-treatment
apical periodontitis raises the possibility that factors other than the mere bacterial
presence can be determinant for a favorable outcome of endodontic treatment.
Because these factors may be related to the bacterial communities colonizing the
root canal, including virulence, density and interactions, the objective of this study
was to compare the community structures found in root canal-treated teeth with (12
samples) and without (11 samples) apical periodontitis lesions by means of a
polymerase chain reaction-denaturing gradient gel eletrophoresis (PCR-DGGE)
fingerprinting approach. Results confirmed a polymicrobial composition even in
treated cases without post-treatment disease. A large microbial community
diversity was observed for both treated teeth with or without disease, but no
specific pattern was detected for diseased teeth. Nevertheless, the number of
bands from samples with apical periodontitis lesion was statistically significantly
higher (p=0.04) compared with samples collected in root canals-treated from teeth
without post-treatment apical periodontitis. Furthermore, predominant bands in
cases with apical disease were also observed.
INTRODUCTION
Endodontic procedures such as root canal instrumentation and irrigation, intracanal
medication and obturation, are intended to eradicate infection from the root canal
system and prevent further reinfection (Sakamoto et al., 2007; Siqueira et al.,
2007). Nevertheless, such procedures are not always efficient for the complete
elimination of endodontic infections in the huge majority of cases. What may be
achieved with such procedures is a reduction of the bacterial populations inside the
root canal to a level below the necessary for maintenance of the disease process.
This is confirmed by the fact that some apical periodontitis lesions may heal even
when bacteria are found in the root canal at the time of filling (Fabricius et al.,
2006; Sundqvist et al., 1998). Even considering that bacterial persistence can be
an important risk factor for post-treatment disease (Sjögren et al., 1997; Sundqvist
et al., 1998), there is no single specific species described as the culprit for
endodontic failures, even with several reports of Enterococcus faecalis colonizing
treated canals (Kaufman et al., 2006; Rôças et al., 2004b; Zoletti et al., 2006).
Although bacteria present in treated canals are arguably involved with post-
treatment disease (Molander et al., 1998; Siqueira & Rôças, 2004; Sundqvist et al.,
1998), there are reports showing that even treated teeth with no discernible
disease may harbor bacteria (Kaufman et al., 2006; Zoletti et al., 2006). Therefore,
rather than mere bacterial presence, other related factors may play a role as
determinants of disease causation. These factors may include density and/or
virulence of the bacterial community as a whole, bacterial localization in the root
canal, and interactions between community members persisting in the root canal.
In this context, a great challenge is to define whether specific bacterial community
profiles are linked to the success/failure of endodontic treatment (Siqueira &
Rôças, 2008).
Recently, the denaturing gradient gel eletrophoresis (DGGE) technique has
been used to evaluate the oral microbial community (Li et al., 2005; Li et al., 2006)
and specifically the endodontic microbiota in diverse clinical conditions (Alves et
al., 2009; Rôças et al., 2004a; Siqueira et al., 2004). This technique allows for the
visualization of the structure of bacterial communities in multiple clinical specimens
at a time, including culture-difficult or as-yet-uncultivated taxa in the fingerprints
(Siqueira et al., 2004). The present study was undertaken to compare the bacterial
communities present in treated root canals of teeth with or without apical
periodontitis by using a 16S rRNA gene-based broad-range polymerase chain
reaction (PCR)-DGGE approach.
MATERIAL AND METHODS
Case description and sample taking
Samples were collected from 23 root canal-treated teeth from adult patients (ages
ranging from 19 to 75 years) who had been referred to the Endodontic Clinic at two
universities (Federal University of Rio de Janeiro and Estácio de Sá University) for
root canal retreatment. Eleven teeth had no radiographic evidence of apical
periodontitis and were referred to endodontic retreatment because of long
exposure of the root canal filling material to the oral cavity as a consequence of
loss of the coronal restoration or when an extensive coronal restoration had to be
placed and the technical quality of the endodontic treatment was considered
inadequate. The other 12 teeth presented post-treatment apical periodontitis as
revealed by conventional periapical radiographs. All the root canal-treated teeth
had endodontic therapy completed more than 1 year previously, and termini of the
root canal filling ranging from 0 to 5 mm short of the radiographic root apex.
Selected teeth showed an absence of periodontal pockets deeper than 4 mm.
All samples were collected by one of the authors (G.O.Z.) for a previous
study (Zoletti et al., 2006). Samples were stored frozen and were available for re-
analysis. Sample taking and DNA extraction procedures were as described
previously (Zoletti et al., 2006).
PCR amplification
A 16S rRNA gene fragment corresponding to nucleotide positions from 968 to 1401
(Escherichia coli numbering) was amplified from DNA extracts of clinical samples
using the following universal bacterial primers: 968f (5’-AAC GCG AAG AAC CTT
AC-3’) containing a 40-base pair (bp) GC clamp (5’-CGC CCG CCG CGC GCG
GCG GGC GGG GCG GGG GCA CGG GGG G-3’) added to its 5’-end, which
makes it suitable for DGGE, and 1401r (5’-CGG TGT GTA CAA GAC CC-3’)
(Nübel et al., 1996).
The PCR mixture comprised 5 µl of the supernatant from clinical samples,
25 pmol universal primers, 5 µl of 10×PCR buffer (Biotools, Madrid, Spain), 3.8 mM
MgCl
2
, 2.5 U of Tth DNA polymerase (Biotools), 0.2 mM concentration of each
deoxynucleoside triphosphate (Biotools) and sterile ultrapure water to a final
volume of 50 µl. Negative controls consisting of sterile ultrapure water instead of
sample were included with each batch of samples analyzed. PCR amplication was
performed in a DNA thermocycler (Mastercycler Personal, Eppendorff, Hamburg,
Germany). The temperature profile included an initial denaturation step at 94ºC for
2 min, followed by 35 cycles of a denaturation step at 94ºC for 1 min, a primer
annealing step at 55
o
C for 1 min, an extension step at 72ºC for 2 min and a final
step of 72ºC for 10 min. Before the DGGE analysis, the presence of PCR products
was checked by electrophoresis in a 1.5% agarose gel conducted at 4 V/cm in
Tris–borate–ethylenediaminetetraacetic acid (EDTA) buffer. The gel was stained
for 15 min with 0.5 µg/ml ethidium bromide and viewed under 300-nm wavelength
ultraviolet light. A 100-bp DNA ladder digest (Biotools) served as the molecular
size standard.
DGGE assay
DGGE of PCR products generated with 968f-GC/1401r primer set was performed
using the Dcode Universal Mutation Detection System (Bio-Rad; Richmond, Va,
USA) at 75 V and 60
o
C for 16 hours in 0.5× TAE buffer (20 mmol/L Tris-acetate
(pH 7.4), 10 mmol/L sodium acetate, 0.5 mmol/L disodium EDTA). The PCR
products from clinical samples (30 µL) were loaded on 6% (w/v) polyacrylamide
gels containing a linear gradient ranging from 45% to 70% denaturant (100%
denaturing solution contains 7 mol/L urea and 40% (v/v) formamide) and
increasing in the direction of electrophoresis. In each gel, samples were loaded in
alternate slots according to the presence or absence of apical periodontitis. For the
sake of alignment and comparisons between gels, a sample from a pool of
reference DNA from Enterococcus faecalis (ATCC 51299), Staphylococcus
epidermidis (ATCC 35984) and Pseudomonas aeruginosa (ATCC 27853) showing
multiple DGGE bands in earlier experiments was loaded in the first and last slot of
each gel.
DGGE Analysis
Individual lanes of the DGGE gel images were straightened and aligned with Gel
Compar II software, version 5.10 (Applied Maths, Kortrijk, Belgium). Dendrograms
for diverse comparisons of DGGE banding patterns were constructed with the
unweighted pair group method using arithmetic averages (UPGMA) following
calculation of the Pearson coefficient. A similarity level of 60% was arbitrarily
considered for cluster preview. The number of bands in cases with and without
post-treatment disease was also compared by using Student t-test (SPSS for
Microsoft Windows, V.9.0, Chicago, IL, USA). Prevalence of the most dominant
bands was also recorded.
RESULTS
All clinical samples yielded the amplicon of expected size after 16S rRNA gene-
based broad-range PCR, indicating the presence of bacterial DNA. Figure 1
depicts the community profiles of the clinical samples clustered in a dendrogram
according to the similarities among them. There was a large interindividual
variability and it was not possible to determine any specific pattern associated with
the clinical condition.
The mean number of bands, as an indicative of the number of bacterial
species, was higher in samples collected from cases with apical periodontitis
(mean, 10.9
+
2.4, ranging from 7 to 16) than cases with no disease (mean, 8.9
+
1.9, ranging from 5 to 11). This difference was statistically significant (p=0.04).
All samples presented several bands (strong and weak), indicating a
polymicrobial community. No band was found to occur in all samples. However, 6
different bands were visualized in more than 50% of the samples taken from root
canals of teeth with disease. One of these bands was visualized in 15 out of 23
(65%) samples analyzed. This band was observed more frequently in clinical
samples collected from cases with apical periodontitis (9/12, 75%) when compared
to samples without disease (6/11, 54.5%). As for the other 5 most prevalent bands
in diseased cases, the respective prevalences in cases with and without apical
periodontitis were 67% and 18%; 67% and 36%; 58% and 18%; 50% and 36%;
and 50% and 27%. Moreover, in 11/12 (92%) root canals of teeth with post-
treatment disease, at least 3 of these 5 bands were found together in the
same bacterial community.
DISCUSSION
The DGGE technique has been widely used to profile bacterial communities from
different environments and has been recently used for the study of endodontic
infections (Muyzer et al., 2003; Siqueira et al., 2005). Some studies observed
differences in the endodontic bacterial community profiles associated with apical
periodontitis when considering patients from distinct geographic regions (Oliveira et
al., 2007) or according to presence/absence of symptoms (Siqueira et al., 2004).
The rationale for bacterial species to be distinguished by the DGGE approach lies
in the fact that different bacterial species present different nucleotide sequences
within the variable regions of the 16S rRNA gene, making PCR amplicons migrate
differently in the DGGE gel. Theoretically, each band in the polycrylamide DGGE
gel represents a certain species, although it must be recognized that there are
several factors that may overestimate or underestimate the community diversity as
revealed by DGGE (Siqueira & Rôças, 2005).
The present study disclosed polymicrobial communities in treated root
canals, irrespective of the presence or absence of apical periodontitis. Occurrence
of mixed communities associated with treated teeth with post-treatment disease
has been previously reported by other studies using molecular biology technology
(Rôças et al., 2004b; Sakamoto et al., 2008). However, an apparently intriguing
finding was the detection of mixed communities also in teeth with no disease.
