ads:
DANIEL YOUSSEF BARGIERI
SELEÇÃO E DESENVOLVIMENTO DE
ADJUVANTES PARA USO EM IMUNIZAÇÕES COM
PROTEÍNAS RECOMBINANTES DE PLASMODIUM
Tese apresentada à Universidade
Federal de São Paulo para
obtenção do título de Doutor em
Ciências.
São Paulo
2009
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
DANIEL YOUSSEF BARGIERI
SELEÇÃO E DESENVOLVIMENTO DE
ADJUVANTES PARA USO EM IMUNIZAÇÕES COM
PROTEÍNAS RECOMBINANTES DE PLASMODIUM
Orientador: Prof. Dr. Mauricio Martins Rodrigues
Co-orientador: Prof. Dr. Luis Carlos de Souza Ferreira
Tese apresentada à Universidade
Federal de São Paulo para
obtenção do título de Doutor em
Ciências.
São Paulo
2009
ads:
Ficha Catalográfica
Bargieri, Daniel Youssef
Seleção e desenvolvimento de adjuvantes para uso em
imunizações com proteínas recombinantes de Plasmodium/ Daniel
Youssef Bargieri – São Paulo, 2009.
XI, 180f
Tese (Doutorado) – Universidade Federal de São Paulo. Programa de
pós-graduação em Microbiologia e Imunologia.
Título em inglês: Selection and development of adjuvants for
immunizations with recombinant proteins of Plasmodium.
1 – Malária. 2 – Proteínas recombinantes. 3 – Adjuvantes. 4 –
Imunização.
UNIVERSIDADE FEDERAL DE SÃO PAULO
Departamento de Microbiologia, Imunologia e Parasitologia
(DMIP)
Centro Interdisciplinar de Terapia Gênica (Cintergen)
Programa de pós-graduação em Microbiologia e Imunologia
Chefe do Departamento: Prof
a
. Dra. Clara Lúcia Barbieri Mestriner
Coordenador do Curso de Pós-graduação: Prof. Dr. Renato Arruda Mortara
Auxílio financeiro: Fundação de Amparo à Pesquisa do Estado de São Paulo
(FAPESP) e Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq).
À minha querida família:
meus pais Ricardo e Munira,
minhas irmãs Ana Maria e Carolina
e minha esposa Bruna
vi
AGRADECIMENTOS:
Ao meu orientador Prof. Dr. Mauricio Martins Rodrigues, por ter me
recebido em seu laboratório desde minha iniciação científica, sempre exigindo o
melhor e orientando com competência e entusiasmo minha formação científica.
Ao meu coorientador Prof. Dr. Luis Carlos Ferreira, pelas sugestões, pelo
apoio e pelas discussões.
À Prof
a
. Dra. Irene Soares, pelas discussões, pelo apoio e pelas
colaborações.
Ao Prof. Dr. Fabio Costa, pelas discussões, pelas colaborações e pela
amizade, e também às suas alunas Juliana Leite, Stefanie Lopes e Bruna
Carvalho.
À Daniela Santoro, pelo apoio, pelo companheirismo e especialmente
pela amizade.
Às amigas e colaboradoras Catarina Braga e Elisabete Sbrogio-Almeida,
pela ajuda em diversos momentos.
Aos amigos do laboratório: Fanny Tzelepis, Carla Claser, Eduardo
Silveira, José Ronnie Vasconcelos, Mariana Dominguez, Filipe Haolla, Adriano
Araújo, Meire Hiyane, Laís Teixeira, Ariane Camacho, pela amizade e apoio
constante.
Aos meus primos Diogo Youssef e Gustavo Youssef, pela eterna e
incondicional amizade.
Aos meus amigos do CEB, pelos incontáveis momentos de felicidade.
Aos professores e amigos do departamento e do Cintergen, pela
convivência agradável nos últimos anos.
À Mércia Maia e Regiane Escobar, pelas informações importantes, ajuda
e paciência.
vii
SUMÁRIO:
LISTA DE ABREVIATURAS.................................................................................................................... VIII
LISTA DE FIGURAS..................................................................................................................................... IX
RESUMO ..........................................................................................................................................................X
INTRODUÇÃO................................................................................................................................................. 1
1.
E
PIDEMIOLOGIA DA MALÁRIA
.................................................................................................................... 2
1.1. Distribuição no Brasil e no mundo.......................................................................................... 2
1.2. Impacto socioeconômico........................................................................................................... 6
1.3. Ciclo de vida do parasita............................................................................................................ 6
1.4. Tratamento e resistência a drogas .......................................................................................... 8
2.
P
ATOGENIA E MANIFESTAÇÕES CLÍNICAS DA MALÁRIA
........................................................................... 9
3.
R
ESPOSTA IMUNE CONTRA MALÁRIA
...................................................................................................... 10
3.1. Resposta imune naturalmente adquirida............................................................................. 10
3.2. Mecanismos de imunidade contra os parasitas da malária: .......................................... 13
3.3. Antígenos alvos da resposta imune protetora contra malária....................................... 16
3.4. Proteína 1 de superfície de merozoítas (MSP1) ................................................................. 18
4.
A
DJUVANTES
........................................................................................................................................... 30
4.1. Adjuvantes em vacinas contra malária ................................................................................ 35
4.2. Adjuvantes de mucosa ............................................................................................................. 37
4.3. Flagelina ....................................................................................................................................... 38
OBJETIVOS ................................................................................................................................................... 42
RESULTADOS .............................................................................................................................................. 44
A
RTIGOS PUBLICADOS OU EM PREPARAÇÃO
............................................................................................. 45
A
RTIGO
1..................................................................................................................................................... 46
Adjuvant requirement for successful immunization with recombinant derivatives of
Plasmodium vivax merozoite surface protein-1 delivered via the intranasal route. ........ 47
Resumo:..................................................................................................................................................................... 47
A
RTIGO
2..................................................................................................................................................... 53
New malaria vaccine candidates based on the Plasmodium vivax Merozoite Surface
Protein-1 and the TLR-5 agonist Salmonella Typhimurium FliC flagellin. .......................... 54
Resumo:..................................................................................................................................................................... 54
A
RTIGO
3..................................................................................................................................................... 66
Immunogenic properties of a recombinant fusion protein containing the C-terminal 19
kDa of Plamsodium falciparum Merozoite Surface Protein-1 and the flagellin FliC of
Salmonella. .......................................................................................................................................... 67
Resumo:..................................................................................................................................................................... 67
CONSIDERAÇÕES FINAIS....................................................................................................................... 109
CONCLUSÕES............................................................................................................................................ 113
ANEXOS....................................................................................................................................................... 115
REFERÊNCIAS BIBLIOGRÁFICAS........................................................................................................ 146
ABSTRACT.................................................................................................................................................. 179
viii
LISTA DE ABREVIATURAS
AMA - “Apical Membrane Antigen”
AS01 - “Adjuvant system 01”
AS02 - “Adjuvant system 02”
CD - “Cluster of Differentiation”
CpG ODN - Citidina-Fosfato-Guanosina oligodeoxinucleotídeo
CS - Proteína do circumsporozoíta
CT - Toxina colérica
DDT - Dicloro-Difenil-Tricloroetano
EGF - Fator de crescimento epidermal
FP9 - “Fowlpox virus 9”
GPI - Glicosilfosfatidilinositol
ICAM - Molécula de adesão intercelular
IFA - Imunofluorescência indireta
IFN-γ - Interferon gama
IgG - Imunoglobulina G
IL - Interleucina
LPS - Lipopolissacarídeo
LSA - “Liver Stage Antigen”
LT - Toxina termo-lábil de E. coli
MHC - Complexo Principal de Histocompatibilidade
MPL - Monofosforil lipídio A
MSP - Proteína de superfície de merozoítas de Plasmodium
MVA - “Modified vaccinia virus Ankara”
NO - Óxido nítrico
PAMP - Padrão molecular relacionado a patógenos
Quil-A - Saponina de Quillaja saponaria
QS-21 - Fração atóxica da saponina de Quillaja saponaria
TLR - “Toll like receptor”
TNF - Fator de Necrose Tumoral
ix
LISTA DE FIGURAS
Página 03 - Tabela 1: estimativa de casos de malária por região, adaptado de [8].
Página 05 - Figura 1: casos de malária registrados anualmente no Brasil (dados
da Secretaria de Vigilância em Saúde).
Página 15 - Figura 2: representação dos diferentes estágios do parasita da
malária que são possíveis alvos de uma vacina [50].
Página 19 - Figura 3: esquema do processamento proteolítico da MSP1 [47].
Página 20 - Figura 4: ilustração representando a estrutura tridimensional obtida
por espectroscopia de ressonância magnética nuclear de uma proteína
recombinante baseada na MSP1
19
de P. vivax [74].
Página 34 - Figura 5: ilustração dos receptores do tipo Toll conhecidos, seus
ligantes e as vias de ativação [159].
Página 35 - Figura 6: ilustração dos receptores do tipo não Toll conhecidos, seus
ligantes e as vias de ativação [159].
Página 39 - Figura 7: estrutura da molécula de flagelina [180].
x
RESUMO
A região C-terminal da proteína 1 de superfície de merozoítas de
Plasmodium (MSP1
19
) vem sendo estudada como um dos principais alvos para
desenvolvimento de uma vacina contra malária. Estudos têm demonstrado a
imunogenicidade desta região em vacinações experimentais utilizando proteínas
recombinantes na presença de adjuvantes fortes.
No presente estudo, consideramos a possibilidade da utilização de
proteínas recombinantes baseadas na sequência da MSP1
19
para imunização de
camundongos por uma via de mucosa. Também geramos novas proteínas
recombinantes de fusão da MSP1
19
com a flagelina (proteína do flagelo de
Salmonella enterica Typhimurium), com o intuito de aumentar a imunogenicidade
deste antígeno.
Avaliamos inicialmente a capacidade de atuação das moléculas toxina
colérica (CT), toxina termo-lábil de E. coli (LT) e do oligodeoxinucleotídeo CpG
ODN 1826 como adjuvantes em imunizações de camundongos pela via de
mucosa intranasal, utilizando como antígenos as proteínas recombinantes
baseadas na MSP1
19
de P. vivax His
6
PvMSP1
19
ou His
6
PvMSP1
19
-PADRE
(contendo o epítopo “helper” universal PADRE). Quando administradas na
presença dos adjuvantes CT ou LT, ambas foram altamente imunogênicas pela via
intranasal, induzindo altos títulos de anticorpos, maiores do que quando utilizamos
o CpG ODN 1826 como adjuvante. A adição do CpG ODN 1826 em imunizações
na presença de CT foi capaz de aumentar a resposta específica de IgG2c. Nossos
resultados demonstraram que CT e LT são adjuvantes potentes de mucosa em
imunizações com antígenos recombinantes de malária, e que o CpG ODN 1826
pode ser utilizado como ferramenta de modulação da resposta imune nestas
imunizações.
Subsequentemente, expressamos em bactérias E. coli uma proteína
recombinante contendo a sequência da PvMSP1
19
-PADRE fusionada à flagelina
FliC de S. enterica Typhimurium (His
6
FliC-PvMSP1
19
-PADRE). Demonstramos
que essa proteína de fusão retém as propriedades antigênicas da PvMSP1
19
e a
capacidade da flagelina de ativar o receptor TLR5 da imunidade inata. A
xi
imunização de camundongos utilizando somente esta proteína recombinante de
fusão induziu altos títulos de anticorpos, além de células específicas produtoras de
IFN-γ medidas no baço dos animais imunes. A adição de CpG ODN 1826 nas
imunizações foi capaz de imunomodular a resposta de anticorpos, aumentando os
títulos de IgG2c. Além disso, os soros dos camundongos imunizados foram
capazes de reconhecer os parasitas por imunofluorescência indireta (IFA). Estes
resultados demonstraram uma nova classe de antígenos candidatos à vacina
contra malária, com atividade adjuvante intrínseca e capaz de estimular respostas
imunológicas humoral e celular específicas, quando administrada sozinha ou na
presença de outros adjuvantes.
Por fim, expressamos em bactérias E. coli uma proteína recombinante
contendo a sequência da MSP1
19
de P. falciparum (PfMSP1
19
) fusionada à
flagelina FliC de S. enterica Typhimurium (His
6
FliC-PfMSP1
19
). Demonstramos
que esta proteína de fusão retém a capacidade da flagelina de ativar o receptor
TLR5 da imunidade inata. A imunização de camundongos com somente esta
proteína recombinante de fusão induziu altos títulos de anticorpos, além de células
produtoras de IFN-γ específicas contra a PfMSP1
19
. A adição de adjuvantes como
CpG ODN 1826 ou Quil-A (saponina de Quillaja saponaria) nas imunizações com
a proteína recombinante de fusão foi capaz de imunomodular a resposta de
anticorpos, aumentando os títulos de IgG2c, bem como de potencializar a resposta
celular medida pela produção de IFN-γ contra a PfMSP1
19
. Os soros de coelhos
imunizados com a His
6
FliC-PfMSP1
19
sem a adição de nenhum adjuvante
apresentaram altos títulos de anticorpos específicos contra a PfMSP1
19
, que foram
capazes de inibir o crescimento do parasita in vitro. Esses resultados sugerem a
estratégia de fusão de antígenos de plasmódios como uma alternativa viável de
desenvolvimento de uma vacina barata e eficaz contra a malária.
INTRODUÇÃO
2
1. Epidemiologia da malária
1.1. Distribuição no Brasil e no mundo
O parasita da malária foi observado pela primeira vez por Alphonse
Laveran em 1880 [1]. Em 1897, Ronald Ross identificou oocistos de Plasmodium
no intestino de mosquitos que haviam picado pássaros infectados, evidenciando a
participação desses insetos como vetores do parasita [2]. Ainda no final do século
XIX os mosquitos do gênero Anopheles foram confirmados como os vetores da
malária humana por Batistta Grassi [3].
Aproximadamente 200 espécies do gênero Plasmodium que infectam
aves, répteis e mamíferos já foram descritas [4]. Quatro espécies infectam
naturalmente o homem: Plasmodium falciparum, Plasmodium vivax, Plasmodium
ovale e Plasmodium malariae. O P. falciparum e o P. vivax são os responsáveis
por quase todos os casos de malária reportados no mundo. Mais recentemente,
foram referidas ocorrências causadas pelo parasita Plasmodium knowlesi [5, 6].
Na década de 1960, com o uso do inseticida DDT contra os mosquitos
vetores, a malária foi relativamente controlada. Entretanto, com a proibição do uso
do DDT na década de 1970, a malária voltou a ser endêmica e a presença do
parasita tem aumentado nas últimas décadas. Três principais fatores contribuíram
para a falha da manutenção do controle da doença: resistência do parasita às
drogas, dificuldade de controle do vetor e falta de uma vacina eficaz [7].
Dados oficiais do ano de 2008 relataram que a malária era endêmica em
109 países, 45 dos quais localizados no continente africano. No ano de 2006
foram estimados cerca de 247 milhões (189 a 327 milhões) de casos de malária
no mundo, causando aproximadamente 1 milhão de mortes, principalmente entre
crianças menores de 5 anos de idade. Estima-se que cerca de metade da
população mundial - mais de 3 bilhões de pessoas -, vive em áreas de risco de se
contrair malária, das quais 1,2 bilhões vivem em áreas de alto risco de
transmissão [8]. O continente africano responde por 86% dos casos mundiais da
doença, sendo 98% destes causados pela espécie P. falciparum. Fora da África, a
malária é endêmica no sudeste da Ásia, Mediterrâneo oriental, Américas do Sul e
Central e Pacífico ocidental. Na Europa são relatados principalmente casos
3
importados. Fora da África o P. falciparum é responsável por cerca de 60% dos
casos e o P. vivax por cerca de 40% (tabela 1).
Tabela 1: estimativa de casos de malária por região, adaptado de [8].
Região Casos estimados
(x1000)
% P. falciparum % P. vivax
África 212.000 98 2
Sudeste da Ásia 21.000 56 44
Mediterrâneo oriental 8.100 76 24
Américas 2.700 29 71
Pacífico ocidental 2.200 67 33
Europa 4 2 98
Total (mundo) 247.000 92 8
Revisões de dados epidemiológicos têm sugerido que os dados oficiais de
agências nacionais podem ser subestimados em pelo menos 2,5 vezes [9].
Trabalhos sugerem ainda que o P. vivax seja responsável por cerca de 20% dos
casos mundiais de malária e 55% dos casos fora da África [10].
No Brasil, três espécies de Plasmodium são causadoras da malária:
P. vivax, P. falciparum e P. malariae. Na metade do século XX, a frequência dos
casos de malária era equitativamente distribuída entre P. falciparum e P. vivax.
Entretanto, nos últimos anos o P. vivax tem sido responsável por cerca de 80%
dos casos da doença.
Mais de 99% dos casos de malária no Brasil ocorrem na região da
Amazônia legal (Acre, Amazonas, Amapá, Pará, Rondônia, Roraima e Tocantins),
mais o estado do Mato Grosso (região Centro-Oeste) e parte do Maranhão (região
Nordeste), onde reside pouco mais do que 12% da população brasileira.
Em 2008 foram registrados na Amazônia legal 297.120 casos,
correspondendo a uma diminuição de 33% do número de casos registrados em
2007 (444.188). O número de casos registrados no Brasil tem variado nos últimos
20 anos entre 300 e 600 mil, segundo dados da Secretaria de Vigilância em
4
Saúde. A principal estratégia utilizada no país para o controle da doença é o
diagnóstico precoce e o tratamento imediato. As principais medidas são: reduzir o
tempo para diagnóstico e tratamento da malária; aprimorar e agilizar o sistema de
informação da malária; fortalecer as estruturas de vigilância epidemiológica e
ambiental nos estados e municípios; definir e desenvolver estratégias de
informação, educação e comunicação; capacitar profissionais do SUS nas ações
diagnósticas e de tratamento; inserir as ações de controle da doença na atenção
básica de saúde; monitorar a resistência às drogas e inseticidas; articular-se com
áreas responsáveis do Ministério do Meio Ambiente, Ministério da Reforma
Agrária, Ministério das Minas e Energia e Ministério dos Transportes para
avaliação de riscos e adoção de medidas preventivas de controle da malária;
promover obras de drenagem e manejo ambiental em áreas endêmicas urbanas;
avaliar de forma continuada o programa descentralizado; fornecer insumos
estratégicos, medicamentos e inseticidas (fonte: Secretaria de Vigilância em
Saúde).
Desde o ano 2000 essas medidas têm sido tomadas e verifica-se ainda
assim grande variação dos números de casos relatados anualmente (figura 1). A
partir do início deste século, os casos nas regiões Nordeste e Centro-Oeste foram
bastante controlados. Entretanto, as medidas de controle não obtiveram tanto
sucesso na Amazônia legal.
Diversos fatores contribuem para a dificuldade de controlar a doença
nessa região: acelerado movimento de urbanização desordenada em regiões
periurbanas, projetos de assentamento agropecuário, construções de hidrelétricas.
Além da inexistência da vacina, outros dois fatores contribuem para a manutenção
da doença: a falta de métodos de diagnóstico em áreas de difícil acesso e a
presença de portadores assintomáticos.
5
Figura 1: casos de malária registrados anualmente no Brasil (dados da Secretaria
de Vigilância em Saúde):
0
100
200
300
400
500
600
700
1990
1
9
92
19
94
19
9
6
1998
2000
2002
2004
2
0
06
20
08
Ano
Casos registrados (x1000)
Amazônia legal
Nordeste (Maranhão)
Centro-Oeste (Mato
Grosso)
A ampla distribuição da malária no mundo só é possível graças à
presença do mosquito vetor do gênero Anopheles. Dentre as cerca de cinco
centenas de espécies de Anopheles descritas, 20 são as principais responsáveis
pela transmissão. O Plasmodium vivax é transmitido por diversas espécies de
Anopheles em diferentes regiões do mundo. No sudeste da Ásia as espécies
predominantes são An. culicifacies, An. subpictus, An. sinensis, An. fluviatilis [11-
13]. Na região amazônica o principal vetor da malária é o An. darlingi. Dentre as
13 espécies de Anopheles presentes nesta região, o An. darlingi é a mais
abundante e amplamente distribuída. As características altamente antropofílicas e
endofílicas dessa espécie fazem com que seja capaz de manter a transmissão da
malária [14, 15]. O An. darlingi tem como criadouros preferenciais água limpa, de
baixo fluxo, quente e sombreada, situação muito frequente na região amazônica.
Na África subsaariana, principalmente três espécies de Anopheles são
responsáveis pela transmissão do P. falciparum: An. gambiae, An. arabiensis e
An. funestus. As altas antropofilia e endofilia também são as causas da
transmissão preferencial por essas espécies [16].
O aparecimento cada vez mais frequente de insetos resistentes aos
inseticidas - documentado em diferentes regiões do mundo -, tem sido um fator
6
preocupante, principalmente por estar frequentemente ligado a uma única
mutação [17].
1.2. Impacto socioeconômico
A prosperidade socioeconômica de uma sociedade é inversamente
proporcional à prosperidade da malária. Calcula-se que entre 1965 e 1990, os
países onde a malária era endêmica tiveram uma redução no crescimento
econômico da ordem de 1 a 2% ao ano. A doença impede o desenvolvimento
social e econômico por múltiplos fatores como: efeitos negativos na fertilidade, no
crescimento populacional, na capacidade de investimentos, na produtividade,
causando mortes prematuras e onerando as famílias e os estados com custos
médicos elevados [18]. Um cálculo semelhante foi realizado pela Organização
Mundial da Saúde, concluindo que os países africanos onde a malária é endêmica
têm o produto interno bruto (PIB) diminuído em 1 a 2% anualmente [8]. Pode-se
dizer que a malária tem um impacto importante no desenvolvimento econômico
mundial, contribuindo fortemente para os índices de pobreza em países do
hemisfério sul, que possuem a maior parte dos seus territórios em zonas tropicais,
onde a doença é mais presente.
1.3. Ciclo de vida do parasita
O parasita da malária humana possui um ciclo de vida complexo que
requer um hospedeiro intermediário vertebrado (homem), e um hospedeiro
definitivo invertebrado (mosquitos do gênero Anopheles).
O ciclo de vida no hospedeiro vertebrado tem início durante a picada de
mosquitos fêmeas do gênero Anopheles. Neste momento, são inoculados
subcutaneamente menos de 100 formas esporozoítas do parasita por picada [19]
que migram para vasos sanguíneos e linfáticos, permanecendo parte na pele [20].
Uma vez na corrente sanguínea, em menos de 30 minutos os esporozoítas se
dirigem ao fígado, onde invadem hepatócitos. Nestas células do hospedeiro, por
um período variável de 5 a 10 dias, dependendo da espécie, o parasita sofre um
processo de diferenciação e esquizogonia dentro de vacúolos parasitóforos,
7
caracterizado por múltiplas divisões do núcleo sem segmentação celular.
Posteriormente, as células são segmentadas e se diferenciam em milhares de
formas merozoítas, que são liberadas dentro de merossomas, vesículas cheias de
parasitas, no lúmen dos sinusóides hepáticos. Os merossomas escapam da
fagocitose por células de Kupffer e outros fagócitos, garantindo que os merozoítas
cheguem à corrente sanguínea [21, 22].
Nas infecções causadas por P. vivax e P. ovale, parte dos esporozoítas
se desenvolve rapidamente dentro dos hepatócitos dando origem a esquizontes e
posteriormente a merozoítas, enquanto outros se diferenciam em uma forma
latente chamada hipnozoíta [23], que permanece dormente no fígado, podendo
causar reincidências da doença meses ou até anos após a primeira infecção. No
caso de infecções causadas pelo P. vivax as recaídas podem variar conforme a
região, podendo ser frequentes e a cada 3 a 6 semanas em zonas tropicais, ou
cerca de 12 meses após a infecção inicial no caso de zonas temperadas [24].
O estágio eritrocítico da doença começa quando ocorre a ruptura de um
hepatócito e os merossomas são liberados na corrente sanguínea, onde os
merozoítas são liberados e invadem eritrócitos e/ou reticulócitos. O P. vivax tem
uma preferência especial pelos reticulócitos. Dentro dos eritrócitos, os merozoítas
passam por um processo de diferenciação em trofozoítas, que sofrem divisões
mitóticas e dão origem a esquizontes. Posteriormente, estes individualizam seus
núcleos, dando origem a de 6 a 32 merozoítas, dependendo da espécie. O ciclo
eritrocítico se fecha com a ruptura do eritrócito infectado e a invasão de outras
células vermelhas pelos novos merozoítas formados. Cada ciclo eritrocítico tem
duração de 48 a 72 horas, dando origem à “febre terçã” - nome popular da malária
- uma vez que, a cada ciclo, a ruptura em massa dos eritrócitos infectados causa o
estado febril do indivíduo infectado.
Durante o ciclo eritrocítico parte dos merozoítas dá origem a gametócitos
masculinos e femininos. Não se sabe ainda que fatores levam à
gametocitogênese. O aparecimento dos gametócitos também varia entre as
espécies. Em infecções pelo P. vivax as formas sexuadas aparecem antes mesmo
dos sintomas, enquanto que no caso do P. falciparum surgem de 10 a 40 dias
8
após o estabelecimento da parasitemia e dos sintomas da doença. Durante uma
nova picada por uma fêmea de Anopheles os gametócitos na corrente sanguínea
são ingeridos pelo mosquito. Em seguida os gametócitos masculinos sofrem um
processo de ex-flagelação formando os micro-gametas, que fecundam os
gametócitos femininos. A fecundação dá origem ao zigoto (oocineto) diplóide,
iniciando o ciclo sexuado do parasita dentro do mosquito. Após a fertilização o
oocineto penetra no epitélio intestinal médio do mosquito e, na lâmina basal, forma
o oocisto que, ainda na parede do intestino médio, sofre um processo de
esporogonia e dá origem a milhares de esporozoítas. Os esporozoítas são então
liberados na hemolinfa do inseto, migram e infectam células das glândulas
salivares, onde permanecem até serem injetados na pele de um indivíduo durante
uma picada, fechando assim o ciclo do parasita [20].
1.4. Tratamento e resistência a drogas
O tratamento quimioterápico da malária causada pelo P. vivax é feito
principalmente com cloroquina (droga esquizonticida) em associação com a
primaquina, que age principalmente contra as formas hipnozoítas. Resistência ao
tratamento, principalmente com cloroquina, já foi relatada diversas vezes no
mundo, por exemplo, na Papua Nova Guiné em 1989 e na Indonésia nos anos
1990. Estudos recentes realizados na Indonésia mostraram que quase 100% dos
tratamentos feitos apenas com cloroquina falharam e a adição de primaquina
reduziu os índices de ineficácia para 18% [25].
O P. falciparum é mais resistente à cloroquina. Cepas resistentes
começaram a surgir nos anos 1950. No final dos anos 1970 quase todas as cepas
no mundo apresentavam resistência. Novas drogas, como antifolatos, foram
desenvolvidas posteriormente, mas o uso contínuo tem acelerado o processo de
desenvolvimento de resistência pelo parasita. Hoje, o tratamento da malária
causada pelo P. falciparum é baseado em uma combinação de artemisinas. Até o
momento não foram observadas cepas que resistam a esta droga, mas cepas
menos sensíveis já têm sido relatadas em laboratório [25].
9
2. Patogenia e manifestações clínicas da malária
A patogenia da malária resulta diretamente do ciclo de vida do parasita e
da resposta inflamatória do hospedeiro. Em indivíduos residentes em áreas
endêmicas, onde há contato contínuo com o parasita, a resposta inflamatória à
infecção é diminuída e os sintomas são bastante atenuados. Em alguns casos a
infecção é totalmente assintomática.
Os principais sintomas da malária são decorrentes do ciclo eritrocítico do
parasita, em que ocorre a multiplicação assexuada dentro das células vermelhas
do sangue. O rompimento em massa destas células leva ao surgimento da
principal característica clínica da doença que é a crise malárica (paroxismo),
variável dependendo da espécie de Plasmodium, que geralmente provoca um
intenso calafrio seguido de rápida elevação da temperatura corpórea, náuseas,
vômitos, dores de cabeça e musculares. Essas crises se repetem a cada 48 horas
no caso da malária causada pelos parasitas P. vivax ou P. falciparum, e são
precedidas por mal-estar, cefaléia, cansaço e mialgia.
Ambas as espécies, P. vivax e P. falciparum, são extremamente
pirogênicas porque possuem toxinas em comum. As principais toxinas de
Plasmodium descritas são o glicosilfosfatidilinositol (GPI) [26] e o DNA do parasita
associado à hemozoína, um produto metabólico do parasita acumulado dentro das
células infectadas, capaz de ligar-se ao receptor da imunidade inata TLR9 [27]. A
cada ciclo eritrocítico, a liberação destas toxinas é responsável pelo efeito
pirogênico observado, acompanhado de produção de citocinas pró-inflamatórias,
como TNF-α, IFN-γ, IL-12, IL-6, NO, importantes para o controle parasitário, mas
que levam a condições patológicas e acentuam os quadros de malária grave, uma
vez que a citoaderência do parasita é dependente da expressão endotelial de
moléculas como CD36 e ICAM-1, que têm expressão aumentada pelas células
endoteliais na presença destas citocinas pró-inflamatórias.
Em infecções pelo P. falciparum o quadro clínico frequentemente evolui
para malária grave. Nesses casos, a anemia é intensa, podendo haver
comprometimento renal e respiratório, além de malária cerebral, levando a
confusão mental e coma. Este quadro ocorre mais frequentemente em pacientes
10
que não tiveram contato prévio com o parasita, ou seja, não imunes. Nestes o
parasita pode chegar a infectar mais de 15% das células vermelhas circulantes.
Além de resultar em anemia grave, as células infectadas aderem às paredes
endoteliais, causando redução do fluxo da microcirculação, principalmente no
cérebro.
Até recentemente acreditava-se que apenas o P. falciparum era capaz de
causar aderência das células infectadas à parede endotelial. Entretanto, novos
relatos de malária grave causada por P. vivax [28] e novos estudos in vitro [24]
têm sugerido que este parasita também induz aderência endotelial das células
infectadas e obstrução microvascular.
Uma grande diferença entre o P. vivax e o P. falciparum é o nível de
parasitemia observado nas infecções pelas duas espécies. Enquanto o P. vivax
infecta preferencialmente reticulócitos (eritrócitos jovens) e induz parasitemias
raramente maiores do que 2%, o P. falciparum é capaz de infectar qualquer
eritrócito circulante, induzindo parasitemias até acima de 15%. É possível que o
fenômeno de citoaderência ocorra no caso da malária causada pelo P. vivax, mas
raramente é tão grave por causa da baixa quantidade de células infectadas
circulantes.
3. Resposta imune contra malária
3.1. Resposta imune naturalmente adquirida
As primeiras evidências de imunidade natural adquirida contra a malária
são anteriores a qualquer informação a respeito da causa da doença.
Colonizadores observavam que nas suas colônias tropicais a população indígena
era muito mais resistente à malária do que os europeus. Entretanto, as primeiras
bases científicas para explicação da proteção naturalmente adquirida surgiram no
ano de 1900, em estudos de Robert Koch, com a comparação das parasitemias de
populações vivendo em áreas de baixa ou alta taxa de transmissão. Koch
demonstrou que a proteção contra malária era adquirida somente após exposição
ininterrupta ao parasita [7]. Em 1917, Von Wagner-Jauregg demonstrou que
11
pacientes submetidos a malarioterapia contra neurosífilis adquiriam imunidade
contra novas infecções.
Estudos publicados nos últimos 10 anos da análise retrospectiva dos
dados dos pacientes tratados contra neurosífilis, nas décadas de 1940 a 1960,
mostraram que, durante uma infecção primária, a imunidade contra o P. falciparum
aparece rapidamente, tanto contra os sintomas clínicos quanto contra os
parasitológicos. Além disso, após reinfecção, foi evidente a presença de
imunidades clínica e parasitológica. Pacientes reinfectados com cepas homólogas
ou heterólogas apresentaram menos episódios de febre intensa e menores
parasitemias em comparação com a primeira infecção, cuja intensidade e duração
não tiveram qualquer relação com o nível de imunidade após a reinfecção. Além
disso, a presença de uma infecção com uma cepa não preveniu contra outra cepa
concomitante [29, 30]. Ainda utilizando os dados dos pacientes tratados por
malarioterapia, foi possível concluir que infecções prévias pelos parasitas P. vivax
e P. ovale não são capazes de conferir imunidade cruzada contra uma infecção
secundária pelo P. falciparum, enquanto que uma infecção prévia pelo P. malariae
é capaz de conferir tal imunidade cruzada [31].
Dados destes mesmos pacientes tratados demonstraram que uma única
infecção com o P.vivax é capaz de conferir imunidade clínica e parasitológica,
determinadas pela redução de episódios de febre e diminuição de parasitemias,
contra reinfecção com cepa homóloga deste parasita. Em reinfecções com cepas
heterólogas os níveis de proteção medidos pela parasitemia foram muito menores,
não sendo estatisticamente significativos [32]. Entretanto, houve uma clara
redução na sintomatologia medida pelo número de episódios de febre [32].
Finalmente, a análise dos dados de pacientes que foram infectados pelo P. ovale
levou a conclusões similares [33].
