( PDF ) Amblyomma imitator: a novel vector for Rickettsia rickettsii in Mexico and South Texas

Download PDF

ads:

KARLA ANDRADE DE OLIVEIRA

Amblyomma imitator: A NOVEL VECTOR FOR Rickettsia rickettsii IN MEXICO

AND SOUTH TEXAS

Tese apresentada à Universidade Federal de

Viçosa, como parte das exigências do

Programa de Pós-Graduação em

Bioquímica Agrícola, para a obtenção do

título de Doctor Scientiae

VIÇOSA

MINAS GERAIS - BRASIL

2010

ads:

Livros Grátis

http://www.livrosgratis.com.br

Milhares de livros grátis para download.

KARLA ANDRADE DE OLIVEIRA

Amblyomma imitator: A NOVEL VECTOR FOR Rickettsia rickettsii IN MEXICO

AND SOUTH TEXAS

Tese apresentada à Universidade Federal de

Viçosa, como parte das exigências do

Programa de Pós-Graduação em Bioquímica

Agrícola, para a obtenção do título de

Doctor Scientiae

APROVADA: 18 de fevereiro de 2010.

__________________________ ____________________________

Andréa de Oliveira Barros Ribon Márcio Antônio Moreira Galvão

(Co-Orientador)

__________________________ ____________________________

David Hughes Walker Donald Hugh Bouyer

_____________________________

Cláudio Lísias Mafra de Siqueira

(Orientador)

ads:

To the Lord, my help and shield (Ps. 33:20),

I dedicate.

iii

AGRADECIMENTOS

À Deus pelo sustento e por mais essa conquista.

À minha família por todo apoio e estímulo.

Aos amigos Anderson, Luciana, Luiza, Ana Marques, Elisa, Marlos, Edvaldo e Williane

pela disposição em ajudar sempre e por de alguma forma participar na realização deste

trabalho.

Aos amigos Sandra e Evandro por todo apoio que me deram durante minha estadia nos

Estados Unidos.

Ao Eduardo, secretário do Programa de Pós Graduação em Bioquímica Agrícola, pelo

auxílio sempre que necessário.

Aos amigos e colaboradores Patricia, Amber, Jeeba, Taís, Thomas, Sumil, Fang,

Jacqueline e Gary, do Rickettsial and Ehrlichial Diseases Research Laboratory na

University of Texas Medical Branch (UTMB), pelas contribuições no meu processo de

aprendizagem e pelo fluxo de idéias que me dirigiu às minhas realizações.

À Sherrill e Doris, as mais eficientes secretárias na UTMB, por me ajudarem e guiarem-

me desde as necessidades mais simples até as essenciais.

Ao professor Cláudio Mafra pela orientação.

Aos professores Juliana Lopes Rangel Fietto, Márcia Rogéria de Almeida Lamêgo,

Elizabeth Batista Pacheco Fontes e Márcio Antônio Moreira Galvão pela co-orientação.

Ao Dr. David H. Walker por participar do Programa de Doutorado Sanduíche no

Exterior do CNPq (Brasil) como supervisor, permitindo-me realizar este estudo e

supervisionando-me no período de Maio de 2008 a Outubro de 2009 na University of

Texas Medical Branch in Galveston, TX, USA. Essa oportunidade contribuiu

grandemente para aumentar o meu conhecimento na área de Biologia Molecular para

pesquisa em Rickettsioses.

Ao Dr. Donald H. Bouyer por me permitir trabalhar e ganhar experiência prática em seu

Laboratório na UTMB e por me ensinar todas as importantes lições para crescimento em

minha carreira.

Ao Programa de Pós-graduação em Bioquímica Agrícola do Departamento de

Bioquímica e Biologia Molecular da Universidade Federal de Viçosa, Viçosa/Brasil.

À CAPES pelo fornecimento da bolsa de Doutorado.

Ao CNPq pelo fornecimento da Bolsa de Douturado Sanduíche no Exterior.

À FAPEMIG/Brasil por financiamento do meu Projeto de Doutorado (APQ-0950-

01/07).

Ao Fogarty International Center (D43 TW00903) pelo suporte dado a essa pesquisa.

INDEX

RESUMO

ABSTRACT

viii

INTRODUCTION

The Pathogen

Rickettsia rickettsii ecology

Amblyomma imitator

Rocky Mountain spotted fever in Mexico 5

REFERENCES

ARTICLE_ Amblyomma imitator: discovery of a novel vector

for Rickettsia rickettsii in Mexico and South Texas

Abstract

Introduction

Methods

Tick collection and establishment of colony

DNA extraction and PCR

Isolation of Rickettsia

IFA

Characterization of the rickettsial isolate:

Electron Microscopy:

Results

Detection and Characterization of Rickettsia

Ultrastructural Observations 20

Discussion

Conclusion

Acknowledgements

Biographical sketch

References

Table. Primers used for amplification of rickettsial genes 26

Figure 1 27

Figure 2 27

Figure 3 28

Figure 4 28

RESUMO

OLIVEIRA, Karla Andrade. D.Sc., Universidade Federal de Viçosa. Fevereiro de 2010.

Amblyomma imitator: um novo vetor para Rickettsia rickettsii no México e Sul

do Texas. Orientador: Cláudio Lísias Mafra de Siqueira. Co-orientadores: Márcia

Rogéria de Almeida Lamêgo, Elizabeth Batista Pacheco Fontes, Juliana Lopes

Rangel Fietto e Márcio Antônio Moreira Galvão.

Rickettsioses, doenças de importância mundial, são causadas por bactérias pequenas,

gram-negativas e intracelulares obrigatórias, que são transmitidas ao homem através de

carrapatos, pulgas, ácaros e piolhos. O gênero Rickettsia tem sido classicamente dividido

em dois grupos, o grupo tifo (TG) e o grupo de febre maculosa (SFG). Nos Estados

Unidos e México, a transmissão da Rocky Mountain spotted fever (RMSF) foi atribuída

aos carrapatos do gênero Dermacentor (D. variabilis e D. andersoni), Rhipicephalus

sanguineus e Amblyomma (A. cajennense). Amblyomma imitator possui alta similaridade

com Amblyomma cajennense e a princípio foi erroneamente identificado como esta

espécie de carrapato. A sua distribuição geográfica compreende o sul do Texas (EUA),

México e América Central. Neste estudo, uma colônia de carrapatos A. imitator

coletados no ambiente no Estado de Nuevo Leon, México, em 2007 foi mantida em

laboratório em coelhos naive, livres de patógenos. Real-time PCR de DNA extraído de

ovos postos pela primeira geração de fêmeas mantidas em laboratório, foi realizado

utilizando-se os primers específicos para Rickettsia CS5A e CS6 para a amplificação de

um fragmento de 150bp do gene gltA. Esta análise indicou a presença de DNA de

Rickettsia em algumas das massas de ovos. O organismo foi isolado das massas de ovos

em células Vero utilizando-se “Shell vials”. Os isolados foram detectados em células

Vero por Diff-Quik e Imunofluorescência Indireta utilizando-se anticorpos policlonais

de coelho contra R. rickettsii cepa Sheila Smith (diluído 1:200) e anti-IgG de coelho

marcado com isotiocianato de fluoresceína (diluído 1:300). Os isolados foram

identificados genotipicamente por seqüenciamento de fragmentos dos genes específicos

de Rickettsia htrA, ompB e ompA amplificados a partir do DNA extraído das células

infectadas. Nested-PCR foi realizada utilizando-se os primers 17K3 e 17K5 para a

primeira reação e 17KD1 e 17kD2 para a segunda reação para a amplificação de

fragmentos de 547 pb e 434 pb, respectivamente, do gene htrA.

vii

Para amplificação de um fragmento de 856 pb do gene ompB o par de primers

120-M59 e 120-807 foi usado. Um fragmento de 533 pb do gene ompA foi amplificado

com os primers Rr190.70F e Rr190.602R. Para uma das amostras um semi-nested foi

necessário para amplificar um fragmento de ompA. Os primers Rr190.70F e Rr190.701R

foram então utilizados para a primeira reação, e primers Rr190.70F e Rr190.602R para a

segunda. Análise das seqüências dos fragmentos dos genes htrA, ompA e ompB revelou

R. rickettsii com identidades de 99%, 100% e 100%, respectivamente. A análise

ultraestrutural de tecidos de carrapatos adultos mostrou a presença do agente rickettsial

no intestino. Este é o primeiro relato da presença e da transmissão transovariana de R.

rickettsii por A. imitator naturalmente infectado e sugere um papel para esta espécie de

carrapato na transmissão de febre maculosa no México e sul do Texas (EUA).

viii

ABSTRACT

OLIVEIRA, Karla Andrade. D.Sc., Universidade Federal de Viçosa. February, 2010.