Considering that bacteria are the primary etiologic agent of post-treatment
apical periodontitis (Molander et al., 1998; Sakamoto et al., 2008; Siqueira &
Rôças, 2004; Sundqvist et al., 1998), a question therefore arises as to why some
cases harboring intracanal bacteria do not develop disease. One possible
explanation may be related to the intracanal bacterial populational density, i.e.,
bacteria may be present in quantities below the necessary to provoke significant
damage to the periradicular tissues. Further studies using sensitive quantitative
molecular biology techniques, such as the real-time PCR, are required to compare
bacterial counts in treated teeth with or without post-treatment disease and then
help elucidate this issue (Espy et al., 2006; Siqueira & Rôças, 2005).
Another explanation may reside in the spatial distribution of the community
within the root canal system. For instance, bacteria present in the coronal portions
of the canal may have been sampled by the method used in this study, which is
widely used for in vivo sampling of endodontic infections. In other words, the paper
point sampling technique does not distinguish the regions of the canal where
detected bacteria were colonizing. Therefore, bacteria present only in the coronal
region of the canal are detected but are not clinically relevant as they may have no
access to the periradicular tissues to cause disease. Ricucci et al., (2009)
evaluated histologically 51 root canal-treated teeth with no evidence of apical
periodontitis and observed bacteria in the coronal portion of the root canal in
almost all cases. They concluded that despite the presence of bacteria coronally,
apical tissue was seldom affected. Bacteria located only at the coronal portion of
the canal and not apically are very likely to be a result of saliva leakage through the
definitive or temporary coronal restoration, which was a common condition for
many of the teeth in the no disease group.
It also seems reasonable to speculate that bacteria under nutrient scarcity
conditions may have entered a dormant state or a state of low metabolic activity,
waiting to thrive again when the source of nutrients is reestablished. This may
never happen in well-treated canals, but these bacteria may still be detectable
during some time.
Another possibility is that the bacterial community associated with teeth with
no disease may present lower virulence ability as compared to that present in
cases with disease. This may be because of the original composition of the
community before treatment or due to perturbations in the community induced by
treatment (Siqueira & Rôças, 2008). Finally, one cannot rule out immunological
aspects involved in host resistance to infection as a factor influencing the presence
or absence of disease in treated canals that are positive for the presence of
bacteria (Kuramitsu et al., 2007).
A limitation of the present study relates to the limited diagnostic capacity of
periapical radiograph for detection of bone changes associated with apical
periodontitis (Huumonen & Ørstavik, 2002; Ricucci & Bergenholtz, 2003).
Conventional periapical radiograph lacks enough sensitivity to serve as a reliable
means for analysis of endodontic treatment outcome, since lesions restricted to the
cancellous bone may pass unnoticed on conventional radiographs, especially in
the posterior mandibular area (Bender, 1982). Therefore, the absence of a
radiolucency associated to the periradicular region of a root canal-treated tooth
does not necessarily prove that the periradicular tissues are actually free of
disease (Wu et al., 2009). In our study, cases were selected by using periapical
radiographs and lack of a community structure pattern associated with disease
may be related to such radiographic diagnostic limitations.
A great interindividual variability in endodontic bacterial communities was
observed, which is in agreement with previous studies using community profiling
techniques (Alves et al., 2009; Rôças et al., 2004a; Siqueira et al., 2004).
Although no disease-related community pattern was observed, the present
findings revealed that the number of bands (bacterial taxa) in teeth with
disease was significantly larger than in teeth with no disease. This results in
more complex communities, with resulting interactions that may influence
the pathogenicity of the bacterial consortium and the initiation or
maintenance of apical periodontitis.
Five bands (bacterial taxa) were found in higher prevalence in cases
with post-treatment disease. At least one of these bacteria have been found
in all diseased samples analyzed, and over 90% of cases harbor at least 3 of
them in the same community. No efforts were made to identify these species
by cutting out the bands from the gel and sequencing their DNA, since this
was not the scope of this study, which was primarily focused on community
analysis. Our further purpose is to look for the identitiy of species more
frequently found in diseased than in non-diseased cases. Based on our
previous reports on the same samples, E. faecalis is very unlikely to be one
of these species (Zoletti et al., 2006).
In conclusion, no significant pattern of bacterial community profile was
associated with root canal-treated teeth with or without apical periodontitis. This
does not mean that the composition of the microbiota is similar between these
conditions, but quite the opposite. They are so dissimilar that apparently very
different compositions can cause disease and raises the possibility for functional
redundancy in the community behavior. Identification of community members may
refine information to the point of detecting species more associated with disease
than with health, since our findings revealed bands more prevalent in samples with
apical periodontitis. Diseased cases harbored a more diverse community and the
number of bands was significantly higher in these samples.
Acknowledgments
This study was supported in part by grants from CAPES, CNPq, and FAPERJ,
Brazilian Governmental Institutions.
References
Alves, F.R., Siqueira, J.F. Jr, Carmo, F.L., Santos, A.L., Peixoto, R.S., Rôças,
I.N. & Rosado, A.S. (2009). Bacterial community profiling of cryogenically ground
samples from the apical and coronal root segments of teeth with apical
periodontitis. J Endod 35, 486-92.
Bender, I.B. (1982). Factors influencing the radiographic appearance of bone
lesions. J Endod 8, 161–70.
Espy, M.J., Uhl, J.R., Sloan, S.P., Buckwalter, S.P., Jones, M.F., Vetter, E.A.,
Yao, J.D., Wengenack, N.L., Rosenblatt, J.E., Cockerill, F.R 3
rd
& Smith, T.F.
(2006). Real-Time PCR in clinical microbiology: applications for routine laboratory
testing. Clin Microbiol Rev 19, 165-256.
Fabricius, L., Dahlén, G., Sundqvist, G., Happonen, R-P. & Moller, A.J.R.
(2006). Influence of residual bacterial on periapical tissue healing after
chemomechanical treatment and root filling of experimentally infected monkey
teeth. Eur J Oral Sci 114, 278-285.
Huumonen, S. & Ørstavik, D. (2002). Radiological aspects of apical periodontitis.
Endod Topics 1, 3–25.
Kaufman, B., Spängberg, L., Barry, J. & Fouad, A.F. (2005). Enterococcus spp.
in endodontically treated teeth with and without periradicular lesions. J Endod 31,
851-856.
Kuramitsu, H.K., He, X., Lux, R., Anderson, M.H. & Shi, W. (2007). Interspecies
interactions within oral microbial communities. Microbiol Mol Biol Rev 71, 653-670.
Li, Y., Ku, C.V., Xu, J., Saxena, D. & Caufield, P.W. (2005). Survey of oral
microbial diversity using PCR-based denaturing gradient gel electrophoresis. J
Dent Res 84, 559-564.
Li, Y., Saxena, D., Bernes, V.M., Trivedi, H.M., Ge, Y. & Xu, T. (2006).
Polymerase chain reaction-based denaturing gradient gel electrophoresis in the
evaluation of oral microbiota. Oral Microbiol Immunol 21, 333-339.
Molander, A., Reit, C., Dahlén, G. & Kvist, T. (1998). Microbiological status of
root-filled teeth with apical periodontitis. Int Endod J 31, 1-7.
Muyzer, G., de Waal, E.C. & Uitterlinden, A.G. (1993). Profiling of complex
microbial populations by denaturing gel eletrctrophoresis analysis of polymerase
chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59,
695-700.
Nübel, U., Engelen, B., Felske, A., Snaidr, J., Wieshuber, A., Amann, R.I.,
Ludwig, W. & Backhaus, H. (1996). Sequence heterogeneities of genes encoding
16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel
electrophoresis. J Bacteriol 178, 5636-5643.
Oliveira, J.C.M., Siqueira, J.F. Jr, Rôças, I.N., Baumgartner, J.C., Xia, T.,
Peixoto, R.S. & Rosado, A.S. (2007). Bacterial community profiles of endodontic
abscesses from Brazilian and USA subjects as compared by DGGE analysis. Oral
Microbiol Immunol 22, 14-18.
Ricucci, D. & Bergenholtz, G. (2003). Bacterial status in root-filled teeth exposed
to the oral environment by loss of restoration and fracture or caries – a
histobacteriological study of treated cases. Int Endod J 36, 787–802.
Ricucci, D., Lin, L.M. & Spängberg, L.S.W. (2009). Wound healing of apical
tissues after root canal therapy: a long-term clinical, radiographic, and
histopathologic observation. Oral Surg Oral Med Oral Pathol Oral Radiol Endod
108, 609-621.
Rôças, I.N., Siqueira, J.F. Jr, Aboim, M.C. & Rosado A.S. (2004a). Denaturing
gradient gel electrophoresis analysis of bacterial communities associated with
failed endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 98,
741-749.
Rôças, I.N., Siqueira, J.F. Jr & Santos, K.R.N. (2004b). Association of
Enterococcus faecalis with different forms of periradicular diseases. J Endod 30,
315-320.
Sakamoto, M., Siqueira, J.F. Jr, Rôças, I.N. & Benno, Y. (2007). Bacterial
reduction and persistence after endodontic treatment procedures. Oral Microbiol
Immunol 22, 19–23.
Sakamoto, M., Siqueira, J.F. Jr, Rôças, I.N. & Benno, Y. (2008). Molecular
analysis of the root canal microbiota associated with endodontic treatment failures.
Oral Microbiol Immunol 23, 275-81.
Siqueira, J.F. Jr & Rôças, I.N. (2004). Polymerase chain reaction-based analysis
of microorganisms associated with failed endodontic treatment. Oral Surg Oral
Med Oral Pathol Oral Radiol Endod 97, 85–94.
Siqueira, J.F. Jr, Rôças, I.N. & Rosado, A.S. (2004). Investigation of bacterial
communities associated with asymptomatic and symptomatic endodontic infections
by denaturing gradient gel electrophoresis fingerprinting approach. Oral Microbiol
Immunol 19, 363-370.
Siqueira, J.F. Jr & Rôças, I.N. (2005). Exploiting molecular methods to explore
endodontic infections: part 1 – current molecular technologies for microbiological
diagnosis. J Endod 31, 411-423.
Siqueira, J.F. Jr, Paiva, S.S.M. & Rôças, I.N. (2007). Reduction in the cultivable
populations in infected root canals by a chlorhexidine-based antimicrobial protocol.
J Endod 33, 541-547.
Siqueira, J.F. Jr & Rôças, I.N. (2008). Clinical implications and microbiology of
bacterial persistence after treatment procedures J Endod 34, 1291-1301.
Sjögren, U., Figdor, D., Persson, S. & Sundqvist, G. (1997). Influence of
infection at the time of root filling on the outcome of endodontic treatment of teeth
with apical periodontitis. Int Endod J 30, 297-306.
Sundqvist, G., Figdor, D., Persson, S. & Sjögren, U. (1998). Microbiologic
analysis of teeth with failed endodontic treatment and the outcome of conservative
retreatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 85, 86-93.