Estes estudos demonstraram claramente que em infecções por
Plasmodium há um rápido surgimento de imunidade que controla a parasitemia e
diminui gradativamente a frequência dos episódios de febre durante a infecção
primária. A imunidade adquirida durante a primeira infecção reduz a gravidade da
12
doença durante uma infecção secundária. Esta imunidade não é totalmente cepa-
específica, mas é espécie-específica, exceto em infecções primárias por
P. malariae e secundárias por P. falciparum.
Na literatura, não há descrição de imunidade estéril adquirida
naturalmente contra a malária. Em indivíduos imunes residentes em áreas
endêmicas, os altos níveis de proteção contra o parasita normalmente são
acompanhados de uma baixa parasitemia latente, mantida por seguidas infecções.
Esse tipo de imunidade é comumente chamado de premunição [7]. Alguns autores
sugerem que a proteção na premunição seja dependente da presença do parasita,
com longa e contínua exposição dos antígenos do Plasmodium no organismo,
mantendo altos os níveis de anticorpos contra as formas sanguíneas, que seriam
responsáveis pelo controle parasitário conferindo imunidade aos sintomas da
doença [34].
Nos primeiros seis meses de idade as crianças são relativamente
protegidas, sendo controversa as bases dessa proteção. Os riscos de contrair a
doença aumentam gradativamente até o sexto mês e o período crítico de
suscetibilidade situa-se entre 1 e 4 anos de idade. Níveis de proteção raramente
são atingidos antes dos 2 anos. Após os 4 ou 5 anos, o número de episódios de
malária cai gradativamente. A partir da adolescência, os casos clínicos passam a
ser raros. Diversos fatores podem estar envolvidos nesse processo, como a
puberdade e o amadurecimento do sistema imunológico. O fato é que em áreas
endêmicas observa-se claramente a aquisição de imunidade contra o parasita e
contra os sintomas. Não se sabe com clareza ainda quais são os fatores que
determinam estes processos [7].
Apesar da aquisição de sólida imunidade contra a malária durante a vida,
mulheres gestantes são extremamente suscetíveis ao parasita, suscetibilidade
esta que pode estar relacionada à imunossupressão hormonal na gravidez
mediada por altos níveis de cortisol [35].
A identificação dos fatores imunológicos e dos antígenos alvos desta
resposta imune, que levam à proteção parasitológica e à ausência de sintomas, é
13
um passo importante ainda a ser alcançado e poderá guiar com maior clareza os
estudos de vacina e drogas contra a malária.
3.2. Mecanismos de imunidade contra os parasitas da malária:
Os mecanismos imunológicos contra as diferentes formas do plasmódio
foram estudados de forma mais detalhada pela utilização de 4 distintas
metodologias. A primeira delas foi a transferência passiva de anticorpos
policlonais, a princípio, e monoclonais mais recentemente. Os mecanismos de
imunidade mediada por linfócitos T foram determinados em modelos
experimentais pela transferência adotiva de clones de linfócitos T CD4 ou CD8.
Além destas, contribuíram para a determinação dos mecanismos imunológicos
contra o plasmódio a utilização de camundongos nos quais populações celulares
foram seletivamente removidas por tratamentos específicos ou pelo uso de
animais geneticamente modificados. Por fim, a imunização ativa visando à indução
destes mecanismos serviu para confirmar a participação destes na imunoproteção
contra a malária e nortear os estudos de desenvolvimento de vacinas
recombinantes.
Durante a picada do mosquito, esporozoítas são inoculados na pele, onde
permanecem durante poucos minutos, migrando em seguida para o sangue, onde
são alvos para anticorpos que inibem sua invasão em hepatócitos. Estes
anticorpos reagem principalmente com um antígeno de superfície denominado
proteína do circumsporozoíta (CS) [36]. Parte dos esporozoítas cai na circulação
linfática e podem ser encontrados nos linfonodos onde levam à ativação de
linfócitos T CD8 [19, 37]. Após invadir hepatócitos, os esporozoítas se
desenvolvem em esquizontes e, após um período de poucos dias, são liberados
na circulação sanguínea dentro de merossomas. Esquizontes hepáticos
expressam tanto antígenos específicos como antígenos comuns aos esporozoítas
e aos parasitas da fase sanguínea.
Os mecanismos efetores imunológicos capazes de eliminar as formas
hepáticas são mediados principalmente por linfócitos T. Linfócitos T CD8
específicos são capazes de eficientemente inibir o desenvolvimento destas formas
14
da malária [38]. Linfócitos T CD4 também mostram um certo efeito inibitório no
desenvolvimento das formas hepáticas do parasita [39, 40]. Os mecanismos
usados por estes linfócitos podem ser dependentes ou não da presença de
Interferon-γ (IFN-γ) [41, 42]. Apesar de vários antígenos das formas hepáticas
terem sido descritos, até o momento só existem evidências formais de que a
proteína CS é alvo dos linfócitos T CD8 e CD4 imunoprotetores. Entretanto, é
concebível que existam outros antígenos alvos, uma vez que camundongos
tolerantes à proteína CS ou infectados com parasitas cuja proteína CS foi trocada
por outra de uma espécie não relacionada, ainda sejam capazes de induzir
potente imunidade protetora [43, 44].
Além dos linfócitos T CD4 e CD8, outros linfócitos T (γδ e NK1.1) podem
também eliminar estas formas do parasita [45]. Entretanto, pouco se evoluiu na
determinação dos alvos moleculares destes linfócitos nos últimos 15 anos,
questionando-se a real existência desses alvos.
Uma vez que os merossomas vão para a circulação, os merozoítas são
liberados e voltam a ficar expostos à imunidade mediada por anticorpos. Foram
descritos diversos antígenos de superfície que são alvos para anticorpos capazes
de inibir a invasão de eritrócitos in vitro. Os antígenos para estes anticorpos
podem ser vários [46], além de ser possível postular diferentes mecanismos que
levam à neutralização da atividade infectiva dos merozoítas de plasmódio. Entre
eles estão: I) a aglutinação dos meorozoítas; II) a inibição do processamento
proteolítico sofrido por algumas das proteínas de superfície do parasita durante o
processo de invasão; III) a inibição da ligação de moléculas do parasita em
receptores específicos na superfície de eritrócitos; IV) a inibição do
desenvolvimento dentro da célula infectada; V) opsonização dos parasitas que são
então alvos de monócitos e macrófagos (revisto em detalhes em [47]). Uma vez
que os merozoítas invadem eritrócitos, eles se transformam em trofozoítas,
subsequentemente em esquizontes e, por fim, são liberados outra vez como
merozoítas na corrente sanguínea. Formas intra-eritrocíticas são alvos da
imunidade mediada por linfócitos T CD4 e mesmo anticorpos, pois alguns dos
15
antígenos parasitários são expostos na superfície dos eritrócitos infectados [48,
49].
Uma parte dos trofozoítas se transforma em gametócitos que são ingeridos
por mosquitos transmissores da malária. Os gametócitos expressam na sua
superfície antígenos que são reconhecidos por anticorpos específicos. Estes
anticorpos inibem parcialmente o desenvolvimento do parasita dentro do mosquito,
bloqueando o ciclo e transmissão da doença. Este tipo de imunidade não protege
o hospedeiro, porém a redução do número de mosquitos infectados e da sua
carga parasitária, pode diminuir a transmissão. Finalmente, antígenos específicos
são expressos na superfície de formas sexuais do parasita (zigoto e oocineto) e
também podem ser alvos para anticorpos que bloqueiam a transmissão [50].
Na figura 2, retirada de [50], são ilustrados os diferentes estágios do
Plasmodium que estão sendo estudados como possíveis alvos de uma vacina
contra a malária.
Figura 2: representação dos diferentes estágios do parasita da malária que são
possíveis alvos de uma vacina.
16
3.3. Antígenos alvos da resposta imune protetora contra malária
A descrição dos vários mecanismos imunológicos de proteção e a
caracterização molecular de inúmeros antígenos parasitários ajudou a determinar
quais moléculas do parasita seriam os alvos para a resposta imune, sobretudo as
que aumentam a resistência do hospedeiro à infecção. Alguns dos antígenos alvos
dos diferentes mecanismos imunológicos estão bem identificados e outros estão
em processo de caracterização.
Baseando-se na importância da resposta contra a proteína CS em
modelos experimentais, foi desenhada uma vacina contra a malária causada pelo
P. falciparum. Denominada RTS,S, foi desenvolvida pela companhia
GlaxoSmithKline (GSK) e consiste na proteína CS recombinante expressa em
fusão com o antígeno S de hepatite B (HBsAg), uma proteína altamente
imunogênica em humanos, e misturada com este mesmo antígeno, formando uma
partícula do tipo viral. Essa formulação vem sendo testada na presença de
diversos sistemas adjuvantes, como o AS01 (mistura de lipossomos, MPL e QS-
21) e o AS02 (emulsão “oil-in-water” de MPL e QS-21). Testes de imunização e
desafio em laboratório com voluntários adultos mostraram indução de proteção de
32 a 42% pela RTS,S/AS02 [51, 52]. A RTS,S/AS01 foi capaz de induzir 50% de
proteção em voluntários adultos imunizados e desafiados em laboratório [52]. No
Gâmbia, testes com voluntários adultos imunizados com a RTS,S/AS02 induziram
34% de proteção contra a exposição a diferentes cepas do parasita [53]. Outros
testes clínicos com a RTS,S/AS foram realizados com a população infantil em
diferentes áreas. Em um deles, envolvendo 340 crianças da Tanzânia, a
imunização com a RTS,S/AS02 reduziu a incidência de malária em 43,2% delas.
Outro teste clínico com a RTS,S/AS02 em 2022 crianças moçambicanas de 1 a 4
anos de idade demonstrou redução de risco de malária clínica de 35,3% e
proteção contra malária grave de 48,6% [54, 55]. A RTS,S/AS01 foi testada em um
estudo envolvendo 809 crianças de 5 a 17 meses de idade na Tanzânia. Nesta
coorte foi observada uma redução na incidênica de malária pela imunização com a
RTS,S/AS01 de 53% [56].
17
Apesar de demonstrarem resultados animadores, principalmente em
crianças, que representam uma população de alto risco, estes estudos
evidenciaram também que há ainda a necessidade de desenvolvimento de outras
estratégias, baseadas em novos antígenos e novos adjuvantes, já que se espera
que uma vacina tenha eficácia maior do que os cerca de 50% já atingidos.
Vários outros antígenos são estudados como possíveis alvos de uma
vacina contra malária, dentre eles os principais são:
- SERA: antígeno com repetições de serinas, aparentemente essencial
para o desenvolvimento das formas sanguíneas. São conhecidos nove genes que
codificam proteínas da família SERA em P. falciparum. Macacos Aotus imunizados
com a proteína SERA 1 na presença de adjuvantes fortes são parcialmente
protegidos contra a malária [57, 58].
- LSA-1: antígeno presente nas formas hepáticas. Foi descrito que
voluntários imunizados com esporozoítas de P. falciparum irradiados desenvolvem
resposta celular específica contra epítopos da LSA-1 [59]. Além disso, há relatos
de correlação de proteção e resposta contra a LSA-1 em indivíduos residentes de
áreas endêmicas [60].
- LSA-3: outro antígeno presente nas formas hepáticas. Diversos
trabalhos demonstraram que a imunização de primatas não humanos com
proteínas recombinantes derivadas da sequência da LSA-3, ou com a própria
sequência de DNA em vetores específicos, é capaz de conferir imunidade estéril
contra desafios com cepas homólogas ou heterólogas. A resposta imunológica
induzida contra a LSA-3 não foi muito robusta em nenhum dos casos, mas ainda
assim foi eficiente para proteção dos animais [61-63].
- AMA-1: antígeno presente na região apical das formas merozoítas do
parasita. Altamente imunogênica durante infecções naturais [64]. Estudos recentes
com proteínas recombinantes baseadas na AMA-1 de P. vivax demonstraram o
reconhecimento de diferentes porções do antígeno por indivíduos residentes de
áreas endêmicas [65]. Diversos estudos demonstraram em modelos animais
proteção contra malária após vacinação utilizando a AMA-1 como antígeno. Além
18
disso, a AMA-1 de P. falciparum já foi testada em humanos na presença de
adjuvantes potentes e mostrou-se imunogênica [66, 67].
- TRAP: antígeno expresso nas formas pré-eritrocíticas do parasita, é
essencial para invasão dos hepatócitos [68]. A proteína TRAP também foi
identificada como um alvo importante em infecções naturais e há evidências de
que esteja em processo de geração de diversidade, sugerindo que haja pressão
seletiva sobre este antígeno, uma possível evidência de que seja alvo importante
da resposta imune [69, 70].
Outras abordagens também vêm sendo testadas como possíveis vacinas
contra malária. A mais relevante delas é a construção denominada ME-TRAP [74],
fusão de quinze epítopos para linfócitos T CD8 e CD4 de diferentes antígenos do
P. falciparum, dentre eles as proteínas CS e LSA-1, juntamente com o antígeno
TRAP e os epítopos para células B da proteína CS em um vetor para expressão
em vírus recombinante. Foi demonstrado que voluntários vacinados com vírus
recombinantes MVA e FP9 expressando a ME-TRAP são protegidos contra
malária causada pelo P. falciparum [71].
Dentre os principais antígenos estudados como candidatos a compor uma
vacina recombinante contra malária podemos destacar a proteína CS, já discutida
acima, e a proteína 1 de superfície de merozoítas (MSP1), descrita adiante com
maiores detalhes.
3.4. Proteína 1 de superfície de merozoítas (MSP1)
Estrutura e função:
A MSP1 está entre os principais antígenos da forma sanguínea do
parasita. Esta proteína tem função biológica ligada à estrutura celular e à invasão
dos eritrócitos/reticulócitos pelos merozoítas e está presente nas diferentes
espécies de Plasmodium. É sintetizada durante a esquizogonia como um
precursor de aproximadamente 195 KDa, ancorada à membrana por
glicosilfosfatidilinositol (GPI). A maioria dos estudos da biologia da MSP1 de
plasmódios foram feitos com o P. falciparum ou com espécies de Plasmodium
murino. Nestes parasitas observou-se que a MSP1 é sintetizada durante a
19
esquizogonia e rapidamente se associa com outras proteínas de superfície do
merozoíta, como as MSP6 e MSP7. No momento da ruptura do esquizonte, a
MSP1 sofre um primeiro processamento proteolítico, pela protease subtilisin 1
(SUB1), gerando quatro fragmentos de 83, 30, 38 e 42 KDa, que ficam ligados por
interações não covalentes na superfície do parasita. Durante a invasão dos
eritrócitos pelos merozoítas o fragmento de 42 KDa (MSP1
42
) é novamente
processado em dois fragmentos de 33 (MSP1
33
) e 19 KDa (MSP1
19
) pela protease
subtilisin 2 (SUB2). Neste segundo processamento a MSP1
33
, correspondente à
porção N-terminal, é liberada juntamente com os outros fragmentos, e a MSP1
19
permanece ligada pela âncora de GPI à parede do merozoíta e é carreada para
dentro do eritrócito juntamente com o parasita [72] e revisto em [47]. A figura 3,
extraída de [47], mostra um esquema representativo da MSP1 e os dois processos
de clivagem proteolítica por SUB1 e SUB2 que ocorrem durante a invasão dos
eritrócitos.
Figura 3: esquema do processamento proteolítico da MSP1 [47]:
Nas diferentes espécies de Plasmodium, a MSP1
19
consiste em dois
domínios estruturados de maneira semelhante ao fator de crescimento epidermal
(EGF). A estrutura terciária da MSP1
19
foi inicialmente sugerida pela sequência
primária de aminoácidos e posteriormente confirmada pela análise cristalográfica
20
de uma proteína recombinante baseada na MSP1
19
de P. cynomolgi expressa em
baculovírus [73]. A análise cristalográfica mostrou dois domínios do tipo EGF, que
possuem resíduos de cisteína formando ligações dissulfídicas.
Mais recentemente, estudos de espectroscopia de ressonância magnética
nuclear, utilizando proteínas recombinantes expressas em bactérias E. coli,
elucidaram a estrutura tridimensional da MSP1
19
de P. vivax. Os resultados
confirmaram a estrutura sugerida pela sequência primária de aminoácidos,
mostrando dois domínios tipo EGF, contendo resíduos de cisteína que formam
ligações dissulfídicas. A figura 4 apresenta a ilustração da estrutura tridimensional
da MSP1
19
de P. vivax.
Figura 4: ilustração representando a estrutura tridimensional obtida por
espectroscopia de ressonância magnética nuclear de uma proteína recombinante
baseada na MSP1
19
de P. vivax [74]:
Em vermelho e cinza são mostrados os dois domínios do tipo EGF e em amarelo
as ligações dissulfídicas.
A estrutura tridimensional da MSP1
19
de P. falciparum também já foi
elucidada e revelou os dois domínios do tipo EGF observados nas outras espécies
de Plasmodium, mantidos por ligações dissulfídicas [75, 76].
A sequência primária de aminoácidos da MSP1
19
sugere uma alta
conservação estrutural deste domínio nas diferentes espécies de Plasmodium. A
análise da diversidade da estrutura primária desta proteína entre as diferentes
espécies aponta que a variabilidade é evolutivamente antiga, pois o conteúdo
21
funcional dos dois domínios do tipo EGF restringiria a geração de sequências
variantes viáveis [77]. Esta análise tem importância para a utilização da MSP1
19
como parte de uma vacina contra a malária, uma vez que a fixação de mutantes
só seria possível caso não houvesse modificação significativa na estrutura
funcional deste domínio.
Estudos sobre a função biológica da MSP1
19
demonstraram que esta
desempenha um papel essencial na sobrevivência do parasita, possivelmente por
fazer parte da estrutura celular e por meio da interação com receptores
específicos nas células hospedeiras que estariam envolvidos no processo de
invasão dos eritrócitos. Tentativas iniciais de gerar parasitas “knock out” que
teriam a sequência da MSP1
19
deletada não foram capazes de gerar parasitas
viáveis [78]. Recentemente, um estudo utilizando parasitas P. berguei mutados
condicionalmente demonstrou que a MSP1
19
também é importante para a
diferenciação das formas esporozoítas no fígado, formando os merozoítas [79].
Papel dos anticorpos contra a MSP1
19
na imunidade contra a malária
Diversas evidências indicam que os anticorpos direcionados contra a
MSP1
19
são importantes na imunidade contra a malária. Estudos iniciais
demonstraram que anticorpos monoclonais contra a MSP1
19
são capazes de inibir
a invasão de eritrócitos por merozoítas de P. falciparum em culturas in vitro.
Posteriormente, estudos demonstraram que anticorpos monoclonais contra a
MSP1
19
de P. yoelii podem transferir passivamente imunidade contra a infecção
por este parasita em camundongos [80]. Estudos realizados por diferentes grupos
mostraram que um fator crítico para proteção é a indução de altos títulos de
anticorpos contra a MSP1
19
. Camundongos deficientes de células B não são
protegidos após imunização com MSP1
19
e a transferência passiva de células Th1
específicas não é capaz de conferir proteção [48].
Vários estudos imunoepidemiológicos têm demonstrado forte correlação
entre presença de altos títulos de anticorpos contra a MSP1
19
e baixos níveis de
parasitemia no sangue de indivíduos infectados pelo P. falciparum, implicando
fatores como a especificidade dos anticorpos. Estes estudos demonstraram que
22
pacientes possuidores de anticorpos capazes de competir com anticorpos
monoclonais contra a MSP1
19
in vitro possuem menores quantidades de parasitas
no sangue [81-83].
Outras evidências que apontam fortemente para a importância dos
anticorpos contra a MSP1
19
na imunidade contra as formas sanguíneas da malária
foram obtidas através de imunizações experimentais. Estudos utilizando proteínas
recombinantes expressas em bactérias ou leveduras e baseadas na sequência da
MSP1
19
de P. yoelii sugerem uma grande capacidade profilática da imunização
com estas proteínas [84-86]. A imunidade induzida por estas proteínas
recombinantes é mediada por anticorpos específicos contra as formas sanguíneas
do parasita [87]. Outros estudos demonstraram que anticorpos contra a MSP1
19
de
P. yoelii protegem camundongos até 12 meses após a imunização [88]. Mais
recentemente demonstrou-se que imunização com uma proteína recombinante
baseada na MSP1
19
de P. yoelii fusionada com a proteína murina C4bp (“C4
binding protein”) foi capaz de proteger camundongos contra a infecção pelo
parasita [89]. Comprovou-se também que a imunização de macacos com uma
proteína recombinante baseada na sequência da MSP1
19
de P. cynomolgi, uma
espécie altamente homóloga ao P. vivax, é capaz de protegê-los contra a infecção
pelo parasita por até seis meses [90]. Além disso, macacos imunizados com uma
proteína recombinante baseada na sequência da MSP1
42
de P. falciparum
também são protegidos do desafio com o parasita [91, 92]. Diversos trabalhos
demonstram a capacidade imunoprotetora da imunização de camundongos e
macacos utilizando proteínas recombinantes baseadas nas sequências da MSP1
42
de parasitas murinos e humanos, entretanto resultados observados após
imunizações com proteínas recombinantes baseadas na sequência da MSP1
33
sugerem que a imunidade protetora induzida após imunizações com a MSP1
42
é
mediada pela resposta de anticorpos contra a MSP1
19
[93].
O mecanismo pelo qual estes anticorpos protetores agem ainda não está
totalmente elucidado. O fato de que títulos extremamente altos de anticorpos são
necessários para proteção sugere que os anticorpos direcionados contra a
MSP1
19
operam via neutralização dos merozoítas. Outra possibilidade é que os
23
anticorpos destruam os merozoítas juntamente com o sistema complemento, ou
que opsonizem os merozoítas para que estes virem alvos de fagocitose por
neutrófilos ou macrófagos [87]. A imunização de camundongos com a MSP1
19
expressa em leveduras induz predominantemente as subclasses IgG1 e IgG2b,
capazes de ativar a cascata do complemento.
Resposta imune contra proteínas recombinantes representando a MSP1
de Plasmodium vivax
Devido à impossibilidade de cultivo do P. vivax em culturas in vitro, os
estudos de antígenos deste parasita só se desenvolveram após o advento da
tecnologia do DNA recombinante, possibilitando a obtenção de quantidades
suficientes de antígenos para estudos imunológicos.
O isolamento, clonagem e seqüenciamento do gene da MSP1 de P. vivax
(PvMSP1) permitiu a obtenção de proteínas recombinantes representando as
diferentes regiões da molécula. Estas diferentes regiões foram utilizadas em
estudos imunoepidemiológicos e de imunizações experimentais para melhor
compreensão da resposta imune humana e de aspectos imunogênicos da
proteína. Proteínas recombinantes baseadas na sequência da PvMSP1 foram
expressas em E. coli [94-106], S. cerevisiae [107-109], baculovírus [110],
P. pastoris [111] e células de mamíferos [112].
Estudos caracterizando a resposta imune naturalmente adquirida contra a
PvMSP1 foram realizados em áreas endêmicas de malária na região amazônica
brasileira. As primeiras investigações utilizaram 10 proteínas recombinantes
expressas em fusão com a glutationa S-transferase de Schistosoma japonicum
(GST) e que representavam os primeiros 682 aminoácidos N-terminais da
PvMSP1 [94]. Uma proporção alta de soros reagiu com as que expressavam
blocos conservados entre as espécies (ICBs) e blocos polimórficos. Em contraste,
aquelas que expressavam exclusivamente ICBs foram reconhecidas por uma
fração reduzida de indivíduos do estado de Rondônia infectados pelo P. vivax [94],
sugerindo a presença de estruturas funcionais nestas porções.
24
Posteriormente foram caracterizados vários aspectos da resposta imune
contra a PvMSP1 em indivíduos residentes em Belém (Pará), recentemente
expostos ao P. vivax. Foi comparado o reconhecimento por anticorpos e células
mononucleares do sangue periférico de 11 proteínas recombinantes expressas em
fusão com a GST e que representavam as regiões N e C-terminais da PvMSP1.
Dez destas cobriram diferentes porções da região N-terminal da PvMSP1, e uma
única proteína recombinante representava a PvMSP1
19
. Embora contendo apenas
111 aminoácidos, a PvMSP1
19
foi a proteína mais imunogênica, reconhecida por
anticorpos citofílicos do tipo IgG1 ou IgG3 ou linfócitos T produtores de IFN-γ de
83,8% dos indivíduos expostos ao P. vivax. Não só a frequência de indivíduos
respondedores foi mais alta como o foram também os títulos de anticorpos contra
a PvMSP1
19
. Estes resultados sugeriram que a região C-terminal da PvMSP1, que
contém os dois domínios do tipo EGF, é particularmente imunogênica durante
infecções pelo P. vivax [95].
A alta frequência de indivíduos infectados contendo anticorpos contra a
PvMSP1
19
foi confirmada em estudos subseqüentes realizados na Coréia [97], no
Brasil [109] e na Tailândia [113]. Estes estudos não só validaram a PvMSP1
19
como um importante alvo da resposta imune humana durante infecções pelo
P. vivax, como também estimularam estudos utilizando esta proteína para
desenvolvimento de kits para diagnóstico de pacientes infectados por esse
parasita [101, 114, 115].
Outro trabalho avaliou a prevalência de anticorpos do tipo IgG e
subclasses de IgG específicas para a PvMSP1
19
no soro de indivíduos que
possuem diferentes níveis de exposição ao parasita. Foi observada uma
proporção semelhante de indivíduos respondedores independentemente da
intensidade de exposição ao parasita, o que confirma a alta imunogenicidade
desta molécula. Em relação às subclasses, indivíduos com exposição prolongada
(19 anos) apresentaram níveis de IgG1 e IgG3 mais baixos do que os menos
expostos (1 ano). Esse trabalho também demonstrou que os anticorpos
específicos gerados eram de longa duração, uma vez que 8 meses após o
aparecimento dos sintomas, 40% dos indivíduos brevemente expostos ao parasita
25
apresentavam anticorpos específicos anti-PvMSP1
19
. Sete anos após um único
contato com o parasita, 28% dos indivíduos ainda apresentavam anticorpos
específicos detectáveis [116]. A longevidade da resposta de anticorpos contra a
PvMSP1
19
também foi demonstrada em um estudo realizado junto a uma
população coreana que habita uma região onde a malária havia sido erradicada 30
anos antes, onde 15% dos indivíduos ainda apresentavam anticorpos específicos
anti-PvMSP1
19
[117].
Estudos quanto ao polimorfismo da PvMSP1
19
demonstraram que na Ásia
há duas formas circulantes da PvMSP1
19
que diferem em apenas 1 aminoácido
[118] e que no Brasil há apenas um alelo circulante [119]. Entretanto, estudos
utilizando soros de animais imunizados ou de pacientes infectados demonstraram
que a única substituição de aminoácido descrita não é capaz de reduzir o
reconhecimento da PvMSP1
19
pelos anticorpos [109].
O potencial imunoprotetor da PvMSP1
19
foi comprovado em vários
modelos experimentais e tornaram esta proteína um dos principais antígenos
alvos para o desenvolvimento de uma vacina contra malária [48, 80]. O sucesso
das imunizações experimentais de macacos com a MSP1
19
de P. falciparum
estimulou tentativas de imunizações experimentais utilizando proteínas
recombinantes de P. cynomolgi e P. vivax. Diferentes grupos têm desenvolvido
trabalhos sobre a imunogenicidade da PvMSP1
19
em camundongos, coelhos e
macacos. Estes trabalhos têm manifestado que, na presença de adjuvantes fortes,
a PvMSP1
19
é sempre altamente imunogênica [88, 96, 98, 99, 102, 104-106, 111,
120, 121].
No caso da região C-terminal de P. cynomolgi, um estudo foi feito por
meio da imunização de primatas (Macaca sinica) com proteínas recombinantes
expressando a MSP1
42
ou a MSP1
19
de P. cynomolgi expressas em baculovírus e
injetadas na presença de adjuvante completo/incompleto de Freund. As
imunizações foram capazes de induzir altos títulos de anticorpos contra os
merozoítas e significativa redução na parasitemia após desafio com formas
sanguíneas do parasita. Essa proteção foi duradoura, uma vez que os animais
imunizados se mantiveram protegidos após um segundo desafio feito 6 meses
26
após a imunização [90], o que refletiu diretamente nas pesquisas de imunização
com a PvMSP1
19
, pois apenas 11 aminoácidos são diferentes entre as MSP1
19
de
P. vivax e P. cynomolgi.
Um outro estudo demonstrou que macacos rhesus imunizados com a
PvMSP1
42
emulsificada no adjuvante Montanide ISA 720
®
eram capazes de
controlar a parasitemia após desafio com formas sanguíneas de P. cynomolgi. A
redução na parasitemia foi semelhante nos animais imunizados com as MSP1
42
de
P. cynomolgi ou de P. vivax. Esse trabalho demonstrou a indução de proteção
conferida pela PvMSP1
42
em primatas não humanos após desafio heterólogo [99].
Em modelos de primatas não humanos adaptados para infecção pelo
P. vivax (esplenectomizados), foi demonstrado que a imunização com proteínas
recombinantes baseadas na PvMSP1
33
, na presença de adjuvante
completo/incompleto de Freund, levou à redução de parasitemia em parte dos
animais imunizados e desafiados com formas sanguíneas de P. vivax [102, 120].
Resposta imune contra proteínas recombinantes representando a MSP1
de P. falciparum
A disponibilidade da manutenção do P. falciparum em culturas de
laboratório possibilitou que estudos sobre os antígenos presentes na superfície de
merozoítas desta espécie e seu potencial vacinal fossem realizados mesmo antes
do isolamento e sequenciamento dos genes destas proteínas. Os primeiros
estudos que descreveram a proteína MSP1 de P. falciparum (PfMSP1) e os
fragmentos resultantes do seu processamento proteolítico datam do início da
década de 80 [122, 123]. Simultaneamente, misturas destes fragmentos derivados
da PfMSP1 foram testadas como vacina em primatas não humanos. Estes
trabalhos de imunização evidenciaram que estes polipeptídeos isolados do
parasita, quando injetados na presença do adjuvante completo de Freund, eram
capazes de proteger os animais contra o desafio com uma cepa letal do
P. falciparum [124].
Na metade da década de 80 foi identificado o gene da PfMSP1 e
realizaram-se diversos outros trabalhos utilizando proteínas recombinantes
27
baseadas na sequência desta proteína em imunizações de primatas não humanos
[125], mostrando grande potencial vacinal do antígeno.
Estudos sobre a estrutura e polimorfismo da sequência da PfMSP1 de
P. falciparum revelaram que o gene é organizado em 17 blocos de polimorfismo
variado. Cinco deles são altamente conservados, 5 são semiconservados e 7 são
altamente polimórficos [126]. Pesquisas desenvolvidas com relação ao
reconhecimento destes diferentes blocos por painéis de soros de indivíduos
infectados mostraram que os blocos N-terminais 2 e 6, altamente polimórficos, e o
bloco C-terminal 17, altamente conservado, são reconhecidos por uma alta
percentagem dos indivíduos infectados [127, 128]. Em populações residentes em
áreas endêmicas, a presença de anticorpos contra epítopos presentes em ambos
os alelos do bloco 2 N-terminal confere uma diminuição de 65% dos riscos de
contração da doença [127]. Foi demonstrado que anticorpos contra esta região
são capazes de induzir a morte dos parasitas in vitro dependente da ação de
monócitos, entretanto esta ação é alelo-específica [129]. Um outro estudo
utilizando amostras de 35 indivíduos residentes de uma área endêmica na Índia,
demonstrou que peptídeos representando a porção conservada N-terminal da
MSP1 são reconhecidos por pelo menos 50% dos soros [130].
A PfMSP1
19
corresponde ao bloco 17, altamente conservado. A
sequência primária de aminoácidos da PfMSP1
19
é altamente conservada, com
exceção de 4 substituições dimórficas. Apesar de ter sido demonstrado que o soro
de pacientes infectados reconhece epítopos estruturais de forma cruzada nas
duas sequências encontradas [131], sabe-se também que uma única substituição
de aminoácido influencia no reconhecimento da proteína por anticorpos
monoclonais. O reconhecimento dos epítopos presentes na PfMSP1
19
por
anticorpos é um passo crucial no papel protetor da resposta imunológica contra
este antígeno, uma vez que já foi demonstrado que estes anticorpos são capazes
de inibir a invasão dos eritrócitos pelo merozoíta [72], além de altamente
relacionados com a redução dos sintomas da doença em pacientes infectados
[132]. Portanto, é possível que uma vacina contra o P. falciparum baseada na
PfMSP1
19
tenha que conter as duas formas da proteína encontradas na natureza,
28
já que qualquer influência no reconhecimento pelos anticorpos seria prejudicial
para a proteção.
Vários estudos apresentam uma associação significativa da presença de
anticorpos contra a região C-terminal da PfMSP1
19
, encontrados até 4 meses após
a infecção em residentes de áreas de baixo nível de transmissão [133], e do
controle dos sintomas da doença [134-139]. Os mecanismos de ação desses
anticorpos ainda não são totalmente conhecidos, mas alguns trabalhos sugerem
que eles possam induzir a aglutinação dos merozoitas, impedir a interação da
MSP1 com outras moléculas, inibir o segundo processamento proteolítico da
MSP1 e inibir o desenvolvimento do parasita dentro dos eritrócitos [47]. O papel de
diferentes anticorpos contra a PfMSP1
19
, bem como sua especificidade e modo de
ação, na imunidade contra o parasita foram extensamente estudados.