Amblyomma imitator: a novel vector for Rickettsia rickettsii in Mexico and South

Texas. Adviser: Cláudio Lísias Mafra de Siqueira. Co- advisers: Márcia Rogéria de

Almeida Lamêgo, Elizabeth Batista Pacheco Fontes, Juliana Lopes Rangel Fietto

and Márcio Antônio Moreira Galvão.

Rickettsioses, diseases of worldwide importance, are caused by small, gram-

negative, obligately intracellular bacteria that are transmitted to humans via ticks, fleas,

mites or lice. The genus Rickettsia has been classically divided into two groups, the

typhus group (TG) and the spotted fever group (SFG). In the United States and Mexico,

transmission of Rocky Mountain spotted fever (RMSF) has been attributed to ticks of

the genera Dermacentor (D. variabilis and D. andersoni), Rhipicephalus (R.

sanguineus), and Amblyomma (A. cajennense). Amblyomma imitator has close affinity

with Amblyomma cajennense and was formerly confused with this species. Its

distributional range extends from southern Texas (USA) southward through Mexico into

Central America (Keirans and Durden, 1998). In this study, a colony of A. imitator

collected from the field in Nuevo Leon State, Mexico in 2007 was maintained in

laboratory on naïve pathogen-free rabbits. Real-time PCR analysis of eggs laid from the

first generation of laboratory-reared females using Rickettsia-specific primers CS5A and

CS6 was carried out for amplification of a fragment of 150bp of the gltA gene. This

analysis indicated the presence of rickettsial DNA in some of the egg masses. The

organism was isolated from the egg masses in Vero cells using shell vials. The bacteria

was detected in Vero cells by Diff-Quik staining and indirect immunofluorescence assay

using rabbit polyclonal antibody against R. rickettsii Sheila Smith strain (diluted 1:200)

and fluorescein isothiocyanate-labeled goat anti-rabbit IgG (diluted 1:300). The isolates

were genotypically identified by sequencing partial sequences of the Rickettsia- specific

genes htrA, ompB, and ompA amplified from DNA extracted from infected cells. Nested-

PCR was performed using primers 17K3 and 17K5 for the first reaction and 17KD1 and

17kD2 for the second reaction for amplification of fragments of 547 bp and 434 bp,

respectively, of the htrA gene. For amplification of a fragment of 856 bp of the ompB

gene, the pair of primers 120-M59 and 120-807 was used. A 533 bp fragment of the

ompA gene was amplified using the primers Rr190.70F and Rr190.602R. For one of the

samples a semi-nested PCR was necessary to amplify an ompA fragment. The primers

Rr190.70F and Rr190.701R were used for the first reaction, and primers Rr190.70F and

Rr190.602R for the second reaction. Analysis of the sequences of the fragments of htrA,

ompA and ompB genes revealed them to be R. rickettsii with identities 99%, 100% and

100%, respectively. Ultrastructural analysis of tissues of adult ticks showed the presence

of the rickettsial agent in the tick midgut. This is the first report of the presence and

transovarial transmission of R. rickettsii by naturally infected A. imitator ticks and

suggests a role for this species of tick in transmission of Rocky Mountain spotted fever

in Mexico and South Texas (USA).

INTRODUCTION

The pathogen

Rickettsia rickettsii is a fastidious, small (0.2–0.5 µm by 0.3–2.0 µm),

pleomorphic Gram-negative coccobacillus. Obligately intracellular, the bacteria is not

surrounded by a host cell membrane and can grow in the cytoplasm and in the nucleus of

infected cells of both arthropod and vertebrate hosts (Burgdorfer et al., 1968).

Electron microscopic study of the R. rickettsii outer envelope revealed a

trilaminar cell wall (TCW) with an inner leaflet measuring 6.2 to 7.7 nm, an outer leaflet

measuring about 2.5 nm, and a "clear" space between the inner and outer leaflets

measuring 2.8 to 4.4 nm (Silverman and Wisseman,1978). The cell-wall composition

and lipopolysaccharide of the pathogen resemble that seen in other Gram-negative

bacteria (Obijeski et al., 1974; Pedersen and Walters, 1978; Anacker et al., 1985). Hayes

and Burgdorfer (1982) described the appearance of R. rickettsii in optimal physiological

stability in ticks that are actively feeding providing essential nutrients, metabolites and

temperature required for rickettsial growth. In those conditions R. rickettsii shows a

prominent “halo”, slime layer (SL) (Silverman et al, 1978), adjacent to the TCW and a

slightly electron-dense microcapsular layer (MCL) between the SL and the TCW,

approximately 16 nm thick composed of beadlike subunits with a periodicity of

approximately 10 nm. Internal to the TCW is a narrow periplasmic space which contains

some material of low electron density and that is bordered internally by a plasma

membrane. Silverman et al. (1978) suggested that the slime material of Rickettsia is

polysaccharide in nature and postulated an antiphagocytic property for the SL also

suggesting a role for it in attachment to the host cell in preparation for penetration. Other

studies using electron microscopy and ruthenium red staining techniques (Luft 1964;

Luft 1971) established the acid protein and polysaccharidic nature of the MCL and of

the SL. Hayes and Burgdorfer suggested the importance of these structures in

pathogenesis and interactions between R. rickettsii and cells of its arthropod and

vertebrate hosts. In this study, the authors reported changes in ultrastructure of R.

rickettsii under growth-limiting conditions infecting starved ticks. The discrete beadlike

MCL structures (present under physiologically optimal conditions) dramatically change

and resemble stringy strands whose proximal portion appears to fuse with the electron-

dense outer leaflet of the TCW. Besides that the sharp demarcation between the

rickettsial SL and the host cell cytoplasm disappear. Supported by examples of a loss or

modification of surface components leading to a loss or modification of virulence and

pathogenesis of other bacteria found in literature, Hayes and Burgdorfer (1982)

suggested that the changes observed in their study are structural changes involved in

reactivation, i.e., changes in the pathogenic and virulent nature of R. rickettsii.

R. rickettsii possesses two major antigenic surface proteins: outer membrane

protein A (OmpA) and outer membrane protein B (OmpB). OmpB is the most abundant

surface protein of rickettsiae. Studies suggested that OmpA and OmpB contribute to the

adherence and invasion of the host cell (Li and Walker, 1998; Uchiyama, 2006).

Uchiyama et al. (2006) demonstrated the functions of OmpB on these steps. OmpA and

OmpB contain species-specific epitopes that provide the basis for rickettsial serotyping

by use of comparative indirect microimmunofluorescence assays (Parola et al., 2005).

Genetic variation of the ompA gene allows the identification of various Rickettsia

species (Roux et al., 1996). Gilmore et al. (1991) described heterogeneity in sequence of

ompB gene of virulent and avirulent strains of R. rickettsii. Sequence analyses of the

genes encoding OmpA and OmpB have been used as a tool for description of new

rickettsial species (Niebylski et al., 1997; Bouyer st al., 2001; Jiang et al., 2005) and

phylogenetic analyses (Fournier et at., 1998; Roux and Raoult, 2000; Moron et al., 2001;

Stenos and Walker, 2000).