Wu, M-K., Shemesh, H. & Wesselink, P.R. (2009). Limitations of previously
published systematic reviews evaluating the outcome of endodontic treatment. Int
Endod J 42, 656–666.
Zoletti, G.O., Siqueira, J.F. Jr & Santos, K.R.N. (2006). Identification of
Enterococcus faecalis in root-filled teeth with or without periradicular lesions by
culture dependent and—independent approaches. J Endod 32, 722-726.
Figure 1 – Dendrogram obtained by the UPGMA method for clustering of DGGE
banding patterns of samples from root canal-treated teeth with or without post-
treatment apical periodontitis.
IV. Discussão
A persistência bacteriana é a principal responsável pelo fracasso da terapia
endodôntica. Entretanto, relatos clínicos passaram a observar a presença
bacteriana dentro dos canais radiculares mesmo em casos sem lesão
perirradicular. E. faecalis é o micro-organismo mais encontrado em canais
tratados. Devido a esta elevada freqüência, seu papel na falha do tratamento
endodôntico vem sendo investigado. Esta ocorrência tem sido observada
através do uso de métodos moleculares, tanto em infecções primárias como
nas persistentes (ROÇAS et al., 2004; SASSONE et al., 2007). Tais
métodos permitiram também a identificação de uma maior diversidade de
micro-organismos nas infecções persistentes (SIQUEIRA & RÔÇAS, 2005c)
e a identificação de espécies novas em infecções endodônticas, bem como
a detecção de espécies não-cultiváveis (SIQUEIRA & RÔÇAS, 2005b).
Zoletti, Siqueira e Santos (2006) também descreveram uma maior
sensibilidade dos testes moleculares na detecção de E. faecalis em dentes
com canais tratados em comparação com o cultivo do micro-organismo
(p<0,001) (Artigo 1; Anexo 1).
No entanto, o papel do E. faecalis na patogênese da doença
perirradicular continua incerto. Kaufman e colaboradores (2005), analisando
dentes com canais tratados com e sem lesão perirradicular, observaram
uma associação significativa entre a detecção de E. faecalis e dentes com
canais dentários tratados. Os autores concluíram que, apesar da
associação do patógeno com canais tratados, não foi observada relação
com doença perirradicular. Esta associação também não foi observada por
Zoletti, Siqueira e Santos (2006), uma vez que não houve diferença
significativa na detecção do E. faecalis em canais dentários tratados com e
sem lesão perirradicular (Artigo 1).
Na tentativa de esclarecer essa duvidosa associação, diversos
aspectos passaram a ser analisados. Uma possível participação do E.
faecalis na etiologia do fracasso do tratamento endodôntico pode estar
relacionada com sua capacidade de sobreviver em ambiente com escassez
nutricional (SIQUEIRA et al., 1997; LOVE, 2001). Além disso, E. faecalis
pode penetrar nos túbulos dentinários (SIQUEIRA, DE UZEDA &
FONSECA, 1996), e permanecer viável por 60 dias (VIVACQUA-GOMES et
al., 2005) até 12 meses (SEDGLEY, LENNAN et al., 2005) como já
observado em dentes ex vivo. Tal capacidade permite o E. faecalis evadir
da ação do tratamento endodôntico.
Além das características de resistência e capacidade de sobreviver ao
tratamento endodôntico, E. faecalis apresenta características de virulência
que podem habilitá-lo a permanecer no canal dentário e, direta ou
indiretamente, causar danos aos tecidos perirradiculares. Entre os fatores
de virulência, os que têm maior potencial para participar da colonização
bacteriana em canais dentários, com possível envolvimento no
desenvolvimento e perpetuação da lesão perirradicular são os fatores
associados à adesão dentinária, formação de biofilme e inflamação
perirradicular (KRISTICH et al., 2004; SEDGLEY et al.,2004).
No presente estudo (Artigo 2), alguns fatores de virulência com tais
características foram analisados. Contudo, dentre eles, os que
apresentaram dados significantes e foram melhor avaliados foram a
gelatinase e a proteína de superfície enterocócica (Esp). Todas as 20 cepas
de E. faecalis isoladas de canais radiculares tratados apresentaram o gene
gelE, identificado por PCR, mas apenas 10 (50%) das amostras
hidrolisaram a gelatina no teste fenotípico (Anexo 2). Cabe ressaltar que
não foi determinada uma possível relação da gelatinase com a perpetuação
e formação de periodontite apical, apesar da produção de gelatinase ter
ocorrido em 70% (7/10) das cepas isoladas de dentes com a doença, em
comparação com apenas 30% (3/10) em amostras de dentes sem lesão
(Tabela 2, Artigo 2). Sedgley, Molander e colaboradores (2005), também
detectaram a produção deste fator de virulência em apenas 33% das
amostras isoladas de infecções persistentes e/ou secundárias que
apresentaram o gene gelE. Os autores analisaram ainda a produção da
gelatinase de E. faecalis isolados de outros sítios da cavidade bucal,
sugerindo uma possível participação da enzima na formação do biofilme
bacteriano.
Um aspecto interessante na produção da gelatinase é a relação com
o locus fsr, o qual regula sua expressão por um sistema “quorum sensing”.
Nossos resultados mostraram que apenas as amostras que apresentaram o
gene ef1841/fsr, indicativo da deleção de 23,9 kb na sequência do gene fsr
(ROBERTS et al., 2004), não expressaram a gelatinase.
Segundo alguns autores, a gelatinase, de fato, pode estar relacionada
à persistência de bactérias no canal radicular, influenciando na formação do
biofilme pelo E. faecalis nas infecções endodônticas (HANCOCK &
PEREGO 2004; KRISTICH et al., 2004). Em nosso estudo (Artigo 2), os
resultados obtidos após análise quantitativa da produção de biofilme permitiu
inferir uma possível relação entre produção de gelatinase, formação de
biofilme e persistência bacteriana no canal radicular, uma vez que, das 7
cepas que hidrolisaram a gelatina isoladas de dentes com periodontite
apical, 5 apresentaram um perfil de produção de biofilme entre moderado e
forte. Embora o papel da gelatinase na formação do biofilme continue sendo
ainda desconhecido, Kristich e colaboradores (2004) descreveram os
possíveis modelos desta relação: a gelatinase pode participar na produção
de um peptídeo de sinalização extracelular através da proteólise de um
precursor peptídico inativo secretado ou pode proteoliticamente ativar uma
outra proteína de superfície envolvida na regulação do processo de
formação de biofilme.
Em nosso estudo, outro fator de virulência analisado que apresentou
aspectos relevantes quanto a uma possível associação do E. faecalis e a
persistência endodôntica foi a proteína de superfície enterocócica (Esp). O
gene esp que codifica a Esp foi encontrado em 40% (8 / 20) das cepas
analisadas, sendo 5 em dentes sem lesão e 3 em dentes com doença pós-
tratamento endodôntico. Sedgley, Molander e colaboradores (2005),
também detectaram este gene em apenas 2 de 6 amostras de E. faecalis
isoladas de canais radiculares tratados. Em nosso estudo, a detecção da
produção da proteína Esp foi confirmada através de western blotting (Anexo
3) e os resultados mostraram que apenas 1 das 8 cepas isoladas, na qual
foi identificado o gene esp, expressava este fator de virulência. Por outro
lado, a produção dessa proteína foi detectada em todas as amostras que
não produziram gelatinase, com exceção de 3 casos sem periodontite apical
(Tabela 2, Artigo 2). Apesar do gene esp ter ocorrido de forma semelhante
em casos sem (40%) e com (30%) periodontite apical pós-tratamento
endodôntico, é possível que exista uma relação entre este fator de
virulência e a presença de E. faecalis no canal radicular, em particular
naqueles com lesão, já que todas as amostras isoladas de dentes com
doença foram positivas para Esp ou gelatinase. A proteína Esp poderia
atuar como uma ferramenta alternativa na colonização do micro-organismo
em canais dentários na ausência da produção de gelatinase.
Estudos recentes têm demonstrado que a presença da proteína Esp
não é determinante para a formação do biofilme, mesmo quando associada
a outros fatores de virulência (CARNIOL & GILMORE, 2004; KRISTICH et
al., 2004). Nossos resultados obtidos a partir da análise da produção de
biofilme por cepas de E. faecalis reforçam esta observação, uma vez que 5
das 7 cepas que expressavam a proteína Esp foram classificadas como
fracas produtoras de biofilme. Apesar disso, tais cepas foram isoladas de
canais dentários com infecção persistente e/ou secundária, sendo assim,
resistentes a um ambiente pobre de nutrientes e evadindo ao tratamento
endodôntico.
Os demais genes de virulência investigados possivelmente
relacionados à persistência de E. faecalis em infecções endodônticas não
apresentaram aparente associação com relação à presença ou ausência de
periodontite apical (Tabela 2, Artigo 2). Os genes efaA e ace foram
encontrados em 90% (18) das amostras, percentual este já detectado de
forma semelhante em amostras de E. faecalis isoladas de canais dentários
(SEDGLEY, MOLANDER et al., 2005; REYNAUD AF GEIJERSSTAM et al.,
2007). Entretanto, tanto o gene agg encontrado em 45% (9) das amostras,
como o gene cpd detectado em 95% (19), são os primeiros relatos da
presença destes genes em infecções endodônticas (Anexos 4, 5, 6, 7).
A análise do polimorfismo de DNA genômico através de rep-PCR
permitiu a distribuição das 20 cepas isoladas de canais tratados em 8
diferentes genótipos (Artigo 2). Dois segmentos de DNA de cerca de 1.200
e 1.300 pb foram encontrados em todas as cepas de E. faecalis analisadas
e são característicos da espécie enterocócica, como relatado anteriormente
por Namdari e Del Vecchio (1998) (Anexo 8). Através dessa técnica, 10 das
cepas analisadas, todas com lesão perirradicular associada, foram divididas
em dois grupos principais (genótipos “a” e “b”). No entanto, esta análise do
polimorfismo bacteriano não apresentou um poder discriminatório menor
quando comparada aos resultados obtidos através de PFGE. Grande parte
das cepas clínicas que apresentaram o mesmo genótipo por rep-PCR
mostraram perfis genotípicos distintos por PFGE (Figura 1, Artigo 2). Esta
diferença pode estar relacionada à baixa reprodutibilidade e ao pequeno
número de bandas geradas na técnica de rep-PCR (MALATHUM et al.,
1998).
Na análise através da técnica de PFGE as 20 cepas de E. faecalis
resultaram em 18 perfis de restrição agrupados em 14 diferentes genótipos.
Cerca de 50% das cepas foram incluídas em cinco genótipos (A a E).