Descreveram-se três classes de anticorpos naturais contra a PfMSP1
19
: inibidores,
neutros e bloqueadores. Os anticorpos inibidores são os capazes de impedir o
processamento proteolítico secundário da MSP1, inibindo a invasão dos eritrócitos
pelo merozoíta. Os neutros e os bloqueadores não inibem o processamento nem a
invasão. Entretanto, os anticorpos bloqueadores facilitam o processo de invasão
dos eritrócitos pelos merozoítas na presença dos anticorpos inibidores, podendo
representar um mecanismo de evasão de resposta. A presença destes anticorpos
no soro de crianças residentes de áreas endêmicas levantou questões sobre a
importância da especificidade da resposta humoral, bem como sobre como o
balanço nos níveis destas três diferentes classes de anticorpos pode ser relevante
para um padrão de resposta protetor ou não [47]. Trabalhos exploratórios da
estrutura molecular da PfMSP1
19
e da ligação de anticorpos monoclonais contra
ela evidenciaram apectos importantes sobre os sítios de ligação de anticorpos
inibidores ou não-inibidores. Aparentemente os sítios de ligação dos anticorpos
inibidores são formados pelos dois motivos do tipo EGF, e se localizam em
regiões diferentes dos resíduos reconhecidos por anticorpos não-inibidores [47].
Alguns resultados sugerem que os anticorpos bloqueadores reconhecem alguns
dos resíduos reconhecidos pelos inibidores. É possível que o efeito bloqueador
seja resultado da competição destas duas classes pelos mesmos sítios, mas não
29
se sabe por que os anticorpos bloqueadores não têm o mesmo efeito inibidor.
Entretanto, substituições de um único resíduo de aminoácido na proteína podem
ter efeito diferente no reconhecimento pelos diferentes anticorpos monoclonais,
indicando que há diferenças relevantes nestes processos para cada classe de
anticorpo. O fato é que substituições que levam a alterações estruturais relevantes
abolem o reconhecimento da proteína por pelo menos dois dos anticorpos
monoclonais inibidores, revelando que os sítios reconhecidos são mesmo
estruturais [47]. Estas observações têm grande importância para o
desenvolvimento de vacinas, uma vez que a estrutura tridimensional dos
antígenos recombinantes deve reproduzir a estrutura da MSP1
19
nativa.
Estudos quanto à especificidade dos anticorpos protetores presentes no
soro de crianças e adultos residentes em áreas endêmicas, e que apresentam
algum grau de imunidade, são extremamente relevantes para nortear os estudos
de desenvolvimento de vacinas, já que uma vacina ideal seria capaz de induzir
estes anticorpos protetores. Estudos recentes demonstraram que, de fato,
aparentemente o aspecto mais importante que contribui para o controle da malária
por estes anticorpos é a especificidade, e não simplesmente a quantidade ou a
sua capacidade de inibir o crescimento do parasita in vitro. Foi demonstrado que
crianças residentes de áreas endêmicas nas quais os soros competem com
anticorpos monoclonais inibidores têm menor risco de contração da doença. Não
houve correlação de imunidade e capacidade de inibição do crescimento do
parasita in vitro [81, 82] e essa correlação também não apareceu em estudos de
imunização e desafio de primatas não humanos [140]. Entretanto, outros trabalhos
foram capazes de correlacionar menores riscos de malária em indivíduos cujos
soros possuem maior capacidade de inibir o crescimento do parasita in vitro [141].
Um dos grandes problemas que retarda o desenvolvimento de uma vacina contra
malária é a falta de correlatos de proteção. A disparidade de resultados de
diferentes estudos neste sentido reflete a dificuldade de determinar exatamente
quais mecanismos ou quais fenômenos medeiam a imunidade contra o parasita. É
possível que uma previsão mais exata de proteção seja determinada pela união
30
dos dois parâmentros: inibição do crescimento do parasita in vitro e competição
com monoclonais inibidores pela ligação em proteínas recombinantes em ELISA.
Nos últimos anos, diversos trabalhos exploraram o potencial vacinal da
região C-terminal da PfMSP1 recombinante expressa em E. coli [142-144],
Saccharomyces cerevisiae [145], Pichia pastoris [146], baculovírus [147] e em
células de mamíferos [92] injetadas em vários modelos animais e em humanos.
Estes estudos demonstraram que diferentes proteínas recombinantes baseadas
na sequência C-terminal da PfMSP1, quando injetadas em camundongos ou
coelhos na presença de adjuvantes potentes como o adjuvante completo de
Freund, induzem anticorpos capazes de inibir o crescimento do parasita in vitro. A
vacinação de primatas não humanos com estas proteínas recombinantes na
presença do adjuvante completo de Freund protegeu os animais contra o desafio
com cepas homólogas. Além disso, a injeção destas na presença do adjuvante
Montanide ISA 720
®
em voluntários humanos foi segura e imunogênica.
Entretanto, quando primatas não humanos foram imunizados com o antígeno
recombinante na presença de adjuvantes pouco potentes, como o Alum, não foi
conferida proteção.
4. Adjuvantes
Adjuvante pode ser definido como qualquer substância ou procedimento
que, combinado a um antígeno numa formulação vacinal, aumenta ou modula a
imunogenicidade específica do antígeno. Em 1920, o termo adjuvante foi cunhado
após observações de que cavalos que desenvolviam abscessos nos locais de
injeção de toxóide diftérico produziam mais anticorpos contra a toxina [148]. Em
1926 sais de alumínio foram utilizados pela primeira vez como adjuvante em uma
vacina com toxóide diftérico [149]. Posteriormente, Freund desenvolveu um
adjuvante potente baseado em emulsão de água em óleo contendo
Mycobacterium tuberculosis mortas pelo calor [150]. Este adjuvante, chamado
adjuvante completo de Freund, é até hoje o mais potente que conhecemos,
entretanto a sua alta toxicidade limita o uso em humanos.
31
Atualmente, poucos adjuvantes são liberados para uso humano. Os
principais deles são os sais baseados em alumínio, genericamente chamados de
Alum, o MF59, uma emulsão de óleo esqualeno em água, e partículas do tipo
virais, que mimetizam o capsídeo de um vírus sem carregar o material genético
dele.
A maioria das vacinas atuais utiliza como antígeno o patógeno morto ou
vivo atenuado. Estes patógenos contêm naturalmente moléculas que atuam como
adjuvantes. Ainda assim, em boa parte delas existe adição de Alum. Bilhões de
pessoas já receberam Alum como adjuvante. Entretanto, em muitos casos este
não atende às necessidades para o desenvolvimento de vacinas modernas.
Existem altos riscos em se desenvolver uma vacina de patógenos mortos
ou vivos atenuados contra o HIV, por exemplo. Em outras situações, não há
disponibilidade dos parasitas para vacinação em massa. Exemplo disso é a
malária causada pelo P. vivax. No caso do P. falciparum, há a disponibilidade de
culturas do parasita, mas a produção das formas esporozoítas irradiadas em
condições ideais para uso humano em massa envolve tecnologias pouco
acessíveis e custos muito altos. Assim, a principal estratégia de desenvolvimento
de novas vacinas baseia-se na tecnologia do DNA recombinante, abordagem mais
barata e segura; porém, proteínas recombinantes são em geral muito pouco
imunogênicas e dependem de adjuvantes para estimular a resposta imunológica.
Nestes casos, o Alum mostra-se pouco eficiente em induzir altos títulos de
anticorpos e respostas celulares robustas [151], tornando clara a necessidade do
desenvolvimento de novas estratégias adjuvantes.
Diversas questões são críticas para o desenvolvimento de novos
adjuvantes. Uma delas é a toxicidade, uma vez que a estimulação do sistema
imunológico envolve altos riscos. Em estudos clínicos recentes foi reportada alta
toxicidade de novos adjuvantes como Montanide ISA 720
®
, Montanide ISA 51
®
e
sistemas adjuvantes como o AS02, administrados com proteínas recombinantes
de malária em humanos. As principais reações locais foram: aparecimento de
eritema, dor, inchaço e abscessos, e algumas reações sistêmicas como dores de
32
cabeça, mal-estar e dores musculares também foram observadas [67, 152].
Outras questões são a estabilidade, o custo e a aplicabilidade.
Agonistas de receptores da resposta imune inata
Apesar de a atividade adjuvante de compostos como o Alum e o
adjuvante completo de Freund ter sido relatada ainda na década de 1920, os
mecanismos envolvidos no efeito adjuvante destes compostos permaneceram
obscuros até o final do século XX.
Somente em 1996 é que novos receptores da resposta imune inata foram
descritos em embriões de Drosophila melanogaster. Utilizando drosófilas mutantes
mostrou-se que o gene toll estaria envolvido no controle de infecções fúngicas
nestes insetos [153]. O gene toll havia sido descrito uma década antes, envolvido
no estabelecimento de polaridade dorsoventral de drosófilas [154, 155]. Em 1997
Janeway e Medzhitov demonstraram que o estímulo de um receptor do tipo Toll
era capaz de induzir uma resposta imune adaptativa em humanos [156].
Finalmente, utilizando camundongos C3H/HeJ e C57BL/10ScCr, foi comprovado
que mutações no gene tlr4 eram responsáveis pela irresponsividade destes
camundongos à endotoxina LPS e, consequentemente, à alta susceptibilidade a
infecções por bactérias gram-negativas. Esse trabalho demonstrou que o receptor
TLR4, homólogo ao receptor Toll descrito em drosófilas, é responsável pelo
reconhecimento do LPS bacteriano em camundongos [157].
Desde então diversos receptores do tipo Toll foram descritos em
camundongos, humanos e outros mamíferos. A família dos receptores Toll é
composta de pelo menos 11 receptores, cada um deles especializado no
reconhecimento de padrões moleculares relacionados a patógenos (PAMPs), ou
sinais de perigo. Eles podem formar homodímeros ou heterodímeros e são
expressos diferencialmente nos diferentes subtipos celulares do sistema
imunológico, como células dendríticas, macrófagos, células B e células T.
Algumas células não pertencentes ao sistema imunológico também podem
expressar receptores do tipo Toll, como fibroblastos e células epiteliais [158]. A
33
figura 5 ilustra a localização celular dos diferentes receptores do tipo Toll
conhecidos e seus ligantes.
Os heterodímeros TLR1/2 e TLR2/6 reconhecem estruturas presentes em
paredes de bactérias gram-positivas. O TLR4 reconhece lipopolissacarídeos
presentes na parede de bactérias gram-negativas. O TLR5 reconhece a proteína
flagelina, componente de flagelos de bactérias flageladas. Os TLR3, 7 e 8 são
intracelulares e reconhecem RNA dupla e simples fita de patógenos. O TLR9
também está localizado dentro das células e reconhece sequências de DNA
bacteriano [158, 159].
Com exceção do TLR3, todos os receptores do tipo Toll, quando
estimulados, ativam uma cascata de sinalização dependente da proteína
adaptadora MyD88, que recruta e fosforila a proteína kinase associada ao receptor
de IL-1 (IRAK). A proteína IRAK associa-se ao fator 6 associado ao receptor de
TNF (TRAF-6), ativando as vias de sinalização do NF-κB e da MAP-K. Esta
ativação leva à produção de citocinas pró-inflamatórias pela célula, como IL-6 e IL-
12, principalmente [158, 159].
34
Figura 5: ilustração dos receptores do tipo Toll conhecidos, seus ligantes e as vias
de ativação [159].
A busca por receptores da resposta imune inata levou à descrição não só
de receptores do tipo Toll, mas também de outros receptores não relacionados ao
Toll. Os receptores não Toll compõem principalmente 4 famílias: os receptores de
lectina (CLR), os receptores do tipo NOD (NLR), os receptores do tipo RIG-I (RLR)
e os receptores DAI, que reconhecem DNA [159]. A figura 6 ilustra os receptores
não Toll conhecidos, bem como seus ligantes e vias.
Os RLRs são intracelulares e reconhecem principalmente RNA viral. Os
CLRs são receptores transmembrana e distinguem PAMPs de diversos
patógenos. Os NLRs também são intracelulares e reconhecem diferentes PAMPs.
Dentre os NLRs estão os receptores IPAF e NAIP5, ambos estimulados pela
proteína flagelina, presente no flagelo de bactérias flageladas [159].
Assim como os TLRs, os receptores não Toll ativados também induzem a
produção de proteínas pró e antiinflamatórias pela células, principalmente
interferon tipo I, IL-1, IL-18, IL-10, IL-12 [159].
35
Figura 6: ilustração dos receptores do tipo não Toll conhecidos, seus ligantes e as
vias de ativação [159].
A descrição destes receptores da resposta imune inata e de seus ligantes
revolucionou a área de desenvolvimento de vacinas. Valendo-se do conhecimento
de diversas moléculas capazes de estimular o sistema imunológico para induzir a
produção de moléculas pró-inflamatórias, imunologistas e vacinologistas passaram
a testá-las como adjuvantes em formulações vacinais com antígenos de
patógenos, dentre eles o Plasmodium sp.
4.1. Adjuvantes em vacinas contra malária
Com a descrição de diversos receptores da resposta imune inata e de
seus ligantes, vários trabalhos foram realizados com o intuito de testar a
possibilidade do uso de agonistas destes receptores como adjuvantes em
formulações vacinais utilizando antígenos de malária. Os principais antígenos
utilizados na maioria destes estudos foram a proteína circunsporozoíta (CS), o
antígeno 1 apical de membrana (AMA-1) e a MSP1
19
.
36
Atualmente, a vacina contra malária em testes mais avançados e
promissores é a chamada RTS,S. Diversos testes clínicos já foram feitos utilizando
esta proteína recombinante, diferindo basicamente na formulação adjuvante
utilizada. Já foram testados sistemas adjuvantes utilizando diferentes
combinações de MPL (monofosforil lipídio A, porção atóxica do LPS capaz de se
ligar ao TLR4), emulsões de óleo em água, QS-21 (fração atóxica da saponina de
Quillaja saponaria), lipossomos (partícula lipídica sintética) e sais de alumínio. Os
testes desta vacina em crianças africanas em áreas endêmicas demonstraram até
agora cerca de 53% de eficácia, na melhor das hipóteses [51, 52, 56, 160, 161].
A proteína AMA-1 já foi largamente experimentada em diferentes modelos
pré-clínicos, como camundongos e primatas não humanos, na presença de
diversos adjuvantes. Além disso, também está sendo testada como vacina em
testes clínicos em humanos formulada com MPL, QS-21, lipossomos, emulsões de
óleo em água como Montanide ISA 720
®
e sais de alumínio. Até o momento os
principais testes encontram-se em fase II [66].
Em estudos pré-clínicos, diversas outras estratégias adjuvantes já foram
testadas. Podemos destacar a estratégia de “prime-boost” utilizando vírus
recombinantes carregando antígenos de malária como uma das mais promissoras.
A proteína CS é o principal antígeno envolvido nestes estudos, porém vírus
recombinantes expressando epítopos da LSA-1 e a ME-TRAP também já foram
testados e os resultados são promissores [162].
A proteína MSP1
19
de Plasmodium nunca foi testada em ensaios clínicos
no homem. Realizaram-se alguns testes utilizando uma proteína recombinante
baseada na MSP1
42
de P. falciparum, mas nenhum passou da fase II. Voluntários
imunizados com a PfMSP1
42
/AS02 apresentaram anticorpos capazes de
reconhecer o parasita em IFA e de inibir o crescimento parasitario in vitro [163].
Entretanto, recentemente foi descrito que a imunização de crianças africanas com
a PfMSP1
42
emulsificada em AS02, apesar de mostrar-se segura e altamente
imunogênica, induzindo altos níveis de anticorpos específicos, não foi capaz de
reduzir a incidência da doença ou os níveis de parasitemia após a exposição
natural ao parasita [164].
37
Trabalhos recentes testaram a imunogenicidade da PvMSP1
19
recombinante expressa em bactérias em camundongos e macacos quando
administrada na presença de diversos adjuvantes. Especificamente, foi
comprovado que em camundongos esta proteína é imunogênica na presença de
Quil-A, CpG ODN 1826, MPL, adjuvante completo e incompleto de Freund e
outros adjuvantes comerciais, induzindo altos títulos de anticorpos específicos
[121]. Em primatas não humanos, os títulos de anticorpos específicos induzidos
após imunização com a PvMSP1
19
na presença de CpG ODN 2006 e Quil-A foram
pelo menos 10 vezes mais baixos do que os títulos de anticorpos específicos
induzidos na presença de adjuvante incompleto de Freund [106]. Estes resultados
evidenciaram a necessidade do desenvolvimento de novas estratégias para
aumentar a imunogenicidade do antígeno.
A adição de novas estratégias adjuvantes em testes clínicos e pré-clínicos
tem indicado que reside aí o principal gargalo que impossibilitou até os dias atuais
o desenvolvimento de uma vacina contra a malária. Assim, o desenvolvimento de
novas abordagens que possam melhorar a resposta imunológica contra antígenos
conhecidos de Plasmodium é de grande interesse.
4.2. Adjuvantes de mucosa
Desde 1962, quando foi licenciada para uso humano a vacina contra a
poliomielite desenvolvida por Albert Sabin, ficou claro que é possível a vacinação
por vias de mucosa. A vacina Sabin é administrada até os dias de hoje pela via
oral em milhões de crianças no mundo inteiro.
Os fatos de não necessitar de agulhas, de ser de baixo custo e de
administração extremamente fácil são comumente citados como principais
responsáveis pela alta eficácia da vacina oral contra a poliomielite, uma vez que
estes fatores possibilitam grande aceitação da população e facilitam a vacinação
em massa.
Em geral, os adjuvantes utilizados pelas vias parenterais não são
eficientes em estimular respostas imunológicas nas mucosas. Os adjuvantes mais
potentes de mucosa são toxinas bacterianas, como a toxina colérica (CT) extraída
38
da bactéria Vibrio cholerae e a toxina termo-lábil extraída de Escherichia coli (LT).
As toxinas CT e LT possuem um elevado grau de homologia - cerca de 80% de
identidade - em suas estruturas primárias e ambas são constituídas de
subunidades AB
5
. A subunidade A é uma enzima com atividade ADP-ribosilase,
responsável pela toxicidade, e a subunidade B, composta de 5 monômeros de 11
KDa, é responsável pela ligação da toxina a receptores GM1, presentes nas
superfícies celulares [165]. Os mecanismos envolvidos na atividade adjuvante das
toxinas CT e LT ainda são motivo de discussão. Embora alguns trabalhos
mostrem que apenas a subunidade B possui efeito adjuvante, induzindo resposta
imunológica específica quando fusionada ou mesmo apenas misturada a
antígenos [166-172], outros trabalhos demonstraram que a subunidade B sozinha
induz tolerância contra antígenos heterólogos quando fusionada aos antígenos e
administrada por via oral ou nasal [173-176]. Aparentemente o efeito adjuvante
destas toxinas é dependente da atividade enzimática da subunidade A [165].
Recentemente, foi demonstrado que a CT é capaz de aumentar a
expressão de CD86, CD80, CD40 e MHC de classe II em células dendríticas,
estimulando resposta específica contra um antígeno heterólogo (OVA) fusionado à
toxina [165].
Outro adjuvante que vem sendo utilizado para indução de resposta
imunológica pela via de mucosa é o CpG ODN [177, 178]. Já foi demonstrado que
o CpG ODN, quando administrado por vias de mucosa, induz aumento de
expressão de MHC de classe II e de moléculas coestimulatórias em células
apresentadoras de antígeno, além de estimular produção de IL-6, IL-12, TNF-α e
IFN-γ pelas células do sistema imunológico, induzindo resposta do tipo Th1 [179].
4.3. Flagelina
O flagelo bacteriano é um fator de virulência para bactérias patogênicas.
A flagelina é a proteína estrutural do filamento flagelar bacteriano. Dependendo da
espécie bacteriana, pode ter uma massa molecular de 28 a 80 KDa. Nas bactérias
flageladas, milhares de moléculas de flagelina são polimerizadas para formar o
flagelo. Diferentes flagelinas, como FliCd, FljB e FliCi, são produzidas pelas
39
diferentes espécies de Salmonella sp. Entretanto, possuem alta homologia na sua
sequência primária [180]. O alinhamento de suas sequências mostra duas regiões
N e C-terminais de 170 e 100 resíduos, respectivamente, altamente conservadas,
flanqueando uma região central altamente variável [180, 181]. A estrutura da
flagelina está ilustrada na figura 7.
Figura 7: estrutura da molécula de flagelina [180]
As regiões N e C-terminais da flagelina formam estruturas α-hélice e
correspondem aos domínios D0 e D1. A região central hipervariável forma os
domínios D2 e D3, que ficam expostos na parte externa da estrutura flagelar como
estruturas de folhas β-pregueadas [180, 181].
A flagelina é um ligante natural dos receptores TLR5 da resposta imune
inata [182]. Foi demonstrado que o TLR5 reconhece uma região conservada na
molécula da flagelina, presente no domínio 1 (D1), essencial para a formação
correta do filamento flagelar [183]. Diversos trabalhos demonstraram que o
estímulo de receptores TLR5 pela flagelina é capaz de maturar células dendríticas
humanas promovendo aumento na expressão de CD80, CD83, CD86, MHC de
classe II e CCR7, além da produção de citocinas [184-187]. Outros estudos
apontaram que a estimulação de células dendríticas murinas pela flagelina induz
leve aumento na expressão de CD80, CD86, CD40 e MHC de classe II [188]. Mais
recentemente, utilizando uma flagelina conjugada à ovalbumina e camundongos
transgênicos, foi demonstrado que a proliferação de células T específicas em
resposta a um antígeno exógeno conjugado à flagelina é dependente da ativação
40
de células dendríticas através do receptor TLR5 [189]. Apesar disso, os
mecanismos de ativação do sistema imunológico pela flagelina ainda são motivo
de discussão. Alguns trabalhos questionam a presença de receptores TLR5 em
células dendríticas esplênicas murinas, argumentando que o efeito pouco
marcante nos marcadores de ativação destas células após estímulo com a
flagelina seria devido à ausência destes receptores [184]. Um estudo recente
demonstrou que na ausência do receptor TLR5, em camundongos knock-out para
esta molécula, não há maturação de células dendríticas após imunização com
flagelina, mas a resposta imune humoral não é afetada [190]. Os mecanismos
exatos de ativação do sistema imunológico pela flagelina ainda precisam ser
elucidados. As dificuldades de estudo deste sistema residem na alta redundância
de mecanismos que evolutivamente se desenvolveram para reconhecer a
molécula da flagelina no organismo.
Além do receptor TLR5, a flagelina é reconhecida por diferentes
receptores da resposta imune inata. Pelo menos outros dois receptores
intracelulares são responsáveis pelo reconhecimento de flagelina: Naip5/Birc1e e
Ipaf. Estes receptores estão envolvidos no reconhecimento de moléculas de
flagelina exportadas para o meio intracelular por sistemas de secreção específicos
bacterianos envolvidos em mecanismos de virulência. Trabalhos recentes
demonstraram que a ativação de macrófagos infectados por Salmonella é
dependente da flagelina e de receptores Ipaf e independente de TLR5. A ativação
de Ipaf nestas células leva à ativação de caspase-1 e produção de IL-1β e IL-18,
independente da ativação de NF-κB [191, 192]. Outros estudos demonstraram que
o receptor Naip5/Birc1e está envolvido no controle do crescimento de bactérias
Legionella em infecções de macrófagos. O controle do crescimento bacteriano
neste caso também é dependente de Naip5/Birc1e e flagelina. A ativação de
Naip5/Birc1e aparentemente ativa caspase-1 e a produção de IL-1β [193-196],
apesar de um trabalho demonstrar que células deficientes de Naip5/Birc1e são
permissivas ao crescimento de Legionella independentemente da ativação de
caspase-1 [193].
41
A alta capacidade da flagelina de se ligar a receptores da resposta imune
inata ativando células apresentadoras de antígeno é um grande indício de sua
possível capacidade adjuvante em formulações vacinais. A flagelina foi
primeiramente utilizada como adjuvante para estimular resposta imunológica
contra antígenos heterólogos no final da década de 1980. Em 1989, um trabalho
demonstrou que a inserção de um epítopo da toxina colérica na flagelina não
alterou a correta formação do flagelo na bactéria, e que a imunização de
camundongos com a bactéria viva carregando o epítopo heterólogo no flagelo foi
capaz de induzir títulos de anticorpos contra a toxina [197]. Três anos depois um
grupo inseriu um epítopo da hemaglutinina (HA) do vírus influenza na flagelina de
Salmonella. A imunização de coelhos e camundongos com uma bactéria viva
expressando o epítopo no flagelo, ou mesmo com a flagelina recombinante isolada
desta bactéria, induziu altos títulos de anticorpos contra a HA e os camundongos
imunizados foram protegidos do desafio com o vírus [198]. A partir de então
diversas investigações exploraram esta abordagem para estimular respostas
imunológicas contra diferentes antígenos em camundongos, como Schistosoma
mansoni [199], “green fluorescent protein” (GFP) [200], toxina colérica [201], vírus
da influenza [202-206], Listeria monocytogenes [202], Mycobacterium tuberculosis
[207], Paracoccidioides brasiliensis [208], Streptococcus mutans [209], toxóide
tetânico [210], vírus “West Nile” [211] e em primatas não humanos contra
antígenos de Yersinia pestis [212, 213]. Além disso, alguns grupos demonstraram
que a flagelina possui efeitos protetores contra radiação em macacos [214] e
atividade antitumoral em camundongos [215].
Em todos esses estudos a flagelina foi altamente eficiente em induzir
respostas imunológicas potentes e em alguns casos protetoras contra antígenos
heterólogos. Entretanto, em todos os casos o antígeno fusionado à flagelina foi um
peptídeo pequeno, epítopos para linfócitos T CD8 ou T CD4. Poucos ou nenhum
trabalho na literatura descrevem a exploração desta estratégia utilizando
peptídeos grandes de protozoários.
OBJETIVOS
43
A hipótese de trabalho desta tese é a de que a elevação dos níveis de
anticorpos até aos obtidos pela imunização de modelos animais com a proteína
MSP1
19
emulsificada em CFA/IFA seria capaz de conferir imunidade protetora
contra a malária.
Deste modo, os objetivos gerais deste trabalho foram: i) avaliar a
possibilidade de estimular resposta imunológica humoral sistêmica específica
contra a PvMSP1
19
em camundongos imunizados com proteínas recombinantes
na presença de diferentes adjuvantes de mucosa, visando alcançar os títulos de
anticorpos obtidos na presença do CFA/IFA; ii) gerar proteínas recombinantes de
fusão das sequências da MSP1
19
de P. vivax e de P. falciparum à sequência da
flagelina de S. enterica Typhimurium e; iii) testar a atividade biológica das
proteínas recombinantes de fusão pela capacidade de ativar o receptor TLR5 e de
estimular resposta imunológica específica em modelos animais, visando alcançar
os títulos de anticorpos obtidos na presença do CFA/IFA.
RESULTADOS
45
Artigos publicados ou em preparação
46
Artigo 1
47
Adjuvant requirement for successful immunization with recombinant
derivatives of Plasmodium vivax merozoite surface protein-1 delivered via
the intranasal route.
Resumo:
Neste artigo testamos a possibilidade de induzir resposta imunológica
humoral sistêmica contra a PvMSP1
19
após imunização com proteínas
recombinantes na presença de diferentes adjuvantes de mucosa. Para isso,
imunizamos camundongos C57BL/6 com as proteínas recombinantes
His
6
PvMSP1
19
ou His
6
PvMSP1
19
-PADRE na presença ou ausência dos adjuvantes
CT, LT e/ou CpG ODN 1826 pelas vias intranasal ou subcutânea.
Observamos que na presença de CT ou LT ambas as proteínas
recombinantes induziram altos títulos específicos de anticorpos após imunizações
pela via intranasal. O CpG ODN 1826 foi mais eficiente quando utilizado como
adjuvante em imunizações pela via subcutânea. Todos as formulações induziram
altos títulos de IgG1, com resposta direcionada para Th2. Quando adicionamos o
CpG ODN 1826 nas formulações a resposta imune foi mais balanceada, já que
este adjuvante induziu um aumento nos títulos específicos de IgG2c, em relação à
CT ou LT.
Todos os protocolos de imunização induziram títulos de anticorpos de alta
longevidade, uma vez que fomos capazes de medir anticorpos específicos até 6
meses após a última dose de imunização. Não houve diferença quanto à afinidade
pelo antígeno dos anticorpos gerados pelos diferentes protocolos de imunização.
Concluímos que as proteínas recombinantes baseadas na PvMSP1
19
podem ser altamente imunogênicas quando administradas pela via de mucosa
intranasal na presença dos adjuvantes de mucosa CT e LT, principalmente na
presença de CpG ODN.
313Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 102(3): 313-317, June 2007
Adjuvant requirement for successful immunization with
recombinant derivatives of Plasmodium vivax merozoite surface
protein-1 delivered via the intranasal route
Daniel Y Bargieri/*, Daniela S Rosa/*, Melissa Ang Simões Lasaro/**,
Luis Carlos S Ferreira/**, Irene S Soares/***, Mauricio M Rodrigues/*/
+
Centro Interdisiciplinar de Terapia Gênica *Departamento de Microbiologia, Imunologia e Parasitologia, Escola Paulista de Medicina,
Universidade Federal de São Paulo, Rua Mirassol 207, 04044-010 São Paulo, SP, Brasil **Departamento de Microbiologia,
Instituto de Ciências Biomédicas ***Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências Farmacêuticas,
Universidade de São Paulo, São Paulo, SP, Brasil
Recently, we generated two bacterial recombinant proteins expressing 89 amino acids of the C-terminal
domain of the Plasmodium vivax merozoite surface protein-1 and the hexa-histidine tag (His
6
MSP1
19
). One of
these recombinant proteins contained also the amino acid sequence of the universal pan allelic T-cell epitope
(His
6
MSP1
19
-PADRE). In the present study, we evaluated the immunogenic properties of these antigens when
administered via the intra-nasal route in the presence of distinct adjuvant formulations. We found that C57BL/
6 mice immunized with either recombinant proteins in the presence of the adjuvants cholera toxin (CT) or the
Escherichia coli heat labile toxin (LT) developed high and long lasting titers of specific serum antibodies. The
induced immune responses reached maximum levels after three immunizing doses with a prevailing IgG1 sub-
class response. In contrast, mice immunized by intranasal route with His
6
MSP1
19
-PADRE in the presence of the
synthetic oligonucleotides adjuvant CpG ODN 1826 developed lower antibody titers but when combined to CT,
CpG addition resulted in enhanced IgG responses characterized by lower IgG1 levels. Considering the limita-
tions of antigens formulations that can be used in humans, mucosal adjuvants can be a reliable alternative for
the development of new strategies of immunization using recombinant proteins of P. vivax.
Key words: Plasmodium vivax - mucosal immunization - recombinant vaccines - adjuvants
Financial support: Fapesp, The Millennium Institute for Vaccine
Development and Technology, CNPq grant 420067/2005-1
+
Corresponding author: [email protected]
DYB, DSR, MASL Fapesp research fellowship; LCSF, ISS,
MMR CNPq research fellowship
Received 5 February 2007
Accepted 10 April 2007
Plasmodium vivax causes more than 40 million
cases of malaria every year and an effective vaccine is
greatly needed (reviewed by Mendis et al. 2001). Be-
cause in vitro large-scale cultures of P. vivax will prob-
ably not be available soon, a vaccine will have to be de-
veloped using recombinant DNA technology. The use of
recombinant proteins to generate effective vaccines
faces several challenges such as the limited number of
adjuvants that can be used in humans. Based on that need,
this field is evolving rapidly and a number of clinically
acceptable adjuvant formulations have been described
(reviewed by Singh & O’Hagan 1999, 2002). Many of
these adjuvants perform better than alum, the most used
adjuvant licensed for human use. These new adjuvants
are in most cases used by the parenteral route of immu-
nization. However, some of them can also be used effi-
ciently by the mucosal route including synthetic oligo-
nucleotides containing unmethylated CpG motifs (CpG
ODN) and bacterial toxins such as cholera toxin (CT)
and the heat-labile toxin (LT) produced by some ente-
rotoxigenic Escherichia coli (ETEC) strains (reviewed
by Holmgren et al. 2003). As an alternative administra-
tion route, mucosal-delivered vaccines offer several ad-
vantages over those injected by parenteral routes includ-
ing the lack of iatrogenic infection risks, simple and pain-
less administration, and induction of both systemic and
secreted immune responses (Holmgren et al. 2005,
Holmgren & Czerkinsky 2006).
Recently, we generated two recombinant proteins con-
taining 89 amino acids of the C-terminal region of the P.
vivax merozoite surface protein-1 (MSP1
19
) and the hexa-
histidine tag (His
6
). The first recombinant protein was
named His
6
MSP1
19
. The second protein contained the
amino acid sequence of the universal pan allelic T-cell
epitope (PADRE) in addition to the His
6
MSP1
19
and was
denominated His
6
MSP1
19
-PADRE (Cunha et al. 2001).
Both recombinant proteins were recognized by IgG anti-
bodies from individuals recently exposed to P. vivax ma-
laria suggesting that the presence of PADRE did not modify
the epitopes of MSP1
19
recognized by human IgG (Cunha
et al. 2001, Rodrigues et al. 2003).
The immunogenic properties of these recombinant
proteins were studied by the parenteral immunization of
C57BL/6 mice with formulations containing different
adjuvants (Rosa et al. 2004). Mice developed high anti-
314 Immunogenicity of P. vivax antigens • Daniel Y Bargieri et al.
body titers when immunized with either recombinant
proteins emulsified in complete/incomplete Freund’s
adjuvant (CFA/IFA). Other adjuvants such as MPL/TDM
and CpG ODN 1826 required the presence of the PA-
DRE for maximal and long lasting antibody responses
(Rosa et al. 2004). These results clearly indicated that
immune responses induced by the universal T-cell
epitope PADRE improved adjuvant-assisted immune re-
sponse in the presence of specific adjuvant.