Rickettsia rickettsii ecology

Rickettsia rickettsii has as main reservoirs in nature hard ticks (family Ixodidae)

of various genera and species, with which the agent has an intimate relationship,

characterized by transovarial and transstadial transmission (McDade and Newhouse,

1986). Although R. rickettsii can also infect domestic and wild mammals, persistent

maintenance of the agent does not occur, and the infection lasts for only a few days or

weeks (Burgdorfer, 1988 cited by Labruna, 2009). Thus, vertebrate hosts cannot be

considered reservoirs of R. rickettsii in nature. However, the participation of vertebrate

hosts as amplifier of the rate of infection in the tick population by starting a new lineage

of infected ticks during rickettsemia is believed to be necessary, since the R. rickettsii

pathogenicity for ticks precludes its enzootic maintenance solely by transovarial and

transstadial transmissions in ticks (Labruna et al., 2009).

In ticks, R. rickettsii initially infects the epithelial cells of midgut, multiplies

there, enters into the hemocoel, and invades and multiplies in other tick tissues including

the salivary glands and ovaries. R. rickettsii can be found in tick hemocytes 3 to 5 days

after a tick has fed on a rickettsemic animal, and all tick tissues can become infected

with R. rickettsii as soon as 7-10 days after infectious feeding (Burgdorfer, 1977).

Species of ticks involved in transmission of R. rickettsii differ according to

different geographic areas.

In the United States Dermacentor andersoni is the principal vector of R. rickettsii

in the western states, as well as in Canada (Burgdorfer, 1969; McKiel, 1960), and

Dermacentor variablilis is the principal vector in the eastern states (Sonenshine, 1979;

Dumler and Walker, 2005). In Texas (USA), A. americanum, Ixodes scapularis and

Rhipicephalus sanguineus were suspected to be involved in outbreaks of RMSF (Elliott

et al., 1990). Recently, Demma et al. (2005) reported cases of RMSF in eastern Arizona,

with common brown dog ticks, Rhipicephalus sanguineus, implicated as a vector.

In Mexico, R. sanguineus is the most important vector in western and central

regions, and A. cajennense has been implicated in the southeastern region (Bustamante

and Varela, 1947a).

Amblyomma cajennense is the most important vector of R. rickettsii in South

America. It has been reported to be naturally infected in Panama (de Rodaniche, 1953),

Colombia (Patino-Camargo, 1941), and Brazil (Dias e Martins 1939). Recently in Brazil,

Rhipicephalus sanguineus was also reported as a suspected vector of R. rickettsii in an

endemic area for Brazilian spotted fever in the metropolitan area of Sao Paulo, Brazil

(Moraes-Filho et al., 2009), where A. aureolatum is a recognized vector (Pinter and

Labruna, 2006).

In Costa Rica, Haemaphysalis leporispalustris has been demonstrated to

participate in R. rickettsii ecology, since it has been isolated from this tick in endemic

areas of RMSF (Fuentes et al., 1986; Hun et al., 2008). But a vector for R. rickettsii is

not known in this country because H. leporispalustris is not a human-biting tick.

Amblyomma imitator

Amblyomma imitator Kohls was described by Kohls (1958) during re-

examination of tick collections in the Rocky Mountain Laboratory that were labeled “A.

cajennense”, revealing a new species of tick, strongly resembling A. cajennense

occurring in southern Texas (USA) and Mexico. Usually, the two species are

distinguished by the presence of chitinous tubercles on the festoons of A. cajennense and

the presence of projections over both sides of the apron of the genital aperture in A.

imitator and by size, ornamentation, and the elongate ventral scutes of the A. imitator

male. Hilburn et al. (1989) proposed the use of isozyme phenotypes for identification of

these ticks. In this study the authors demonstrated eight enzymes that are diagnostic for

the two species.

The distribution of A. imitator extends from southern Texas, southward through

Mexico into Central America (Keirans and Durdenj, 1998). In Mexico, it is widely

sympatric with A. cajennense, often found on the same host animal (Hilburn et al.,

1989).

Hosts of A. imitator are various species of birds and mammals, including wild

turkey, squirrels, peccary, dog, goat, horse, cattle, and humans (Keirans and Durden,

1998).

Interestingly, in 1933, Parker and colleagues performed tests of transmission of

RMSF with supposed A. cajennense. In this study, stage to stage persistence of the agent

was demonstrated from larvae through nymphs and into the resulting adults, as well as

and transmission to guinea-pigs, showing successful transstadial transmission and that

this tick was an efficient vector. However, the study of Kohls (1958) revealed that the

ticks used for the mentioned tests were actually A. imitator, suggesting that this species

of tick is a vector for R. rickettsii.

Recently, Medina-Sanchez et al. (2005) detected and isolated R. prowazekii from

A. imitator ticks collected in Mexico. However, reports of R. rickettsii infecting this

species have not been described in the literature.

Rocky Mountain spotted fever in Mexico

Rocky Mountain spotted fever (RMSF) is a life-threatening disease caused by R.

rickettsii and is one of the most virulent infections identified in human beings.

The geographic distribution of RMSF is restricted to countries of the western

hemisphere. The disease has been found in the USA, western Canada (McKiel, 1960)

western and central Mexico (Bustamante and Varella, 1943; Bustamante and Varella,

1947b), Panama (Rodaniche and Rodaniche, 1950), Costa Rica (Fuentes, 1979),

northwestern Argentina (Ripoll et al., 1999), Brazil (Piza, 1932; Dias e Martins, 1939),

and Colombia (Patino et al., 1937).

Investigations of rickettsial diseases in Mexico including studies to identify

vectors of R. rickettsii have been scarce. Cases of RMSF in Mexico occurred during the

decades from 1930 to 1950. They were identified in Sinaloa, Sonora, Coahuila, and

Durango states, where Rhipicephalus sanguineus ticks were incriminated as the vector

(Bustamante, 1943; Mariotte et al., 1944; Bustamante and Varella, 1947a). An isolate of

SFG Rickettsia was also established from A. cajennense ticks in the tropical Gulf Coast

state of Veracruz (Bustamante and Varela, 1946). This isolate was demonstrated to

cause periorchitis and scrotal necrosis in guinea pigs consistent with R. rickettsii.

In study carried out in 1996, sera of patients from Yucatan and Jalisco States,

suspected clinically to have dengue fever were shown to contain antibodies reactive with

R. rickettsii antigens by indirect immunofluorescence (Zavala-Velazquez et al., 1996).

Since this year, epidemiologic surveillance was implemented to search for human cases

in the public hospitals of Yucatan State, and in 2006 Zavala-Castro et al. reported the

first human case of infection by R. rickettsii in this state, diagnosed by using

immunohistochemistry and specific polymerase chain reaction. Subsequently, eight new

cases of RMSF were reported in 2008 (Zavala-Castro et al., 2008).

REFERENCES

ANACKER, R. L.; LIST, R. H.; MANN, R. E.; HAYES, S. F.; THOMAS, L. A.

Characterization of monoclonal antibodies protecting mice against Rickettsia rickettsii.

Journal of Infectious Diseases, v. 151, p. 1052–1060, 1985.

AZAD, A. F.; BEARD, C. B. Rickettsial pathogens and their arthropod vectors.

Emerging Infectious Diseases, v.4, p. 179-186, 1998.

BOUYER, D. H.; STENOS, J.; CROCQUET-VALDES, P.; MORON, C. G.; POPOV,

V. L.; ZAVALA-VELAZQUEZ, J. E.; FOIL, L. D.; STOTHARD, D. R.; AZAD, A. F.;

WALKER, D. H. Rickettsia felis: molecular characterization of a new member of the

spotted fever group. International Journal of Systematic and Evolutionary

Microbiology, v. 51, p. 339–347, 2001.

BURGDORFER, W. Ecological and epidemiological considerations of Rocky Mountain

spotted fever and scrub typhus. In: WALKER, D. H. Biology of Rickettsial Diseases.

Boca Raton: CRC Press, 1988, p. 33-50.

BURGDORFER, W. Tick-borne diseases in the United States: Rocky Mountain spotted

fever and Colorado tick fever. Acta Tropica, v. 34, p. 103-26, 1977.

BURGDORFER, W. Ecology of tick vectors of American spotted fever. Bulletin of the

World Health Organization, v. 40, n. 3, p. 375-381, 1969.