Apesar da grande diversidade clonal encontrada entre as cepas de E.
faecalis, quatro destas amostras incluídas em dois genótipos (A e B) foram
classificados como similares por ambas as técnicas, rep-PCR e PFGE. De
fato, as amostras 35RW e 37RW (genótipo A) eram provenientes de dentes
diferentes, porém de um mesmo paciente. Tal fato também ocorreu com as
amostras 50RN e 55RN (genótipo B). Os outros três genótipos (C, D e E),
provenientes de pacientes distintos, apresentaram subtipos estreitamente
relacionados entre si. Duas cepas de cada um dos genótipos C e D foram
isoladas a partir de canais radiculares com e sem periodontite apical,
enquanto as cepas do genótipo E foram isoladas de casos sem doença.
Exceto para as cepas do genótipo E, as demais apresentaram aspectos de
virulência e padrões de biofilme distintos, apesar de perfis semelhantes de
produção de gelatinase e Esp, demonstrando a variabilidade genética das
cepas de E. faecalis isoladas de canais dentários tratados.
Com o objetivo de conhecer melhor as infecções persistentes e/ou
secundárias, analisamos a comunidade bacteriana nestas infecções em
espécimes clínicos isolados de canais tratados com e sem periodontite
apical associada. Tal análise foi realizada através da técnica de DGGE.
Esta técnica tem sido amplamente utilizada na análise do perfil de
comunidades bacterianas em diferentes ambientes e tem sido utilizada
recentemente para o estudo das infecções endodônticas (NÜBEL,
ENGELEN, FELSKE et al., 1996; SIQUEIRA et al., 2005). Alguns estudos
observaram diferenças nos perfis das comunidades bacterianas de
amostras coletas de infecções endodônticas com periodontite apical
associada, de pacientes de diferentes regiões geográficas (OLIVEIRA,
SIQUEIRA, RÔÇAS et al., 2007) e de acordo com a presença/ausência de
sintomas clínicos (SIQUEIRA, RÔÇAS & ROSADO, 2005). A justificativa para
espécies bacterianas serem distinguidas pela DGGE reside no fato de que
diferentes espécies apresentam distintas seqüências de nucleotídeos dentro
das regiões variáveis do gene 16S rRNA, fazendo com que fragmentos
amplificados pela PCR migrem de forma diferente no gel de DGGE.
Teoricamente, cada banda no gel de DGGE representa uma determinada
espécie bacteriana, embora seja preciso reconhecer que existam vários
fatores que podem superestimar ou subestimar a diversidade da
comunidade (SIQUEIRA & RÔÇAS, 2005b).
No presente estudo (Artigo 3) foram analisadas comunidades
polimicrobianas em canais radiculares tratados, incluindo-se casos com e
sem periodontite apical. Verificamos um aspecto polimicrobiano das
comunidades nos casos com e sem a doença. Contudo, o número de
bactérias presentes nos casos com periodontite apical foi estatisticamente
maior do que o encontrado em dentes sem lesão (p=0,04). Além disso,
cinco bactérias foram mais freqüentes em comunidades bacterianas de
canais tratados com lesão, quando comparadas a comunidade de dentes
sem a doença. Apesar da ocorrência de comunidades mistas em dentes
com doença pós-tratamento endodôntico ter sido relatada em alguns
estudos (RÔÇAS, SIQUEIRA, ABOIM et al., 2004; SAKAMOTO et al., 2008),
este tipo de investigação não havia sido realizado em dentes sem lesão
perirradicular. A detecção de comunidades mistas também em dentes sem
a doença pode sugerir que o perfil populacional bacteriano pode interferir no
desenvolvimento da periodontite apical (Anexo 9).
Tal conceito de comunidade como um conjunto de populações que
coexistem e interagem em um determinado ambiente com o objetivo de
sobrevivência reforça que a qualidade destas comunidades possa interferir e
justificar as várias combinações de bactérias no desempenho da patogenicidade
perirradicular. Desta forma, a identificação dos membros da comunidade pode ser
determinante no desenvolvimento de algumas formas da doença e que,
dependendo da intensidade ou ausência dos sintomas, podem estar relacionadas
com composições de comunidades específicas (KURAMITSU et al, 2007;
SIQUEIRA & RÔÇAS, 2009a).
Considerando-se que as bactérias são o principal agente etiológico de
periodontite apical pós-tratamento endodôntico (MOLANDER et al., 1998;
SUNDQVIST et al., 1998; SIQUEIRA & RÔÇAS, 2004; SAKAMOTO et al., 2008),
uma questão que se coloca é por que alguns pacientes, apesar de
abrigarem bactérias intracanal, não desenvolvem a doença. Uma possível
explicação pode estar relacionada com a densidade populacional bacteriana
intracanal, ou seja, as bactérias podem estar presentes em quantidade
abaixo do necessário para provocar prejuízos significativos aos tecidos
perirradiculares. Estudos quantitativos que utilizem técnicas mais sensíveis
de detecção, como a PCR em tempo real, seriam necessários para
comparar o número de bactérias nos dentes tratados com ou sem doença
pós-tratamento e ajudar a elucidar esta questão (BENDER 1982; SIQUEIRA &
RÔÇAS, 2005b).
Outra explicação pode residir na distribuição espacial da comunidade
dentro do sistema de canal radicular. Por exemplo, o método de coleta,
amplamente utilizado nas infecções endodônticas, pode permitir a obtenção
apenas de bactérias presentes na porção coronária do canal dentário. Em
outras palavras, a técnica de coleta utilizando papel absorvente, não
distingue a região do canal na qual foram coletadas as bactérias. Logo, os
micro-organismos presentes apenas na região coronária podem não se
apresentar clinicamente relevantes na patogenicidade apical por não terem
acesso ao tecido perirradicular. Ricucci e colaboradores (2009) avaliaram
histologicamente 51 canais tratados, sem evidência de periodontite apical, e
observaram bactérias na porção coronária do canal radicular em quase
todos os casos. Eles concluíram que, apesar da presença de bactérias
nesta região, o tecido apical raramente era afetado. Uma possível infiltração
de saliva através da restauração coronária definitiva ou temporária poderia
justificar a detecção de bactérias nesta região analisada.
Outras possíveis explicações microbiológicas podem justificar a não
perpetuação ou desenvolvimento de lesão perirradicular por parte daquelas
bactérias remanescentes. Uma vez em escassez nutricional tais bactérias podem
assumir um estado de latência ou um estado de baixa atividade metabólica, a
prosperar novamente quando a fonte de nutrientes for restabelecida. Ressalta-se
ainda que as bactérias remanescentes podem não expressar fatores de virulência
em um ambiente inerte, não atingindo assim concentrações suficientes para
provocar danos aos tecidos perirradiculares. Cabe por fim destacar que, apesar da
possível ocorrência de todos estes atributos microbiológicos, não se pode
descartar os aspectos imunológicos envolvidos na resistência do hospedeiro a
estas infecções (KURAMITSU et al, 2007).
Uma restrição do presente estudo refere-se à limitada capacidade de
diagnóstico da radiografia periapical para a detecção de alterações ósseas
associadas com periodontite apical (HUUMONEN & ØRSTAVIK, 2002;
RICUCCI & BERGENHOLTZ, 2003). As radiografias periapicais convencionais
não têm sensibilidade suficiente para servirem como um meio confiável na
análise dos resultados do tratamento endodôntico, uma vez que lesões
restritas ao osso esponjoso podem passar despercebidas nas radiografias
convencionais, especialmente na área posterior da mandíbula (BENDER
1982). Portanto, a ausência de uma imagem radiolúcida associada à região
perirradicular de um canal tratado não prova que o tecido perirradicular
esteja livre da doença. Uma evidência definitiva de cura periapical só pode
ser obtida com o auxílio de testes histológicos e tomografia computadorizada
(WU et al, 2009). Em nossos estudos (Artigos 1, 2 e 3), os casos foram
selecionados apenas por meio de radiografias periapicais, o que pode ter
influenciado na definição dos casos estudados quanto à presença ou
ausência de lesão, e conseqüentemente, na análise dos resultados
encontrados.
Os resultados encontrados no presente estudo, como a elevada
variabilidade genômica observada entre as amostras de E. faecalis isoladas, a
distribuição aleatória de genes e fatores de virulência e a diversidade das
comunidades bacterianas observadas em canais tratados com e sem lesão
perirradicular demonstram a necessidade cada vez maior de se analisar o aspecto
populacional e as interações bacterianas presentes no canal dentário, ao invés de
se procurar um protagonista, no possível fracasso do tratamento endodôntico.
Conclusões
1- O método de PCR do 16S rRNA gene específico apresentou maior
sensibilidade (80%) quando comparado à metodologia convencional (16%) na
detecção de E. faecalis a partir de canais dentários tratados com e sem lesão
perirradicular (p < 0,001).
2- Todas as 20 amostras de E. faecalis isoladas de canais dentários
tratados apresentaram o gene gelE, porém apenas 10 hidrolisaram a
gelatina, sendo 7 de dentes com periodontite apical. Em 8 (40%) das
amostras foi detectado o gene esp, das quais 7 produziram a proteína Esp,
detectadas por western-blotting. Todas as amostras que não hidrolisaram a
gelatina foi detectada a produção da proteína Esp, exceto em 3 casos sem
periodontite apical, demonstrando que Esp poderia atuar como uma
ferramenta alternativa do micro-organismo na colonização de canais
dentários na ausência da produção de gelatinase.
3- Apesar da técnica de rep-PCR ter definido apenas 8 genótipos, a
mesma agrupou 10 (50%) amostras de E. faecalis isoladas de canais
tratados com lesão em dois genótipos (“a” e “b”). A metodologia de PFGE
mostrou um maior poder discriminatório. Esta técnica agrupou as 20
amostras analisadas em 14 diferentes genótipos, entre os quais cinco (A até
E) representaram 50% das amostras. Estas cepas apresentarem o mesmo
perfil de virulência para gelatinase e Esp.
4- Não foi observada associação entre o perfil de comunidade
bacteriana e periodontite apical. Contudo, o número de bandas, cada uma
representando um micro-organismo diferente, nas comunidades analisadas,
foi significativamente maior quando comparado ao número de casos sem
doença (p=0,04). Além disso, cinco bandas foram encontradas em maior
prevalência nos casos com doença pós-tratamento endodôntico.
Referências Bibliográficas
ABDULLAH, M.; CLINDENT, M.; NG, Y-L.; GULABIVALA, K.; MOLES, D. &
SPRATT, D.A. Susceptibilties of two Enterococcus faecalis phenotypes to
root canal medications. J. Endod. 31: 30-36, 2004.
ADIB, V.; SPRATT, D.; NG, Y-L & GULABIVALA, K. Cultivable microbial flora
associated with persistent periapical disease and coronal leakage after root
canal treatment: a preliminary study. Int. Endod. J. 37: 542-551, 2004.