Based on these results, it was our intention to extend
our studies on the immunogenicity of these recombi-
nant proteins to establish whether mucosal adjuvants
could be used to generate immune responses in mice.
To address this question, we compared the serum anti-
body responses elicited by C57BL/6 mice immunized
with vaccine formulations prepared with the
His
6
MSP1
19
-PADRE or His
6
MSP1
19
antigens and deliv-
ered via the intranasal route in the presence of the mu-
cosal adjuvants CpG ODN 1826, CT and/or LT.
MATERIALS AND METHODS
Recombinant proteins containing P. vivax MSP1
19
- The recombinant proteins were obtained exactly as de-
scribed previously (Cunha et al. 2001). Purified proteins
were analyzed by SDS-PAGE and stained with Coomassie
blue or silver nitrate. A single band of 19 kDa was ob-
served. Protein concentration was determined by absor-
bance according to the following formula:
Concentration (mg/ml) = absorbance 280 nm × ε280 nm/
molecular weight
ε280 nm = (number of tryptophan × 5690) +
(number of tyrosine × 1280)
Immunization of mice with the recombinant proteins
His
6
MSP1
19
- PADRE or His
6
MSP1
19
. - Six to eight-
week-old female C57BL/6 (H-2
b
) mice were purchased
from Federal University of São Paulo, Brazil. Experi-
ments were performed with approved consent of the
Committee of Ethics of Universidade Federal de São
Paulo-Escola Paulista de Medicina. Groups of six mice
were immunized three times, two weeks apart, with 10
µg of recombinant protein in the presence of 2.5 µg of
CT (Sigma-Aldrich), or 2.5 µg of LT and/or 10 µg of
CpG ODN 1826 (TCCATGACGTTCCTGACGTT) syn-
thesized with a nuclease-resistant phosphorothioate back-
bone (Coley Pharmaceutical Group) as adjuvants. LT was
purified by affinity chromatography as previously de-
scribed (Lasaro et al. 2006) from the 25A-1 ETEC strain
(O78:H12 LT-I/ST CFA/I
+
) isolated from a diarrheic
child in São Paulo city and kindly supplied by Dr BEC
Guth at the Federal University of São Paulo. Mice were
immunized subcutaneously (s.c.) in the two hind foot-
pads with the recombinant antigen mixed with adjuvant
in a final volume of 50 µl in each footpad, or intrana-
sally (i.n.), drop by drop, assisted by a micropipette for
a final volume of 8 µl in each nostril. For the s.c. immu-
nizations, the second and third doses were administered
at the base of the tail in a 100 µl volume.
Immunological assays - Antibodies to MSP1
19
in the
mice sera were detected by ELISA essentially as de-
scribed by Cunha et al. (2001). The antigen added to the
plates was the recombinant protein His
6
-MSP1
19
(200
ng/well) and the secondary antibody, conjugated to per-
oxidase, was goat anti-mouse IgG (KPL) diluted 1:4000.
Each serum was analyzed in serial dilutions from 1:100
up to 1:1,638,400. The individual titers were considered
as the highest dilution of serum that presented an OD
492
higher than 0.1. The results are presented as the log 10
antibody titer of each immunized mouse.
Detection of IgG subclass responses was performed
as described above, except that the secondary antibod-
ies were specific for mouse IgG1, IgG2b, and IgG2c (all
obtained from Southern Technologies) diluted 1:2,000.
The results are presented as the mean of log antibody
titers ± SD of three animals per group.
The affinities of anti-His
6
MSP1
19
antibodies were
assessed by a thiocyanate elution-based ELISA (Rosa et
al. 2004). The procedure was similar to that described
for the standard ELISA with the inclusion of an extra step.
After the plates were washed following incubation of the
pooled serum dilutions (1:20,000), ammonium thiocy-
anate, diluted in PBS, was added to the wells in duplicate
or triplicate, in concentrations ranging from 0 to 8M.
The plates were allowed to stand for 15 min at room
temperature before they were washed and the assay pro-
ceeded. The concentration of ammonium thiocyanate re-
quired to dissociate 50% of the bound antibody was deter-
mined. The percentage of binding was calculated as fol-
lows: OD
492
in the presence of ammonium thiocyanate
X100/OD
492
in the absence of ammonium thiocyanate.
Statistical analysis - The One-Way ANOVA, Stu-
dents’ t test and the Tukey HSD test were used to com-
pare the possible differences between the mean values
of the different groups.
RESULTS
In the presence of the adjuvants CT, LT or CpG ODN
1826, C57BL/6 female i.n. immunized with His
6
MSP1
19
-
PADRE or His
6
MSP1
19
induced high serum IgG titers.
In all cases, maximal antibody responses were detected
after the third immunizing dose (Fig. 1A). In contrast,
i.n. administration of three doses of His
6
MSP1
19
-PA-
DRE or His
6
MSP1
19
in the absence of adjuvant failed to
induce detectable specific antibody responses (Fig. 1A).
Statistical comparison of the different mouse groups
revealed that the antibody titers of mice immunized with
His
6
MSP1
19
-PADRE or His
6
MSP1
19
in the presence of
CT or LT were similar after the third dose (P > 0.05). In
both groups, we found significantly higher specific anti-
body titers to His
6
MSP1
19
when compared to animals
immunized with His
6
MSP1
19
-PADRE admixed with CpG
ODN 1826 (P < 0.01). In addition, mice immunized via
the s.c. route with His
6
MSP1
19
-PADRE in the presence
of CpG ODN 1826 developed higher serum antibody ti-
ters than those immunized with the same vaccine for-
mulation by the i.n. route (P < 0.05) (Fig. 1A).
Two other vaccine regimens were also tested using
the antigen His
6
MSP1
19
-PADRE. First, we administered
CT and CpG ODN 1826 together with the antigen by the
i.n. route. This immunization induced similar levels of
315Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 102(3), June 2007
specific antibodies obtained when we used only CT as
adjuvant (P > 0.05). In a different immunization regi-
men, mice were first s.c. primed with the antigen ad-
mixed with CpG ODN 1826 followed by two i.n. doses
of the antigen admixed with CT. The final specific se-
rum IgG levels in this group were similar to mice i.n.
immunized with CT or LT and mice immunized s.c. with
CpG ODN 1826 (P > 0.05) (Fig. 1A).
Determination of the specific IgG subclass responses
revealed that mice immunized i.n. with His
6
MSP1
19
-
PADRE or
His
6
MSP1
19
in the presence of CT or LT, elic-
ited a prevailing IgG1 response. The ratio of IgG1/IgG2c
varied from 158.5 to 501.2, with LT in both cases
(Fig.1B). The presence of CpG ODN in the vaccine for-
Fig. 1:
magnitude and IgG subclasses of the antibody immune response
of mice immunized with the recombinant proteins His
6
MSP1
19
-PADRE
or His
6
MSP1
19
in the presence of different adjuvant formulations. A:
C57BL/6 mice were immunized i.n or s.c. with three doses of 10 mg of
recombinant protein, two weeks apart, in the presence or absence of the
indicated adjuvants. Results are expressed as the logarithmic (Log
10
) anti-
body titer of each individual mouse after the third immunizing dose (n = 6).
For statistical analyses see results section; B: specific antibodies of dis-
tinct IgG subclasses were detected with serum samples harvested 2 weeks
after the third immunizing dose. Results are expressed as the mean of six
mice ± S.D. The IgG1/IgG2c ratios were indicated on the top of the figure.
mulations significantly reduced this ratio, which varied
from 2.5 (s.c. route) to 50.1 (CpG + CT, s.c./i.n immu-
nization regimen) (Fig. 1B). These results clearly dem-
onstrate the Th2 bias of the immune responses induced
by the intra-nasal immunization in the presence of CT
and LT. In contrast, CpG ODN 1826 modulates the im-
mune response toward a more balanced Th1-Th2 pattern.
The longevity of the antibody immune response was
also compared among groups of immunized C57BL/6
mice. We found that the serum IgG responses to
His
6
MSP1
19
were extremely long lived in mice immu-
nized with His
6
MSP1
19
-PADRE or His
6
MSP1
19
antigens
in the presence of all tested adjuvants. No significantly
faster decay of specific antibody responses was associ-
ated to a particular adjuvant (Fig. 2).
Antibodies induced after immunization with His
6
MSP1
19
-PADRE or His
6
MSP1
19
admixed with different
adjuvants show similar affinities to the target antigen as
indicated in Fig. 3.
Fig. 2: longevity of the antibody immune responses elicited in C57BL/6
mice immunized with His
6
MSP1
19
-PADRE or His
6
MSP1
19
in different
adjuvant formulations. C57BL/6 mice were immunized i.n. or s.c. with
three doses of 10 mg of the recombinant proteins, two weeks apart, in the
presence of the indicated adjuvants. Results are expressed as the mean
of six mice ± S.D. of log antibody titers detected at the indicated weeks
after the first immunizing dose.
A
B
316 Immunogenicity of P. vivax antigens • Daniel Y Bargieri et al.
DISCUSSION
Our study demonstrated unequivocally that the re-
combinant proteins His
6
MSP1
19
and His
6
MSP1
19
-PA-
DRE of P. vivax are highly immunogenic to C57BL/6
mice when administered through the i.n. route in the pres-
ence of the mucosal adjuvants CT or LT. These formula-
tions generated high IgG1 antibody titers that remained el-
evated even six months after the third immunization. In a
previous study, it was described that the intra-nasal immu-
nization with a recombinant protein containing the C-ter-
minal region of the P. yoelii MSP1
19
antigen generated pro-
tective antibodies against an experimental challenge of mice
against blood stage malaria (Hirunpetcharat et al. 1998).
Together with our data, these results may open impor-
tant perspectives for the development of an anti-malarial
vaccine using this alternative administration route.
In our earlier work, we observed that the 13-amino
acid long PADRE epitope AKFVAAWTLKAAA
(Alexander et al. 1994) significantly improved the elic-
ited antibody responses in mice immunized s.c. with vac-
cine formulations containing adjuvants other than com-
plete/incomplete Freund's adjuvant (Rosa et al. 2004).
In the present study, we found that the His
6
MSP1
19
anti-
gen performed as well as the His
6
MSP1
19
-PADRE at in-
ducing high specific serum antibody titers when injected
by the i.n. route in the presence of CT or LT. These ob-
servations imply that CT and LT are endowed with strong
adjuvant effects, similarly to the effect observed with
the complete/incomplete Freund's adjuvant, and, there-
fore, do not require a strong activation of T helper cell
response. Alternatively, it is possible that the T cell and/
or B cell activation thresholds differ according the ad-
ministration route. In this regard, we recently observed
that i.n. vaccination with a recombinant protein of Try-
panosoma cruzi required B cells to prime specific CD4
+
and CD8
+
T cells (MM Rodrigues, unpublished results).
The fact that B cells are critical for the priming of cell-
mediated immune responses following i.n. administra-
tion of specific vaccine formulations may explain, at
least in part, the distinct performance of the CD4 PA-
DRE epitope.
The mechanisms implicated in the adjuvant activity
of CT and LT remains elusive. The two toxins are mem-
bers of the AB class bacterial toxins in which the enzy-
matically active ADP-ribosylating A subunit is respon-
sible for the toxicity while the pentameric B subunit oli-
gomer recognizes and binds to ganglioside receptors,
such as GM-1, present on the surface of different cells
types (Lavelle et al. 2004). The inherent toxicity of these
molecules hampers their use in human trials, but the use
of the nontoxic B subunit alone or detoxified whole
molecule derivatives represent promising alternatives
for the future pre-clinical and clinical testing of these
vaccine formulations (Jakobsen et al. 2002, Holmgren
et al. 2005, reviewed by Freytag & Clements 2005,
Holmgren & Czerkinsky 2006).
Several groups have described CpG ODN 1826 as an
effective mucosal adjuvant (reviewed by Holmgren &
Czerkinsky 2006). We observed that, for our recombi-
nant proteins, CpG ODN 1826 showed less efficient
adjuvant effects than CT or LT when administered via the
i.n. route. Nevertheless, the synthetic oligonucleotides
showed an excellent adjuvant activity when administered
to mice via the s.c. route. Additionally, combination of
CpG ODN 1826 with CT resulted in similar IgG re-
sponses with reduced bias toward a Th2 immune re-
sponse pattern. Therefore, CpG ODN 1826 can be a use-
ful adjuvant alternative for the differential activation of
T helper response leading to a more balanced Th1-Th2
immune response.
In summary, our results demonstrated that strong and
specific serum IgG responses can be achieved in mice
immunized with important recombinant antigens derived
from P. vivax by the i.n. administration in the presence
of the adjuvants CT or LT. This observation may be use-
ful for the rational design of new vaccine formulations
against P. vivax malaria.
REFERENCES
Alexander J, Sidney J, Southwood S, Ruppert J, Oseroff C,
Maewal A, Snoke K, Serra HM, Kubo RT, Sette A 1994.
Development of high potency universal DR-restricted helper
epitopes by modification of high affinity DR-blocking pep-
tides. Immunity 1: 751-761.
Cunha MG, Rodrigues MM, Soares IS 2001. Comparison of the
immunogenic properties of recombinant proteins represent-
ing the Plasmodium vivax vaccine candidate MSP1(19) ex-
pressed in distinct bacterial vectors. Vaccine 20: 385-396.
Freytag LC, Clements JD 2005. Mucosal adjuvants. Vaccine 23:
1804-1813.
Hirunpetcharat C, Stanisic D, Liu XQ, Vadolas J, Strugnell RA,
Lee R, Miller LH, Kaslow DC, Good MF 1998. Intranasal
immunization with yeast-expressed 19 kD carboxyl-terminal
Fig. 3: affinity determination of specific anti-His
6
MSP1
19
IgG antibodies
based on the thiocyanate elution method. Pooled sera from 6 C57BL/6
mice i.n. or s.c. immunized with three doses of 10 mg of His
6
MSP1
19
-
PADRE or His
6
MSP1
19
together with the indicated adjuvant were tested
in the presence of different concentrations of ammonium thiocyanate.
Results are expressed as average of duplicate samples.
317Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 102(3), June 2007
fragment of Plasmodium yoelii merozoite surface protein-1
(yMSP119) induces protective immunity to blood stage ma-
laria infection in mice. Parasite Immunol 20: 413-420.
Holmgren J, Czerkinsky C 2006. Mucosal immunity and vac-
cines. Nat Med (Suppl. 11): S45-53.
Holmgren J, Adamsson J, Anjuere F, Clemens J, Czerkinsky C,
Eriksson K, Flach CF, George-Chandy A, Harandi AM,
Lebens M, Lehner T, Lindblad M, Nygren E, Raghavan S,
Sanchez J, Stanford M, Sun JB, Svennerholm AM, Tengvall
S 2005. Mucosal adjuvants and anti-infection and anti-immu-
nopathology vaccines based on cholera toxin, cholera toxin
B subunit and CpG DNA. Immunol Lett 97:181-188.
Holmgren J, Czerkinsky C, Eriksson K, Mharandi A 2003. Mu-
cosal immunisation and adjuvants: a brief overview of recent
advances and challenges. Vaccine 21 (Suppl. 2): S89-95.
Jakobsen H, Bjarnarson S, Del Giudice G, Moreau M, Siegrist
CA, Jonsdottir I 2002. Intranasal immunization with pneu-
mococcal conjugate vaccines with LT-K63, a nontoxic mu-
tant of heat-Labile enterotoxin, as adjuvant rapidly induces
protective immunity against lethal pneumococcal infections
in neonatal mice. Infect Immun 70: 1443-1452.
Lasaro MAS, Rodrigues JF, Mathias-Santos C, Guth BEC, Régua-
Mangia A, Ferreira AJ P, Takagi M, Cabrera-Crespo J,
Sbrogio-Almeida ME, Ferreira LCS 2006. Production and
release of heat-labile toxin (LT) by wild type human-derived
enterotoxigenic Escherichia coli. FEMS Immunol Med
Microbiol 48: 123-131.
Lavelle EC, Jarnicki A, McNeela E, Armstrong ME, Higgins SC,
Leavy O, Mills KH 2004. Effects of cholera toxin on innate
and adaptive immunity and its application as an im-
munomodulatory agent. J Leukoc Biol 75: 756-763.
Mendis K, Sina BJ, Marchesini P, Carter R 2001. The neglected
burden of Plasmodium vivax malaria. Am J Trop Med Hyg
64: 97-106.
Rodrigues MH, Cunha MG, Machado RL, Ferreira OC Jr,
Rodrigues MM, Soares IS 2003. Serological detection of
Plasmodium vivax malaria using recombinant proteins cor-
responding to the 19-kDa C-terminal region of the merozoite
surface protein-1. Malar J 2: 39.
Rosa DS, Tzelepis F, Cunha MG, Soares IS, Rodrigues MM 2004.
The pan HLA DR-binding epitope improves adjuvant-assisted
immunization with a recombinant protein containing a ma-
laria vaccine candidate. Immunol Lett 92: 259-268.
Singh M, O’Hagan D 1999. Advances in vaccine adjuvants. Nat
Biotechnol 17: 1075-1081.
Singh M, O’Hagan DT 2002. Recent advances in vaccine adju-
vants. Pharm Res 19: 715-728.
53
Artigo 2
54
New malaria vaccine candidates based on the Plasmodium vivax Merozoite
Surface Protein-1 and the TLR-5 agonist Salmonella Typhimurium FliC
flagellin.
Resumo:
Neste trabalho geramos uma nova proteína de fusão da PvMSP1
19
-
PADRE com a flagelina de Salmonella. As sequências gênicas foram clonadas
num vetor de expressão e a proteína recombinante de fusão foi expressa em
bactérias E. coli. Purificamos a proteína de fusão e demonstramos que esta
mantinha as propriedades adjuvantes da flagelina e antigênicas da PvMSP1
19
.
A imunização de camundongos C57BL/6 pelas vias subcutânea ou
intranasal com a proteína recombinante de fusão foi capaz de induzir altos títulos
de anticorpos específicos. A imunização pela via subcutânea foi mais eficiente.
Todos os protocolos de imunização induziram altos títulos de IgG1, conotando
respostas imunológicas de padrão Th2. Além disso, fomos capazes de detectar
anticorpos específicos até 6 meses depois da última dose de imunização.
Demonstramos também que a imunização de camundongos com a
proteína de fusão induziu resposta celular medida pela produção de IFN-γ
específica em resposta ao antígeno de malária in vitro por células de baço. A
adição do adjuvante CpG ODN 1826 nas formulações vacinais não potencializou a
resposta de anticorpos, mas foi capaz de balancear o padrão de resposta
imunológica, aumentando os títulos específicos de IgG2c e aumentando a
produção de IFN-γ. Finalmente, o soro dos camundongos imunizados reconheceu
o parasita no sangue de pacientes infectados em lâminas de imunofluorescência.
Concluímos que a fusão da PvMSP1
19
-PADRE com a flagelina gerou uma
proteína recombinante candidata a compor uma vacina contra a malária, que
carrega atividade adjuvante intrínseca, capaz de induzir resposta imunológica
sistêmica humoral e celular contra o antígeno.
Vaccine 26 (2008) 6132–6142
Contents lists available at ScienceDirect
Vaccine
journal homepage: www.elsevier.com/locate/vaccine
New malaria vaccine candidates based on the Plasmodium vivax Merozoite
Surface Protein-1 and the TLR-5 agonist Salmonella Typhimurium FliC flagellin
Daniel Y. Bargieri
a,b
, Daniela S. Rosa
a
, Catarina J.M. Braga
c
, Bruna O. Carvalho
d
, Fabio T.M. Costa
d
,
Noeli Maria Espíndola
e
, Adelaide José Vaz
e
, Irene S. Soares
e
, Luis C.S. Ferreira
c
, Mauricio M. Rodrigues
a,b,∗
a
Centro Interdisciplinar de Terapia Gênica (CINTERGEN), Universidade Federal de São Paulo, Escola Paulista de Medicina, Rua Mirassol, 207, São Paulo 04044-010, SP, Brazil
b
Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, Escola Paulista de Medicina, Rua Mirassol, 207, São Paulo 04044-010, SP, Brazil
c
Departamento de Microbiologia do Instituto de Ciências Biomédicas da Universidade de São Paulo, Av. Prof. Lineu Prestes, 1374, São Paulo 05508-900, SP, Brazil
d
Departamento de Parasitologia, Instituto de Biologia, Universidade Estadual de Campinas, Rua Monteiro Lobato, 255, Campinas 13083-970, SP, Brazil
e
Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências Farmacêuticas da Universidade de São Paulo, Av. Prof. Lineu Prestes 580, São Paulo 05508-900, SP, Brazil
article info
Article history:
Received 29 April 2008
Received in revised form 31 July 2008
Accepted 31 August 2008
Available online 18 September 2008
Keywords:
P. vivax
Vaccine
Flagellin
FliC
TLR5
CpG ODN
TLR9
abstract
The present study evaluated the immunogenicity of new malaria vaccine formulations based on the 19 kDa
C-terminal fragment of Plasmodium vivax Merozoite Surface Protein-1 (MSP1
19
) and the Salmonella enter-
ica serovar Typhimurium flagellin (FliC), a Toll-like receptor 5 (TLR5) agonist. FliC was used as an adjuvant
either admixed or geneticallylinked to the P. vivax MSP1
19
and administered toC57BL/6 mice via parenteral
(s.c.) or mucosal (i.n.) routes. The recombinant fusion protein preserved MSP1
19
epitopes recognized by
sera collected from P. vivax infected humans and TLR5 agonist activity. Mice parenterally immunized with
recombinant P. vivax MSP1
19
in the presence of FliC, either admixed or genetically linked, elicited strong
and long-lasting MSP1
19
-specific systemic antibody responses with a prevailing IgG1 subclass response.
Incorporation of another TLR agonist, CpG ODN 1826, resulted in a more balanced response, as evaluated
by the IgG1/IgG2c ratio, and higher cell-mediated immune response measured by interferon-␥ secretion.
Finally, we show that MSP1
19
-specific antibodies recognized the native protein expressed on the surface
of P. vivax parasites harvested from infected humans. The present report proposes a new class of malaria
vaccine formulation based on the use of malarial antigens and the innate immunity agonist FliC. It con-
tains intrinsic adjuvant properties and enhanced ability to induce specific humoral and cellular immune
responses when administered alone or in combination with other adjuvants.
© 2008 Elsevier Ltd. All rights reserved.
1. Introduction
Plasmodium vivax causes more than 130 million malaria cases
every year [1]. Chemotherapy has remained almost unchanged
in the past 50 years and drug resistance is developing in many
parts of the world, reducing the efficacy of conventional treat-
ment [2,3]. To make matters worse, the number of severe cases
has recently increased [2,3]. Therefore, prophylactic alternatives
such as effective vaccines are urgently needed. Because large-
scale cultures of this parasite are not feasible, an effective vaccine
must rely on recombinant DNA technology or synthetic polypep-
tides. Several target recombinant proteins have been tested as
∗
Corresponding author at: CINTERGEN, UNIFESP, Escola Paulista de Medicina,
Rua Mirassol 207, São Paulo 04044-010, SP, Brazil. Tel.: +55 11 5571 1095;
fax: +55 11 5571 1095.
P. vivax vaccine candidates including pre-erythrocytic and blood
stages antigens, such as the circumsporozoite protein, Merozoite
Surface Proteins (MSP), Duffy-binding protein-1, apical mem-
brane antigen-1 and reticulocyte-binding protein, among others
[4–24].
Among blood stage malarial antigens, the MSP1 has been inten-
sively investigated as a malaria vaccine candidate. The protein is
synthesized in a precursor form with a high molecular weight
during schizogony and, during the invasion process, a proteolytic
cleavage releases most of the molecule from the merozoite mem-
brane leaving a membrane-anchored 19 kDa fragment (MSP1
19
)
on the parasite surface [25]. Genetic modification studies with
malaria parasites demonstrated that the essential role of MSP1
19
for
parasite survival is the same among distantly related Plasmodium
species [26]. Pre-clinical vaccination trials carried out with rhesus
monkeys showed that animals immunized with a recombinant pro-
tein based on the P. vivax MSP1 C-terminal region (MSP1
42
kDa) and
encompassing the MSP1
19
fragment developed partial protection
0264-410X/$ – see front matter © 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.vaccine.2008.08.070
D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142 6133
to infection with P. cynolmogi, a species closely related to P. vivax
[17].
In earlier studies, we characterized the immunogenic proper-
ties of several recombinant malaria vaccine candidates, including
genetically modifie d derivatives of the P. vivax MSP1
19
protein
[27,28]. One of the tested MSP1
19
derivatives revealed a particu-
larly strong immunological behavior after genetic linkage to the Pan
allelic HLA DR-binding epitope (PADRE) [29]. The protein, named
His
6
MSP1
19
-PADRE, was immunogenic when subcutaneously (s.c.)
administered to mice in the presence of different adjuvants elic-
iting a strong and long-lasting specific antibody response [29].
More recent studies confirmed and extended these observations
by showing potent antibody responses following mucosal admin-
istration of this recombinant protein to mice in the presence of the
adjuvants cholera toxin or Escherichia coli heat labile enterotoxin
[30].
Based on these successful experimental studies using the mouse
model, pre-clinical immunization trials were carried out with non-
human primates. Animals vaccinated with the P. vivax MSP1
19
genetically linked to two helper epitopes failed to develop strong
specific antibody responses in the presence of different formu-
lations except when Incomplete Freund Adjuvant was used [31].
This result showed that although the recombinant MSP1
19
protein
can be highly immunogenic in non-human primates, the adjuvant
properties of the vaccine formulation have to be improved. This
assumption led us to pursue a novel type of vaccine that could incor-
porate intrinsic adjuvant properties, new T helper cell epitopes and
recombinant MSP1
19
derivatives.
Recent advances in the field of innate immunity have disclosed
the cellular and molecular mechanisms behind the adjuvant effects
of pathogen-associated molecular patterns (PAMPs). The recogni-
tion of PAMPs in mammalian cells is mediated by innate immune
receptors such as TLR5 (specific for bacterial flagellins) and TLR9
(specific for unmethylated CpG DNA), expressed by antigen pre-
senting cells (APC). Following the binding of the specific agonists,
the TLR receptor intracellular domain activates molecular signal-
ing cascades and the recruitment of adaptor proteins, for example,
the myeloid differentiation factor 88 (MyD88), and the activation of
transcription factors such as NF-B and mitogen activated kinases.
These signaling events result in the activation of inflammatory
responses and APC maturation, which mediate the activation of T
and B cell-dependent adaptive immune responses [32,33].
Flagellins, the structural subunit of flagellar filaments, con-
tribute both to the virulence of bacterial pathogens and to the
activation of inflammatory responses in mammalian hosts [32,33].
Bacterial flagellins have been shown to bind extracellular TLR5
as well as intracellular receptors leading to strong inflammatory
responses [34–36]. Very recently, flagellins such as those expressed
by Salmonella species, have shown strong adjuvant effects when
delivered via parenteral or mucosal routes either admixed or genet-
ically linked to target antigens [37–43]. Salmonella enterica serovar
Typhimurium strains may express two alternate flagellar antigens,
FliC and FljB flagellins. The adjuvant properties of S. Typhimurium
FljB have been experimentally demonstrated either by induction
of specific antibody responses or activation of cell-dependent
immune responses [38,40–43], but few groups have shown the
potential adjuvant effects of S. Typhimurium FliC in vaccine for-
mulations [44].
Here, we investigated the adjuvant properties of S. Typhimurium
FliC in malaria vaccine formulations based on recombinant deriva-
tives of the P. vivax MSP1
19
protein. The adjuvant properties of
FliC were evaluated in mice immunized via parenteral (s.c.) or
mucosal (i.n.) routes with purified His
6
MSP1
19
and His
6
MSP1
19
-
PADRE admixed or genetically linked to FliC. Additionally, we
investigated the role of a TLR9 agonist, CpG ODN 1826, on the mod-
ulation of the immune responses elicited in mice immunized with
the MSP1
19
/FliC vaccine formulations. The reported results demon-
strated that the incorporation of TLR agonists to MSP1
19
-based
formulations represents a promising alternative for the develop-
ment of simple and inexpensive malaria vaccine candidates.
2. Methods
2.1. Generation of recombinant MSP1
19
-derived proteins
The recombinant His
6
MSP1
19
and His
6
MSP1
19
-PADRE proteins
were obtained exactly as described previously [27]. Purified pro-
teins were analyzed by SDS-PAGE and stained with Coomassie Blue.
The nucleotide sequence encoding the S. Typhimurium FliC and
MSP1
19
-PADRE were obtained by PCR amplification using Platinum
Taq High Fidelity DNA polymerase (Invitrogen). Specific oligonu-
cleotides for amplification of FliC-encoding gene, containing
EcoRI and HindIII restriction sites (GGGGAATTCATGGCACAAGT-
CATTAATACA and GGCAAGCTTGACGCAGTAAAGAGAGGAC) and the
MSP1
19
-PADRE nucleotide sequence, containing HindIII and
XhoI restriction sites (GGCAAGCTTGCATGACTATGAGCTCCGAG and
GGGCTCGAGTTTAAGCGGCAGCCTTCAGGGT) were purchased from
Integrated DNA Technologies, Inc. Amplified fragments were cloned
in frame in pET28a vector (Novagen). The recombinant protein
was expressed and purified as describ ed previously [27]. Briefly,
recombinant E. coli was cultivated at 37
◦
C under aeration in flasks
containing Luria broth (LB) and kanamycin (30 g/ml). Protein
expression was induced at an OD
600
of 0.6 with 0.1 mM IPTG (Invit-
rogen) for 4 h. After centrifugation, bacteria were lysed on ice with
the aid of an ultrasonic processor (Sonics and Materials INC Vibra
Cell VCX 750) in a phosphate buffer with lysosyme (Sigma) and
PMSF (Sigma). Bacterial lysate was centrifuged and the supernatant
was applie d to a column with Ni
2+
–NTA–Agarose resin (Quiagen).
After several washes, bound proteins were eluted with 0.5 M imi-
dazole (Sigma). The eluted protein was dialyzed against 20 mM
Tris–HCl, pH 8.0 and the recombinant proteins were purified by ion-
exchange chromatography using a Mono Q column (GE Healthcare)
coupled to an FPLC system (GE Healthcare). Fractions contain-
ing the recombinant proteins with a high degree of purity were
pooled and extensively dialyzed against PBS. Protein concentra-
tion was determined with the Bradford assay and by SDS-PAGE
analyses.
Recombinant proteins His
6
-MSP1
19
or His
6
FliC-MSP1
19
-PADRE
(0.25 mg) were reduced following incubation at 37
◦
C for 1 h in a
solution containing 0.5 M Tris–HCl (pH 8.0), 2 mM EDTA, and 60 mM
dithiothreitol (DTT; Sigma). After that period, urea was added to a
final concentration of 4 M and the solution was incubated for 15 min
at 95
◦
C. Iodoacetamide (Sigma) was added in a 2.5-fold molar
excess over DTT. The samples were kept in the dark for 30 min.
The reduced proteins were used to coat ELISA plates in carbonate
buffer pH 9.6 containing 0.2 mM EDTA, 6 mM DTT and 0.4 M urea.
2.2. FliC purification
Native S. Typhimurium FliCi was purified of the attenuated
S. Typhimurium SL3201 strain expressing FliCi but not FljB [45].
Briefly, bacteria were grown in LB supplemented with kanamycin
(30 g/ml) overnight at 37
◦
C under aeration (80 rpm). Cells were
washed once with phosphate-buffered saline (PBS) and submitted
to mechanical shearing with four 2 min cycles in a bench vortex
mixer. The cell suspensions were centrifuged to remove the
cells and the flagellar filaments collected from the supernatant
following acetone precipitation. The protein content of FliC was
determined with the Bradford assay and by SDS-PAGE analyses.
6134 D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142
Recombinant FliC (rFliC) was expressed in pET28a vector and
purified as described above for the other recombinant proteins.
2.3. Generation of monoclonal antibodies (MAb) to the
recombinant His
6
MSP1
19
BALB/c mice were immunized three times two weeks apart in
the footpads with 20 g of recombinant His
6
MSP1
19
emulsified in
Complete Freund Adjuvant (first dose), Incomplete Freund Adju-
vant (second dose) and in saline (third dose). Immunized mice had
their spleen or popliteal lymph nodes removed 3 days after the
third immunization and fused with myeloma cells (SP2/O) using
polyethylene glycol 4000 (Merck, Darmstadt, Germany). Hybrido-
mas were grown for 2 weeks in RPMI-1640 Medium (Invitrogen)
with 10% Fetal Calf Serum, 1.5% HEPES buffer, 1% non-essential
amino-acid solution, 2% sodium pyruvate, 1% l-glutamine, 0.1%
streptomycin, and 3% hypoxanthine, aminopterin and thymidine
(HAT) medium, at 37
◦
Cin5%CO
2
in air. Samples of medium
from these cultures were screened by ELISA and immunoblotting
for antibodies reacting with His
6
MSP1
19
. The positive hybridomas
were cloned and recloned by limiting dilution. MAb k23 purified by
Protein A agarose (Sigma) was used for the immunological assays.
In addition, we used the MAb 3F8, kindly provided by Dr. J.W. Barn-
well, CDC, Atlanta, and generated as described in reference [46].