BURGDORFER, W.; ANACKER, R. L.; BIRD, R. G.; BERTRAM, D. S. Intranuclear

growth of Rickettsia rickettsii. Journal of Bacteriology, v. 96, n. 4, p. 1415-1418, Oct.

1968.

BUSTAMANTE, M. E.; VARELA IV, G. Studies on spotted fever in Mexico: the role

of Rhipicephalus sanguineus in the transmission of spotted fever in the Mexican

republic. Revista del Institute de Salubrida y Emfermedades Tropicales, v. 8, p. 139-

141, 1947a (in Spanish).

BUSTAMENTE, M. E.; VARELA, G. Distribution of rickettsioses in Mexico. Revista

del Institute de Salubrida y Emfermedades Tropicales, v. 8, p. 3-14, 1947b (in

Spanish).

BUSTAMANTE, M. E.; VARELA, G. Estudios de fiebre manchada en Mexico. III.

Hallazgo del Amblyomma cajennense naturalmente infectado, en Veracruz. Revista del

lnstituto de Salubridad y Enfermedades Tropicales, v. 7, p. 75-78, 1946.

BUSTAMENTE, M. E.; VARELA, G. A new rickettsiosis in Mexico. The existence of

American spotted fever in the states of Sinoloa and Sonora. Revista del Institute de

Salubrida y Emfermedades Tropicales, v. 4, p. 189–210, 1943 (in Spanish).

DEMMA, L. J.; TRAEGER, M. S.; NICHOLSON, W. L.; et al. Rocky Mountain spotted

fever from an unexpected tick vector in Arizona. New England Journal of Medicine, v.

353, p. 587–594, 2005.

DE RODANICHE, E. C. Natural infection of the tick, Amblyomma cajennense, with

Rickettsia rickettsii in Panama. American Journal of Tropical Medicine and Hygiene,

v. 2, p. 696-699, 1953.

DIAS, E.; MARTINS, A. V. Spotted fever in Brazil. A summary. American Journal of

Tropical Medicine and Hygiene, v. 19, p. 103–108, 1939.

DUMLER, J. S.; WALKER, D. H. Rocky Mountain spotted fever-changing ecology and

persisting virulence. New England Journal of Medicine, v. 353, p. 551–553, 2005.

ELLIOTT, L. B.; FOURNIER, P. V.; TELTOW, G. J. Rickettsia in Texas. Annals of

the New York Academy of Science, v. 590, p. 221-226, 1990.

FOURNIER, P. E.; ROUX, V., RAOULT, D. Phylogenetic analysis of spotted fever

group rickettsiae by study of the outer surface protein rOmpA. International Journal of

Systematic Bacteriology, v. 48, p. 839-849, 1998.

FUENTES, L. Ecological study of Rocky Mountain spotted fever in Costa Rica.

Amercian Journal of Tropical Medicine and Hygiene, v. 35, n. 1, p. 192-196, 1986.

GIMORE JR, R. D.; CIEPLAK, W. Jr.; POLICASTRO, P. F.; HACKSTADT, T. The

120 kilodalton outer membrane protein (rOmp B) of Rickettsia rickettsii is encoded by

an unusually long open reading frame: evidence for protein processing from a large

precursor. Molecular Microbiology, v. 5, n. 10, p. 2361-70, Oct. 1991.

FUENTES, L. G. First case of Rocky Mountain spotted fever in Costa Rica, Central

America. Revista Latinoamericana de Microbiologia, v. 21, p. 167–172, 1979.

(in Spanish).

HAYES, S. F.; BURGDORFER, W. Reactivation of Rickettsia rickettsii in Dermacentor

andersoni ticks: an ultrastructural analysis. Infection and Immunity, v. 37, n. 2, p. 779-

785, Aug. 1982.

HILBURN, L. R.; GUNN, S. J.; CASTILLO, C. Comparison of the isozyme phenotypes

of the morphologically similar ticks Amblyomma cajennense and A. imitator (Acari:

Ixodidae) from South Texas. Journal Of Medical Entomology, v. 26, n. 1, p. 23-29,

1989.

HUN, L.; CORTES, X.; TAYLOR, L. Molecular characterization of Rickettsia rickettsii

isolated from human clinical samples and from the rabbit tick Haemaphysalis

leporispalustris collected at different geographic zones in Costa Rica. American

Journal of Tropical Medicine and Hygiene, v. 79, n. 6, p. 899–902, 2008.

JIANG, J.; BLAIR, P. J.; FELICES, V.; MORON, C.; CESPEDES, M.; ANAYA, E.;

SCHOELER, G. B.; SUMNER, J. W.; OLSON, J. G.; RICHARDS, A. L. Phylogenetic

Analysis of a novel molecular isolate of spotted fever group rickettsiae from Northern

Peru Candidatus Rickettsia andeanae. Annals of the New York Academy of Science,

v. 1063, p. 337–342, 2005.

KEIRANS, J. E.; DURDEN, L. A. Illustrated key to nymphs of the tick genus

Amblyomma (Acari: Ixodidae) found in the United States. Medical Entomology, v. 35,

p. 489-495, 1998.

KOHLS, G. M. Amblyomma imitator, a new species of tick from Texas and Mexico, and

remarks on the synonymy of A cajennense (Fabricius) (Acarina-Ixodidae). Journal of

Parasitology, v. 44, p. 430-433, 1958.

LABRUNA, M. B. Ecology of Rickettsia in South America. Annals of the New York

Academy of Science, v. 1166, p. 156–166, 2009

LI, H.; WALKER, D. H. RompA is a critical protein for the adhesion of Rickettsia

rickettsii to host cells. Microbial Pathogenesis, v. 24, p. 289-298, 1998.

LUFT, J. H. Ruthenium red and violet. I. Chemistry, purification, methods of use for

electron microscopy and mechanisms of action. The Anatomical Record, v. 171, p.

347-368, 1971.

LUFT, J. H. Electron microscopy of cell extraneous coats as revealed by ruthenium red

staining. Journal of Cellular Biology, v. 23, p. 54-55, 1964.

MARIOTTE, C. O.; BUSTAMANTE, M. E.; VARELA, G. Hallazgo del Rhipicephalus

sanguineus Latreille infectado naturalmente con fiebre manchada de las Montanas

Rocosas, en Sonora (Mexico). Revista del lnstituto de Salubridad y Enfermedades

Tropicales, v. 5, p. 297–300, 1944.

MCDADE, J. E.; NEWHOUSE, V. F. Natural history of Rickettsia rickettsii. Annual

Review of Microbiology, v. 40, p. 287–309, 1986.

MCKIEL, J. A. The rodent- and avian-borne diseases in Canada. Canadian Journal of

Public Health, v. 51, p. 220-25, 1960.

MEDINA-SANCHEZ, A.; BOUYER, D. H.; ALCANTARA-RODRIGUEZ, V.;

MAFRA, C.; ZAVALA-CASTRO, J.; WHITWORTH, T.; POPOV, V. L.;

FERNANDEZ-SALAS, I.; WALKER, D. H. Detection of a typhus group Rickettsia in

Amblyomma ticks in the state of Nuevo Leon, Mexico. Annals of the New York

Academy of Science, v. 1063, p. 327-332, 2005.

MORAES-FILHO, J.; PINTER, A.; PACHECO, R. C.; et al. New epidemiological data

on Brazilian spotted fever in an endemic area of the state of Sao Paulo, Brazil. Vector

Borne and Zoonotic Diseases, v. 9, p. 73–78, 2009.

MORON, C. G.; BOUYER, D.H.; YU, X-J.; FOIL, L. D.; CROCQUET-VALDES, P.;

WALKER, D. H. Phylogenetic analysis of the rompB genes of Rickettsia felis and

Rickettsia prowazekii European-human and North American flying-squirrel strains.

American Journal of Tropical Medicine and Hygiene, v. 62, p. 598-603, 2001.