ALVES, F.R.; SIQUEIRA, J.F. Jr; CARMO, F.L.; SANTOS, A.L.; PEIXOTO, R.S.;
RÔÇAS, I.N.; ROSADO, A.S. Bacterial community profiling of cryogenically
ground samples from the apical and coronal root segments of teeth with
apical periodontitis. J. Endod. 35: 486-92, 2009.
ARCHIMABAUD, C.; SHANKAR, N.; FORESTIER, C.; BAGHDAYAN, A.;
GILMORE, M.S.; CHARBONNÉ, F. & JOLY, B. In vitro adhesive properties and
virulence factors of Enterococcus faecalis strains. Res. Microbiol. 153: 75-80,
2002.
BALDASSARRI, L.; CRETI, R.; ARCIOLA, C.R.; MONTANARO, L.; VENDITTI, M.
& DI ROSA, R. Analysis of virulence factors in cases of enterococcal
endocarditis. Clin. Microbiol. Infect. 10: 1006-1008, 2004.
BENDER, I.B. Factors influencing the radiographic appearance of bone
lesions. J. Endod. 8: 161–70, 1982.
BLOME, B.; BRAUN, A.; SOBARZO, V. & JEPSEN, S. Molecular identification
and quantification of bacteria from endodontic infections using real-time
polymerase chain reaction. Oral Microbiol. Immunol. 23: 384-90, 2008.
CARNIOL, K. & GILMORE, M. Signal transduction, quorum-sensing, and
extracellular protease activity in Enterococcus faecalis biofim formation. J.
Bacteriol. 186: 8161-8163, 2004.
CHOW, J.W.; THAL, L.A.; PERRI, M.B.; VAZQUEZ, J.A.; DONABEDIAN, S.M.;
CLEWELL, D.B. & ZERVOS, M.U. Plasmid-associated hmolysin and
aggregation substance production contribute to virulence in experimental
enterococcal endocarditis. Antimicrob. Agents Chemother. 37: 2474-2477, 1993.
COLOMBO, A.P.; HAFFAJEE, A.D.; DEWHIRST, F.E.; PASTER, B.J.; SMITH,
C.M.; CUGINI, M.A. & SOCRANSKY, S.S. Clinical and microbiological features
of refractory periodontitis subjects. J. Clin. Periodontol. 25: 169-180, 1998.
COLURN, P.S.; PILLAR, C.M.; JETT, B.D.; HAAS, W. & GILMORE, M.S.
Enterococcus faecalis senses target cells and in response expresses
cytilysin. Science 306: 2270-2272, 2004.
CONRADS, G.; GHARBIA, S.E.; GULABIVALA, K.; LAMPERT, F. & SHAH, H.N.
The use of a 16 rDNA PCR for the detection of endodontopathogenic
bacteria. J. Endod. 23: 433-438, 1997.
COQUE, T.M.; PATTERSON, J.E.; STECKLBERG, J.M. & MURRAY, B.E.
Incidence of hemolysin, gelatinase, and aggregation substance among
enterococci isolated from patients with endocarditis and other infections and
from feces of hospitalized and community-based persons. J. Infect. Dis. 171:
1223-1229, 1995.
DAHLÉN, G.; SAMUELSSON, W.; MOLANDER, A. & REIT, C. Identification and
antimicrobial susceptibility of enterococci isolated from the root canal. Oral
Microbiol. Immun. 15: 309-312, 2000.
DISTEL, J.W.; HATTON, J.F. & GILLESPIE, M.J. Biofilm formation in medicated
root canals. J. Endod. 28: 689-693, 2002.
DUNNY, G.M.; LEONARD, B.A. & HEDBERD, P.J. Pheromone-inducible
conjugation in Enterococcus faecalis: interbacterial and host-parasite
chemical communication. J. Bacteriol. 177: 871-876, 1995.
DUPONT, H.; MONTRAVERS, P.; MOHLER, J. & CARBON, C. Disparate
findings on the role of virulence factors of Enterococcus faecalis in mouse
and rat models of peritonitis. Infect. Immun. 66: 2570-2575, 1998.
EATON, T.J. & GASSON, M.J. Molecular screening of Entercoccus virulence
determinants and potential for genetic exchanges between food and medical
isolates. Appl. Environ. Microbiol. 67: 1628-35, 2001.
ELSNER, H-A; SOBOTTKA, I.; MARCK, M.; CLAUSSEN, M.; LAUFS, R. &
WIRTH, R. Virulence factors of Enterococcus faecalis and Enterococcus
faecium blood culture isolates. Eur. J. Clin. Microbiol. Infect. Dis. 19: 39-42,
2000.
ENGELBERT, M.; MYLONAKIS, E.; AUSUBEL, F.M.; CALDERWOOD, S.B. &
GILMORE, M.S. Contribution of gelatinase, serine protease, and fsr to the
pathogenesis of Enterococcus faecalis endophthalmitis. Infect. Immun. 72:
3628-3633, 2004.
ENGSTRÖM B. The significance of enterococci in root canal treatment.
Odontol. Revy 15: 87-106, 1964.
EVANS, M.; DAVIES, J.K.; SUNDQVIST, G. & FIGDOR, D. Mechanisms
envolved in the resistence of Enterococcus faecalis to calcium hydroxide. Int.
Endod. J. 35: 221-228, 2002.
FABRICIUS, L.; DAHLÉN, G.; SUNDQVIST, G.; HAPPONEN, R-P.; MOLLER,
A.J.R. Influence of residual bacterial on periapical tissue healing after
chemomechanical treatment and root filling of experimentally infected
monkey teeth. Eur. J. Oral Sci. 114: 278-285, 2006.
FACKLAM, R.R. & TEIXEIRA, L.M. Enterococcus. In: Collier, L., Ballows, A. &
Susman, M. (ed). Topley and Wilson’s Microbiology and Microbial Infections. 9
th
ed.
Edward Arnold. London, United Kindon, p. 669-682, 1998.
FIGDOR, D.; DAVIES, J.K. & SUNDQVIST, G. Starvation survival, growth and
recovery of Enterococcus faecalis in human serum. Oral Microb. Immunol. 18:
234-239, 2003.
FOUAD, A.F.; BARRY, J.; CAIMANO, M.; CLAWSON, M.; ZHU, Q.; CARVER, R.;
HAZLETT, K. & RADOLF, J.D. PCR-based identification of bacteria associated
with endodontic infections. J. Clin. Microbiol. 40: 3223-3231, 2002.
GILMORE, M.S.; SEGARRA, R.A.; BOOTH, M.C.; BOGIE, C.P.; HALL, L.R. &
CLEWELL, D.B. Genetic structure of the Enterococcus faecalis plasmid
pAD1-encoded cytilytic toxin system and its relationship to lantibiotic
determinants. J. Bacteriol. 176: 7335-7344, 1994.
GOMES, B.P.F.A.; PINHEIRO, E.T.; GADÊ-NETO, C.R.; SOUZA, E.L.R.;
FERRAZ, C.C.R.; ZAIA, A.A.; TEIXEIRA, F.B. & SOUZA-FILHO, F.J.
Microbiological examination of infected dental root canals. Oral Microbiol.
Immunol. 19: 71-76, 2004.
GORDILLO, M.E.; SINGH, K.V.; BAKER, C.J. & MURRAY, B.E. Typing of Group
B streptococci: comparison of pulsed-field gel electrophoresis and
conventional electrophoresis. J. Clin. Microbiol. 31: 1430-1434, 1993.
HAAPASALO, M.; RANTA, H. & RANTA, K.T. Facultative gram-negative enteric
rods in persistent periapical infections. Acta Odont. Scand. 41: 19-22, 1983.
HALL, L.M.C.; DUKE, B.; URWIN, G. & GUINEY, M. Epidemiology of
Enterococcus faecalis urinary tract infection in a teaching hospital in
London, United Kingdom. J. Clin. Microbiol. 30: 1953-1957, 1992.
HANCOCK, L.E. & PEREGO, M. The Enterococcus faecalis fsr two-component
system controls biofilm development through production of gelatinase. J.
Bacteriol. 186: 5629-5639, 2004.
HANCOCK, H.H.; SIGURDSSON, A.; TROPE, M. & MOISEIWITSCH, J. Bacteria
isolated after unsucessul endodontic treatment in a North American
population. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 5: 579-589,
2001.
HARTKE, A.; GIARD, J.C.; LAPLACE, J.M. & AUFFRY, Y. Survival of
Enterococcus faecalis in an oligotrophic microcosm: changes in
morphology, development of general stress resistance, and analysis of
protein synthesis. Appl. Environ. Microbiol. 64: 4238-4245, 1998.
HAAS, W.; SHEPARD, B.D. & GILMORE, M.S. Two-component regulator of
Enterococcus faecalis cytolysin responds to quorum–sensing autoinduction.
Nature 415: 84-87, 2002.
HUBBLE, T.S.; HATTON, J.F.; NALLAPAREDDY, S.R.; MURRAY, B.E. &
GILLESPLE, M.J. Influence of Enterococcus faecalis proteases and the
collagen-binding protein, Ace, on adhesion to dentin. Oral Microbiol. Immunol.
18: 121-126, 2003.
HUUMONEN, S. & ØRSTAVIK, D. Radiological aspects of apical periodontitis.
Endod. Topics 1: 3–25, 2002.
IKE, Y. & CLEWELL, D.B. Evidence that the hemolysin/bacteriocin phenotype
of Enterococcus faecalis subsp. Zymogenes can be determined by plasmids
in different incompatibility groups as well as by the chromosome. J. Bacteriol.
174: 8172-8174, 1992.
JETT, B.D.; HUYCKE, M.M. & GILMORE, M.S. Virulence of enterococci. Clin.
Microbiol. Rev. 7: 462-478, 1994.
JIANS, X. & CHAI, T. Survival of Vibrio parahaemolyticus at low temperatures
under starvation conditions and subsequent resuscitation of viable
nonculturable cells. Appl. Environ. Microbiol. 62: 1300–1305, 1996.
JUNG, I.Y.; CHOI, B.K.; KUM, K.Y.; YOO, T.C. & LEE, C.Y. Identification of oral
spirochetes at the species level and their association with other bacteria in
endodontic infections. Oral Surg. Oral Med. Oral Pathol. Oral Radio. Endod. 92:
329-334, 2001.
KAKEHASHI, S.; STANLEY, H.R. & FITZGERLD, R.J. The effects of surgical
exposures of dental pulps in germ-free and conventional laboratory rats. Oral
Surg. Oral Med. Oral Pathol. 18: 340-348, 1965.
KAUFMAN, B.; SPÄNGBERG, L.; BARRY, J. & FOUAD, A. F. Enterococcus spp.
in endodontically treated teeth with and without periradicular lesions. J.
Endod. 31: 851-856, 2005.