2.4. Immunization regimens
Six to eight-week-old female C57BL/6 (H-2
b
) and C57BL/10SCN
(TLR4 deficient) mice were purchased from Federal University of
São Paulo, Brazil. Experiments were performed in accordance with
the guidelines of the Ethics Committee for Animal Handling of
the Federal University of São Paulo. Mice were immunized three
times, three weeks apart, via the s.c. route in the two hind foot-
pads, using a final volume of 50 l in each footpad (first dose) and
at the base of the tail (second and third dose) with a final volume of
100 l. The doses are indicated in each experiment. The intranasal
(i.n.) immunizations were carried out in mouse under anesthesia
(Ketamine-Xylazine at 40 and 16 mg/kg weight, respectively) with
a micropipette and using a final volume of 8 l in each nostril.
CpG ODN 1826 (TCCATGACG
TTCCTGACGTT) was synthesized with a
nuclease-resistant phosphorothioate backbone (Coley Pharmaceu-
tical Group). We used 10 g per dose per mouse admixed with the
antigen just before injection.
2.5. Immunological assays
Serum anti-MSP1
19
antibodies were detected by ELISA essen-
tially as describ ed previously [27]. The recombinant His
6
MSP1
19
(200 ng/well) antigen was employed as solid phase bound antigen.
The peroxidase-conjugated goat anti-mouse IgG (KPL) was applied
at a final dilution of 1:4000 while the tested mice sera were tested
at serial dilutions starting from 1:100. Specific anti-MSP1
19
titers
were determined as the highest dilution yielding an OD
492
higher
than 0.1. Detection of IgG subclass responses was performed as
described above, except that the secondary antibody was specific
for mouse IgG1, IgG2b, and IgG2c (purchased from Southern Tech-
nologies) diluted 1:2000. The results are presented as means ± S.D.
The detection of human anti-MSP1
19
IgG antibodies was per-
formed by ELISA, as previously described [27,28,47–49]. The ELISA
plates were coated with recombinant His
6
MSP1
19
(200 ng/well)
or His
6
FliC-MSP1
19
-PADRE (50 ng/well). This amount of protein
was adjusted to provide the same OD
492
when we used a MAb to
MSP1
19
. A volume of 50 l of each solution was added to each well
of 96-well plates (high binding, Costar). After overnight incuba-
tion at room temperature, the plates were washed with PBS-Tween
(0.05%, v/v) and blocked with PBS-milk (5%, w/v) for 2 h at 37
◦
C.
Serum samples were diluted in PBS-milk (5%, w/v) with 1.5 g/ml
of FliC and 50 l of each sample was added to each well in dupli-
cate. After incubation for 1 h at room temperature and washes
with PBS-Tween, we added to each well 50 l of a solution con-
taining peroxidase-conjugated goat anti-human IgG (Fc specific)
diluted 1:10,000 (Sigma). The enzymatic reaction was developed
by the addition of 1 mg/ml of O-phenylene diamine (Sigma) diluted
in phosphate-citrate buffer, pH 5.0, containing 0.03% (v/v) hydro-
gen peroxide. The enzymatic reaction was stopped by the addition
of 50 l of a solution containing 4 N H
2
SO
4
. Plates were read at
492 nm (OD
492
) with an ELISA reader (Labsystems Multiskan MS).
To avoid recognition of FliC by human antibodies, we added a final
concentration of 1.5 g/ml of this protein in the buffer solution used
to dilute each serum sample. This concentration was sufficient to
completely inhibit the binding of immune antibodies to FliC (data
not shown). Anti-Histidine tag (GE Amershan Bioscience) was used
for ELISA and immunoblot.
Secreted IFN-␥ in cell culture supernatants were determined
with 10
6
spleen cells, collected from different immunization
groups, cultivated in flat-bottom 96-well plates in a final volume
of 200 l. The His
6
MSP1
19
protein or the PADRE peptide was adde d
to the culture at a final concentration of 10 g/ml. After 120 h, the
supernatants were collected for cytokine determination. Cytokine
concentration was estimated by capture ELISA using antibodies and
recombinant cytokines purchased from Pharmingen (San Diego,
CA), as previously described [50]. Cytokine concentration in each
sample was determined with standard curves with known concen-
trations of recombinant mouse IFN-␥. The detection limit of the
assay was 0.2 ng/ml.
Determination of TLR5 bioactivity with native or recombinant
flagellins, as well as with the His
6
FliC-MSP1
19
-PADRE protein, was
carried out with the HEK293 cell line expressing mouse TLR5
(Invivogen). The cells were maintained in DMEM media 10% FBS
and 10 g/ml of blasticidin. Non-transfected or TLR5-transfected
HEK293 cells (5 × 10
4
cells/well) were grown overnight in 96-well
plates and stimulated with the recombinant proteins for 5 h. The
culture supernatants were collected and concentration of secreted
human IL-8 measured using a Human IL-8 ELISA Kit purchased from
BD biosciences, as recommended by the manufacturer.
2.6. P. vivax slide preparation and indirect immunofluorescence
assay (IFA)
Assays were carried out with 10-well IFA slides containing late
stage forms of P. vivax enriched in Percoll
®
(Amershan) gradient, as
described elsewhere [51]. Blood samples (5–10 ml) were collected
into heparin-coated tubes from P. vivax-positive patients living
in Manaus, AM, Brazil. All patients had given informed consent
and the procedure was approved by the Oswaldo Cruz Foundation
(FIOCRUZ) Research Committee. In brief, after plasma separation,
red blood cell pellets were washed three times and ressuspended
in RPMI 1640 medium (Sigma) to 10% hematocrit. The cell suspen-
sions were distributed in 15 ml tubes (5 ml each) containing 5 ml of
45% Percoll. After centrifugation, floating mature forms of infected
erythrocytes enriched up to 40–70% were collected, washed and
ressuspended in 10% of Fetal Calf Serum. The infected erythrocytes
were spread on IFA slides (50 l/well), fixed in acetone for 10 min
and air-dried. Pooled sera from different immunization groups
were diluted 1:100 in PBS, applied to the slides and kept 30 min in a
humid chamber at 37
◦
C. The slides were extensively washed with
PBS and, then, incubated with 10 g/ml of FITC-conjugated sheep
anti-mouse IgG (Sigma) and 100 g/ml of DAPI (4
,6-diamidino-2-
phenylindole, dihydrochloride) (Molecular Probes) for 30 min in a
humid chamber at 37
◦
C. After several washes with PBS, the slides
D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142 6135
were sealed with coverslips and viewed in an immunofluorescence
microscope.
2.7. Statistical analyses
The one-way ANOVA, Students’ t-test and the Tukey HSD test
were used to compare the differences between the mean values
of the tested immunization groups. Correlations of serum affinity
between two different recombinant proteins were analyzed by the
Spearman test.
3. Results
3.1. Production, purification, antigenicity and TLR5 bioactivity of
recombinant MSP1
19
-derived peptides
In the present study, we used two previously described recom-
binant proteins derived from the P. vivax MSP1
19
peptide [29]: one
with an N-terminal His-tag fusion (His
6
MSP1
19
) and another car-
rying the T cell PADRE epitope at the C-terminal end of the protein,
as well as the N-terminal His-tag (His
6
MSP1
19
-PADRE). The native
FliC protein, purified from the monophasic S. Typhimurium SL3201
strain, was employed as an adjuvant admixed with the recombi-
nant MSP1
19
-derived peptides. We also generated a recombinant
fusion protein consisting of the MSP1
19
-PADRE peptide linked to
the C-terminal end of FliC (His
6
FliC-MSP1
19
-PADRE). The schematic
representation of each of the recombinant proteins as well as the
purified proteins sorted in SDS-PAGE are presented on Fig. 1A and
B, respectively.
The recombinant His
6
FliC-MSP1
19
-PADRE protein was rec-
ognized by antibodies present in 44 serum samples from P.
vivax-infected subjects. As shown on Fig. 1C, when tested side
by side with His
6
MSP1
19
, the purified His
6
FliC-MSP1
19
-PADRE
reacted similarly with the serum samples of malaria patients
with a high correlation index (r
2
= 0.7276; p < 0.0001, Spearman
test). Additionally, immunoblot analyses revealed that the His
6
FliC-
MSP1
19
-PADRE was recognized by anti-FliC and anti-MSP1
19
antibodies (data not shown). These results indicate that the recom-
binant His
6
FliC-MSP1
19
-PADRE protein preserved the antigenicity
of both flagellin and MSP1
19
. TLR5-transfected HEK293 cells
secreted HuIL-8 following exposure to the native S. Typhimurium
FliC, a recombinant FliC and His
6
FliC-MSP1
19
-PADRE (Fig. 1D). On
a molar basis, both E. coli recombinant proteins (regardless of
Fig. 1. Generation and characterization of the recombinant P. vivax MSP1
19
-derived peptides. (A) Schematic representation of the recombinant proteins used in the present
study. (B) SDS-PAGE analysisof the recombinant proteins. Lanes: 1, molecular weight markers; 2, purified His
6
-MSP1
19
-PADRE protein; 3,purified S. Typhimurium FliCflagellin;
4, purified His
6
FliC-MSP1
19
-PADRE protein. Each lane was loaded with approximately 1 g of protein, sorted in a 12% polyacrylamide gel and stained with Coomassie Blue.
(C) Reactivity of 44 sera from individuals with P. vivax malaria with the recombinant His
6
MSP1
19
and His
6
FliC-MSP1
19
-PADRE proteins in ELISA. The serum samples were
tested at a final dilution of 1:1600 or at a dilution corresponding to a final OD
492
value between 1.0 and 4.0. Symbols represent the average OD
492
of each serum sample
tested in duplicate. The correlation coefficient (r
2
) between values obtained with the two proteins is indicated on the left corner of the panel. Data are representative of
two experiments performed with similar results. (D) HuIL-8 secretion by TLR5-transfected HEK 293 cells. Non-transfected HEK293 cells (white symbols) or TLR5-transfected
HEK293 cells (black symbols) were stimulated with different concentrations of native FliC (squares), recombinant FliC (triangles) or His
6
FliC-MSP1
19
-PADRE (circles) during
5 h. The secreted HuIL-8 was determined in culture supernatant by capture ELISA. Data are representative of two experiments performed with similar results.
6136 D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142
Fig. 2. Presence of conformational epitopes on the His
6
FliC-MSP1
19
-PADRE as rec-
ognized by two specific MAbs. ELISA was performed using recombinant proteins
His
6
-MSP1
19
(open symbols) or His
6
FliC-MSP1
19
-PADRE (closed symbols) as sub-
strates. MAbs K23 and 3F8 specific for His
6
-MSP1
19
or polyclonal antibodies specific
for the Histidine tag (Anti-His
6
) were used at the indicated concentrations. (A) Non-
manipulated recombinant proteins; (B) recombinant proteins were reduced with
DTT as described in Section 2. Data are average of duplicate samples representative
of two experiments performed with identical results.
whether they contained the MSP1
19
-PADRE at the C-terminus)
showed a reduced induction of HuIL-8 when compared to the
native FliC. Nonetheless, the results clearly demonstrate that the
MSP1
19
-PADRE C-terminal fusion did not impair the TLR5-specific
bioactivity of the E. coli recombinant protein.
To study whether the recombinant protein His
6
FliC-MSP1
19
-
PADRE still retained conformational epitopes present on His
6
-
MSP1
19
, we reacted both proteins with two specific MAbs (K23
and 3F8). Both recombinant proteins were well recognized by these
MAbs (Fig. 2A). After reduction with DTT, they were no longer rec-
ognized by them (Fig. 2B). As positive control, we used polyclonal
antibodies to the Histidine tag which still recognized well both
recombinant proteins after reduction (Fig. 2A and B). We conclude
that these MAbs reacted to conformational epitopes present in both
recombinant proteins.
3.2. Induction of MSP1
19
-specific antibody responses in mice
immunized with MSP1
19
-derived peptides admixed or genetically
fused to FliC
The serum IgG responses to the P. vivax MSP1
19
were deter-
mined in C57BL/6 mice immunized with the purified His
6
MSP1
19
or
His
6
MSP1
19
-PADRE proteins (5 g/dose of each antigen) admixed
with FliC (2.5 g/dose) via parenteral (s.c) or mucosal (i.n.) routes.
Mice parenterally immunized with recombinant proteins in the
presence of FliC developed significantly higher MSP1
19
-specific
IgG titers than mice immunized with the His
6
MSP1
19
-PADRE pro-
tein alone (p < 0.01). Maximal IgG antibody titers were achieved
after the second dose in all mice receiving the MSP1
19
recombi-
nant proteins admixed with flagellin and no significant adjuvant
effect was attributed to the PADRE epitope on the induced
MSP1
19
-specific antibody responses (Fig. 3A). Similar results were
obtained in mice immunized with different amounts (6, 25 and
100 g/dose) of the recombinant protein genetically fused to
flagellin (His
6
FliC-MSP1
19
-PADRE). No statistically significant dif-
ferences were detected in the antibody titers of mouse groups
immunized with different amounts of the recombinant protein,
an indication that maximal anti-MSP1
19
responses were achieved
after only two doses of the lowest tested protein concentration
(Fig. 3A). Additionally, C57BL/10SCN (TLR4 deficient) LPS non-
responsive mice s.c. immunized with His
6
MSP1
19
-PADRE in the
presence of FliC developed MSP1
19
-specific IgG responses similar
to wild type mice, thus discarding any adjuvant effect attributed to
contaminating LPS (data not shown). Mice submitted to an immu-
nization regimen administered via the i.n. route mounted lower
specific anti-MSP1
19
antibody titers when compared to animals
immunized via s.c. route but the recorded IgG titers after the sec-
ond or third doses were significantly higher than those detected in
mice immunized with three doses of the His
6
MSP1
19
-PADRE pro-
tein alone (p < 0.01, Fig. 3B). Together, these results indicate that FliC
can act as a potent adjuvant either admixed or genetically fused to
the malarial MSP1
19
antigen.
In order to determine the quality of the humoral immune
responses, we measured the IgG subclasses of the MSP1
19
-specific
antibody responses elicited in mice parenterally immunized with
the recombinant proteins. All mice immunized with the malarial
recombinant proteins in the presence of FliC, either admixed or
genetically fused, developed higher IgG1 levels with IgG1/IgG2c
ratios ranging from 200 (His
6
MSP1
19
+ FliC) to 794 (His
6
FliC-
MSP1
19
-PADRE). Similar results were observed in mice immunized
via the mucosal route (Fig. 4A). We also tracked the longevity
of the induced antibody responses in mice immunized with the
recombinant proteins. Although the total anti-MSP1
19
IgG titers dif-
fered among the tested immunization groups, there was no relative
difference in the kinetics of the responses decay among animals
submitted to the distinct immunization regimens (Fig. 4B).
3.3. Incorporation of CpG ODN 1826 and FliC generated a more
balanced Th1/Th2 immune response in mice immunized with
MSP1
19
-erived peptides
Because all immunization protocols that we tested generated
strong Th2 biased immune responses against PvMSP1
19
,wewon-
dered whether the presence of a TLR9 agonist adjuvant would
modulate the humoral immune response, balancing the IgG1/IgG2c
D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142 6137
Fig. 3. Induction of anti-MSP1
19
IgG responses in mice immunized with the malarial recombinant proteins in the presence of FliC. Female C57BL/6 mice were immunized
three times either with recombinant proteins alone (His
6
MSP1
19
-PADRE), admixed with flagellin (His
6
MSP1
19
+ FliC, His
6
MSP1
19
-PADRE + FliC), or genetically fused to flagellin
(His
6
FliC-MSP1
19
-PADRE). Numbers in parenthesis indicate the amount (g/dose) of each protein used in the immunizations. (A) Mice immunized via the s.c. route. (B) Mice
immunized via the i.n. route. All mice immunized with a malarial recombinant protein in the presence of FliC had higher IgG titers than control groups, p < 0.01. Asterisks denote
statistically significant lower antibody levels (p < 0.01) with regard to mice immunized by the s.c. route. Results are expressed as means ± S.D. (n = 6). Data are representative
of multiple experiments performed with similar results.
ratio in the sera of the immunized mice. Although the addition
of the TLR9 agonist CpG ODN 1826 to both His
6
MSP1
19
-PADRE
plus FliC and His
6
FliC-MSP1
19
-PADRE did not enhance the total
anti-MSP1
19
serum IgG response elicited in parenterally immu-
nized mice (Fig. 5A), there was a clear modulation of the IgG
subclass response pattern to a more balanced Th1/Th2 response
(Fig. 5B). The IgG1/IgG2c ratios detected in mice immunized with
His
6
MSP1
19
-PADRE plus FliC changed from 794 to 125 in the pres-
ence of CpG ODN 1826. Similarly, the IgG1/IgG2c ratios detected
in mice immunized with His
6
FliC-MSP1
19
-PADRE dropped from
794 to 50 when the TLR9 agonist was admixed to the recombi-
nant protein (Fig. 5B). A further demonstration of the CpG ODN
1826-dependent immune modulation effect was obtained after
determining the IFN-␥ secreted by spleen cells of mice immunized
with the different vaccine formulations. As shown in Fig. 5C, spleen
cells from mice immunize d with His
6
MSP1
19
-PADRE admixed to
FliC responded modestly to the PADRE epitope and did not respond
at all to His
6
MSP1
19
. Nevertheless, spleen cells from mice immu-
nized with His
6
FliC-MSP1
19
-PADRE secreted IFN-␥ in response to
PADRE or to His
6
MSP1
19
. The addition of CpG ODN 1826 drastically
enhanced the amount of IFN-␥ secreted by spleen cells harvested
from mice immunize d either with His
6
MSP1
19
-PADRE admixed to
FliC or with His
6
FliC-MSP1
19
-PADRE, following in vitro stimulation
with the PADRE peptide or the purified His
6
MSP1
19
. Together, these
results indicate that the addition of the TLR9 agonist CpG ODN 1826
balanced the immune response pattern and improved activation of
specific cell-dependent immune responses, as evaluated by IFN-␥
secretion by spleen cells, induced by MSP1
19
/FliC-based malaria
vaccines.
3.4. Antibodies raised in mice immunized with
MSP1
19
/FliC-based vaccine formulations recognized P. vivax
parasites from human blood cells
The MSP1
19
-specific antibodies raised in mice immunized
with the vaccine formulations had a similar affinity to the puri-
6138 D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142
Fig. 4. Characterization of the specific serum IgG responses elicited in mice immunized with recombinant MSP1
19
-derived proteins and FliC flagellin. (A) IgG subclasses
responses and IgG1/IgG2c ratios in mice submitted to different immunization regimens. Immunization groups were as described in the legend of Fig. 3. Results are expressed
as means ± S.D. (n = 3). (B) Longevity of the induced anti-MSP1
19
IgG responses in mice immunized with the different malarial vaccine formulations. Results are expressed as
means ± S.D. (n = 6). Data are representative of two experiments performed with similar results.
fied His
6
MSP1
19
protein, as determined in ELISA carried out in
the presence of different concentrations of a chaotropic reagent
ammonium thiocyanate (data not shown). Moreover, the MSP1
19
-
specific antibodies that were induced in mice immunized with
the dif ferent formulations by the s.c. route, bound to epitopes
exposed on the surface of P. vivax parasites isolated from infected
donors (Fig. 6). The antibodies induced in mice immunized by
the i.n. route with His
6
MSP1
19
-PADRE mixed to FliC or His
6
FliC-
MSP1
19
-PADRE were also capable of recognizing the parasites
isolated from infected donors (Fig. 6). Nevertheless, antibodies
from mice i.n. immunized with His
6
MSP1
19
mixed to FliC did
not bind to the parasites, indicating that, in immunizations by
this route, the PADRE epitope may influence the quality of the
response.
4. Discussion
The present study provides evidence that a proteic TLR agonist
(Salmonella FliC) can act as an adjuvant and molecular carrier to a
malaria recombinant antigen (P. vivax MSP1
19
) promoting a strong
and long-lasting adaptive immune response in vaccinate d mice. In
addition, the immunogenicity of this malaria vaccine formulation
can be further improved with the use of additional TLR agonists
such as CpG ODN 1826. Recent studies have also examined the
adjuvant/carrier property of Salmonella flagellin co-administered
with distinct antigens. In some cases, admixing flagellin and
antigen was sufficient to elicit antigen-specific antibody responses
[37–39]. In other cases, the flagellin and the antigen had to be
genetically linked in order to ef ficiently induce immune responses
D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142 61 39
Fig. 5. MSP1
19
-specific antibody and cell-dependent responses in mice immu-
nized with vaccine formulations admixed with CpG ODN 1826. (A) MSP1
19
-specific
serum IgG responses in mice s.c. immunized (three doses) with His
6
MSP1
19
-
PADRE (5 g/dose) or His
6
FliC-MSP1
19
-PADRE (25 g/dose) in the presence of FliC
(2.5 g/dose) and/or CpGODN 1826 (10 g/dose). All mouse groupsimmunized with
the recombinant fusion proteins in the presence of FliC or CpG ODN 1826 had signif-
icantly higher IgG titers than control group immunized with His
6
MSP1
19
-PADRE
alone (p < 0.01). Results are expressed as means ± S.D. (n = 6). (B) IgG subclasses
responses in mice immunized with different vaccine formulations. The MSP1
19
-
specific IgG1, IgG2b, and IgG2c titers are indicated. The IgG1/IgG2c ratio of each
immunization group is indicated at the top of the figure. Results are expressed as
means ± S.D. (n = 3). (C) IFN-␥ secretion by in vitro cultured spleen cells harvested
from vaccinated mice. Splenocytes collected from different mouse groups were cul-
tured in medium alone or in the presence of PADRE epitope or the His
6
MSP1
19
protein (10 g/ml) during 120 h. The IFN-␥ concentration in culture supernatants
was monitored by ELISA. Results are expressed as means ± S.D. (n = 3). Data are
representative of two experiments performed with similar results.
Fig. 6. MSP1
19
-specific antibodies generated in vaccinated mice recognize the
native protein expressed by P. vivax parasites. Fixed IFA slides were incubated with
pooled sera diluted 1:100 in PBS from mice immunized as indicated. Bound IgG
were stained with FITC and the parasite nuclei were stained with DAPI. Data are
representative of two experiments performed with similar results.
6140 D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142
[40–43]. The reasons for such discrepant results are not clear but
may be dependent on the nature of the non-flagellin antigen.
Another ambiguous point is the importance of the route of
administration on the induced immune responses in mice immu-
nized with vaccine formulations containing Salmonella flagellins.
A single comparison between the different routes of immuniza-
tion showed that the amount of antigen required to elicit specific
antibody responses by the s.c. route was approximately 10 times
lower than the amount required to achieve similar antibody levels
in mice immunized via the i.n. route [43]. This result concurs with
our present findings, in which significantly lower antibody titers to
the malarial antigen were observed in mice immunized by the i.n.
route.
The protective nature of the antibodies to the C-terminal domain
of Plasmodium MSP1 proteins has been thoroughly documented in
a number of in vitro and in vivo studies. In mice infected with the
rodent malaria parasite P. yoelii, the passive transfer of MSP1
19
-
specific monoclonal antibodies to naïve mice conferred complete
protection [52,53]. In subsequent studies, active immunization of
recombinant proteins with Complete Freund Adjuvant also pro-
vided a high degree of protective immunity with a prevailing serum
IgG1 subclass response [54–58]. The MSP1
19
-specific serum anti-
body immune responses observed in mice vaccinated with flagellin
and malarial recombinant proteins revealed a predominant IgG1
response, as showe d in other models [37,39]. These finding are
compatible with previous observations that flagellin promotes the
secretion of IL-4 and IL-13 by antigen-specific CD4
+
T cells, pro-
moting a Th2 biased immune response [59,60]. The Th2 biased
responses elicited in mice immunized with bacterial flagellins is
apparently due to the activation of TLR5, which relies solely on the
MyD88 adaptor activation [59].
We observed that the genetic linkage of the flagellin with the
malarial antigen did not dramatically influence the conformation
of the P. vivax MSP1
19
epitopes. Antibodies from humans exposed
to malaria parasites (native protein) clearly recognized the fusion
protein and this recognition was not significantly different when
compared to His
6
-MSP1
19
. These observations werecomplemented
using two MAbs which recognized conformational epitopes in both
recombinant proteins (Fig. 2). In addition, antibodies from immu-
nized mice recognized by IFA parasites obtained from a infected
human individual (Fig. 6). Previous studies using influenza or West
Nile virus epitopes fused to flagellin presented similar conclusions
[42,43]. The fact that all recombinant fusion proteins generated so
far retained their bioactivity for TLR5 activation [40,42,43] suggests
that the genetic linkage of antigens to Salmonella flagellins might be
a general approach for the development of vaccines using distinct
microbial antigens.
It is very likely that the mechanism that mediates the adjuvant
properties of flagellin involves the activation of TLR5 in antigen
presenting cells. This activation leads to an increase in the sur-
face expression of B7-2, which seems to be required – at least in
part – for the adjuvant properties of flagellin. B7-2 and B7-1/2
knockout mice had significantly lower antibody responses when
immunized with the saliva-binding region of the adhesin AgI/II of
Streptococcus mutans [38]. Alternatively, flagellin may act through
an Ipaf (ICE protease-activating factor)-dependent mechanism that
detects cytosolic flagellin and may activate antigen presenting cells
[34,36,61,62]. We are currently exploring this second hypothesis
using Ipaf deficient mice. Most recently, flagellin has been shown to
activate APC through the reduction of IL-10 secretion, an immuno-
suppressive cytokine [63]. This may further improve the adjuvant
properties of flagellin, allowing for a stronger adaptive immune
response.
In addition to the strong systemic antibody responses, we
observed that mice immunized with flagellin and MSP1
19
-
containing vaccine formulations acted also as an adjuvant for CMI,
as demonstrated by the secretion of IFN-␥ by immune spleen
cells. However, in contrast to the induce d MSP1
19
-specific antibody
responses, the genetic linkage between the malarial antigen and
flagellin resulted in higher PADRE and MSP1
19
-specific IFN-␥ secre-
tion by immune spleen cells of vaccinated mice (Fig. 5C). Therefore,
even though the antibody responses that we observed were similar,
the linkage of the antigen to flagellin may be an important strategy
to improve the adjuvant activity in CMI. The presence of B-cell and
helper epitopes in the flagellin, linked to the antigen, may enhance
both the antigen presentation of MSP1
19
CD4-specific epitopes and
the expansion of CD4 T cells specific for MSP1
19
. These possibilities
should be evaluated further in future studies.
The immunization of non-human primates with recombinant
P. falciparum and P. cynolmogi MSP1 C-terminal regions provided
a certain degree of protective immunity to the vaccinated animals
when parenterally administered with Complete or Incomplete Fre-
und Adjuvant [64–66]. Based on these promising results, phase I
clinical trials with P. falciparum recombinant proteins have already
been initiated [67,68]. However, it is important to mention that
similar pre-clinical or clinical studies have yet to be initiated using
recombinant proteins based on the C-terminal region of the P. vivax
MSP1 protein. Indeed, the P.vivax and P. falciparum proteins share
an overall structural homology. No cross-reaction is observed, how-
ever, at the level of antibody recognition or immune-protection.
We have also evaluated whether a second TLR agonist, CpG-
containing oligonucleotides, could modify the immune response
elicited in the presence of the TLR5 agonist flagellin. The TLR9 ago-
nist CpG ODN 1826 is well-known for the ability to stimulate IL-12
and IFN-␥ production when injected in vivo [69]. The addition of
CpG ODN 1826 did not improve the magnitude of the antibody
responses, though its presence changed the IgG1/IgG2c ratio to a
more balanced Th1/Th2 pattern. Co-administration of the CpG ODN
1826 has also evoked a clear increase in the PADRE and MSP1
19
-
specific IFN-␥ secretion by immune spleen cells (Fig. 5C). This result
further emphasizes that the incorporation of both TLR agonists may
confer broader immune responses elicited in animals immunized
with MSP1
19
and provides new perspectives for the rational devel-
opment of new malarial vaccine candidates.
Acknowledgments
This work was supported by grants from Fundac¸ãodeAmparoà
Pesquisa do Estado de São Paulo, Fundac¸ ão de Amparo à Pesquisa do
Estado do Rio de Janeiro, and The Millennium Institute for Vaccine
Development and Technology (CNPq – 420067/2005-1). DYB, DSR,
CJMB, BOC, NME were supported by fellowships from FAPESP. FTMC,
AJV, LCSF, ISS, MMR were supported by fellowships from CNPq.
References
[1] Price RN, Tjitra E, Guerra CA, Yeung S, White NJ, Anstey NM. Vivax malaria:
neglected and not benign. Am J Trop Med Hyg 2007;77(December (6
Suppl.)):79–87.
[2] Baird JK. Chloroquine resistance in Plasmodium vivax. Antimicrob Agents
Chemother 2004;48(November (11)):4075–83.
[3] Baird JK. Neglect of Plasmodium vivax malaria. Trends Parasitol 2007;
23(November (11)):533–9.
[4] Rogers WO, Gowda K, Hoffman SL. Construction and immunogenicity of DNA
vaccine plasmids encoding four Plasmodium vivax candidate vaccine antigens.
Vaccine 1999;17(August 6 (3–24)):3136–4 4.
[5] Castellanos A , Arevalo-Herrera M, Restrepo N, Gulloso L, Corradin G, Herrera S.
Plasmodium vivax thrombospondin related adhesion protein: immunogenicity
and protective efficacy in rodents and Aotus monkeys. Memorias do Instituto
Oswaldo Cruz 2007;102(June (3)):411–6.
[6] Herrera S, Bonelo A, Perlaza BL, Fernandez OL, Victoria L, Lenis AM, et al. Safety
and elicitation of humoral and cellular responses in colombian malaria-naive
volunteers by a Plasmodium vivax circumsporozoite protein-derived synthetic
vaccine. Am J Trop Med Hyg 2005;73(November (5 Suppl.)):3–9.
D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142 614 1
[7] Arevalo-Herrera M, Solarte Y, Yasnot MF, Castellanos A, Rincon A, Saul A, et al.
Induction of transmission-blocking immunity in Aotus monkeys by vaccination
with a Plasmodium vivax clinical grade PVS25 recombinant protein. Am J Trop
Med Hyg 2005;73(November (5 Suppl.)):32–7.
[8] Malkin EM, Durbin AP, Diemert DJ, Sattabongkot J, Wu Y, Miura K, et al. Phase 1
vaccine trial of Pvs25H: a transmission blocking vaccine for Plasmodium vivax
malaria. Vaccine 2005;23(May 2 (24)):3131–8.
[9] Collins WE, Barnwell JW, Sullivan JS, Nace D, Williams T, Bounngaseng A, et
al. Assessment of transmission-blocking activity of candidate Pvs25 vaccine
using gametocytes from chimpanzees. Am J Trop Med Hyg 2006;74(February
(2)):215–21.
[10] Ramjanee S, Robertson JS, Franke-Fayard B, Sinha R, Waters AP, Janse CJ, et al.
The use of transgenic Plasmodium berghei expressing the Plasmodium vivax
antigen P25 to determine the transmission-blocking activity of sera from
malaria vaccine trials. Vaccine 2007;25(January 15 (5)):886–94.
[11] Miura K, Keister DB, Muratova OV, Sattabongkot J, Long CA, Saul A.
Transmission-blocking activity induced by malaria vaccine candidates
Pfs25/Pvs25 is a direct and predictable function of antibody titer. Malar J
2007;6:107.
[12] Saul A, Hensmann M, Sattabongkot J, Collins WE, Barnwell JW, Langermans
JA, et al. Immunogenicity in rhesus of the Plasmodium vivax mosquito stage
antigen Pvs25H with Alhydrogel and Montanide ISA 720. Parasite immunol
2007;29(October (10)):525–33.
[13] Herrera S, Corradin G, Arevalo-Herrera M. An update on the search for a Plas-
modium vivax vaccine. Trends Parasitol 2007;23(March (3)):122–8.
[14] Valderrama-Aguirre A, Quintero G, Gomez A, Castellanos A, Perez Y, Mendez
F, et al. Antigenicity, immunogenicity, and protective efficacy of Plasmodium
vivax MSP1 PV200l: a potential malaria vaccine subunit. Am J Trop Med Hyg
2005;73(November (5 Suppl.)):16–24.
[15] Dutta S, Ware LA, Barbosa A, Ockenhouse CF, Lanar DE. Purification, charac-
terization, and immunogenicity of a disulfide cross-linked Plasmodium vivax
vaccine candidateantigen, Merozoite Surface Protein 1, expressed in Escherichia
coli. Infect Immun 2001;69(September (9)):5464–70.
[16] Sachdeva S, Ahmad G, Malhotra P, Mukherjee P, Chauhan VS. Comparison of
immunogenicities of recombinant Plasmodium vivax Merozoite Surface Protein
1 19- and 42-kiloDalton fragments expressed in Escherichia coli. Infect Immun
2004;72(October (10)):5775–82.
[17] Dutta S, Kaushal DC, Ware LA, Puri SK, Kaushal NA, Narula A, et al. Mero-
zoite Surface Protein 1 of Plasmodium vivax induces a protective response
against Plasmodium cynomolgi challenge in rhesus monkeys. Infect Immun
2005;73(September (9)):5936–44.
[18] Devi YS, Mukherjee P, Yazdani SS, Shakri AR, Mazumdar S, Pandey S, et al.
Immunogenicity of Plasmodium vivax combination subunit vaccine formu-
lated with human compatible adjuvants in mice. Vaccine 2007;25(July 9
(28)):5166–74.