NIEBYLSKI, M. L.; SCHRUMPF, M. E.; BURDORFER, W.; FISCHER, E. R.; GAGE,

K.L.; SCHWAN, T.G. Rickettsia peacockii sp. nov., a new species infecting wood ticks,

Demacentor andersoni, in western Montana? International Journal of Systematic

Bacteriology, v. 47, n. 2, p. 446-452, 1997.

OBIJESKI, J. R.; PALMER, E. L.; TZIANABOS, T. Proteins of purified rickettsiae.

Microbios, v. 11, p. 61–76, 1974.

PARKER, R. R.; PHILIP, C. B.; JELLISON, W. L. Rocky Mountain spotted fever.

Potentialities of tick transmission in relation to geographical occurrence in the United

States. American Journal of Tropical Medicine, v. 13, p. 341-379, 1933.

PEDERSEN JR, C. E.; WALTERS, V. D. Comparative electrophoresis of spotted fever

group rickettsial proteins. Life Science, v. 22, p. 583–587, 1978.

PAROLA, P.; PADOCK, C. D.; RAOULT, D. Tick-borne rickettsioses around the

world: emerging diseases challenging old concepts. Clinical Microbiology Reviews, v.

18, p. 719–756, 2005.

PATINO-CAMARGO, L. Nuevas observaciones sobre un tercer foco de fiebre petequial

(maculosa) en el hemisferio Americano. Bal. Of. Sanit. Panam., v. 20, p. 11l2-1124,

1941.

PATINO, L.; AFANADOR, A.; PAUL, J. H. A spotted fever in Tobia, Colombia.

Preliminary report. American Journal of Tropical Medicine, v. 17, p. 639–653, 1937.

PINTER, A.; LABRUNA, M. B. Isolation of Rickettsia rickettsii and Rickettsia bellii in

cell culture from the tick Amblyomma aureolatum in Brazil. Annals of the New York

Academy of Science, v. 1078, p. 523–529, 2006.

PIZA, J.T. Considerações epidemiológicas e clínicas sobre o tifo exantemático de São

Paulo. São Paulo: Sociedade Impressora Paulista, p. 11-119. 1932.

ROUX, V.; RAOULT, D. Phylogenetic analysis of members of the genus Rickettsia

using the gene encoding the outer-membrane protein rOmpB (ompB). Intertnational

Journal of Systematic Evolutionary Microbiology, v. 50, p. 1449-1455, Jul. 2000.

Ripoll, C. M.; REMONDEGUI, C. E.; ORDONEZ, G.; et al. Evidence of rickettsial

spotted fever and ehrlichial infections in a subtropical territory of Jujuy, Argentina.

American Journal of Tropical Medicine and Hygiene, v. 61, p. 350–354, 1999.

RODANICHE, E. C.; RODANICHE, A. Spotted fever in Panama: isolation of the

etiologic agent from a fatal case. American Journal of Tropical Medicine, v. 30, p.

511-517, 1950.

ROUX, V.; FOURNIER, P. E.; RAOULT, D. Differentiation of spotted fever group

rickettsiae by sequencing and analysis of restriction fragment length polymorphism of

PCR-amplified DNA of the gene encoding the protein rOmpA. Journal of Clinical

Microbiology, v. 34, p. 2058–2065, 1996.

SILVERMAN, D. J.; WISSEMAN JR, C. L. Comparative ultrastructural study on the

cell envelopes of Rickettsia prowazekii, Rickettsia rickettsii, and Rickettsia

tsutsugamushi. Infection and Immunity, v. 21, n. 3, p. 1020-1023, Sept. 1978.

SILVERMAN, D. J.; WISSEMAN JR, C. L.; WADDELL, A. D.; JONES, M. External

layers of Rickettsia prowazekii and Rickettsia rickettsii: Occurrence of a slime layer.

Infection and Immunity, v. 22, n. 1, p. 233-246, Oct. 1978.

SONENSHINE, D. E. Zoogeography of the American dog tick, Dermacentor variabilis.

Recent Advances in Acarology, v. 2, p. 1 23-34, 1979.

STENOS, J.; WALKER, D. H. The rickettsial outer-membrane protein A and B genes of

Rickettsia australis, the most divergent rickettsia of the spotted fever group.

International Journal of Systematic and Evolutionary Microbiology, v. 50, p. 1775–

1779, 2000.

UCHIYAMA, T.; KAWANO, H.; KUSUHARA, Y. The major outer membrane protein

rOmpB of spotted fever group rickettsiae functions in the rickettsial adherence to and

invasion of Vero cells. Microbes and Infection, v. 8, p. 801-809, 2006.

ZAVALA-CASTRO, J. E.; DZUL-ROSADO, K. R.; LEON, J. J. A.; WALKER, D. H.;

ZAVALA-VELAZQUEZ, J. E. An increase in human cases of spotted fever rickettsiosis

in Yucatan, Mexico, involving children. American Journal of Tropical Medicine and

Hygiene, v. 79, p. 907–910, 2008.

ZAVALA-CASTRO, J. E.; ZAVALA-VELAZQUEZ, J. E.; WALKER, D. H.;

ARCILA, E. E. R.; LAVIADA-MOLINA, H.; OLANO, J. P.; RUIZ-SOSA, J. A.,

SMALL, M. A.; DZUL-ROSADO, K. R. Fatal human infection with Rickettsia

rickettsii, Yucatán, Mexico. Emerging Infectious Diseases, v. 12, p. 672-674, 2006.

ZAVALA-VELAZQUEZ, J. E.; YU, X-J; WALKER, D. H. Unrecognized spotted fever

group rickettsiosis masquerading as dengue fever in Mexico. American Journal of

Tropical Medicine and Hygiene, v.55, p.157-159, 1996.

This manuscript has been submitted for consideration in Emerging Infectious Diseases.

ARTICLE SUMMARY LINE:

In this study we report the natural infection of Amblyomma imitator ticks by Rickettsia

rickettsii as well as its transovarial transmission by this species of ticks, strongly

suggesting the discovery of a novel vector of Rickettsia rickettsii in South Texas and

Mexico.

RUNNING TITLE:

Amblyomma imitator as a vector of R. rickettsii

Key Words: Ticks, Rickettsia rickettsii, RMSF, ultrastructure.

TITLE:

Amblyomma imitator: discovery of a novel vector for Rickettsia rickettsii in Mexico and

South Texas

Karla A. Oliveira

, Adriano Pinter

, Aaron Medina-Sanchez

, Venkata D. Boppana,

Stephen K. Wikel, Tais B. Saito, Thomas Shelite, Lucas Blanton, Vsevolod Popov

, Pete

D. Teel

, David H. Walker, Claudio Mafra

, Donald H. Bouyer.

Author Affiliations: University of Texas Medical Branch at Galveston, Galveston,

Texas, USA.

Current Affiliations: Universidade Federal de Viçosa, Vicosa, Brazil.

Current Affiliation: Superintendência de Controle de Endemias (SUCEN), Sao Paulo,

Brazil.

Current Affiliation: Laboratorio de Medicina Molecular y Terapia Celular, Hospital y

Clinica OCA, Monterrey, Nuevo Leon, Mexico.

Current Affiliation: Texas A&M University, College Station, Texas, USA.

ABSTRACT

Amblyomma imitator ticks collected from the field in Nuevo Leon State, Mexico,

were maintained in the laboratory by feeding on naïve pathogen-free rabbits. Real-time

PCR analysis of eggs laid from the first generation of laboratory-reared females

indicated the presence of Rickettsia in some of the egg masses. Further characterization

of the organism isolated from these ticks in Vero cells by analyzing fragments of htrA,

ompA and ompB genes revealed it to be R. rickettsii. Ultrastructural analysis of tissues of

adult ticks showed the presence of the rickettsial agent in midgut. This is the first report

of the presence and transovarial transmission of R. rickettsii by naturally infected A.

imitator ticks and suggests a role for this species of tick in transmission of Rocky

Mountain spotted fever in Mexico and South Texas (USA).