KOCH, S.; HUNFNAGEL, M.; THEILACKER, C. & HUEBNER, J. Enterococcal
infections: host response, therapeutic and prophylatic possibilities. Vaccine
22: 822-830, 2004.
KRISTICH, C.J.; LI, Y.H.; CVITKOVITCH, D.G. & DUNNY, G.M. Esp-independent
biofilm formation by enterococcus faecalis. J. Bacteriol. 186: 154-163, 2004.
KURAMITSU, H.K.; HE, X.; LUX, R.; ANDERSON, M.H. & SHI, W. Interspecies
interactions within oral microbial communities. Microbiol. Mol. Biol. Rev. 71:
653-670, 2007.
LI, Y.; KU, C.V.; XU, J.; SAXENA, D. & CAUFIELD, P.W. Survey of oral microbial
diversity using PCR-based denaturing gradient gel electrophoresis. J. Dent.
Res. 84: 559-564, 2005.
LI, Y.; SAXENA, D.; BARNES, V.M.; TRIVEDI, H.M.; GE, Y. & XU, T. Polymerase
chain reaction-based denaturing gradient gel electrophoresis in the
evaluation of oral microbiota. Oral Microbiol. Immunol. 21: 333-339, 2006.
LIN, L.M.; PASCON, E.A.; SKRINBNER, J.; GÄNGLER, P. & LANGELAND, K.
Clinical, radiographic, and histologic study of endodontic treatment failures.
Oral Surg. Oral Med. Oral Pathol. 11: 603-611, 1991.
LLEÒ, M.M.; TAFI, M.C. & CANEPARI, P. Nonculturable Enterococcus faecalis
cells are metabolically active and capable of resuming of active growth. Syst.
Appl. Microbiol. 21: 333-339, 1998.
LOVE, R.M. Enterococcus faecalis – a mechanism for its role in endodontic
failure. Int. Endod. J. 34: 399-405, 2001.
MÄKINEN, P.L.; CLEWELL, D.B.; AN, F. & MÄKINEN, K.K. Purification and
substrate specificity of a strongly hydrophobic extracellular
metalloendopeptidase (“gelatinase”) from Streptococcus faecalis (Strain
0G1-10). J. Biol. Chem. 264: 3325-3334, 1989.
MALATHUM, K.; SINGH, K.V.; WEINSTOCK, G.M. & MURRAY, B.E. Repetitive
sequence-based PCR versus pulsed-field gel electrophoresis for typing of
Enterococcus faecalis at the subspecies level. J. Clin. Microbiol. 36: 211-215,
1998.
MILLER, W.D. An introducion to the study of the bacterio-pathology of the
dental pulp. Dent. Cosmos 36: 505-528, 1894.
MOLANDER, A.; LUNDQUIST, P.; PAPAPANOU, P.N.; DAHLÉN, G. &, REIT, C.
A protocol for polymerase chain reaction detection of Enterococcus faecalis
and Enterococcus faecium from the root canal. Int. Endod. J. 35:1-6, 2002.
MOLANDER, A.; REIT, C.; DAHLÉN, G. & KVIST, T. Microbiological status of
root-filled teeth with apical periodontitis. Int. Endod. J. 31: 1-7, 1998.
MÖLLER, A.J.R. Microbial examination of root canals and periapical tissues
of human teeth. Odontologisk Tidskrift 1-380, 1966.
MORRISON, D.; WOODFORD, N. & COOKSON, B. Enterococci as emerging
pathogens of humans. J. Appl. Microbiol. Symp. Supplem. 83: 89S-99S, 1997.
MUNDY, L.M.; SAHM, D.F. & GILMORE, M. Relationships between
enterococcal virulence and antimicrobial resistence. Clin. Microbiol. Rev. 13:
513-522, 2000.
MURRAY, B.E. The life and times of the Enterococcus. Clin. Microbiol. Rev. 3:
46-65, 1990.
MUYZER, G.; DE WAAL, E.C. & UITTERLINDEN, A.G. Profiling of complex
microbial populations by denaturing gradient gel electrophoresis analysis of
polymerase chain reaction-amplified genes coding for 16S rRNA. Appl.
Environ. Microbiol. 59: 695-700, 1993.
NAKAYAMA, J.; CAO, Y.; HORII, T.; SAKUDA, S.; AKKERMANS, A.D.L. & DE
VOS, W.M. Gelatinase biosynthesis-activating pheromone: a peptide lactone
that mediates a quorum sensing in Enterococcus faecalis. Molecular Microbiol.
41: 145-154, 2001.
NAKAYAMA, J.; CAO, Y.; HORII, T.; SAKUDA, S. & NAGASAWA, H. Chemical
synthesis and biological activity of the gelatinase biosynthesis-activating
pheromone of Enterococcus faecalisand its analogs. Biosci. Biotechnol.
Biochem. 65: 2322-2325, 2001.
NAKAYAMA, J.; KARIYAMA, R. & KUMON, H. Description of a 23.9-kilobase
chromosomal deletion containing a region encoding fsr genes which mainly
determines the gelatinase-negative phenotype of clinical isolates of
Enterococcus faecalis in urine. Appl. Environ. Microbiol. 68: 3152-3155, 2002.
NALLAPAREDDY, S.R.; DUH, R.W.; SINGH, K.V. & MURRAY, B.E. Molecular
typing of selected Enterococcus faecalis isolates: pilot study using
multilocus sequence typing and pulsed-field gel electrophoresis. J. Clin.
Microbiol. 40: 868-876, 2002.
NAMDARI, H. & DELVECCHIO, V. Application of PCR for characterization of
Enterococci. Clin. Microbiol. Newsletter 20: 91-98, 1998.
NOIRI, Y.; EHARA, A.; KAWAHARA, T.; TAKEMURA, N. & EBISU, S.
Participation of bacterial biofilms in refractory and chronic periapical
periodontitis. J. Endod. 28: 679-683, 2002.
NÜBEL, U.; ENGELEN, B.; FELSKE, A.; SNAIDR, J.; WIESHUBER, A.; AMANN,
R.I.; LUDWIG, W. & BACKHAUS, H. Sequence heterogeneities of genes
encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature
gradient gel electrophoresis. J. Bacteriol. 178: 5636-5643, 1996.
OLIVEIRA, J.C.M.; SIQUEIRA, J.F. Jr; RÔÇAS, I.N.; BAUMGARTNER, J.C.; XIA,
T.; PEIXOTO, R.S. & ROSADO, A.S. Bacterial community profiles of
endodontic abscesses from Brazilian and USA subjects as compared by
DGGE analysis. Oral Microbiol. Immunol. 22: 14-18, 2007.
PECIULIENE, V.; REYNAUD, A.H.; BALCIUNIENE, I. & HAAPASALO, M.
Isolation of yeasts and enteric bacteria in root-filled teeth with chronic apical
periodontitis. Int. Endod. J. 34: 429-434, 2001.
PILLAI, S.K.; SAKOULAS, G.; GOLD, H.S.; WENNERSTEN, C.; ELIOPOULOS,
G.M.; MOELLERING, R.C. & INOUYE, R.T. Prevalence of the fsr lócus in
Enterococcus faecalis infections. J. Clin. Microbiol. 40: 2651-2652, 2002.
PINHEIRO, E.T.; GOMES, B.P.F.A. & DRUCKER, D.B. Phenotypic and
genotypic identification of enterococci isolated from canals of root-filled
teeth with periapical lesions. Oral Microbiol. Immunol. 21: 137-144, 2006.
PINHEIRO, E.T.; GOMES, B.P.F.A.; FERRAZ, C.C.R.; TEIXEIRA, F.B.; ZAIA, A.A.
& SOUZA-FILHO, F.J. Evaluation of root canal microorganisms isolated from
teeth with endodontic failure and their antimicrobial susceptibility. Oral
Microbiol. Immunol. 18: 100-103, 2003.
PORTENIER, I.; WALTIMO, T.M.T. & HAAPASALO, M. Enterococcus faecalis –
the root canal survivor and ‘star’ in post-treatment disease. Endod. Topics 6:
135-159, 2003.
QIN, X.; SINGH, K.V.; WEINSTOCK, G.M. & MURRAY, B.E. Effects of
Enterococcus faecalis fsr genes on production of gelatinase and a serine
protease and virulence. Infect. Immun. 68: 2579-2586, 2000.
RADCLIFFE, C.E.; POTOURIDOU, L.; QURESHI, R.; HABAHBEH, N.;
QUALTROUGH, A.; WORTHINGTON, H. & DRUCKER, D.B. Antimicrobial
activity of varying concentrations of sodium hypochlorite on the endodontic
microorganisms Actinomyces israelee, A. naeslundii, Cândida albicans and
Enterococcus faecalis. Int. Endod. J. 37: 438-446, 2004.
RANTA, K.; HAAPASALO, M. & RANTA, H. Monoinfection of root canal with
Pseudomonas aeruginosa. Endod. Dent. Traumatol. 4: 269-272, 1988.
REYNAUD AF GEIJERSSTAM, A.; CULAK, R.; MOLENAAR, L.; CHATTAWAY,
M.; ROSLIE, E.; PECIULIENE, V.; HAAPASALO, M. & SHAH, H.N. Comparative
analysis of virulence determinants and mass spectral profiles of Finnish and
Lithuanian endodontic Enterococcus faecalis isolates. Oral Microbiol.
Immunol. 22: 87-94, 2007.
RICH, R.L.; DEMELER, B.; KREIKEMEYER, B.; OWENS, R.T.; LABRENZ, S.;
NARAYANNA, S.V.; WEINSTOCK, J.M.; MURRAY, B.E. & HOOK, M. Ace is a
collagen-binding MSCRAMM from Enterococcus faecalis. J. Biol. Chem. 274:
6939-26945, 1999.
RICUCCI, D.; BERGENHOLTZ, G. Bacterial status in root-filled teeth exposed
to the oral environment by loss of restoration and fracture or caries – a
histobacteriological study of treated cases. Int. Endod. J. 36: 787–802, 2003.
RICUCCI, D.; LIN, L.M.; SPÄNGBERG, L.S.W. Wound healing of apical tissues
after root canal therapy: a long-term clinical, radiographic, and
histopathologic observation. Oral Surg. Oral Med. Oral Pathol. Oral Radiol.
Endod. 108: 609-621, 2009.
ROBERTS, J.C.; SINGH, K.V.; OKHUYSEN, P.C. & MURRAY, B.E. Molecular
epidemiology of the fsr lócus and of gelatinase production among different
subsets of Enterococcus faecalis isolates. J. Clin. Microbiol. 42: 2317-2320,
2004.
RÔÇAS, I.N. Infecções endodônticas: análise da microbiota associada a
infecções primárias do terço apical de canais radiculares e a infecções
persistentes associadas ao fracasso da terapia endodôntica através de
métodos moleculares. [Tese Doutorado – Instituto Professor Paulo de Góes –
IMPPG/UFRJ]. Rio de Janeiro, Brasil. Universidade Federal do Rio de Janeiro,
2004.