[19] Kocken CH, Dubbeld MA, Van Der Wel A, Pronk JT, Waters AP, Langermans JA,
et al. High-level expression of Plasmodium vivax apical membrane antigen 1
(AMA-1) in Pichia pastoris: strong immunogenicity in Macaca mulatta immu-
nized with P. vivax AMA-1 and adjuvant SBAS2. Infecti Immun 1999;67(January
(1)):43–9.
[20] Arevalo-Herrera M, Castellanos A, Yazdani SS, Shakri AR, Chitnis CE, Dominik
R, et al. Immunogenicity and protective efficacy of recombinant vaccine based
on the receptor-binding domain of the Plasmodium vivax Duffy binding pro-
tein in Aotus monkeys. Am J Trop Med Hyg 2005;73(November (5 Suppl.)):25–
31.
[21] Grimberg BT, Udomsangpetch R, Xainli J, McHenry A, Panichakul T, Sat-
tabongkot J, et al. Plasmodium vivax invasion of human erythrocytes
inhibited by antibodies directed against the Duffy binding protein. PLoS Med
2007;4(December (12)):e337.
[22] Chitnis CE, Sharma A. Targeting the Plasmodium vivax Duffy-binding protein.
Trends Parasitol 2008;24(January (1)):29–34.
[23] Oliveira-Ferreira J, Vargas-Serrato E, Barnwell JW, Moreno A, Galinski MR.
Immunogenicity of Plasmodium vivax Merozoite Surface Protein-9 recombinant
proteins expressed in
E. coli. Vaccine 2004;22(May 7 (15–16)):2023–30.
[24] Rojas Caraballo J, Delgado G, Rodriguez R, Patarroyo MA. The antigenicity
of a Plasmodium vivax reticulocyte binding protein-1 (PvRBP1) recombinant
fragment in humans and its immunogenicity and protection studies in Aotus
monkeys. Vaccine 2007;25(May 4 (18)):3713–21.
[25] Blackman MJ, Heidrich HG, Donachie S, McBride JS, Holder AA. A single frag-
ment of a malaria Merozoite Surface Protein remains on the parasite during
red cell invasion and is the target of invasion-inhibiting antibodies. J Exp Med
1990;172(July 1 (1)):379–82.
[26] O’Donnell RA, Saul A, Cowman AF, Crabb BS. Functional conservation of the
malaria vaccine antigen MSP-119across distantly related Plasmodium species.
Nat Med 2000;6(January 1):91–5.
[27] Cunha MG, Rodrigues MM, Soares IS. Comparison of the immunogenic
properties of recombinant proteins representing the Plasmodium vivax vac-
cine candidate MSP1(19) expressed in distinct bacterial vectors. Vaccine
2001;20(November 12 (3–4)):385–96.
[28] Rodrigues MH, Cunha MG, Machado RL, Ferreira Jr OC, Rodrigues MM, Soares
IS. Serological detection of Plasmodium vivax malaria using recombinant pro-
teins corresponding to the 19-kDa C-terminal region of the Merozoite Surface
Protein-1. Malar J 2003;2(November 14 (1)):39.
[29] Rosa DS, Tzelepis F, Cunha MG, Soares IS, Rodrigues MM. The pan HLA DR-
binding epitope improves adjuvant-assisted immunization with a recombinant
protein containing a malaria vaccine candidate. Immunol Lett 2004;92(April 15
(3)):259–68.
[30] Bargieri DY, Rosa DS, Lasaro MA, Ferreira LC, Soares IS, Rodrigues MM. Adju-
vant requirement for successful immunization with recombinant derivatives
of Plasmodium vivax Merozoite Surface Protein-1 delivered via the intranasal
route. Memorias do Instituto Oswaldo Cruz 2007;102(June (3)):313–7.
[31] Rosa DS, Iwai LK, Tzelepis F, Bargieri DY, Medeiros MA, Soares IS, et al. Immuno-
genicity of a recombinant protein containing the Plasmodium vivax vaccine
candidate MSP1(19) and two human CD4+ T-cell epitopes administered to non-
human primates (Callithrix jacchus jacchus). Microbes Infect/Institut Pasteur
2006;8(July (8)):2130–7.
[32] Janeway Jr CA, Medzhitov R. Innate immune recognition. Annu Rev Immunol
2002;20:197–216.
[33] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity.
Cell 2006;124(February 24 (4)):783–801.
[34] Miao EA, Alpuche-Aranda CM, Dors M, Clark AE, Bader MW, Miller SI, et al.
Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1beta via
Ipaf. Nat Immunol 2006;7(June (6)):569–75.
[35] Smith KD, Andersen-Nissen E, Hayashi F, Strobe K, Bergman MA, Barrett SL,
et al. Toll-like receptor 5 recognizes a conserved site on flagellin required for
protofilament formation and bacterial motility. Nat Immunol 2003;4(Decem-
ber (12)):1247–53.
[36] Franchi L, Amer A, Body-Malapel M, Kanneganti TD, Ozoren N, Jagirdar R, et al.
Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin 1beta
in salmonella-infected macrophages. Nat Immunol 2006;7(June (6)):576–
82.
[37] Lee SE, Kim SY, Jeong BC, Kim YR, Bae SJ, Ahn OS, et al. A bacterial flagellin,
Vibrio vulnificusFlaB, has a strong mucosal adjuvantactivity toinduce protective
immunity. Infect Immun 2006;74(January (1)):694–702.
[38] Pino O, Martin M, Michalek SM. Cellular mechanisms of the adjuvant activity
of the flagellin component FljB of Salmonella enterica Serovar Typhimurium
to potentiate mucosal and systemic responses. Infect Immun 2005;73(October
(10)):6763–70.
[39] Honko AN, Sriranganathan N, Lees CJ, Mizel SB. Flagellin is an effective adjuvant
for immunization against lethal respiratory challenge with Yersinia pestis. Infect
Immun 2006;74(February (2)):1113–20.
[40] Cuadros C, Lopez-Hernandez FJ, Dominguez AL, McClelland M, Lustgarten J.
Flagellin fusion proteins as adjuvants or vaccines induce specific immune
responses. Infect Immun 2004;72(May (5)):2810–6.
[41] Huleatt JW, Jacobs AR, Tang J, Desai P, Kopp EB, Huang Y, et al. Vaccination with
recombinant fusion proteins incorporating Toll-like receptor ligands induces
rapid cellular and humoral immunity. Vaccine 2007;25(January 8 (4)):763–
75.
[42] McDonald WF, Huleatt JW, Foellmer HG, Hewitt D, Tang J, Desai P, et al. A West
Nile virus recombinant protein vaccine that coactivates innate and adaptive
immunity. J Infect Dis 2007;195(June 1 (11)):1607–17.
[43] Huleatt JW, Nakaar V, Desai P, Huang Y, Hewitt D, Jacobs A, et al. Potent immuno-
genicity and efficacy of a universal influenza vaccine candidate comprising a
recombinant fusion protein linking influenza M2e to the TLR5 ligand flagellin.
Vaccine 2008;26(January 10 (2)):201–14.
[44] Applequist SE, Rollman E, Wareing MD, Liden M, Rozell B, Hinkula J, et al.
Activation of innate immunity, inflammation, and potentiation of DNA vacci-
nation through mammalian expression of the TLR5 agonist flagellin. J Immunol
2005;175(September 15 (6)):3882–91.
[45] Schmitt CK, Darnell SC, O’Brien AD. The attenuated phenotype of a Salmonella
typhimurium flgM mutant is related to expression of FliC flagellin. J Bacteriol
1996;178(May (10)):2911–5.
[46] Barnwell JW, Galinski MR, DeSimone SG,Perler F, Ingravallo P. Plasmodium vivax,
P. cynomolgi, and P. knowlesi: identification of homologue proteins associated
with the surface of merozoites. Exp Parasitol 1999;91(March (3)):238–49.
[47] Soares IS, Levitus G, Souza JM, Del PortilloHA, Rodrigues MM.Acquired immune
responses to the N- and C-terminal regions of Plasmodium vivax Merozoite Sur-
face Protein 1 in individuals exposed to malaria. Infect Immun 1997;65(May
(5)):1606–14.
[48] Soares IS, da Cunha MG, Silva MN, Souza JM, Del Portillo HA, Rodrigues MM.
Longevity of naturally acquired antibody responses to the N- and C-terminal
regions of Plasmodium vivax Merozoite Surface Protein 1. Am J Trop Med Hyg
1999;60(March (3)):357–63.
[49] Soares IS, Barnwell JW, Ferreira MU, Gomes Da Cunha M, Laurino JP, Castilho
BA, et al. A Plasmodium vivax vaccine candidate displays limited allele polymor-
phism, which does not restrict recognition by antibodies. Mol Med 1999;5(July
(7)):459–70.
[50] Rodrigues MM, Ribeirao M, Pereira-Chioccola V, Renia L, Costa F. Predomi-
nance of CD4 Th1 and CD8 Tc1 cells revealed by characterization of the cellular
immune response generated by immunization with a DNA vaccine containing
a Trypanosoma cruzi gene. Infect Immun 1999;67(August (8)):3855–63.
[51] Ljungström I, Perlmann H, Schlichtherle M, Scherf A, Wahlgren M. Methods in
malaria research. 4th ed. Manassas, Virginia, USA: MR4/ATCC; 2004.
[52] Majarian WR, Daly TM, Weidanz WP, Long CA. Passive immunization against
murine malaria with an IgG3 monoclonal antibody. J Immunol 1984;132(June
(6)):3131–7.
[53] Spencer Valero LM, Ogun SA, Fleck SL, Ling IT, Scott-Finnigan TJ, Blackman MJ,
et al. Passive immunization with antibodies against three distinct epitopes on
Plasmodium yoelii Merozoite Surface Protein 1 suppresses parasitemia. Infect
Immun 1998;66(August (8)):3925–30.
6142 D.Y. Bargieri et al. / Vaccine 26 (2008) 6132–6142
[54] Daly TM, Long CA. A recombinant 15-kilodalton carboxyl-terminal fragment of
Plasmodium yoelii yoelii 17XL Merozoite Surface Protein 1 induces a protective
immune response in mice. Infect Immun 1993;61(June (6)):2462–7.
[55] Ling IT, Ogun SA, Holder AA . Immunization against malaria with a recombinant
protein. Parasite Immunol 1994;16(February (2)):63–7.
[56] Hirunpetcharat C, Tian JH, Kaslow DC, van Rooijen N, Kumar S, Berzofsky JA, et
al. Complete protective immunity induced in mice by immunization with the
19-kilodalton carboxyl-terminal fragment of the Merozoite Surface Protein-1
(MSP1[19]) of Plasmodium yoelii expressed in Saccharomyces cerevisiae: corre-
lation of protection with antigen-specific antibody titer, but not with effector
CD4 + T cells. J Immunol 1997;159(October 1 (7)):3400–11.
[57] Rotman HL, Daly TM, Clynes R, Long CA. Fc receptors are not required for
antibody-mediated protection against lethal malaria challenge in a mouse
model. J Immunol 1998;161(August 15 (4)):1908–12.
[58] Bates MD, Newbold CI, Jarra W, Brown KN. Protective immunity to malaria:
studies with clone d lines of Plasmodium chabaudi chabaudi in CBA/Ca mice. III.
Protective and suppressive responses induced by immunization with purified
antigens. Parasite Immunol 1988;10(January (1)):1–15.
[59] Didierlaurent A, Ferrero I, Otten LA, Dubois B, Reinhardt M, Carlsen H, et
al. Flagellin promotes myeloid differentiation factor 88-dependent devel-
opment of Th2-type response. J Immunol 200 4;172(June 1 (11)):6922–
30.
[60] Cunningham AF, Khan M, Ball J, Toellner KM, Serre K, Mohr E, et al. Responses
to the soluble flagellar protein FliC are Th2, while those to FliC on Salmonella
are Th1. Eur J Immunol 2004;34(November (11)):2986–95.
[61] Molofsky AB, Byrne BG, Whitfield NN, Madigan CA, Fuse ET, Tateda K,
et al. Cytosolic recognition of flagellin by mouse macrophages restricts
Legionella pneumophila infection. J Exp Med 2006;203(April 17 (40)):1093–
104.
[62] Ren T, Zamboni DS, Roy CR, Dietrich WF, Vance RE. Flagellin-deficient Legionella
mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS
Pathog 200 6;2(March (3)):e18.
[63] Vicente-Suarez I, Takahashi Y, Cheng F, Horna P, Wang HW, Wang HG, et al.
Identification of a novel negative role of flagellin in regulating IL-10 production.
Eur J Immunol 2007;37(November (11)):3164–75.
[64] Perera KL, Handunnetti SM, Holm I, Longacre S, Mendis K. Baculovirus Mero-
zoite Surface Protein 1 C-terminal recombinant antigens are highly protective
in a natural primate model for human Plasmodium vivax malaria. Infect Immun
1998;66(April (4)):1500–6.
[65] Darko CA, Angov E, Collins WE, Bergmann-Leitner ES, Girouard AS, Hitt SL,
et al. The clinical-grade 42-kilodalton fragment of Merozoite Surface Protein
1ofPlasmodium falciparum strain FVO expressed in Escherichia coli protects
Aotus nancymai against challenge with homologous erythrocytic-stage para-
sites. Infect Immun 2005;73(January (1)):287–97.
[66] Singh S, Miura K, Zhou H, Muratova O, Keegan B, Miles A, et al. Immu-
nity to recombinant plasmodium falciparum Merozoite Surface Protein 1
(MSP1): protection in Aotus nancymai monkeys strongly correlates with anti-
MSP1 antibody titer and in vitro parasite-inhibitory activity. Infect Immun
2006;74(August (8)):4573–80.
[67] Malkin E, Long CA, Stowers AW, Zou L, Singh S, MacDonald NJ, et al. Phase 1
study of two Merozoite Surface Protein 1 (MSP1(42)) vaccines for Plasmodium
falciparum malaria. PLoS Clin Trials 2007;2(4):e12.
[68] Huaman MC, Martin LB, Malkin E, Narum DL, Miller LH, Mahanty S, et al. Ex vivo
cytokine and memory T cell responses to the 42-kDa fragment of Plasmodium
falciparum Merozoite Surface Protein-1 in vaccinated volunteers. J Immunol
2008;180(February 1 (3)):1451–61.
[69] Klinman DM. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nature
Rev 2004;4(April (40)):249–58.
66
Artigo 3
67
Immunogenic properties of a recombinant fusion protein containing the C-
terminal 19 kDa of Plamsodium falciparum Merozoite Surface Protein-1 and
the flagellin FliC of Salmonella.
Resumo:
Neste trabalho geramos uma nova proteína de fusão da PfMSP1
19
com a
flagelina de Salmonella. As sequências gênicas foram clonadas num vetor de
expressão e a proteína recombinante de fusão foi expressa em bactérias E. coli.
Purificamos a proteína de fusão e demonstramos que esta mantinha as
propriedades adjuvantes da flagelina.
A imunização de camundongos C57BL/6 com a proteína de fusão sozinha
ou na presença dos adjuvantes CpG ODN 1826, adjuvante incompleto de Freund
(AIF), Quil-A ou adjuvante completo de Freund (ACF) pela via subcutânea induziu
altos títulos de anticorpos específicos. A proteína de fusão somente ou na
presença de AIF ou ACF induziu resposta imune de padrão Th2. Os adjuvantes
Quil-A e CpG ODN 1826 induziram um aumento dos títulos específicos de IgG2c,
balanceando o padrão imunológico de resposta. Em coelhos, a proteína
recombinante de fusão foi capaz de induzir altos títulos de anticorpos específicos.
Demonstramos também que a imunização de camundongos com a
proteína de fusão induziu resposta celular com produção de IFN-γ específica em
resposta ao antígeno de malária. A adição de qualquer adjuvante potencializou a
resposta imune celular. O soro dos camundongos imunizados reconheceu o
parasita em lâminas de imunofluorescência.
Finalmente, o soro dos coelhos imunizados inibiu o crescimento in vitro de
três cepas diferentes de P. falciparum.
Pudemos testar a funcionalidade dos anticorpos gerados pela imunização
de modelos experimentais com proteínas recombinantes de fusão da MSP1
19
com
a flagelina. Concluímos que esta estratégia vacinal gera resposta de anticorpos
capaz de inibir o crescimento parasitário.
Bargieri et al. 2009 Vaccine
1
Immunogenic properties of a recombinant fusion protein
containing the C-terminal 19 kDa of Plasmodium falciparum
Merozoite Surface Protein-1 and the innate immunity agonist FliC
flagellin of Salmonella Typhimurium
5
Running title: New malaria vaccine candidates based on P. falciparum MSP1
19
and Salmonella flagellin.
Daniel Y. Bargieri
a, b
, Juliana A. Leite
c
, Stefanie C. P. Lopes
c
, Maria Elisabete
Sbrogio-Almeida
d
, Catarina J.M. Braga
e
, Luis C. S. Ferreira
e
, Irene S. Soares
f
, 10
Fabio T. M. Costa
c
and Mauricio M. Rodrigues
a, b, *
a
Centro Interdisciplinar de Terapia Gênica (CINTERGEN),
Universidade Federal de São Paulo, Escola Paulista de Medicina, Brazil.
b
Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de
São Paulo, Escola Paulista de Medicina,
15
Rua Mirassol, 207, São Paulo 04044-010, SP, Brazil.
c
Departamento de Genética, Evolução e Bioagentes, Instituto de Biologia, Universidade
Estadual de Campinas, Rua Monteiro Lobato, 255, Campinas 13083-970, SP, Brazil.
d
Instituto Butantan, Lab. Centro de Biotecnologia, Av. Vital Brazil, 1500, São Paulo
05503-900, SP, Brazil.
20
e
Departamento de Microbiologia do Instituto de Ciências Biomédicas Universidade de São
Paulo, Av. Prof. Lineu Prestes, 1374, São Paulo 05508-900, SP, Brazil.
f
Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências
Farmacêuticas, Av. Prof. Lineu Prestes 580, São Paulo 05508-900, SP, Brazil.
25
*Corresponding author:
CINTERGEN, UNIFESP, Escola Paulista de Medicina,
Rua Mirassol 207, São Paulo 04044-010, SP, Brazil.
Tel.: +55 11 5571 1095; fax: +55 11 5571 1095.
E-mail address: mrodrigues@unifesp.br 30
Bargieri et al. 2009 Vaccine
2
Summary
In a recent study, we demonstrated the immunogenic properties of a new
malaria vaccine polypeptide based on a 19 kDa C-terminal fragment of the 35
merozoite surface protein-1 (MSP1
19
) from P. vivax and an innate immunity agonist,
the Salmonella enterica serovar Typhimurium flagellin (FliC). Herein, we tested
whether the same strategy, based on the MSP1
19
component of the deadly malaria
parasite P. falciparum, could also generate a fusion polypeptide with enhanced
immunogenicity. The His
6
FliC-MSP1
19
fusion protein was expressed from a 40
recombinant E. coli and showed preserved in vitro TLR5-binding activity. In contrast
to animals injected with His
6
MSP1
19
, mice subcutaneously immunised with the
recombinant His
6
FliC-MSP1
19
developed strong MSP1
19
-specific systemic antibody
responses with a prevailing IgG1 subclass. Incorporation of other adjuvants, such
as CpG ODN 1826, complete and incomplete Freund´s adjuvants or Quil-A, 45
improved the IgG responses after the second, but not the third, immunising dose. It
also resulted in a more balanced IgG subclass response, as evaluated by the
IgG1/IgG2c ratio, and higher cell-mediated immune response, as determined by the
detection of antigen-specific interferon-γ secretion by immune spleen cells. MSP1
19
-
specific antibodies recognised not only the recombinant protein, but also the native 50
protein expressed on the surface of P. falciparum parasites. Finally, sera from
rabbits immunised with the fusion protein alone inhibited the in vitro growth of three
different P. falciparum strains. In summary, these results extend our previous
observations and further demonstrate that fusion of the innate immunity agonist FliC
to Plasmodium antigens is a promising alternative to improve their immunogenicity. 55
Keywords: P. falciparum, vaccine, flagellin, TLR5.
Bargieri et al. 2009 Vaccine
3
1. Introduction
Plasmodium falciparum is estimated to cause around 250 million malaria
cases every year, leading to 1 million deaths, mostly of children under five years of
age [1]. Drug resistance to this parasite has emerged, reducing the efficacy of 60
conventional treatment and often contributing to malaria-related mortality [2].
Therefore, prophylactic alternatives, such as effective vaccines, are urgently
needed.
Immunity to malaria is a multi-factorial process that involves various
components of the adaptive immune system. Antibody and T-cell mediated 65
mechanisms cooperate to establish resistance to pre- and erythrocytic forms of the
parasite. A number of target antigens have been described and are being pursued
for the development of a recombinant subunit malaria vaccine, as extensively
reviewed [3-6]. Recent phase II clinical trials were performed in African children
using a recombinant malaria vaccine that is based on a pre-erythrocytic antigen, 70
the circumsporozoite (CS) protein, in the presence of the adjuvant AS01E or
AS02D. Children immunised with the vaccine formulations RTS,S/AS01E or
RTS,S/AS02D displayed a significant reduction in the incidence of naturally
acquired infection, indicating that a certain degree of protective immunity was
indeed achieved. In spite of the success, immunity was not ideal because a 75
significant part of the RTS,S/AS01E or RTS,S/AS02D vaccinated children still
contracted the infection during the trials [7, 8].
Considering the fact that the RTS,S/AS01E and RTS,S/AS02D vaccines did
not provide an optimal degree of protective immunity against malaria, a search for
new vaccines with improved efficacy is required. One possible approach to achieve 80
Bargieri et al. 2009 Vaccine
4
this goal is the identification of additional target antigens. Merozoite surface protein
1 (MSP-1) is expressed by the pre- and erythrocytic stages of P. falciparum and
represents a promising malaria vaccine candidate [9]. The protein is synthesised in
a precursor form with a high molecular weight during schizogony and, during the
invasion process, a proteolytic cleavage releases most of the molecule from the 85
merozoite membrane, leaving a membrane-anchored 19 kDa fragment (MSP1
19
)
on the parasite surface [10]. Genetic modification studies with malaria parasites
demonstrated that the essential role of MSP1
19
in parasite survival during in vivo
replication is similar among even distantly related Plasmodium species [11]. More
recently, studies using clonal conditional mutagenesis showed that silencing MSP-90
1 in sporozoites impaired subsequent merozoite formation in the liver, implicating
this molecule in the life cycle of the parasite in the liver as well as in the blood [12].
Over the past twenty years, many studies have been performed that support
the use of MSP1
19
as a component of subunit-based malaria vaccine formulations.
Monoclonal antibodies against MSP1
19
and polyclonal antibodies against MSP1
42
95
inhibit the in vitro growth of P. falciparum [10, 13]. In addition, non-human primates
injected with recombinant proteins containing the C-terminal region of the
P. falciparum MSP-1 expressed in baculovirus [14-16], Saccharomyces cerevisiae
[17], Escherichia coli [16, 18, 19] and mammalian cells [20] are protected against
homologous challenge with the parasite. Nonetheless, the lack of an effective 100
malaria vaccine formulation, either based on MSP-1 or other antigens, is often
explained by the lack of adequate adjuvants that could be used in humans to
promote high and long-lasting antibody responses to the target recombinant
proteins.
Bargieri et al. 2009 Vaccine
5
Recent advances in the field of innate immunity have disclosed the cellular 105
and molecular mechanisms behind the adjuvant effects of pathogen-associated
molecular patterns (PAMPs). The recognition of PAMPs in mammalian cells is
mediated by innate immune receptors such as TLR5 (specific for bacterial
flagellins) and TLR9 (specific for unmethylated CpG DNA), which are expressed by
antigen-presenting cells (APC). Following the binding of the specific agonists, the 110
intracellular domain of the TLR receptor activates molecular signalling cascades
and promotes the recruitment of adaptor proteins, such as the myeloid
differentiation factor 88 (MyD88), and the activation of transcription factors, such as
NF-κB and mitogen-activated kinases. These signalling events result in the
activation of inflammatory responses and APC maturation, which mediate the 115
activation of T and B cell-dependent adaptive immune responses [21, 22].
Flagellins, the structural subunit of flagellar filaments, contribute both to the
virulence of bacterial pathogens and to the activation of inflammatory responses in
mammalian hosts [21, 22]. Bacterial flagellins have been shown to bind
extracellular TLR5 as well as intracellular receptors, leading to strong inflammatory 120
responses [23-30]. Flagellins, such as those expressed by Salmonella species,
have shown strong adjuvant effects when delivered via parenteral or mucosal
routes and either admixed or genetically linked to target antigens in mice [31-42]
and in non-human primates [43-45]. In a recent work, we generated a recombinant
protein consisting of the flagellin FliC of S. enterica Typhimurium fused to the 125
MSP1
19
of P. vivax. Mice immunised with the fusion protein in the absence of
adjuvant elicited high and long-lasting antibody titres that recognised the parasite
in the blood of infected patients [46]. We also showed that the fusion process did
Bargieri et al. 2009 Vaccine
6
not change the antigenic properties of the malaria antigen or the capacity of
flagellin to bind to the innate immunity receptor TLR5. 130
Here we investigated the immunogenicity of a fusion polypeptide containing
the P. falciparum MSP1
19
and an innate immunity agonist, the Salmonella
Typhimurium FliC flagellin. The immunogenicity of the recombinant fusion protein
was assessed by immunisation of mice and rabbits with the recombinant protein
alone or in the presence of different adjuvants, such as the TLR9 agonist CpG 135
ODN 1826, Quil-A or complete and incomplete Freund’s adjuvants. Additionally,
we investigated whether the anti-MSP1
19
antibodies recognised the malaria
parasites and impaired in vitro parasite growth. The reported results demonstrate
that the incorporation of TLR agonists into MSP1
19
-based formulations represents
an alternative for the development of new, simple and inexpensive malaria vaccine 140
candidates.
2. Methods
2.1. Generation of recombinant MSP1
19
–derived proteins. The S. Typhimurium FliC
and MSP1
19
gene sequences were obtained by PCR amplification using Platinum 145
Taq High Fidelity DNA polymerase (Invitrogen). Template DNA for the
amplifications were obtained from S. Typhimurium and P. falciparum 3D7 blood
stages. Specific oligonucleotides for the amplification of the FliC gene, containing
EcoRI and HindIII restriction sites (GGGGAATTCATGGCACAAGTCATTAATACA
and GGCAAGCTTGACGCAGTAAAGAGAGGAC), and the MSP1
19
nucleotide 150
sequence, containing HindIII and XhoI restriction sites
(GGCAAGCTTGCGGAAAATTCCAAGATATG and
Bargieri et al. 2009 Vaccine
7
GGGCTCGAGTTTAACTGCAGAAAATACCATC), were purchased from Integrated
DNA Technologies, Inc. Amplified fragments were cloned in frame in the pET28a
vector (Novagen). The recombinant protein was expressed and purified as 155
described previously [47]. Briefly, recombinant E. coli BL21 DE3 (Novagen) was
cultivated at 37°C in flasks containing Luria broth (LB) and kanamycin (30 µg/ml).
Protein expression was induced at an OD
600
of 0.6 with 0.1 mM IPTG (Invitrogen)
for 4 h. After centrifugation, bacteria were lysed on ice with the aid of an ultrasonic
processor (Sonics and Materials INC Vibra Cell VCX 750) in a phosphate buffer 160
with 1.0 mg/ml lysozyme (Sigma) and 1mM PMSF (Sigma). Bacterial lysate was
centrifuged, and the supernatant was applied to a column with Ni
2+
–NTA–agarose
resin (Quiagen). After several washes, bound proteins were eluted with 0.5 M
imidazole (Sigma). The eluted protein was dialysed against 20 mM Tris–HCl (pH
8.0), and the recombinant proteins were purified by ion-exchange chromatography 165
using a Resource Q column (GE Healthcare) coupled to an FPLC system (GE
Healthcare). Fractions containing the recombinant proteins with a high degree of
purity were pooled and extensively dialysed against phosphate-buffered saline
(PBS). Protein concentration was determined with the Bradford assay and by SDS-
PAGE analyses. 170
2.2. FliC purification – Native S. Typhimurium FliC was purified from the attenuated
S. Typhimurium SL3201 strain, which expresses FliC, but not FljB [48]. Briefly,
bacteria were grown in LB supplemented with kanamycin (30 µg/ml) overnight at
37°C under aeration (80 rpm). Cells were washed once with PBS and submitted to 175
Bargieri et al. 2009 Vaccine
8
mechanical shearing for four, 2 min cycles in a bench vortex mixer. The cell
suspensions were centrifuged to remove the cellular debris, and following acetone
precipitation, the flagellar filaments were collected from the supernatant and
suspended in PBS. The purity of the preparations was monitored by SDS-PAGE.
The recombinant FliC (rFliC) was obtained after cloning the corresponding gene 180
into the pET28a expression vector as previously reported [46]. The recombinant
vector was introduced into the E. coli BL21 DE3 strain, and the encoded peptide
was subsequently purified by affinity chromatography based on standard
procedures [46].
185
2.3. Immunisation regimens – Six- to eight-week-old female C57BL/6 (H-2
b
) mice
were purchased from the Federal University of São Paulo, Brazil. C57BL/6 TLR4
knock-out mice were kindly provided by Dr. Shizuo Akira at Osaka University,
Japan. Experiments were performed in accordance with the guidelines of the
Ethics Committee for Animal Handling of the Federal University of São Paulo. Mice 190
were immunised three times, three weeks apart, subcutaneously in the two hind
footpads, using a final volume of 50 µl in each footpad (first dose) and a final
volume of 100 µl at the base of the tail (second and third dose). For each dose, 5
µg of His
6
MSP1
19
or 25 µg of the fusion protein was used. CpG ODN 1826
(TCCATGACGTTCCTGACGTT) was synthesised with a nuclease-resistant 195
phosphorothioate backbone (Coley Pharmaceutical Group); a dose of10 µg per
mouse was admixed with the antigen just before injection. A dose of 2.5 µg of Quil-
A (Superfos Biosector a/s) per mouse was alternatively admixed with the antigen
Bargieri et al. 2009 Vaccine
9
just before injection. Complete (CFA) and incomplete (IFA) Freund’s adjuvants
(Sigma) were emulsified extensively with the proteins (1:1, v/v) prior to injection. 200
For CFA/IFA immunisation regimens, CFA was used for the first dose, and IFA was
used for the subsequent doses. Rabbits were immunised four times s.c. in the back
skin with 200 µg of His
6
FliC-MSP1
19
or 50 µg of FliC.
2.4. Immunological assays – Serum anti-MSP1
19
antibodies were detected by 205
ELISA essentially as described previously [47]. The recombinant His
6
MSP1
19
(200
ng/well) antigen was employed as the solid phase bound antigen. A peroxidase
conjugated goat anti-mouse IgG (Sigma) or goat anti-rabbit IgG (Sigma) was
applied at a final dilution of 1:2,000, while the mice or rabbit sera were tested at
serial dilutions starting from 1:200. Specific anti-MSP1
19
titres were determined as 210
the highest dilution yielding an OD
492
higher than 0.1. Detection of IgG subclass
responses was performed as described above, except that the secondary antibody
was specific for mouse IgG1, IgG2b and IgG2c (Southern Technologies). The
results are presented as mean ± SD.
The amount of IFN-γ secreted into cell culture supernatants was determined 215
with 10
6
spleen cells collected from different immunisation groups and cultivated in
flat-bottom 96-well plates in a final volume of 200 µl. The His
6
MSP1
19
protein was
added to the culture at a final concentration of 1 or 10 µg/ml. After 120 h, the
supernatants were collected for cytokine determination. Cytokine concentration
was estimated by capture ELISA using antibodies and recombinant cytokines 220
purchased from Pharmingen (San Diego, CA) as previously described [49]. The
Bargieri et al. 2009 Vaccine
10
cytokine concentration in each sample was determined with standard curves
created with known concentrations of recombinant mouse IFN-γ. The detection limit
of the assay was 0.2 ng/ml.
Determination of TLR5 bioactivity with native or recombinant flagellins, as 225
well as with the His
6
FliC-MSP1
19
protein, was performed with a HEK293 cell line
expressing mouse TLR5 (Invivogen). The cells were maintained in DMEM media
supplemented with10% FBS and 10 µg/ml of blasticidin. Non-transfected or TLR5-
transfected HEK293 cells (5 x 10
4
cells/well) were grown overnight in 96-wells
plates and stimulated with the recombinant proteins for 5 h. The culture 230
supernatants were collected, and the concentration of secreted human HuIL-8 was
measured using a Human IL-8 ELISA Kit (BD biosciences) following the protocol
recommended by the manufacturer.
2.5. Cultivation of P. falciparum-infected erythrocytes – P. falciparum 3D7, FCR3 235
[50] and S20 [51] strains were cultured in candle jars as described elsewhere [52].
Briefly, P. falciparum-infected erythrocytes were cultivated in fresh type O
+
human
erythrocytes (Blood Center - UNICAMP) suspended at a 4% final hematocrit in
complete medium (RPMI 1640; Sigma) supplemented with 10% of homologous
human plasma and adjusted to pH 7.2. In some experiments, parasites were 240
synchronised (± 6 hours) by repeated 5% sorbitol treatment as described
elsewhere [53].