INTRODUCTION

Rickettsioses, diseases of worldwide importance, are caused by small, Gram-

negative, obligately intracellular bacteria that are transmitted to humans via ticks, fleas,

mites or lice. The genus Rickettsia has been classically divided into two groups, the

typhus group (TG) and the spotted fever group (SFG). In the United States and Mexico,

transmission of Rocky Mountain spotted fever (RMSF) has been attributed to ticks of

the genera Dermacentor (D. variabilis and D. andersoni), Rhipicephalus (R.

sanguineus), and Amblyomma (A. cajennense).

Amblyomma imitator has close affinity with Amblyomma cajennense and was

formerly confused with this species. Its distributional range extends from southern Texas

(where it is more or less sympatric with Amblyomma cajennense), southward through

Mexico (where it is widely sympatric with A. cajennense) into Central America (1).

According to Kohls (2) it is apparent that the Rocky Mountain spotted fever

transmission studies performed with supposed A. cajennense by Parker, Philip, and

Jellison (3) were actually performed with A. imitator, which suggested a role for this

species of tick as a vector of R. rickettsii. In the present study, we report the isolation

and characterization of R. rickettsii from A. imitator using molecular biology methods,

suggesting the discovery of a novel vector for the RMSF agent in Mexico and South

Texas.

METHODS

Tick collection and establishment of colony: Ticks were collected from Nuevo Leon

State Mexico (2007) and Laguna Atascosa National Wildlife Reserve in southern Texas

(2009) using dry ice traps. The ticks were identified using morphological keys as

defined by Kohls (2) and Keirans et al. (1). The adult ticks from both localities were

initially screened for the presence of Rickettsia using Gimenez staining of hemolymph

content. The Nuevo Leon and South Texas collections were maintained in the laboratory

at the UTMB, according to methods described by Brossard and Wikel (4). The colonies

are maintained at 22

C, under a 14 hour-light / 10 hour-dark photoperiod. Ticks are held

in 16 ml glass vials (Wheaton Glass, Millville, NJ) with a mesh top over a super-

saturated solution of potassium nitrate. The larvae and nymphs from the Nuevo Leon

collection obtained blood meals from mice and adults were fed on naïve pathogen free

rabbits.

DNA extraction and PCR: DNA from eggs of A. imitator ticks collected in Nuevo

Leon state, Mexico and from 20 pools of 10 adult ticks from South Texas was extracted

using a DNeasy Kit (Qiagen) following the recommendations of the manufacturer. For

real-time PCR analysis, Rickettsia-specific primers CS5A and CS6 (5) that amplify a

fragment of 150 bp of the gltA gene were utilized. The real-time PCR was performed in

a Bio-Rad iCycler thermocycler with 25 µL per reaction, which contained 12.5 µL of the

PCR mix, 0.4 mM of each primer and 10.5 µL of molecular-grade water/bovine serum

albumin solution (BSA; 800 ng/µL) and 1 µL of each sample. Rickettsia australis DNA

and water served as the positive and negative controls, respectively, and serial dilutions

of a plasmid that contained the R. prowazekii gltA gene were utilized as the standards.

Real-time PCR cycling conditions were as follows: 1 cycle at 95°C for 2 min, followed

by 50 cycles of 15 s at 95°C, 30 s at 55°C, and 30s at 60°C. DNA from egg masses

determined by real-time PCR to contain rickettsial DNA was used to select egg masses

for isolation of the rickettsial agent. DNA extracted from ticks of South Texas collection

was also used as template for a Nested-PCR using primers (5, 6) for amplification of a

fragment of the htrA gene using the following conditions: 94

C for 15 min, 30 cycles at

C for 1 min,

C for 1 min, and 72

C for 2 min, followed by a step at 72°C for 7 min.

Isolation of Rickettsia: Rickettsiae were isolated from an A. imitator egg mass in Vero

cells using shell vials as previously described (7). In brief, egg masses from the first

generation of laboratory-reared female ticks were collected and disinfected in 3% bleach

and 70% ethanol, with washes with sterile PBS between each disinfection, and triturated

in 200 µL of DMEM with 10% bovine calf serum (BCS) and utilized to inoculate Vero

cell monolayers. The shell vials were incubated at 34

C and monitored daily by Diff-

Quik staining for the presence of rickettsiae. Slides that contained four rickettsiae were

considered positive, and the monolayer from the corresponding shell vial was removed

manually and used to inoculate a T-25 flask containing Vero cells (in DMEM containing

3% BCS) for propagation of the agent. Cells of the 25-cm

flask were observed by Diff-

Quik staining until more than 90% of the cells were infected, when they were harvested

and inoculated into 150-cm

flasks of Vero cells. The A. imitator isolates were

genotypically identified by sequencing the PCR product of the resultant infected cells, as

described below.

IFA: Indirect immunofluorescence assay was performed from infected-Vero cells using

rabbit polyclonal antibody against R. rickettsii Sheila Smith strain (diluted 1:200) and

fluorescein isothiocyanate-labeled goat anti-rabbit IgG (diluted 1:300) (Kirkegaard &

Perry Laboratories, Gaithersburg, MD ) following the Protocol for Identification of

Rickettsial Antigens of the Rickettsial and Ehrlichial Diseases Research Laboratory at

University of Texas Medical Branch (UTMB) with some modifications. Rickettsia

rickettsii-infected Vero cells were used as the positive control, and uninfected Vero cells

were the negative control. Slides containing a smear from infected and uninfected Vero

cells were fixed in acetone for 10 minutes, rinsed with PBS, incubated with primary

antibody diluted in PBS/BSA at 34°C in a humid chamber for 30 minutes, washed twice

with PBS solution containing Evans Blue and Triton X-100 (0.1%), and incubated with

the secondary antibody diluted in PBS at 34°C in a humid chamber for 30 minutes.

Slides were mounted with Crystal Mount (Biomedia, Foster City, CA) under coverslips

and examined using a fluorescent microscope Olympus BX31.

Characterization of the rickettsial isolate: For detection and characterization of the

organism isolated in Vero cells, partial sequences of the Rickettsia- specific genes htrA,

ompB, and ompA were amplified and analyzed. DNA from infected Vero cells was

extracted using the DNeasy Kit (Qiagen). Nested-PCR was performed using Rickettsia-

specific primers 17K3 and 17K5 (5) for the first reaction and 17KD1 and 17kD2

described by Webb et al. (6) for the second reaction for amplification of fragments of

547 bp and 434 bp, respectively, of the htrA gene. For amplification of a fragment of

856 bp of the ompB gene the pair of primers 120-M59 and 120-807 was used (8). A 533

bp fragment of the ompA gene was amplified using the primers Rr190.70F and

Rr190.602R (8). For one of the samples a semi-nested PCR was necessary to amplify an

ompA fragment. The primers Rr190.70F and Rr190.701R (10) were used for the first

reaction, and primers Rr190.70F and Rr190.602R for the second reaction. The sequences

of primers used for characterization are shown in the table.

For sequencing, amplified fragments were cloned into pCR®4-TOPO® (Invitrogen

TOPO TA Cloning® Kit) following the manufacturer’s protocol. Plasmid DNA

extraction was performed using Wizard Plus SV Minipreps DNA Purification System

(Promega). Plasmids containing inserts were sequenced at least three times using the

Universal primers M13F and M13R. The nucleotide sequences were edited with

SeqMan and compared with the corresponding homologous sequences available at

GenBank, using Blast analysis (11).

Electron Microscopy: For detection of rickettsiae in A. imitator salivary glands,

midguts and ovaries were dissected from unfed adults and fixed in modified Ito’s

fixative (2.5% formaldehyde, 0.1% glutaraldehyde, 0.03% trinitrophenol, 0.03% CaCL

in 0.05M cacodylate buffer at pH 7.3-7.4) (12), postfixed in 1% osmium tetroxide for 1

h, stained en bloc in 2% aqueous uranyl acetate for 20 minutes at 60°C, dehydrated in

ethanol, and embedded in epoxy resin (Poly/Bed 812). Ultrathin sections were cut on a

Reichert Ultracut S ultramicrotome, placed on copper grids, stained with lead citrate,

and examined in a Philips (FEI) CM-100 electron microscope at 60kV.