RÔÇAS, I.N.; SIQUEIRA, J.F. Jr; ABOIM, M.C. & ROSADO, A.S. Denaturing
gradient gel electrophoresis analysis of bacterial communities associated
with failed endodontic treatment. Oral Surg. Oral Med. Oral Pathol. Oral Radiol.
Endod. 98: 741-749, 2004.
RÔÇAS, I.N.; SIQUEIRA, J.F. Jr & SANTOS, K.R.N. Association of
Enterococcus faecalis with different forms of periradicular diseases. J.
Endod. 30: 315-320, 2004.
RÔÇAS, I.N.; SIQUEIRA, J.F. JR, SANTOS, K.R.N. & COELHO, A.M. “Red
Complex” (Bacteroides forsythus, Porphyromonas gingivalis, and
Treponema denticola) in endodontic infection: A molecular approach. Oral
Surg. Oral Med. Oral Pathol. Oral Radio. Endod. 91: 468-471, 2001.
ROLPH, H.J.; LENNON, A.; RIGGIO, M.P.; SAUNDERS, W.P.; MACKENZIE, D.;
COLDERO, L. & BAGG, J. Molecular identification of microorganisms from
endodontic infections. J. Clin. Microbiol. 39: 3282-3289, 2001.
SAKAMOTO, M.; SIQUEIRA, J.F. Jr; RÔÇAS, I.N. & BENNO, Y. Bacterial
reduction and persistence after endodontic treatment procedures. Oral
Microbiol. Immunol. 22: 19–23, 2007.
SAKAMOTO, M.; SIQUEIRA, J.F. Jr; RÔÇAS, I.N. & BENNO, Y. Molecular
analysis of the root canal microbiota associated with endodontic treatment
failures. Oral Microbiol. Immunol. 23: 275-81, 2008.
SASSONE, L.; FIDEL, R.; FIGUEIREDO, L.; FIDEL, S.; FAVERI, M. & FERES, M.
Evaluation of the microbiota of primary endodontic infections using
checkerboard DNA-DNA hybridization. Oral Microbiol. Immunol. 22: 390-397.
2007.
SEDGLEY, C.M.; GWENDOLYN, B. & APPELBE, O. Prevalence of
Enterococcus faecalis at multiple oral sites in endodontic patients using
culture and PCR. J. Endod. 32: 104-109, 2006.
SEDGLEY, C.M.; LENNAN, S.L. & CLEWELL, D.B. Prevalence, phenotype and
genotype of oral enterococci. Oral Microb. Immun. 19: 95-101, 2004.
SEDGLEY, C.M.; MOLANDER, A.; FLANNAGAN, S.E.; NAGEL, A.C.; APPELBE,
O.K.; CLEWELL, D.B. & DAHLÉN, G. Virulence, phenotype and genotype
characteristics of endodontic Enterococcus ssp. Oral Microbiol. Immun. 20:
10-19, 2005.
SEDGLEY, C.M.; NAGEL, A.C.; SHELBURNE, C.E.; CLEWEL, D.B.; APPELBE,
O. & MOLANDER A. Quantitative real-time PCR detection of oral
Enterococcus faecalis in humans. Arch. Oral Biol. 50: 575-583, 2005.
SHANKAR, V.; BAGHDAYAN, A.S.; HUYCKE, M.M.; LINDAHL, G. & GILMORE,
M.S. Infection-derived Enterococcus faecalis strains are enriched in esp, a
gene encoding a novel surface protein. Infect. Immun. 67: 193-200, 1999.
SHANKAR, N.; LOCKATELL, C.V.; BAGHDAYAN, A.S.; DRACHENBERG, C.;
GILMORE, M.S. & JOHNSON, D.E. Role of Enterococcus faecalis surface
protein Esp in the pathogenesis of ascending urinary tract infection. Infect.
Immun. 69: 4366-4372, 2001.
SIFRI, C.D.; MYLONAKIS, E.; SINGH, K.V.; QIN, X.; GARSIN, D.A.; MURRAY,
B.E.; AUSUBEL, F.M. & CALDERWOOD, S.B. Virulence effect of Enterococcus
faecalis protease genes and the quorum-sensing locus fsr in Caenorhabditis
elegans and mice. Infect. Immun. 70: 5647-5650, 2002.
SIQUEIRA, J.F. Jr. Aetiology of root canal treatment failure: why well-treated
teeth can fail. Int. Endod. J. 34: 1-10, 2001.
SIQUEIRA, J.F. Jr. Endodontic infections: concepts, paradigms, and
perspectives. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 94: 281-293,
2002.
SIQUEIRA, J.F. Jr; DE UZEDA, M. & FONSECA, M.E.F. A scanning electron
microscopic evaluation of in vitro dentinal tubules penetration by selected
anaerobic bactéria. J. Endod. 22: 308-310, 1996.
SIQUEIRA, J.F. Jr; MACHADO, A.G.; SILVEIRA, R.M.; LOPES, H.P. & DE
UZEDA, M. Evaluation of the effectiveness of sodium hypochlorite used with
three irrigation methods in the elimination of Enterococcus faecalis from the
root canal, in vitro. Int. Endod. J. 30: 279-282, 1997.
SIQUEIRA, J.F. Jr & RÔÇAS, I.N. Polymerase chain reaction-based analysis of
microorganisms associated with failed endodontic treatment. Oral Surg. Oral
Med. Oral Pathol. Oral Radiol. Endod. 97: 85-94, 2004.
SIQUEIRA, J. F. Jr & RÔÇAS, I. N. Uncultivated phylotypes and newly named
species associated with primary and persistent endodontic infections. J. Clin.
Microbiol. 43: 3314-3319, 2005a.
SIQUEIRA , J. F. Jr & RÔÇAS, I. N. Exploiting molecular methods to explore
endodontic infections: part 1 – current molecular Technologies for
microbiological diagnosis. J. Endod. 31: 411-423, 2005b.
SIQUEIRA , J. F. Jr & RÔÇAS, I. N. Exploiting molecular methods to explore
endodontic infections: part 2 – redefining the endodontic microbiota. J.
Endod. 31: 488-498, 2005c.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N.; FAVIERI, A. & SANTOS, K.R.N. Detection of
Treponema denticola in endodontic infections by 16S rRNA gene directed
Polymerase Chain Reaction. Oral Microbiol. Immunol. 15: 335-337, 2000.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N. & LOPES, H.P. Microbiologia Endodôntica. In:
Lopes, H.P. & Siqueira, J.F. Jr. Endodontia: Biologia e Técnica. Rio de Janeiro:
MEDSI, p. 223-280, 2004.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N.; OLIVEIRA, J.C.M. & SANTOS, K.R.N. Detection
of putative oral pathogens in acute periradicular abscesses by 16S rDNA
directed PCR. J. Endod. 27: 164-167, 2001a.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N.; OLIVEIRA, J.C.M. & SANTOS, K.R.N. Molecular
detection of black-pigmented bactéria in infections of endodontic origin. J.
Endod. 27: 563-566, 2001b.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N.; SOUTO, R.; DE UZEDA, M. & COLOMBO, A.P.
Checkerboard DNA-DNA hybridization analysis of endodontic infections. Oral
Surg. Oral Med. Oral Pathol. Oral Radio. Endod. 89: 744-748, 2000.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N.; ALVES, F.R.F. & CAMPOS, L.C. Periradicular
status related to the quality of coronal restorations and root canal fillings in a
Brazilian population. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 100:
369-374, 2005.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N. & ROSADO, A.S. Application of denaturing
gradient gel electrophoresis (DGGE) to the analysis of endodontic infections.
J. Endod. 31: 775-782, 2005.
SIQUEIRA, J.F. Jr; RÔÇAS, I.N.; PAIVA, S.S.; GUIMARÃES-PINTO, T.;
MAGALHÃES, K.M. & LIMA, K.C. Bacteriologic investigation of the effects of
sodium hypochlorite and chlorhexidine during the endodontic treatment of
teeth with apical periodontitis. Oral Surg. Oral Med. Oral Pathol. Oral Radiol.
Endod. 104:122-130, 2007.
SIQUEIRA, J.F. Jr & RÔÇAS, I.N. Clinical implications and microbiology of
bacterial persistence after treatment procedures. J. Endod. 34: 1291-1301,
2008.
SIQUEIRA, J.F. Jr & RÔÇAS, I.N. Community as the unit of pathogenicity: an
emerging concept as to the microbial pathogenesis of apical periodontitis.
Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 107: 870-878, 2009a.
SIQUEIRA, J.F. Jr & RÔÇAS, I.N. Diversity of endodontic microbiota revisited.
J. Dent. Res. 88: 969–981, 2009b.
SINGH, K.V.; COQUE, T.M.; WEINSTOCK, G.M. & MURRAY, B.E. In vivo testing
of an Enterococcus faecalis efaA mutant and use of efaA homologs for
species identification. FEMS Immunol. Med. Microbiol. 21: 323-331, 1998.
STRUELENS, M.J. & THE MEMBERS OF THE EUROPEAN STUDY GROUP ON
EPIDEMIOLOGICAL MARKERS (ESGEM) OF THE EUROPEAN SOCIETY FOR
CLINICAL MICROBIOLOGY AND INFECTION DISEADES (ESCMID). Consensus
guidelines for appropriate use and evaluation of microbial epidemiologic
typing systems. Clin. Microbiol. Infect. 2: 2-11, 1996.
SU, Y.A.; SULAVIK, M.C.; HE, P.; MAKINEN, K.K.; MAKINEN, P.L.; FIEDLER, S.;
WIRTH, R. & CLEWELL, D.B. Nucleotide sequence of the gelatinase gene
(gelE) from Enterococcus faecalis subsp. liquefaciens. Infect. Immun. 59: 415-
420, 1991.
SUNDQVIST, G. Bacteriological studies of necrotic dental pulps [Dissertation].
Umea, Swedwn: University of Umea, 1976.
SUNDQVIST, G. Ecology of the root canal flora. J. Endod. 18: 427-430, 1992.
SUNDQVIST, G.; FIGDOR, D.; PERSSON, S. & SJÖGREN, U. Microbiologic
analysis of teeth with failed endodontic treatment and the outcome of
conservative retreatment. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod.
85: 86-93, 1998.
SUNDQVIST, G.; JOHANSSON, E. & SJÖGREN, U. Prevalence of black-
pigmented Bacteroides species in root canal infections. J. Endod. 15: 13-19,
1989.
SUSSMUTH, S.D.; MUSCHOLL-SILBERHORN, A.; WIRTH, R.; SUSA, M.;
MARRE, R. & ROZDINSKI, E. Aggregation substance promotes adherence,
phagocytosis, and intracellular survival of Enterococcus faecalis with human
macrophages and suppresses respiratory burst. Infect. Immun. 68: 4900-4906,
2000.