Bargieri et al. 2009 Vaccine
11
2.6. P. falciparum slide preparation and indirect immunofluorescence assay (IIA) –
Assays were performed with 10-well IIA slides containing late stage forms of 245
P. falciparum enriched in a Voluven (Fresenius) gradient as described elsewhere
[53]. The infected erythrocytes were diluted 1:1 in fetal bovine serum (FBS), spread
on IIA slides (20 µL/well), fixed in acetone for 10 min and air dried. Pooled sera
from different immunisation groups were diluted 1:100 in PBS, applied to the slides
and kept for 30 min in a humid chamber at 37°C. The slides were extensively 250
washed with PBS and incubated with 20 µg/ml of Alexa Fluor 488-conjugated goat
anti-mouse IgG (Molecular Probes) and 100 µg/ml of 4',6-diamidino-2-phenylindole
(DAPI) (Molecular Probes) for 30 min in a humid chamber at 37°C. After several
washes with PBS, the slides were sealed with coverslips and viewed under an
immunofluorescence microscope. For liquid phase IIA, the infected erythrocytes 255
were fixed in 2% paraformaldehyde and then diluted in FBS. Pooled sera from
rabbits were added in a final dilution of 1:20 and kept for 60 min at 37°C. After two
washes with FBS, the cells were incubated with 100 µg/ml of Alexa Fluor 568-
conjugated goat anti-rabbit IgG (Molecular Probes) and 200 µg/ml of DAPI
(Molecular Probes) for 30 min 37°C. The cells were washed twice with FBS and 260
viewed under an immunofluorescence microscope on slides sealed with coverslips.
2.7. Growth inhibition assay (GIA) – The merozoite invasion inhibition assay using
the sera from the rabbits was essentially performed as previously described [54].
Briefly, trophozoite synchronised P. falciparum 3D7, S20 and FCR3 cultures with a 265
parasitemia of 4.0% and a hematocrit of 4.0% were cultured in micro-plates (50 µl)
Bargieri et al. 2009 Vaccine
12
in the presence of increasing concentrations of rabbit sera at 37°C for 24–30 h. In
order to quantify the parasitemia, blood smears from each well were stained with
Giemsa and then analysed by counting the number of rings in at least 500
erythrocytes. 270
2.8. Statistical analyses – One-way ANOVA, Student’s t test and the Tukey HSD
test were used to compare the differences between the mean values of the tested
immunisation groups.
275
3. Results
3.1. Production, purification and TLR5 bioactivity of flagellin-related peptides
In the present study, we generated two recombinant proteins: the
P. falciparum MSP1
19
peptide linked to a hexa-histidine tag (His
6
MSP1
19
) and a
fusion protein consisting of the MSP1
19
-peptide linked to the C-terminal end of FliC 280
(His
6
FliC-MSP1
19
). The schematic representation of each of the recombinant
polypeptides and purified proteins separated by SDS-PAGE are presented in Fig.
1A and B, respectively. The native FliC protein purified from the monophasic
S. Typhimurium SL3201 strain was used as control in the immunologic assays.
To determine whether the fusion polypeptide retained the ability to bind to 285
TLR5, HEK293 cells transfected with the mouse TLR5 receptor gene were cultured
in the presence of increasing concentrations of the recombinant protein and
recombinant or native FliC (positive controls). Exposure to both the native and
recombinant S. Typhimurium FliC and to the hybrid His
6
FliC-MSP1
19
protein
Bargieri et al. 2009 Vaccine
13
induced the production of HuIL-8 by TLR5-transfected HEK293 cells (Fig. 1C). On 290
a molar basis, all proteins showed similar HuIL-8 induction. Non-transfected
HEK293 cells did not produce HuIL-8 after exposure to the recombinant proteins.
These results clearly demonstrate that the MSP1
19
C-terminal fusion did not impair
the TLR5-specific bioactivity of the FliC in the E. coli recombinant protein.
295
3.2. Induction of MSP1
19
-specific antibody responses in mice immunised with
MSP1
19
-derived peptides genetically fused to FliC
The serum IgG responses to P. falciparum MSP1
19
were determined in
C57BL/6 mice immunised subcutaneously with the purified His
6
MSP1
19
protein (5
µg/dose) emulsified in complete or incomplete Freund’s adjuvant (CFA/IFA). Mice 300
parenterally immunised with the recombinant protein in the presence of CFA/IFA
developed significantly higher MSP1
19
-specific IgG titres than mice immunised with
the His
6
MSP1
19
protein alone (p < 0.01). Maximal IgG antibody titres were achieved
after the second dose (Fig. 2A). Mice immunised with the recombinant fusion
protein His
6
FliC-MSP1
19
alone developed significantly higher MSP1
19
-specific IgG 305
titres than mice immunised with the His
6
MSP1
19
protein alone (p < 0.01). Mice
immunised twice with the recombinant His
6
FliC-MSP1
19
protein or with His
6
MSP1
19
emulsified in CFA/IFA showed a statistically significant difference in their MSP1
19
-
specific antibody titres in favour of the latter group (p < 0.01). Nevertheless, after a
third immunising dose, no difference was observed between the specific IgG titres 310
from these two mouse groups (p > 0.05), indicating that, after three doses, the
fusion to FliC conferred the same immunogenicity to the hybrid MSP1
19
protein as
Bargieri et al. 2009 Vaccine
14
the non-fused antigen emulsified in CFA/IFA, as measured by the serum antigen-
specific IgG levels (Fig. 2A). The adjuvant effect of His
6
FliC-MSP1
19
cannot be
attributed to contaminating LPS since immunisation of C57BL/6 TLR4 knock-out 315
mice (non-responsive to LPS) with His
6
FliC-MSP1
19
elicited MSP1
19
-specific IgG
responses similar to those found in wild type mice (data not shown).
Addition of other adjuvants to His
6
FliC-MSP1
19
, specifically CpG ODN 1826,
CFA, IFA and Quil-A, increased the antigen-specific antibody responses when
compared to mice immunised only with the His
6
FliC-MSP1
19
antigen (p < 0.05), as 320
observed by comparison of the specific IgG titres following the two immunising
doses. However, after three doses, the presence of adjuvants did not significantly
change the magnitude of the MSP1
19
-specific IgG responses (Fig. 2A). These
results clearly show that immunisation with the MSP1
19
-peptide fused to FliC was
capable of inducing a high IgG antibody titres even in the absence of other admixed 325
adjuvants.
In order to determine the quality of the humoral immune responses, we
measured the IgG subclasses of the MSP1
19
-specific antibody responses elicited in
mice parenterally immunised with the recombinant proteins. Mice immunised with
His
6
MSP1
19
emulsified in CFA/IFA developed high MSP1
19
-specific IgG1, IgG2b 330
and IgG2c titres, with an IgG1/IgG2c ratio equal to 10 (Fig. 2B). The recombinant
fusion protein His
6
FliC-MSP1
19
alone induced a less balanced subclass response,
with low IgG2c and high IgG1 and IgG2b MSP1
19
-specific titres and an IgG1/IgG2c
ratio equal to 79 (Fig. 2B). The addition of other adjuvants to the His
6
FliC-MSP1
19
immunisation regimen was not capable of changing the MSP1
19
-specific IgG1 or 335
Bargieri et al. 2009 Vaccine
15
IgG2b responses, but addition of IFA plus CpG ODN 1826, or Quil-A increased the
MSP1
19
-specific IgG2c subclass response, leading to a more balanced IgG1/IgG2c
ratio (6.3 and 1.0, respectively) (Fig. 2B).
3.3. Incorporation of CpG ODN 1826 and IFA, or Quil-A to the fusion protein 340
induced more IFN-
γ
secretion by immune spleen cells in response to His
6
MSP1
19
in
vitro
To further characterise the cellular-mediated immune responses (CMI)
induced by vaccination with the recombinant proteins, we determined the secreted
IFN-γ produced by spleen cells of mice immunised with the different vaccine 345
formulations. As shown in Fig. 3, spleen cells from mice immunised with
His
6
MSP1
19
secreted IFN-γ in response to the antigen only when administered with
the CFA/IFA emulsion. On the other hand, spleen cells from mice immunised with
His
6
FliC-MSP1
19
, even when administered in the absence of other adjuvants,
secreted modest, but significant, amounts of IFN-γ following incubation with the 350
recombinant protein. Nevertheless, addition of IFA/CpG ODN 1826 or Quil-A to the
formulations containing His
6
FliC-MSP1
19
improved the cellular immunogenicity of
the antigen, as measured by the amount of IFN-γ secreted by spleen cells upon in
vitro stimulation (Fig. 3). Together, these results indicate that the addition of the
TLR9 agonist CpG ODN 1826 or Quil-A balanced the immune response pattern 355
and improved the activation of specific cell-dependent immune responses, as
evaluated by the IFN-γ secretion from spleen cells.
Bargieri et al. 2009 Vaccine
16
3.4. Antibodies generated in mice immunised with His
6
FliC-MSP1
19
recognised in
vitro-cultured P. falciparum 3D7 parasites 360
Sera from mice immunised with His
6
FliC-MSP1
19
were used in
immunofluorescence assays with P. falciparum 3D7 parasites cultured under in
vitro conditions. The MSP1
19
-specific antibodies bound to epitopes exposed on the
surface of the parasites, clearly showing that the antibody immune responses
raised after immunisation with the recombinant proteins are specific against the 365
epitopes that are naturally expressed by the parasite (Fig. 4).
3.5. Immunisation of rabbits with His
6
FliC-MSP1
19
induced antibodies that inhibited
invasion of parasites of distinct strains in vitro
Two rabbits were immunised with His
6
FliC-MSP1
19
, and a third rabbit was 370
immunised with FliC as a control. The two rabbits injected subcutaneously with
His
6
FliC-MSP1
19
raised higher specific anti-MSP1
19
IgG titres as compared to the
animal injected with FliC (p < 0.01), which had undetectable anti-MSP1
19
titres (Fig.
5A). The anti-MSP1
19
IgG titres in the immunised rabbits achieved maximal values
following the third dose (Fig. 5A). Additionally, pooled sera from the two rabbits 375
immunised with His
6
FliC-MSP1
19
labelled surface-exposed epitopes of the
P. falciparum 3D7 strain, in contrast to the serum harvested from the rabbit
immunised with FliC (Fig. 5B).
Bargieri et al. 2009 Vaccine
17
After four immunising doses, the sera of the three rabbits were used to
perform growth inhibition assays (GIA) with the parasites of three P. falciparum 380
strains. The P. falciparum 3D7, S20 and FCR3 strains were grown in vitro, and
serum samples of the immunised rabbits were added to the cultures at three
different dilutions. Serum samples of the two rabbits immunised with His
6
FliC-
MSP1
19
efficiently inhibited invasion of erythrocytes by the parasites of the different
P. falciparum strains (inhibition values ranged from 66% to 89% of normal 385
invasion), whereas serum samples of the rabbit immunised with FliC did not
efficiently inhibit parasite invasion (inhibition values ranged from 11 to 21%) (Fig 6).
Analyses of the MSP1
19
nucleotide sequences of these three P. falciparum strains
showed identity of at least 97.7% (data not shown). These results clearly show that
antibodies raised in rabbits following immunisation with His
6
FliC-MSP1
19
, in the 390
absence of admixed adjuvants, can specifically inhibit erythrocyte invasion by
different P. falciparum strains, an essential step of the parasitic life cycle.
4. Discussion
In the present study, we tested whether the proteic innate immunity activator 395
(Salmonella FliC) acts both as an adjuvant for specific humoral and cellular immune
responses and an antigen molecular carrier to be used as a simple and
inexpensive strategy to improve the immunogenicity of P. falciparum MSP1
19
, one
of the best studied malaria vaccine candidates. Parenteral immunisation with the
fusion protein His
6
FliC-MSP1
19
elicited strong adaptive immune responses in 400
vaccinated mice. The immunogenicity of the malaria vaccine formulation could be
Bargieri et al. 2009 Vaccine
18
further modulated with the use of additional TLR agonists, such as CpG ODN 1826,
as well as with commercially available adjuvants, such as Quil-A. The present study
reproduces and extends recent reports on the use of Salmonella flagellin as an
adjuvant and antigen carrier, allowing additional plasticity to the design and 405
production of vaccine antigens endowed with enhanced immunogenicity [31-42].
Indeed, recent studies in non-human primates extend the knowledge obtained for
murine hosts, strongly arguing in favour of future clinical trials [43-45].
The protective nature of antibodies targeting the C-terminal domain of the
P. falciparum MSP-1 protein has been thoroughly documented in a number of in 410
vitro and in vivo studies. In vitro, antibodies directed against P. falciparum MSP1
19
,
which were obtained from immune individuals, were highly inhibitory for parasite
growth [55]. In vivo, studies on non-human primates confirmed that protective
immunity elicited by vaccination with recombinant proteins correlates with the
antibody titres to this specific region of the MSP-1 protein [16, 18, 19]. In spite of 415
these promising results in some non-human primate models, the observed
protective immunity is strain-specific and requires the use of specific adjuvants,
some of them endowed with high toxicity and, thus, can not be used in humans
[16].
Based on the promising results in the experimental models of malaria 420
infection, a recent phase IIb vaccine trial was performed in Africa [56]. In this
clinical trial, children were vaccinated with a formulation containing a recombinant
His-tagged fusion protein encompassing the MSP-1 42 kDa C-terminal fragment of
the P. falciparum 3D7 strain (FMP1) formulated with the adjuvant AS02 [56]. This
Bargieri et al. 2009 Vaccine
19
vaccine formulation was shown to be safe and immunogenic, as demonstrated by 425
detection of specific antibody titres by ELISA. Unfortunately, the trial failed, and no
significant reduction in the incidence of malaria infection could be observed in
children receiving the FMP1/AS02 formulation [56]. The precise reason why the
vaccination failed should be investigated. It might be attributed to the
polymorphism of the MSP-1 protein. This fact may be relevant for the interpretation 430
of the results, considering that protective immunity to the C-terminal region of P.
falciparum MSP-1 can be strain-specific and antibodies targeting this antigen may
not show parasite inhibitory activity [16, 57]. Furthermore, some of the MSP-1-
specific antibodies are endowed with the ability to block parasite the activity of
inhibitory antibodies [58]. Although negative, these results do not completely refute 435
that the C-terminal region of P. falciparum MSP-1 could still be part of a subunit
malaria vaccine in a new recombinant form or formulation. Currently, the
immunogenic properties of distinct recombinant proteins are being compared in
experimental animals to select possible candidates for human trials [59]. In that
scenario, our approach may help in the search for an ideal malarial vaccine 440
formulation containing blood stage antigens with increased immunogenicity and
improved potency, which will generate antibodies that proficiently inhibit the late
steps of parasite development.
Although it was described that flagellin is a natural agonist of at least three
innate immune receptors, TLR5 [24, 30], Ipaf (ICE protease-activating factor) [23, 445
25] and Naip5/Birc1e (Neuronal Apoptosis Inhibitory Protein) [26-29], it is very likely
that the mechanism that mediates the adjuvant properties of flagellin involves the
activation of TLR5 in antigen-presenting cells. A recent study showed that the direct
Bargieri et al. 2009 Vaccine
20
stimulation of TLR5
+
CD11c
+
dendritic cells (DCs) via TLR5 is necessary for
flagellin adjuvant activity [60], which would act mainly by upregulating CD80, CD83, 450
CD86 and MHC class II in these cells. Nevertheless, one laboratory suggests that
murine DCs do not express TLR5 [61] and another showed that, in the absence of
the TLR5, flagellin is capable of inducing a humoral immune response despite a
lack in DC maturation [62]. Additionally, flagellin has been shown to activate APC
through inhibition of IL-10 secretion, an immunosuppressive cytokine [63], resulting 455
in a higher adaptive immune response. Therefore, the exact mechanism(s) by
which flagellin acts as an adjuvant in these models remains to be elucidated. It is
possible that another unknown receptor might be playing a relevant role in this
scenario. Despite of these unanswered questions, it seems that human DCs
express higher levels of TLR5 than murine DCs [61], which would be an advantage 460
for the development of a vaccine for humans using the strategy of antigen fusion to
flagellin.
5. Acknowledgments
This work was supported by grants from the Fundação de Amparo à 465
Pesquisa do Estado de São Paulo (FAPESP), the Millennium Institute for Vaccine
Development and Technology (CNPq - 420067/2005-1) and the National Institute
for Vaccine Development and Technology (CNPq - INCTV). DYB, JAL, SCPL and
CJMB were supported by fellowships from FAPESP. MESA, LCSF, ISS, FTMC
and MMR were supported by fellowships from CNPq. 470
Bargieri et al. 2009 Vaccine
21
6. References
[1] Aregawi M, Cibulskis R, Otten M, Williams R, Dye C. World malaria report
2008. World Health Organization (WHO) 2008.
[2] White NJ. Antimalarial drug resistance. The Journal of clinical investigation 475
2004 Apr;113(8):1084-92.
[3] Beeson JG, Osier FH, Engwerda CR. Recent insights into humoral and
cellular immune responses against malaria. Trends in parasitology 2008
Dec;24(12):578-84.
[4] Yazdani SS, Mukherjee P, Chauhan VS, Chitnis CE. Immune responses to 480
asexual blood-stages of malaria parasites. Current molecular medicine 2006
Mar;6(2):187-203.
[5] Doolan DL, Martinez-Alier N. Immune response to pre-erythrocytic stages of
malaria parasites. Current molecular medicine 2006 Mar;6(2):169-85.
[6] Renia L. Protective immunity against malaria liver stage after vaccination 485
with live parasites. Parasite (Paris, France) 2008 Sep;15(3):379-83.
[7] Bejon P, Lusingu J, Olotu A, Leach A, Lievens M, Vekemans J, et al.
Efficacy of RTS,S/AS01E vaccine against malaria in children 5 to 17 months of
age. The New England journal of medicine 2008 Dec 11;359(24):2521-32.
Bargieri et al. 2009 Vaccine
22
[8] Abdulla S, Oberholzer R, Juma O, Kubhoja S, Machera F, Membi C, et al. 490
Safety and immunogenicity of RTS,S/AS02D malaria vaccine in infants. The New
England journal of medicine 2008 Dec 11;359(24):2533-44.
[9] Diggs CL, Ballou WR, Miller LH. The major merozoite surface protein as a
malaria vaccine target. Parasitology today (Personal ed 1993 Aug;9(8):300-2.
[10] Blackman MJ, Heidrich HG, Donachie S, McBride JS, Holder AA. A single 495
fragment of a malaria merozoite surface protein remains on the parasite during red
cell invasion and is the target of invasion-inhibiting antibodies. The Journal of
experimental medicine 1990 Jul 1;172(1):379-82.
[11] O'Donnell RA, Saul A, Cowman AF, Crabb BS. Functional conservation of
the malaria vaccine antigen MSP-119across distantly related Plasmodium species. 500
Nature medicine 2000 Jan;6(1):91-5.
[12] Combe A, Giovannini D, Carvalho TG, Spath S, Boisson B, Loussert C, et
al. Clonal conditional mutagenesis in malaria parasites. Cell host & microbe 2009
Apr 23;5(4):386-96.
[13] Bergmann-Leitner ES, Duncan EH, Angov E. MSP-1p42-specific antibodies 505
impact growth and development of intra-erythrocytic parasites of Plasmodium
falciparum. Malar J 2009 Aug 3;8(1):183.
Bargieri et al. 2009 Vaccine
23
[14] Chang SP, Case SE, Gosnell WL, Hashimoto A, Kramer KJ, Tam LQ, et al.
A recombinant baculovirus 42-kilodalton C-terminal fragment of Plasmodium
falciparum merozoite surface protein 1 protects Aotus monkeys against malaria. 510
Infection and immunity 1996 Jan;64(1):253-61.
[15] Stowers AW, Cioce V, Shimp RL, Lawson M, Hui G, Muratova O, et al.
Efficacy of two alternate vaccines based on Plasmodium falciparum merozoite
surface protein 1 in an Aotus challenge trial. Infection and immunity 2001
Mar;69(3):1536-46. 515
[16] Lyon JA, Angov E, Fay MP, Sullivan JS, Girourd AS, Robinson SJ, et al.
Protection induced by Plasmodium falciparum MSP1(42) is strain-specific, antigen
and adjuvant dependent, and correlates with antibody responses. PloS one
2008;3(7):e2830.
[17] Kumar S, Yadava A, Keister DB, Tian JH, Ohl M, Perdue-Greenfield KA, et 520
al. Immunogenicity and in vivo efficacy of recombinant Plasmodium falciparum
merozoite surface protein-1 in Aotus monkeys. Molecular medicine (Cambridge,
Mass 1995 Mar;1(3):325-32.
[18] Singh S, Miura K, Zhou H, Muratova O, Keegan B, Miles A, et al. Immunity
to recombinant plasmodium falciparum merozoite surface protein 1 (MSP1): 525
protection in Aotus nancymai monkeys strongly correlates with anti-MSP1 antibody
Bargieri et al. 2009 Vaccine
24
titer and in vitro parasite-inhibitory activity. Infection and immunity 2006
Aug;74(8):4573-80.
[19] Darko CA, Angov E, Collins WE, Bergmann-Leitner ES, Girouard AS, Hitt
SL, et al. The clinical-grade 42-kilodalton fragment of merozoite surface protein 1 530
of Plasmodium falciparum strain FVO expressed in Escherichia coli protects Aotus
nancymai against challenge with homologous erythrocytic-stage parasites.
Infection and immunity 2005 Jan;73(1):287-97.
[20] Stowers AW, Chen Lh LH, Zhang Y, Kennedy MC, Zou L, Lambert L, et al.
A recombinant vaccine expressed in the milk of transgenic mice protects Aotus 535
monkeys from a lethal challenge with Plasmodium falciparum. Proceedings of the
National Academy of Sciences of the United States of America 2002 Jan
8;99(1):339-44.
[21] Janeway CA, Jr., Medzhitov R. Innate immune recognition. Annual review of
immunology 2002;20:197-216. 540
[22] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate
immunity. Cell 2006 Feb 24;124(4):783-801.
[23] Miao EA, Alpuche-Aranda CM, Dors M, Clark AE, Bader MW, Miller SI, et al.
Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1beta via
Ipaf. Nature immunology 2006 Jun;7(6):569-75. 545
Bargieri et al. 2009 Vaccine
25
[24] Smith KD, Andersen-Nissen E, Hayashi F, Strobe K, Bergman MA, Barrett
SL, et al. Toll-like receptor 5 recognizes a conserved site on flagellin required for
protofilament formation and bacterial motility. Nature immunology 2003
Dec;4(12):1247-53.
[25] Franchi L, Amer A, Body-Malapel M, Kanneganti TD, Ozoren N, Jagirdar R, 550
et al. Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin
1beta in salmonella-infected macrophages. Nature immunology 2006 Jun;7(6):576-
82.
[26] Lamkanfi M, Amer A, Kanneganti TD, Munoz-Planillo R, Chen G,
Vandenabeele P, et al. The Nod-like receptor family member Naip5/Birc1e restricts 555
Legionella pneumophila growth independently of caspase-1 activation. J Immunol
2007 Jun 15;178(12):8022-7.
[27] Zamboni DS, Kobayashi KS, Kohlsdorf T, Ogura Y, Long EM, Vance RE, et
al. The Birc1e cytosolic pattern-recognition receptor contributes to the detection
and control of Legionella pneumophila infection. Nature immunology 2006 560
Mar;7(3):318-25.
[28] Vinzing M, Eitel J, Lippmann J, Hocke AC, Zahlten J, Slevogt H, et al. NAIP
and Ipaf control Legionella pneumophila replication in human cells. J Immunol
2008 May 15;180(10):6808-15.
Bargieri et al. 2009 Vaccine
26
[29] Ren T, Zamboni DS, Roy CR, Dietrich WF, Vance RE. Flagellin-deficient 565
Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity.
PLoS pathogens 2006 Mar;2(3):e18.
[30] Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR, et al. The
innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.
Nature 2001 Apr 26;410(6832):1099-103. 570
[31] McDonald WF, Huleatt JW, Foellmer HG, Hewitt D, Tang J, Desai P, et al. A
West Nile virus recombinant protein vaccine that coactivates innate and adaptive
immunity. J Infect Dis 2007 Jun 1;195(11):1607-17.
[32] Ben-Yedidia T, Tarrab-Hazdai R, Schechtman D, Arnon R. Intranasal
administration of synthetic recombinant peptide-based vaccine protects mice from 575
infection by Schistosoma mansoni. Infection and immunity 1999 Sep;67(9):4360-6.
[33] Cuadros C, Lopez-Hernandez FJ, Dominguez AL, McClelland M, Lustgarten
J. Flagellin fusion proteins as adjuvants or vaccines induce specific immune
responses. Infection and immunity 2004 May;72(5):2810-6.
[34] Chauhan N, Kumar R, Badhai J, Preet A, Yadava PK. Immunogenicity of 580
cholera toxin B epitope inserted in Salmonella flagellin expressed on bacteria and
administered as DNA vaccine. Molecular and cellular biochemistry 2005
Aug;276(1-2):1-6.
Bargieri et al. 2009 Vaccine
27
[35] Huleatt JW, Jacobs AR, Tang J, Desai P, Kopp EB, Huang Y, et al.
Vaccination with recombinant fusion proteins incorporating Toll-like receptor 585
ligands induces rapid cellular and humoral immunity. Vaccine 2007 Jan
8;25(4):763-75.
[36] Huleatt JW, Nakaar V, Desai P, Huang Y, Hewitt D, Jacobs A, et al. Potent
immunogenicity and efficacy of a universal influenza vaccine candidate comprising
a recombinant fusion protein linking influenza M2e to the TLR5 ligand flagellin. 590
Vaccine 2008 Jan 10;26(2):201-14.
[37] Song L, Nakaar V, Kavita U, Price A, Huleatt J, Tang J, et al. Efficacious
recombinant influenza vaccines produced by high yield bacterial expression: a
solution to global pandemic and seasonal needs. PloS one 2008;3(5):e2257.
[38] Adar Y, Singer Y, Levi R, Tzehoval E, Perk S, Banet-Noach C, et al. A 595
universal epitope-based influenza vaccine and its efficacy against H5N1. Vaccine
2009 Mar 26;27(15):2099-107.
[39] Le Moigne V, Robreau G, Mahana W. Flagellin as a good carrier and potent
adjuvant for Th1 response: study of mice immune response to the p27 (Rv2108)
Mycobacterium tuberculosis antigen. Molecular immunology 2008 May;45(9):2499-600
507.
Bargieri et al. 2009 Vaccine
28
[40] Braga CJ, Rittner GM, Munoz Henao JE, Teixeira AF, Massis LM, Sbrogio-
Almeida ME, et al. Paracoccidioides brasiliensis vaccine formulations based on the
gp43-derived P10 sequence and the Salmonella enterica FliC flagellin. Infection
and immunity 2009 Apr;77(4):1700-7. 605
[41] Lee SE, Kim SY, Jeong BC, Kim YR, Bae SJ, Ahn OS, et al. A bacterial
flagellin, Vibrio vulnificus FlaB, has a strong mucosal adjuvant activity to induce
protective immunity. Infection and immunity 2006 Jan;74(1):694-702.
[42] Pino O, Martin M, Michalek SM. Cellular mechanisms of the adjuvant activity
of the flagellin component FljB of Salmonella enterica Serovar Typhimurium to 610
potentiate mucosal and systemic responses. Infection and immunity 2005
Oct;73(10):6763-70.
[43] Honko AN, Sriranganathan N, Lees CJ, Mizel SB. Flagellin is an effective
adjuvant for immunization against lethal respiratory challenge with Yersinia pestis.
Infection and immunity 2006 Feb;74(2):1113-20. 615
[44] Mizel SB, Graff AH, Sriranganathan N, Ervin S, Lees CJ, Lively MO, et al.
Flagellin-F1-V fusion protein is an effective plague vaccine in mice and two species
of nonhuman primates. Clin Vaccine Immunol 2009 Jan;16(1):21-8.
[45] Weimer ET, Lu H, Kock ND, Wozniak DJ, Mizel SB. A fusion protein vaccine
containing OprF epitope 8, OprI, and type A and B flagellins promotes enhanced 620
Bargieri et al. 2009 Vaccine
29
clearance of nonmucoid Pseudomonas aeruginosa. Infection and immunity 2009
Jun;77(6):2356-66.
[46] Bargieri DY, Rosa DS, Braga CJ, Carvalho BO, Costa FT, Espindola NM, et
al. New malaria vaccine candidates based on the Plasmodium vivax Merozoite
Surface Protein-1 and the TLR-5 agonist Salmonella Typhimurium FliC flagellin. 625
Vaccine 2008 Nov 11;26(48):6132-42.
[47] Cunha MG, Rodrigues MM, Soares IS. Comparison of the immunogenic
properties of recombinant proteins representing the Plasmodium vivax vaccine
candidate MSP1(19) expressed in distinct bacterial vectors. Vaccine 2001 Nov
12;20(3-4):385-96. 630
[48] Schmitt CK, Darnell SC, O'Brien AD. The attenuated phenotype of a
Salmonella typhimurium flgM mutant is related to expression of FliC flagellin.
Journal of bacteriology 1996 May;178(10):2911-5.
[49] Rodrigues MM, Ribeirao M, Pereira-Chioccola V, Renia L, Costa F.
Predominance of CD4 Th1 and CD8 Tc1 cells revealed by characterization of the 635
cellular immune response generated by immunization with a DNA vaccine
containing a Trypanosoma cruzi gene. Infection and immunity 1999
Aug;67(8):3855-63.
Bargieri et al. 2009 Vaccine
30
[50] Lekana Douki JB, Traore B, Costa FT, Fusai T, Pouvelle B, Sterkers Y, et al.
Sequestration of Plasmodium falciparum-infected erythrocytes to chondroitin 640
sulfate A, a receptor for maternal malaria: monoclonal antibodies against the native
parasite ligand reveal pan-reactive epitopes in placental isolates. Blood 2002 Aug
15;100(4):1478-83.
[51] di Santi SM, Boulos M, Vasconcelos MA, Oliveira S, Couto A, Rosario VE.
[Characterization of Plasmodium falciparum strains of the State of Rondonia, 645
Brazil, using microtests of sensitivity to antimalarials, enzyme typing and
monoclonal antibodies]. Revista do Instituto de Medicina Tropical de Sao Paulo
1987 May-Jun;29(3):142-7.
[52] Trager W, Jensen JB. Human malaria parasites in continuous culture.
Science (New York, NY 1976 Aug 20;193(4254):673-5. 650
[53] Ljungström I, Perlmann H, Schlichtherle M, Scherf A, Wahlgren M. Methods
in Malaria Research. 4th ed. Manassas, Virginia, USA: MR4/ATCC, 2004.
[54] Kulane A, Ekre HP, Perlmann P, Rombo L, Wahlgren M, Wahlin B. Effect of
different fractions of heparin on Plasmodium falciparum merozoite invasion of red
blood cells in vitro. The American journal of tropical medicine and hygiene 1992 655
May;46(5):589-94.
Bargieri et al. 2009 Vaccine
31
[55] O'Donnell RA, de Koning-Ward TF, Burt RA, Bockarie M, Reeder JC,
Cowman AF, et al. Antibodies against merozoite surface protein (MSP)-1(19) are a
major component of the invasion-inhibitory response in individuals immune to
malaria. The Journal of experimental medicine 2001 Jun 18;193(12):1403-12. 660
[56] Ogutu BR, Apollo OJ, McKinney D, Okoth W, Siangla J, Dubovsky F, et al.
Blood stage malaria vaccine eliciting high antigen-specific antibody concentrations
confers no protection to young children in Western Kenya. PloS one
2009;4(3):e4708.
[57] Guevara Patino JA, Holder AA, McBride JS, Blackman MJ. Antibodies that 665
inhibit malaria merozoite surface protein-1 processing and erythrocyte invasion are
blocked by naturally acquired human antibodies. The Journal of experimental
medicine 1997 Nov 17;186(10):1689-99.
[58] Holder AA. The carboxy-terminus of merozoite surface protein 1: structure,
specific antibodies and immunity to malaria. Parasitology 2009 Oct;136(12):1445-670
56.
[59] Reed ZH, Kieny MP, Engers H, Friede M, Chang S, Longacre S, et al.
Comparison of immunogenicity of five MSP1-based malaria vaccine candidate
antigens in rabbits. Vaccine 2009 Mar 4;27(10):1651-60.
Bargieri et al. 2009 Vaccine
32
[60] Bates JT, Uematsu S, Akira S, Mizel SB. Direct stimulation of tlr5+/+ 675
CD11c+ cells is necessary for the adjuvant activity of flagellin. J Immunol 2009 Jun
15;182(12):7539-47.
[61] Means TK, Hayashi F, Smith KD, Aderem A, Luster AD. The Toll-like
receptor 5 stimulus bacterial flagellin induces maturation and chemokine
production in human dendritic cells. J Immunol 2003 May 15;170(10):5165-75. 680
[62] Sanders CJ, Franchi L, Yarovinsky F, Uematsu S, Akira S, Nunez G, et al.
Induction of adaptive immunity by flagellin does not require robust activation of
innate immunity. European journal of immunology 2009 Feb;39(2):359-71.
[63] Vicente-Suarez I, Takahashi Y, Cheng F, Horna P, Wang HW, Wang HG, et
al. Identification of a novel negative role of flagellin in regulating IL-10 production. 685
European journal of immunology 2007 Nov;37(11):3164-75.