RESULTS

Detection and Characterization of Rickettsia

In 2007,we collected five tick species (A. imitator, Boophilis microplus,

Dermacentor variabilis, Rhipacephalus sanguineus, and Ixodes species) from the field

in Nuevo Leon State (24°50'N, 100°04'W), Mexico.(13) From this collection we were

only able to successfully establish a colony of A. imitator that was maintained in the

laboratory by allowing to blood feed on naïve rabbits. Real-time PCR analysis of eggs

laid by one full generation of laboratory-reared females indicated the presence of

rickettsial DNA in two egg masses (Figure 1). The CT value for these samples was high

(38 cycles), indicating a low concentration of Rickettsia in the egg masses. The

organisms were isolated in Vero cells from two egg masses that showed the presence of

rickettsial DNA by real-time PCR. Rickettsial organisms were observed in Vero cells by

using Diff-Quik staining and IFA with antibody against R. rickettsii (Figs. 2 and 3).

Rickettsiae were also detected in Vero cells and characterized by analyzing the

sequences of fragments of 434 bp, 856 bp and 533 bp amplified from Rickettsia-specific

genes, htrA, ompB, and ompA, respectively. Amplification and analysis of the ompB

fragment were achieved from only one of the samples.

Analysis of the sequences obtained from the htrA gene fragments amplified from

both samples showed 99% identity with spotted fever group Rickettsia sequences,

including the Rickettsia rickettsii sequence from a fatal case of RMSF in southwestern

Mexico, Yucatan State (DQ176856.1) (14), with which the alignment of the sequences

obtained from the samples of the present study presented the highest Bit Score (S), with

only one nucleotide difference. Analysis of the partial sequence of ompB gene showed

100% identity between the organism isolated from one of the egg masses and R.

rickettsii Sheila Smith strain (CP000848.1). The partial sequences obtained from the

ompA gene of both isolates were 100% identical to the corresponding sequence of R.

rickettsii Sheila Smith strain (CP000848.1) in GenBank. The sequences obtained in this

study were submitted to the GenBank with the following accession numbers:

(GU723476) and (GU723477) for the fragments amplified from htrA gene, (GU723478)

and (GU723479) for the fragments of ompA gene and (GU723475) for the fragment of

ompB gene.

In addition, we have obtained preliminary data from A. imitator ticks collected

from the field in Laguna Atascosa National Wildlife Reserve in southern Texas in 2009.

The sequence analysis of a 434 bp fragment of the htrA gene amplified from DNA

extracted from two pools of ticks using the primers listed previously showed 100% and

99% identity with R. rickettsii strain from Mexico (DQ176856.1). Isolation and further

characterization of the agent(s) infecting ticks collected in this area are in progress.

Ultrastructural Observations

Ultrathin sections of salivary glands, ovaries and midguts of unfed PCR-positive

A. imitator were examined in a transmission electron microscope. Those ticks were

tested for the presence of Rickettsia by nested-PCR with primers that amplify a 434 bp

fragment of the htrA gene and were shown to contain DNA of Rickettsia. Single

rickettsial cells were found in highly vacuolated cytoplasm of midgut epithelial cells of

one tick (#5 – male) (Fig. 4A). They had typical ultrastructure for Gram-negative

bacteria being surrounded by two trilaminar membranes (Fib. 4B): inner cytoplasmic

membrane and outer cell wall membrane. Their size was 0.6 x 0.2 µm.

DISCUSSION

This study demonstrated that R. rickettsii has been isolated from egg masses of

A.imitator ticks that were documented to contain R. rickettsii DNA by real-time PCR

and DNA sequencing. Since the eggs were laid by field collected unfed adult ticks that

were further fed in the laboratory using naïve pathogen-free rabbits for one full

generation in order to establish a colony of ticks, the presence of those organisms in

eggs documents their transovarial transmission by naturally infected ticks, suggesting a

role for this species of ticks in the maintenance of R. rickettsii in nature.

Since the hosts of A. imitator are various species of birds and mammals,

including wild turkey, squirrel, peccary, dog, goat, horse, cattle, and humans (1), and the

adult stage of this tick species seems to be very aggressive to human beings (13), the

medical importance of the findings of this study is the potential participation of this tick

in a zoonotic cycle of R. rickettsii. Because of its high similarity to A. cajennense and

the overlapping range of distribution of these species of ticks in Mexico, it is likely that

the previously described spotted fever group rickettsial isolate from supposed A.

cajennense in Veracruz State, which was demonstrated to cause periorchitis and scrotal

necrosis in guinea pigs consistent with R. rickettsii (15), was actually isolated from A.

imitator. Kohls (2), when re-examining tick collections in the Rocky Mountain

Laboratory that were labeled “A cajennense”, identified A. imitator and suggested that

the positive results in tests of transmission of RMSF performed in 1933 (3) using

supposed A. cajennense were actually obtained using A. imitator. Evaluation of

transmission of R. rickettsii by this species of tick is in progress in our laboratory.

Cases of RMSF in Mexico occurred during the decades from 1930 to 1950, and

Rhiphicephalus sanguineus ticks were incriminated as the vector (16, 17, 18). In a study

carried out in 1996, sera of patients from Yucatan and Jalisco States suspected clinically

to have dengue fever were shown to contain antibodies reactive with R. rickettsii

antigens by indirect immunofluorescence (19). Subsequently, the first human case of

infection with R. rickettsii in Yucatan State was reported in 2006, diagnosed by using

immunohistochemistry and specific polymerase chain reaction (14). With 99% identity

and only one nucleotide difference in the sequence of a fragment of the htrA gene

obtained in this study (R. rickettsii strain from Mexico, DQ176856.1) and the

corresponding sequence obtained in the present study showing the closest relatedness,

the close relationship between these strains is apparent. It would be interesting to have

the availability of the sequences of ompB and ompA genes of the Yucatan strain for

comparison. Although the sequences of the fragments of these genes obtained here

showed 100% identity to R. rickettsii Sheila Smith strain, it would not be unlikely to

have the same result in comparison of them and the R. rickettsii strain from Mexico,

(DQ176856.1), since this strain also has a close relationship with R. rickettsii Sheila

Smith strain. Studies determining the species of tick with potential for transmission of

R. rickettsii are necessary in Mexico, and according to the results of the present study,

we suggest that A. imitator is a potential vector or at least is involved in maintenance of

this rickettsial agent in nature in this country as well as in South Texas (US).

The ultrastructure of Rickettsia rickettsii observed in this study, which includes

the absence of a discrete microcapsular layer and electron lucent halo zone, are similar

to those in the study of Hayes and Burgdorfer (20). Through electron microscopic

studies of R. rickettsii, the authors observed that physiological conditions, under which

ticks actively feeding and obtaining essential nutrients, metabolites and temperature

required for rickettsial growth, influence the ultrastructural appearance of the

microcapsular and electron lucent zone of R. rickettsii. Their study correlated the

ultrastructural features of the rickettsia and electron lucent zone to the phenomenon of

reactivation of virulence of this bacterium. The growth-limiting conditions in such

reactivation are well described by Spencer and Parker (21). As emphasized by Hayes

and Burgdorfer (20), “the ability of R. rickettsii to reestablish its surface structures

(microcapsular layer and electron lucent zone) under optimal physiological conditions

after having lost them during the periods of stress and starvation of its arthropod host

may indeed provide the basis for reactivation and restoration of virulence”.

Transmission electron microscopy of the midgut ultrathin sections revealed

rickettsia with typical ultrastructure though in low quantities and only in one tick.

CONCLUSION

Transmission of RMSF has been attributed to ticks of the genera Dermacentor

(D. variabilis and D. andersoni), Rhipicephalus (R. sanguineus), and Amblyomma (A.

cajennense) in the United States and Mexico. In this study we report the natural

infection of A. imitator by R. rickettsii as well as transovarial transmission by this

species of ticks, strongly suggesting the discovery of a novel vector of R. rickettsii in

Mexico and South Texas.