TEIXEIRA, L.M.; CARVALHO, M. G. S. & FACKLAM, R.R. Enterococcus. In:
Murray P.R, Baron E.J., Jorgensen, J.H., Pfaller M.A., Yolken R.H. (eds). Manual
of Clinical Microbiology. 9
th
ed., ASM Press, Washington, DC, p 430-442, 2007.
TENDOLKAR, P.M.; BAGHDAYAN, A.S.; GILMORE, M.S. & SHANKAR, N.
Enterococcal surface protein, Esp, enhances biofilm formation by
Enterococcus faecalis. Infect. Immun. 72: 6032-6039, 2004.
TENOVER, F.C.; ARBEIT, R.D.; GEORING, R.V.; MICKELSEN, P.A.; MURRAY,
B.E.; PERSING, D.H. & SWANINATHAN, B. Interpreting chromosomal DNA
restriction patterns produced by pulsed-field gel electroforesis. J. Clin.
Microbiol. 33: 2233-2239, 1995.
TOMAYKO, J.F. & MURRAY, B.E. Analysis of Enterococcus faecalis isolates
from intercontinental sources by multilocus enzyme electrophoresis and
pulsed-field gel electrophoresis. Antimicrob. Agents Chemother. 33: 903-2907,
1995.
TOP, J.; SCHOULS, L.M.; BONTEN, M.J. & WILLEMS, R.J. Multiple-locus
variable-number tandem repeat analysis, a novel typing scheme to study the
genetic relatedness and epidemiology of Enterococcus faecium isolates. J.
Clin. Microbiol. 42: 4503-4511, 2004.
VAN BELKUM, A.; VAN LEEUWEN, W.; KLUYTMANS, J. & VERBRUGH, H.
Molecular nosocomial epidemiology: high speed typing of microbial
pathogens by arbitrary primed polymerase chain reaction assays. Infect.
Control Hosp. Epidemiol. 16: 658-666, 1995.
VERGIS, E.N.; SHANKAR, N.; CHOW, J.W.; HAYDEN, M.K.; SNYDMAN, D.R.;
ZERVOS, M.J.; LINDEN, P.K.; WAGENER, M.M. & MUDER, R.R. Association
between the presence of enterococcal virulence factors gelatinase,
hemolysin and enterococcal surface protein and mortality among patients
with bacteremia due to Enterococcus faecalis. Clin. Infect. Dis. 35: 570-575,
2002.
VIVACQUA-GOMES, N.; GURGEL FILHO, E.D.; GOMES, B.P.F.A.; FERRAZ,
C.C.R.; ZAIA, A.A. & SOUZA-FILHO, F.J. Recovery of Enterococcus faecalis
after single-or multiple-visit root canal treatments carried out in infected
teeth ex vivo. Int. Endod. J. 38: 697-704, 2005.
WATERS, C.M.; ANTIPORTA, M.H.; MURRAY, B.E. & DUNNY, G.M. Role of the
Enterococcus faecalis gelE protease in determination of cellular chain
length, supernatant pheromone levels, and degradation of fibrin and
misfolded surface proteins. J. Bacteriol. 185: 3613-3623, 2003.
WILLIAN, J.M.; TROPE, M.; CAPLAN, D.J. & SHUAGARS, D.C. Detection and
quantitation of E. faecalis by real-time PCR (qPCR), reverse transcription-
PCR (RT-PCR), and cultivation during endodontic treatment. J. Endod. 32:
715-722, 2006.
WU, M-K; SHEMESH, H.; WESSELINK, P.R. Limitations of previously
published systematic reviews evaluating the outcome of endodontic
treatment. Int. Endod. J. 42: 656–666, 2009.
XIA, T.; BAUMGARTNER, J.C. & DAVID, L.L. Isolation and identification of
Prevotella tannerae from endodontic infections. Oral Microbiol. Immun. 15:
273-275, 2000.
ZERVOS, M.J.; KAUFFMAN, C.A.; THERASSE, P.M.; BERGMAN, A.G.T.;
MIKESELL & SCHABERG, D.R. Nosocomial infection by gentamicin-resistant
Streptococcus faecalis: an epidemiologic study. Ann. Intern. Med. 106: 687-69,
1987.
ZOLETTI, G.O.; SIQUEIRA, J.F. Jr & SANTOS, K.R.N. Identification of
Enterococcus faecalis in root-filled teeth with or without periradicular lesions
by culture dependent and—independent approaches. J. Endod. 32: 722-726,
2006.
ANEXO 1
Figura 1 – Eletroforese em gel de agarose evidenciando um segmento de 310 pb do 16S rRNA de E. faecalis em espécimes clínicos endodônticos
submetidos a PCR: Linha 1 – padrão de tamanho de DNA em pares de bases (100pb ladder); Linha 2: controle positivo (E. faecalis OG1RF); Linha 3
–controle negativo (E. faecium Ec2594); Linhas 4, 5, 7, 8 e 10 – amostras clínicas identificadas como E. faecalis; Linhas 6 e 9 – amostras clínicas
negativas.
ANEXO 2
Figura 1 – Análise da produção da gelatinase e da detecção do gene gelE em amostras de E. faecalis isolada de canais dentários tratados (A)
Eletroforese em gel de agarose evidenciando um segmento de 419 pb do gene gelE que codifica a produção do fator de virulência gelatinase em
Enterococcus faecalis: Linha 1 - padrão de tamanho de DNA em pares de bases (100pb ladder); Linha 2: controle positivo (E. faecalis OG1RF); Linha
3 –controle negativo do PCR; Linhas 4, 5, 7, 8 e 9 – amostras de E. faecalis positivos para o gene gelE (RN18, RN29, RW35, RW 37 e RN66
respectivamente); (B) – Caracterização fenotípica da produção de gelatinase por amostras de Enterococcus faecalis isoladas de canais dentários
tratados. Amostras clínicas negativas RN04 (04), RW12 (12), RN44 (44) e RN45 (45). Amostras clínicas positivas RN18 (18), RN29 (29), RW35 (35) e
RW37 (37). Amostra E. faecalis OG1RF – controle positivo.
ANEXO 3
Figura 1. Análise da produção da proteína Esp e da detecção do gene esp em amostras de E. faecalis isolada de canais dentários tratados (A)
Eletroforese em gel de agarose evidenciando um segmento de 933 pb referente ao gene esp que codifica a produção da proteína de superfície
enterocócica (Esp) em Enterococcus faecalis: Linha 1 - padrão de tamanho de DNA em pares de bases (100pb ladder); Linha 2 – controle positivo
(E. faecium Ec2594); Linha 3 – controle negativo da PCR; Linhas 5, 7 e 10 – amostras de E. faecalis positivas para o gene esp (RW12, RN29 e RN44
respectivamente); Linhas 4, 6, 8 e 9 – amostras de E. faecalis negativas para o gene esp (RN4, RN18, RW35 e RW37). (B) Análise de Western
blotting utilizando anticorpo policlonal anti-Esp. Linhas 01 e 02; controles positivo (E. faecium Ec2594) e negativo (E. faecalis OG1RF),
respectivamente; Linha 03, 04 e 05 amostras Esp-positivas (RN44; RN50 e RW77 respectivamente); Linha 06 amostra Esp-negativa (RN29)
ANEXO 4
Figura 1. Eletroforese em gel de agarose evidenciando um segmento de 499 pb do gene efaA que codifica a produção do antígeno A (EfaA) em
Enterococcus faecalis: Linha 1 - padrão de tamanho de DNA em pares de bases (100pb ladder); Linha 2: controle positivo (E. faecalis V583); Linha 3
–controle negativo da PCR; Linhas 4, 5, 7, 8 e 9 – amostras de E. faecalis positivas para o gene efaA (RW12, RW37, RN74, RN73 e RW85); Linha 8
– amostra de E. faecalis negativa para o gene efaA (RN50).
ANEXO 5
Figura 1. Eletroforese em gel de agarose evidenciando um segmento de 782 pb do gene cpd que codifica a produção de feromônio sexual em
Enterococcus faecalis: Linha 1 - padrão de tamanho de DNA em pares de bases (100pb ladder); Linha 2: controle negativo da PCR; Linhas 3, 4, 5, 7,
8 e 9 – amostras de E. faecalis positivas para o gene cpd (RW35, RW37, RW85, RN04, RN18 e RN74).
ANEXO 6
Figura 1. Eletroforese em gel de agarose evidenciando um segmento de 1553 pb do gene agg que codifica a produção de substância de agregação
(Agg) em Enterococcus faecalis: Linha 1 - padrão de tamanho de DNA em pares de bases (100pb ladder); Linha 2: controle negativo da PCR; Linha
3: controle positivo (E. faecalis DS16); Linhas 4, 5, 6, 7 e 8 – amostras de E. faecalis positivas para o gene agg (RW37, RW72, RW77, RW79 e
RW85).
ANEXO 7
Figura 1. Eletroforese em gel de agarose evidenciando um segmento de 320 pb do gene ace que codifica a produção da adesina de colágeno (Ace)
em Enterococcus faecalis: Linha 1 - padrão de tamanho de DNA em pares de bases (100pb ladder); Linha 2: controle positivo (E. faecalis V583);
Linha 3: controle negativo da PCR; Linhas 4, 5, 7, 8, 9 e 10 – amostras de E. faecalis positivas para o gene ace (RN04, RN29, RW81, RW85, RN73 e
RN 74); Linha 6 – amostra de E. faecalis negativa para o gene ace (RN55).
ANEXO 8
Figura 1 – Eletroforese em gel de agarose do perfil de fragmentos gerados por rep-PCR das amostras controle e de amostras clínicas de
Enterococcus faecalis isoladas de canais tratados. Linha 1: padrão de tamanho de DNA em pares de bases (100pb ladder); Linhas 2, 3 e 4: E.
faecalis DS16; E. faecalis V583 e E. faecalis OG1RF respectivamente (amostras controle); Linhas 5 e 12: genótipo “c” (amostras RN04 e RN45);
Linha 6: genótipo “b” (amostra RW12); Linhas 7 e 8: genótipo “d” (amostras RN18 e RN29); Linhas 9 e 10: genótipos “a” (amostras RW35 e RW37);
Linha 11: genótipo “e” (amostra RN44).
pb 02 03 04 05 06 07 08 09 10 11 12
100
500
300
1000
01pb 02 03 04 05 06 07 08 09 10 11 12
100
500
300
1000
01
ANEXO 9
Figura 1 – Dendrograma obtido pela análise de padrões de bandas DGGE (método de Ward) em espécimes coletados de canais dentários tratados.
(A) Espécimes coletados de canais que apresentaram periodontite apical; (B) Espécimes coletados de canais sem perirodontite apical.
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
