75
population, were aged from 5 to 30 years old (mean = 14.16 and standard
deviation = 6.30 years). Fifteen (50%) were diagnosed as autistic, 11 (36.67%)
with PDD-NOS and 4 (13.33%) with Asperger’s syndrome. The patients were
from two specialized autism schools and all individuals were conclusively
diagnosed by psychiatrists using different methods. Additionally, all were
evaluated by an interdisciplinary team composed of a psychiatrist, neurologist,
geneticist, psychologist, speech therapist and nurse before participating in this
study. Besides the clinical evaluation, the diagnosis of ASD was made if the
patient met the DSM-IV criteria. Patients were submitted to clinical and
karyotypic examinations and molecular investigations of the FMR1 gene. Only
those individuals with normal results for these tests were included in the study.
We also excluded patients with evidence of any other psychiatric or neurological
conditions and those with other genetic syndromes. Genomic DNA was isolated
from the leukocytes of peripheral blood
15
and the primer sequences were designed
using the Primer3 program.
For all patients, the entire exon 8 and parts of the coding region of exon 22 of the
SHANK3 gene were screened.
Exon 8 was targeted using the forward and reverse primers (5´-
CAGCTGTGATTCCCTCTTCC-3´ and 5´-GGGAAGAACCAAGGTTCAGA-3´)
flanking the positions 8671 and 8870 of DNA producing an amplification of 200
bp. Exon 22 was targeted using
two pairs of primers
; the first flanked the
positions 46748 and 46934 of DNA, producing an amplification of 186 pb
(forward primer 5´- GAAGTCACCCGAGGACAAGA-3´ and reverse primer 5´-
CACAGCCGCTGACTGCAT-3´) and the second flanked the positions 47435 and
47617 of DNA, producing an amplification of 183 pb (forward primer 5´-
CAAGCCCAAGCTCAAGTCC-3´ and reverse primer 5´-
GGGAAGAACCAAGGTTCAGA -3´).
Amplification was performed in a reaction volume of 25L containing 1x PCR
Buffer, 50mM of MgCl
2,
1.25mM dNTPs (GE Healthcare), 50ng genomic DNA,
10M of each primer, and 5U Taq DNA polymerase (Invitrogen). The PCR
reaction was carried out in a GeneAmp
®
PCR System 9700 (Applied Biosystems,
CA) with 4 min of denaturation at 94ºC, followed by 35 cycles of 94ºC for 45s,
45s at an annealing temperature of 62ºC, and for exon 8, an extension for 1 min at
72ºC, with 5 min denaturation at 95ºC, followed by 30 cycles of 95ºC for 30s, 30s
at the annealing temperature at 57ºC, and for each primers of exon 22, extension
for 1 min at 72ºC.
PCR products were purified with ethanol.
16
Sequencing reactions were carried
out with the Applied Biosystems Dye-Terminator v3.1 Kit (Applied Biosystems,
USA) and analyzed on a 3730 DNA analyzer (Applied Biosystems, CA). Analysis
of sequences was performed using the DS Gene 2.0 program (Accelrys, USA) and
a comparison with existing sequences was made using GenBank
(www.ncbi.nlm.nih.gov/nuccore/24137474).
To date 30 individuals have been investigated. Karyotyping was performed when
possible on probands resulting in 27 individuals and 9 subjects for molecular
genetic testing of the Fragile-X syndrome with one affected individual in each