ACKNOWLEDGMENTS

We are thankful to CAPES/Brazil and CNPq/Brazil (202151/2007-7) for

awarding a scholarship to the graduate student K.A. Oliveira to pursue a PhD in the

Agricultural Biochemistry Program at the University of Viçosa /Brazil and Split

Fellowship Program at the University of Texas Medical Branch (UTMB/US),

respectively. The authors are grateful to Fogarty International Center (D43 TW00903)

and FAPEMIG/Brazil (APQ-0950-01/07) for supporting this research.

BIOGRAPHICAL SKETCH

K.A. Oliveira has a degree in Nutrition from the Federal University of Vicosa and a

Master’s degree in the Program of Agricultural Biochemistry of the same University

with emphasis in molecular biology and research in infectious diseases transmitted by

ticks. Currently, she is pursuing a PhD degree at the same University investigating

rickettsioses.

REFERENCES:

1. Keirans JE, Durden LA. Illustrated key to nymphs of the tick genus Amblyomma

(Acari: Ixodidae) found in the United States. Med Entomol.1998; 35:489-95.

2. Kohls GM. Amblyomma imitator, a new species of tick from Texas and Mexico, and

remarks on the synonymy of A cajennense (Fabricius) (Acarina-Ixodidae). J Parasitol.

1958; 44:430-3.

3. Parker RR, Philip CB, Jellison WL. Rocky Mountain spotted fever. Potentialities of

tick transmission in relation to geographical occurrence in the United States. Am J Trop

Med. 1933; 13:341-79.

4. Brossard M, Wikel SK. Tick immunobiology. Parasitology. 2004; 129 Suppl:S161-

76.

5. Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride J, Pinter A, et al.

Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao

Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004; 42:90–

6. Webb L, Mitchell C, Malloy DC, Dasch GA, Azad AF. Detection of murine typhus

infection in fleas by using the polymerase chain reaction. J Clin Microbiol. 1990;

28:530-4.

7. Kelly JP, Raoult D, Mason PR. 1991. Isolation of spotted fever group rickettsiae from

triturated ticks using a modification of the centrifugation vial technique. Trans R Soc

Trop Med Hyg. 1991 ; 85:397–98.

8. Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using

the gene encoding the outer membrane protein rOmpB (ompB). Int J Syst Evol

Microbiol. 2000; 50:1449-55.

9. Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and

estimation of intraspecies sequence divergence for portions of two rickettsial genes. J

Bacteriol. 1991; 173:1576–89.

10. Roux V, Fournier PE, Raoult D. Differentiation of spotted fever group rickettsiae by

sequencing and analysis of restriction fragment length polymorphism of PCR-amplified

DNA of the gene encoding the protein OmpA. J Clin Microbiol. 1996; 34:2058-65.

11. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment

search tool. J Mol Biol. 1990; 215:403-10.

12. Ito, S., Y. Rikihisa. Techniques for electron microscopy of rickettsiae. In: W.

Burgdorfer and R. L. Anacker, editors. Rickettsiae and rickettsial diseases. New York:

Academic Press; 1881. p. 213–27.

13. Pinter A, Medina-Sanchez A, Bouyer DH, Teel PD, Fernandes-Salas I, Walker DH.

Preliminary data of Amblyomma imitator Kohls, 1958 (Acari:Ixodidae) biology study.

In : Abstracts of the VI International Conference on Ticks and Tick-borne Pathogens ;

Buenos Aires ; 2008 Sep 21-26; Abstract P190.

14. Zavala-Castro JE, Zavala-Velázquez JE, Walker DH, Arcila EER, Laviada-Molina

H, Olano JP, et al. Fatal human infection with Rickettsia rickettsii, Yucatán, Mexico.

Emerg Infect Dis. 2006; 12:672-4.

15. Bustamante ME, Varela G. Estudios de fiebre manchada en Mexico. III. Hallazgo

del Amblyomma cajennense naturalmente infectado, en Veracruz. [in Spanish]. Revista

del lnstituto de Salubridad y Enfermedades Tropicales. 1946; 7:75-8.

16. Bustamante ME. Una nueva rickettsiosis en Mexico. Existencia de la fiebre

manchada Americana en los estados de Sinaloa y Sonora. [in Spanish]. Revista del

lnstituto de Salubridad y Enfermedades Tropicales. 1943; 4:189–211.

17. Mariotte CO, Bustamante ME, Varela G. Hallazgo del Rhipicephalus sanguineus

Latreille infectado naturalmente con fiebre manchada de las Montanas Rocosas, en

Sonora (Mexico). [in Spanish]. Revista del lnstituto de Salubridad y Enfermedades

Tropicales. 1944; 5 297–300.

18. Bustamante ME, Varela G. Distribucion de las rickettsiasis en Mexico. [in Spanish].

Revista del lnstituto de Salubridad y Enfermedades Tropicales. 1947; 8:3–14.

19. Zavala-Velazquez JE, Yu X-J, Walker DH. Unrecognized spotted fever group

rickettsiosis masquerading as dengue fever in Mexico. Am J Trop Med Hyg. 1996;

55:157-59.

20. Hayes SF, Burgdorfer W. Reactivation of Rickettsia rickettsii in Dermacentor

andersoni ticks: an ultrastructural analysis. Infect Immun.1982; 37:779-85.

21. Spencer RR, Parker RR. Rocky Mountain spotted fever: experimental studies of tick

virus. Public Health Rep. 1924; 39:3027-40.

Address for correspondence: Donald H Bouyer, Pathology Department at UTMB, 301

University Boulevard, Route 0609, Galveston, TX 77555, USA; email:

dobouyer@utmb.edu. Fax: (409) 747-2455 Phone: (409) 747-2035.

Table. Primers used for amplification of rickettsial genes

Genes and primers Primer sequence (5’ 3’) References

gltA

CS5A GAGAGAAAATTATATATCCAAATGTTGAT

(4)

CS6 AGGGTCTTCGTGCATTTCTT

(4)

htrA

17K3 TGTCTATCAATTCACAACTTGCC

(4)

17K5 GCTTTACAAAATTCTAAAAACCATATA

(4)

17KD1 GCTCTTGCAACTTCTATGTT

(6)

17KD2 CATTGTTCGTCAGGTTGGCG

(6)

ompB

120-M59 CCGCAGGGTTGGTAACTGC

(7)

120-807 CCTTTTAGATTACCGCCTAA

(7)

ompA

Rr190.70F ATGGCGAATATTTCTCCAAAA

(8)

Rr190.602R AGTGCAGCATTCGCTCCCCCT

(8)

Rr190.701R GTTCCGTTAATGGCAGCATCT

(9)

Figure 1. Agarose gel (1,2%) showing citrate synthase gene fragments amplified by

real-time PCR from DNA of egg masses. Lanes 1 and 30: 100bp DNA ladder; lanes 2-7:

standards (serial dilutions of plasmids containing Rickettsia prowazekii gltA gene); lane

8: negative control; lanes 9 to 26: products amplified from egg masses; lanes 27 to 29:

positive control.

Figure 2: Dif-Quik stain showing Rickettsia rickettsii in cultured Vero cells. A. Non-

infected Vero cells. B. Infected Vero cells. Bars: 10 µm.

Figure 3: Indirect immunofluorescence of cultured Vero cells infected and uninfected

with R. rickettsii using rabbit polyclonal Ab against Rickettsia rickettsii Sheila Smith

strain (1:200) and fluorescein isothiocyanate-labeled goat anti-rabbit IgG. A. Rickettsial

organisms isolated from a sample of A. imitator egg masses in this study infecting the

cytoplasm of Vero cell. Bar: 10 µm. B and C. Positive and negative controls: Vero cells

infected and non-infected with Rickettsia rickettsii, respectively. Bars: 20 µm.

Figure 4: Electron microscopy of tick tissue showing Rickettsia rickettsii in a cell of

tick midgut. A. Bar: 1 µm; B. The trilaminar cell wall is separated from the cell

membrane by the periplasmic space. Bar: 0.1 µm.

Livros Grátis
( http://www.livrosgratis.com.br )
 
Milhares de Livros para Download:
 
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas

Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
 
 