Bargieri et al. 2009 Vaccine
33
Figure legends
690
Figure 1: Generation and characterisation of recombinant P. falciparum MSP1
19
-
derived peptides. A. Schematic representation of the recombinant proteins used in
the present study. B. SDS-PAGE analysis of the recombinant proteins. Lanes: 1,
molecular weight markers; 2, purified His
6
MSP1
19
protein; 3, purified
S. Typhimurium FliC flagellin; 4, purified recombinant His
6
FliC-MSP1
19
protein. 695
Each lane was loaded with approximately 1 µg of protein, separated on a 15%
polyacrylamide gel and stained with Coomassie Blue. C. HuIL-8 secretion by
TLR5-transfected HEK 293 cells. Non-transfected HEK293 cells (white symbols)
and TLR5-transfected HEK293 cells (black symbols) were stimulated for 5 h with
different concentrations of native FliC, recombinant FliC (rFliC) or His
6
FliC-MSP1
19
700
antigens as indicated. The amount of secreted HuIL-8 in culture supernatant was
determined by capture ELISA. Data are representative of two experiments with
similar results.
Figure 2: Induction of total IgG responses to MSP1
19
and Ig subclass 705
determination in serum samples of mice immunised with the malarial recombinant
proteins. Female C57BL/6 mice were immunised three times, either with 5 µg of
the recombinant protein His
6
MSP1
19
alone or emulsified in CFA/IFA (1:1, v/v), or
with 25 µg of the recombinant fusion protein His
6
FliC-MSP1
19
alone or admixed
with the following adjuvant formulations: i) 10 µg of CpG ODN 1826 emulsified in 710
IFA (1:1, v/v), ii) 2.5 µg Quil-A, iii) CFA/IFA (1:1, v/v). A. MSP1
19
-specific total IgG
Bargieri et al. 2009 Vaccine
34
titres after the second and third doses. All mice immunised with His
6
MSP1
19
in
CFA/IFA or with His
6
FliC-MSP1
19
had higher IgG titres than the control groups (p <
0.01). B. IgG subclass responses and IgG1/IgG2c ratios in mice submitted to the
different immunisation regimens. 715
Figure 3: IFN-γ secretion by in vitro-cultured spleen cells harvested from
vaccinated mice. Splenocytes collected from different mouse groups immunised as
described in Fig. 2 were cultured in medium alone or in the presence of the
His
6
MSP1
19
protein (1 or 10 µg/ml) for 120 h. The IFN-γ concentration in the culture 720
supernatants was monitored by ELISA. Results are expressed as mean ± SD
(n=5).
Figure 4: MSP1
19
-specific antibodies generated in vaccinated mice recognise the
native protein expressed by P. falciparum 3D7 parasites. Glass slides containing 725
infected cells were incubated with pooled sera, diluted 1:100 in PBS, from mice
immunised as indicated. IIA were carried out with bound IgG stained with Alexa
Fluor 488. Parasite nuclei were stained with DAPI. Data are representative of two
experiments with similar results.
730
Figure 5: Rabbits immunised with His
6
FliC-MSP1
19
induced specific anti-MSP1
19
antibodies that recognise P. falciparum parasites. Two rabbits were immunised
with four, 200 µg doses of His
6
FliC-MSP1
19
, and one rabbit received four, 50 µg
doses of FliC. A. MSP1
19
-specific total IgG titres after each dose. The rabbits
Bargieri et al. 2009 Vaccine
35
immunised with His
6
FliC-MSP1
19
had higher IgG titres than the rabbit immunised 735
with FliC (p < 0.01). B. After four immunising doses, serum samples were tested in
liquid phase IIA with P. falciparum 3D7 parasites. Surface bound IgG was stained
with Alexa Fluor 568, while parasite nuclei were detected with DAPI.
Figure 6: Sera from rabbits immunised with His
6
FliC-MSP1
19
inhibited erythrocyte 740
invasion by P. falciparum 3D7, S20 and FCR3 strains. The parasites were cultured
in vitro in the presence of sera from rabbits at different dilutions (1:2, 1:5 or 1:10).
After 24-30 hours of incubation, parasitemia was determined in blood smears by
counting the number of rings in at least 500 erythrocytes. Results are shown as
mean ± SD of three cultures from each strain and serum sample dilution. 745
Erythrocyte invasion inhibition values were determined in relation to the control, a
parasite sample prepared with no added sera. Percentages of erythrocyte invasion
mediated by the different tested sera are shown only for the 1:2 serum dilution.
Histidine tag – 6 a.a.
FliC – 490 a.a.
MSP1
19
– 91 a.a.
His
6
MSP1
19
FliC
His
6
FliC-MSP1
19
A
50 -
30 -
160 -
15 -
1
KDa
2
10 -
3 4
75 -
35 -
B
Stimulus (µM)
10
-4
10
-3
10
-2
10
-1
10
0
10
1
10
2
Secreted IL-8 (ng/ml)
0
5
10
15
20
25
30
FliC
rFliC
His
6
FliC-MSP1
19
rFliC
His
6
FliC-MSP1
19
C
Figure 1
Bargieri et al. 2009 Vaccine
Antibody titer (log)
2
3
4
5
6
7
8
IgG1
IgG2b
IgG2c
Antigen
Adjuvant noneCFA/IFA
IFA +
CpG ODN
1826
Quil-A CFA/IFA
His
6
MSP1
19
His
6
FliC-MSP1
19
IgG1/IgG2c ratio
10 79 6.3 1 63
Antigen
Adjuvant none
none
none noneCFA/IFA
IFA +
CpG ODN
1826
Quil-A CFA/IFA
His
6
MSP1
19
His
6
FliC-MSP1
19
Antibody titer (log)
2
3
4
5
6
7
2
nd
dose
3
rd
dose
Antigen
Adjuvant none
none
none noneCFA/IFA
IFA +
CpG ODN
1826
Quil-A CFA/IFA
A
B
Figure 2
Bargieri et al. 2009 Vaccine
IFN-γ (ng/ml)
0
20
40
60
80
100
120
140
no stimulus
1 µg/ml His
6
PFMSP1
19
10 µg/ml His
6
PFMSP1
19
Adjuvant
Antigen
none none none
CFA/IFA
CFA/IFA
IFA +
CpG ODN
1826
Quil-A
none His
6
MSP1
19
His
6
FliC-MSP1
19
Figure 3
Bargieri et al. 2009 Vaccine
Naive
5 µ
µµ
µg His
6
MSP1
19
5 µ
µµ
µg His
6
MSP1
19
+ CFA/IFA
25 µ
µµ
µg His
6
FliC-MSP1
19
25 µ
µµ
µg His
6
FliC-MSP1
19
+ IFA + CpG
25 µ
µµ
µg His
6
FliC-MSP1
19
+ Quil-A
25 µ
µµ
µg His
6
FliC-MSP1
19
+ CFA/IFA
Phase DAPI Alexa 488
Figure 4
Bargieri et al. 2009 Vaccine
Figure 5
Days
0 21 42 63 84
Antibody titer (log)
2
3
4
5
6
7
50 µ
µµ
µg FliC
200 µ
µµ
µg His
6
FliC-PfMSP1
19
rabbit 1
200 µ
µµ
µg His
6
FliC-PfMSP1
19
rabbit 2
1
st
dose 3
rd
dose2
nd
dose 4
th
dose
A
B
Bargieri et al. 2009 Vaccine
200 µ
µµ
µg His
6
FliC-MSP1
19
50 µ
µµ
µg FliC
Phase DAPI Alexa 568
% parasitemia
0
2
4
6
8
1/10
1/5
1/2
% parasitemia
0
2
4
6
8
% parasitemia
0
2
4
6
8
3D7
S20
FCR3
2
0
8
9
8
5
2
1
87
79
1
1
8
9
66
no
sera
50 µg
FliC
200 µg
His
6
FliC-PfMSP1
19
# 1 # 2
Figure 6
Bargieri et al. 2009 Vaccine
109
CONSIDERAÇÕES FINAIS
110
A leitura desta tese levanta questões importantes relacionadas ao
desenvolvimento de uma vacina contra a malária. Há décadas foi descrito que a
transferência de imunoglobulinas purificadas do soro de indivíduos imunes
residentes de áreas endêmicas para pacientes infectados reduzia a parasitemia,
controlando o crescimento do parasita. Anos de estudos demonstraram que um
dos alvos dos anticorpos durante a infecção natural pelo parasita é a MSP1
19
.
Além da MSP1
19
, anticorpos para outros antígenos expressos nas formas
sanguíneas do Plasmodium também apresentam propriedades imunoprotetoras.
O conhecimento sobre estes antígenos levou à elaboração de várias
formulações vacinais capazes de induzir imunidade protetora em pequenos
roedores. Entretanto, ainda não se tem nenhuma formulação vacinal que
efetivamente reduza a incidência de malária no homem. Estudos feitos em
primatas não-humanos dão evidências de que o principal gargalo para o
desenvolvimento de uma vacina eficaz reside na disponibilidade de adjuvantes
fortes, capazes de induzir respostas imunológicas tão potentes quanto às
induzidas pelo CFA/IFA. Foi neste sentido que nós tentamos contribuir para o
desenvolvimento de uma vacina contra malária.
A identificação de novas vias para imunização com proteínas
recombinantes baseadas na MSP1
19
de P. vivax abre possibilidades de
formulações vacinais com novas alternativas de adjuvantes. Neste trabalho
propusemos a utilização das toxinas CT e LT em conjunto com um agonista de
TLR9 (CpG ODN 1826). Esta formulação vacinal levou a títulos de anticorpos
específicos tão altos quanto os induzidos na presença de CFA/IFA. Apesar destes
resultados interessantes no modelo animal de roedores, ainda precisamos
estender estas observações, primeiramente para primatas não-humanos e
finalmente para o homem.
Além do uso de novas vias de imunização, geramos proteínas
recombinantes baseadas na MSP1
19
com imunogenicidade aumentada pela fusão
com um agonista da imunidade inata, a flagelina FliC de Salmonella, utilizando-as
em conjunto com um agonista de TLR9 (CpG ODN 1826). Novamente, no modelo
experimental de roedores observamos a presença de títulos de anticorpos tão
111
altos quanto os alcançados com o uso dos adjuvantes CFA/IFA. Mas assim como
descrito acima, ainda precisamos estender estas observações para primatas não-
humanos e finalmente para o homem.
O desenho racional de uma vacina depende do conhecimento específico
de correlatos in vitro de proteção, mas no caso da malária os mecanismos exatos
que conferem proteção ainda são mais especulativos do que certos. A discussão
sobre quais propriedades biológicas dos anticorpos refletem melhor suas
propriedades in vivo levanta outras questões importantes. Apesar de ser um dos
principais alvos da resposta de anticorpos durante a infecção natural, sofrendo alta
pressão seletiva, a MSP1
19
é um dos antígenos mais conservados do parasita. A
recente identificação dos três tipos de anticorpos contra a MSP1
19
- inibidores,
bloqueadores e neutros - lançou alguma luz sobre esta questão. Aparentemente,
esta região da MSP1 evoluiu para apresentar epítopos para anticorpos
bloqueadores e neutros, que são ineficientes na inibição do crescimento do
parasita, representando um mecanismo de evasão de resposta por “confundir” o
sistema imunológico. Por outro lado, os anticorpos inibidores reconhecem
epítopos conformacionais determinados por regiões nos dois motivos do tipo EGF
da molécula. Como estes dois motivos são fundamentais para a função biológica
da MSP1
19
, a geração de sequências variantes viáveis é limitada. Por isso esta
molécula é tão conservada evolutivamente, apesar da alta resposta de anticorpos,
já que boa parte deles pode nem exercer pressão seletiva.
É evidente que seria mais eficiente uma formulação vacinal que induzisse
apenas anticorpos inibidores, mas não sabemos se isto é possível. Provavelmente
as formulações vacinais testadas nesta tese induzem anticorpos específicos
inibidores, bloqueadores e neutros. Talvez este seja o motivo de ser necessário
atingir títulos tão altos de anticorpos, de modo a elevar os títulos dos inibidores,
ainda que se induzam anticorpos de outros tipos também.
É nossa hipótese que uma formulação vacinal eficaz para a indução de
resposta imune protetora contra o P. vivax deverá conter várias regiões
imunodominantes de diversas formas do parasita. Esta estratégia visa aumentar
a intensidade da resposta imune e o número de alvos por parasita. Visa também
112
reduzir o impacto do polimorfismo genético e a possibilidade de seleção de
variantes antigênicos. Para tal, necessitaremos de diversos antígenos
expressos em diferentes formas do parasita e de determinar a combinação que
é mais eficiente para gerar uma imunidade forte e duradoura mediada por
anticorpos e linfócitos T. Neste sentido, nos últimos anos nós e outros grupos de
pesquisas temos nos dedicado à geração de proteínas recombinantes
representando regiões imunologicamente relevantes das formas sanguíneas de
Plasmodium. Nossos estudos complementarão outros estudos que já
desenvolvemos como parte do Instituto do Nacional de Tecnologia e
Desenvolvimento de Vacinas (INCTV), que financia o desenvolvimento de vários
recombinantes (proteínas e vírus) expressando antígenos da forma eritrocítica
de P. vivax [65, 95, 96, 101, 106, 109, 111, 119, 121, 216, 217].
As formulações vacinais contendo antígenos das formas eritrocíticas do
Plasmodium deverão ser então administradas juntamente com formulações que
contenham antígenos das formas pré-eritrocíticas do parasita da malária. Como
mencionado na introdução desta tese, no caso do P. falciparum já existe uma
formulação vacinal que contém um antígeno da forma pré-eritrocítica da
malária, a proteína CS, e que apresenta um efeito significativo na redução da
incidência da doença em “trials” clínicos de vacinação realizados na África . No
caso do P. vivax, somente agora começam a ser desenvolvidas proteínas
recombinantes contendo as sequências primárias da proteína CS. Neste
sentido, os adjuvantes e carreadores que nós descrevemos nestas tese
poderão também ser úteis.
Enfim, propomos novas alternativas de vacinação utilizando como modelo
a MSP1
19
, que deverão ser testadas no futuro em novos modelos experimentais,
como primatas não-humanos, e misturadas com outros antígenos
imunodominantes do P. vivax. Acreditamos que estas contribuições poderão ser
relevantes a médio e longo prazo para o desenvolvimento de uma vacina contra a
malária.
CONCLUSÕES
114
A partir dos trabalhos podemos concluir que:
1) As proteínas recombinantes His
6
PvMSP1
19
e His
6
PvMSP1
19
-PADRE
foram bastante imunogênicas quando administradas pela via de mucosa intranasal
na presença dos adjuvantes CT e LT em camundongos, induzindo títulos de
anticorpos tão altos quanto os obtidos em imunizações com o CFA/IFA.
2) A proteína recombinante de fusão His
6
FliC-PvMSP1
19
-PADRE manteve
as características adjuvantes da flagelina e antigênicas da PvMSP1
19
, e foi capaz
de induzir resposta imunológica humoral e celular específica contra o antígeno
quando injetada em camundongos sem a adição de nenhum outro adjuvante,
induzindo títulos de anticorpos tão altos quanto os obtidos em imunizações com o
CFA/IFA.
3) A proteína recombinante His
6
FliC-PfMSP1
19
manteve as características
adjuvantes da flagelina e foi capaz de estimular resposta humoral específica
contra o antígeno quando injetada em camundongos ou coelhos, induzindo títulos
de anticorpos tão altos quanto os obtidos em imunizações com o CFA/IFA, e
reposta celular específica em camundongos. Os anticorpos gerados pelas
imunizações dos modelos experimentais foram capazes de inibir o crescimento do
parasita in vitro.
115
ANEXOS
116
Anexo 1
Original article
Immunogenicity of a recombinant protein containing the
Plasmodium vivax vaccine candidate MSP1
19
and two
human CD4
þ
T-cell epitopes administered to
non-human primates (Callithrix jacchus jacchus)
Daniela S. Rosa
a
, Leo K. Iwai
b
, Fanny Tzelepis
a
, Daniel Y. Bargieri
a
,
Magda A. Medeiros
c
, Irene S. Soares
d
, John Sidney
e
, Alessandro Sette
e
, Jorge Kalil
b
,
Luiz Euge
ˆ
nio Mello
f
, Ede
´
cio Cunha-Neto
b
, Mauricio M. Rodrigues
a,
*
a
CINTERGEN, Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de S
~
ao Paulo-Escola Paulista de Medicina,
Rua Botucatu 862, 6th floor, S
~
ao Paulo, SP 04023-062, Brazil
b
Laborato´rio de Imunologia, Instituto do corac¸
~
ao (Incor), Faculdade de Medicina da Universidade de S
~
ao Paulo, Av. Dr. Ene´as de Carvalho Aguiar,
44-Bloco II-9th floor, S~ao Paulo, SP 05403-000, Brazil
c
Departamento de Cieˆncias Fisiolo´gicas, Universidade Federal Rural do Rio de Janeiro, BR 464, km 7, Serope´dica, RJ 23890-000, Brazil
d
Departamento de Ana´lises Clı´nicas e Toxicolo´gicas, Faculdade de Cieˆncias Farmaceˆuticas, Universidade de S
~
ao Paulo, Av. Prof. Lineu Prestes,
580, Bloco 17, S
~
ao Paulo, SP 05508-900, Brazil
e
La Jolla Institute for Allergy and Immunology, San Diego, CA 92121, USA
f
Departamento de Fisiologia, Universidade Federal de S
~
ao Paulo-Escola Paulista de Medicina, Rua Botucatu 862, 5th floor,
S
~
ao Paulo, SP 04023-062, Brazil
Received 10 January 2006; accepted 30 March 2006
Available online 2 June 2006
Abstract
One of the most promising vaccine candidates against the erythrocytic forms of malaria is the 19 kDa C-terminal region of the merozoite
surface protein 1 (MSP1
19
). As part of our studies aimed at the development of a Plasmodium vivax malaria vaccine, we characterized the im-
munogenic properties of a new bacterial recombinant protein containing the P. vivax MSP1
19
and two helper T-cell epitopes, the synthetic uni-
versal pan allelic DR epitope (PADRE) and a new internal MSP1 P. vivax epitope (DYDVVYLKPLAGMYK). We found that the recognition of
His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE was as good as the recognition of His
6
MSP1
19
indicating that the presence of the T-cell epitopes
PADRE and DYDVVYLKPLAGMYK did not modify the MSP1
19
epitopes recognized by human IgG. The recombinant protein His
6
MSP1
19
-
DYDVVYLKPLAGMYK-PADRE proved to be highly immunogenic in marmosets (Callithrix jacchus jacchus) when administered in incom-
plete Freund’s adjuvant. However, when administered in other adjuvant formulations such as Quil A, CpG ODN 2006 or MPL/TDM, antibody
titers to MSP1
19
were significantly lower. Among these three adjuvants, Quil A proved to be the most efficient one generating antibody titers
significantly higher than the others. These results indicated that under the circumstances evaluated, adjuvants were key for the immunogenicity
of the recombinant protein His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE.
Ó 2006 Elsevier SAS. All rights reserved.
Keywords: Plasmodium vivax; Recombinant vaccines; Adjuvants
Abbreviations: CFA, complete Freund’s adjuvant; CpG, immunostimulatory CpG motifs; EGF, epidermal growth factor; GST, glutathione S-transferase;
His
6
MSP1
19
, MSP1
19
containing a hexa-histidine tag; IFA, incomplete Freund’s adjuvant; MPL/TDM, mono phosphoryl lipid Aþ trehalose dicorynomycolate;
MSP1, merozoite surface protein-1; MSP1
19
, 19 kDa C-terminal region of the MSP1; ODN, oligodeoxynucleotide; PADRE, pan allelic DR epitope; TLR, Toll
like receptor.
* Corresponding author. Tel./fax: þ55 (11) 5571 1095.
E-mail address: mrodrigues@ecb.epm.br (M.M. Rodrigues).
1286-4579/$ - see front matter Ó 2006 Elsevier SAS. All rights reserved.
doi:10.1016/j.micinf.2006.03.012
Microbes and Infection 8 (2006) 2130e2137
www.elsevier.com/locate/micinf
1. Introduction
Plasmodium vivax causes more than 40 million cases of
malaria every year and an effective vaccine is urgently needed
[1]. One of the most promising vaccine candidates against the
erythrocytic forms of malaria is the merozoite surface protein
1 (MSP1). During the invasion process, a proteolytic cleavage
step releases most of the molecule from the merozoite mem-
brane and only a 19 kDa glycosylphosphatidylinositol an-
chored fragment of the C-terminus (MSP1
19
) is carried into
the invaded red blood cells [2]. Although the precise biological
function of MSP1
19
is unknown at present, reverse genetic ex-
periments using Pl asmodium falciparum provided evidence
that MSP1
19
is important for parasite survival [3].
Antibodies that recognize MSP1
19
are potent inhibitors of
merozoite invasion in vitro, and confer passive immunity
against rodent malaria infection [4,5]. However, most relevant
for the development of a vaccine against malaria is the fact
that active immunization with recombinant proteins based on
the sequence of MSP1
19
can provide remarkable protective
immunity against experimental infection with blood stages
of distinct species of Plasmodium [6e8].
As part of our studies aimed at the development of a Plas-
modium vivax malaria vaccine, we are characterizing the im-
munogenic properties of several recombinant proteins
containing the P. vivax MSP1
19
[9e14]. Bacterial recombinant
proteins expressed in the pET vector (His
6
MSP1
19
) retained
native epitopes being recognized by antibodies of 93.5% of
Brazilian individuals exposed to P. vivax malaria [13]. The ad-
dition of a synthetic universal T-cell epitope denominated Pan
Allelic DR epitope (PADRE) did not modify the MSP1
19
epi-
topes recognized by human naturally acquired IgG [11,13] and
improved the performance of several adjuvant formulations
when the antigen was administered to a mouse strain, such
as C57BL/6, which develops PADRE-specific helper CD4
T cells [14].
In the present study, we generated a new bacterial recombi-
nant protein in which we added a new parasite derived putative
promiscuous MSP1 internal helper T-cell epitope to the pro-
tein His
6
MSP1
19
-PADRE, with the rationale of increasing
cognate help. Our assumption is that a cognate help may im-
prove a human vaccine performance as previously demon-
strated in the mouse model of blood stage infection [15].
The immunogenic properties of this new recombinant protein
denominated His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE
were evaluated by its ability to be recognized by serum IgG
antibodies from individuals with patent malarial infection
and upon immunization of non-human primates in the pres-
ence of different adjuvant formulations.
2. Materials and methods
2.1. Mapping of a T-cell epitope on the 33 kDa region
of P. vivax MSP1
The amino acid sequence of the 33 kDa region of the C-ter-
minal of P. vivax MSP1 was scanned by TEPITOPE algorithm
that can predict epitopes that have a potential ability to bind to
one or more of 25 different HLA-DR molecules, by using 25
virtual matrices that cover most of the HLA class II peptide
binding specificities in the Caucasian population [16,17].
The algorithm provides a scoredthe algebraic sum of the ma-
trix values for each peptide positiondto each of the 9-mer
windows along the scanned sequence. Nonamers attaining
a score above the 3% threshold for a given HLA-DR molecule
(a 3% threshold selects sequences with HLA-binding scores
equal to or higher than those of the 3% sequences with highest
scores in the TEPITOPE database) are selected by the soft-
ware. The algorithm also allows the selection of sequences
predicted to bind simultaneouslydthus, promiscuouslydto
several HLA-DR molecules. The sequence within MSP1,
DYDVVYLKPLAGMYK, predicted to bind to 24 out of the
25 HLA-DR molecules available at TEPITOPE (with the ex-
ception of HLA-DR7) of HLA-DR molecules at the 3%
threshold was selected.
2.2. Synthetic peptide and binding assay to human
HLA DR molecules
We synthesized the peptide DYDVVYLKPLAGMYK cor-
responding to an inner nonamer core selected by TEPITOPE
as the multiple HLA-binding motif, with three flanking amino
acids added at both N- and C-terminal ends, to increase the ef-
ficiency of in vitro peptide presentation to CD4
þ
T cells, using
solid phase technology with the 9-fluorenylmethoxycarbonyl
(Fmoc) strategy [18] on an automated benchtop simultaneous
multiple solid-phase peptide synthesizer PSSM8 (Shimadzu,
Tokyo, Japan) with Fmoc protected amino acid residues and
TGR resin (Novabiochem, San Diego, USA). Therefore, the
peptide was obtained with the C-terminal carboxyl group in
amide form. Peptide quality was assessed by Maldi-Tof
mass spectometry on a TofSpec-E instrument (Micromass,
UK) using a-cyano-4 hydroxy cinnamic acid as the matrix,
and its purity was assessed as 90%.
Peptide-binding affinity to purified HLA-DR molecules
was determined as described previously [19]. The nanomolar
concentration of unlabeled peptide necessary for 50% inhibi-
tion of the labeled peptide to the purified HLA-DR molecules
(IC50) was used as an approximation of the affinity of interac-
tion (K
D
). The values reported are IC50 nM values.
2.3. Recombinant proteins containing P. vivax MSP1
19
The recombinant proteins were obtained exactly as de-
scribed in reference [12]. We inserted the oligonucleotides
containing the sequence encoding the 15 amino acids DYDV-
VYLKPLAGMYK and the nucleotides to ligate to the two
BamHI site as described for the insertion of the PADRE
[12]. This plasmid was used to express the recombinant pro-
teins denominated His
6
MSP1
19
-DYDVVYLKPLAGMYK
His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE. The recom-
binant proteins that we used in the present study are listed
in Table 1. The expression and purification of the recombinant
proteins produced by E. coli transformed with the pET or
2131D.S. Rosa et al. / Microbes and Infection 8 (2006) 2130e2137
pGEX vectors were performed exactly as described [12]. Pu-
rified proteins were analyzed by SDS-PAGE and stained
with Coomassie blue or silver nitrate.
2.4. Immunization of mice with the recombinant proteins
Six to eight week old female C57BL/10.A (H-2
a
) mice
were purchased from Universidade Federal de S
~
ao Paulo-
Escola Paulista de Medicina. Groups of six mice were immu-
nized twice, 4 weeks apart, with 10 mg of recombinant protein
in the presence of the indicated adjuvant formulations. Mice
were injected subcutaneously (s.c.) in the two hind footpads
with the recombinant antigen emulsified or mixed with adju-
vant. A volume of 50 ml was injected into each hind footpad.
Four weeks later, each animal received a booster injection of
the same antigen s.c. at the base of the tail. For these immuni-
zations, 10 mg of the indicated recombinant proteins were di-
luted in PBS and emulsified in complete or incomplete
Freund’s adjuvant (CFA/IFA, 0.05 ml/dose per animal,
Sigma). Control mice received only the diluent PBS and the
indicated adjuvant. Mice were bled at 4 weeks after the first
or second antigen dose through the tail vein and individual se-
rum samples were stored at À20
C until used.
2.5. Immunization of non-human primates
with the recombinant prote in
His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE
A total of 24 adult (male and female) marmosets (Callithrix
jacchus jacchus) weighting between 210 and 400 g were se-
lected and randomized into eight groups. According to Brazil-
ian law on animal experimentation, the protocol of this study
was reviewed and approved by the institute’s animal care and
ethical committee. Animals were under the supervision of a vet-
erinarian specialized in primatology. Each group contained two
males and one female. Two groups received adjuvant only: (i)
Quil A (250 mg/animal per dose), (ii) a mixture of Quil A
(250 mg/animal per dose) and monophosphoryl lipid Aþ treha-
lose dicorynomycolate (MPL/TDM, 0.3 ml/animal per dose,
Sigma). The other six groups received 100 mg of the antigen
His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE in the follow-
ing adjuvants: (i) IFA (0.3 ml/animal per dose), (ii) Quil A
(250 mg/animal per dose), (iii) CpG ODN 2006 (500 mg/animal
per dose, TCGTCGTTTTGTCGTTTTGTCGTT, Coley
Pharmaceuticals), (iv) MPL/TDM (0.3 ml/animal per dose),
(v) Quil Aþ CpG ODN 2006, (v) Quil Aþ MPL/TDM.
A total dose of 0.6 ml of antigen/adjuvant formulation was
injected subcutaneously. This volume was divided into four in-
jections of 0.15 ml: two in the inguinal and two in the axillary
region. The marmosets were immunized a total of four times,
at weeks 0, 6, 12 and 18. After anesthesia with ketamin
(10e20 mg/kg), blood samples were collected from the femo-
ral vein at the indicated days just before each immunization.
During the experiment all animals were observed by trained
personnel for the local reactogenicity of each formulation. We
examined the injection sites for skin warmth, skin erythema,
skin edema, muscle induration, ulceration, abscess or other ab-
normalities at days 1, 2 and 3 post injection. Systemic toxicity,
fever and weight loss were also evaluated on these same days.
2.6. Immunologi cal assays
The detection of human or mouse IgG antibodies against
MSP1
19
was performed by ELISA as described [9e14]. Anti-
bodies to MSP1
19
in monkey sera were detected by ELISA us-
ing goat anti-monkey IgG (Sigma) diluted 1:2000. Each serum
was analyzed in serial dilutions from 1:100 up to 1:1,638,400.
The individual titers were considered as the highest dilution of
serum that presented an OD
492
higher than 0.1. The results are
presented as the mean of log antibody titers Æ SD of six mice
or three marmosets per group.
2.7. Statistical analysis
One-way ANOVA and Tukey’s honestly significantly dif-
ferent (HSD) tests were used to compare the possible differ-
ences between the mean values of the different groups.
3. Results
3.1. Expression and purification of recombinant proteins
His
6
MSP1
19
-DYDVVYLKPLAGMYK and
His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE
With the aim of boosting cognate help, we used the TEPI-
TOPE algorithm to select a peptide sequence in the 33 kDa C-
terminal region of P. vivax MSP1 that would most likely bind
to multiple HLA-DR molecules. The amino acid sequence
DYDVVYLKPLAGMYK was predicted to be the most pro-
miscuous HLA-DR ligand in the 33 kDa region of the P. vivax
MSP1. Synthesis of the corresponding peptide and direct
binding assays with the eight most prevalent HLA-DR mole-
cules in the general population showed that the peptide
DYDVVYLKPLAGMYK bound to HLA-DRB1*0101,
DRB1*1101, DRB1*0501, and DRB5*0101 (Table 2).
This epitope was then added to either His
6
MSP1
19
or
to His
6
MSP1
19
-PADRE generating the proteins denominated
His
6
MSP1
19
-DYDVVYLKPLAGMYK or His
6
MSP1
19
-
DYDVVYLKPLAGMYK-PADRE, respectively (Table 1).
Recombinant proteins were expressed in large amounts and
purified from E. coli in aqueous buffer in the absence of
Table 1
Recombinant proteins used
Designation Protein expressed
His
6
-MSP1
19
MSP1
19
GST-MSP1
19
a
GST-MSP1
19
His
6
-MSP1
19
-PADRE MSP1
19
þ PADRE
b
His
6
MSP1
19
-
DYDVVYLKPLAGMYK
MSP1
19
þ DYDVVYLKPLAGMYK
epitope
His
6
MSP1
19
-
DYDVVYLKPLAGMYK-PADRE
MSP1
19
þ DYDVVYLKPLAGMYK
epitope
b
þ PADRE
a
Amino acids 1616e1704 of P. vivax MSP1
19
(Bele
´
m strain).
b
PADRE epitope is composed of amino acids AKFVAAWTLKAAA.
2132 D.S. Rosa et al. / Microbes and Infection 8 (2006) 2130e2137
detergents. Fig. 1 shows the migration pattern of the purified
proteins in SDS-PAGE performed under reducing or non re-
ducing conditions.
3.2. T-cell helper activity in mice induced by the epitope
DYDVVYLKPLAGMYK
To test whether the epitope DYDVVYLKPLAGMYK could
in fact be recognized by mouse T cells, we immunized differ-
ent inbred mice (BALB/c, C57BL/6 and C57BL/10.A) with
the synthetic peptide containing the amino acids DYDV-
VYLKPLAGMYK. We found that only C57BL/10.A (H-2
a
)
mice presented specific T-cell proliferative response in vitro
to this synthetic peptide (data not shown).
Based on this result, we immunized C57BL/10.A mice with
the recombinant proteins His
6
MSP1
19
or His
6
MSP1
19
-DYDV-
VYLKPLAGMYK in the presence of different adjuvant formu-
lations. We also used the recombinant protein GST-MSP1
19
as
a positive control. As shown in Table 3, after the first immuniz-
ing dose in the presence of CFA, the antibody titers to the epitope
His
6
MSP1
19
of C57BL/10.A mice immunized with
His
6
MSP1
19
-DYDVVYLKPLAGMYK was 56.23-fold higher
than animals immunized with the antigen His
6
MSP1
19
(P < 0.01). After the second immunizing dose in the presence
of IFA, the titers of mice immunized with His
6
MSP1
19
-DYDV-
VYLKPLAGMYK were still 5.33-fold higher than mice in-
jected with His
6
MSP1
19
(P < 0.01).
A similar improvement of the antibody immune response
was observed in C57BL/10.A mice immunized with
His
6
MSP1
19
-DYDVVYLKPLAGMYK in the presence of
IFA. After the second immunizing dose, antibody titers of
mice immunized with His
6
MSP1
19
-DYDVVYLKPLAGMYK
were 6.76-fold higher than the titers of mice injected with
His
6
MSP1
19
(P < 0.01). Together, these results indicated
that the epitope DYDVVYLKPLAGMYK can function as
a helper T-cell epitope.
3.3. Comparative evaluation of the reactivity of the
different recombinant proteins with serum samples from
individuals with patent P. vivax infection
The recognition of the recombinant proteins His
6
MSP1
19
,
His
6
MSP1
19
-DYDVVYLKPLAGMYK and His
6
MSP1
19
-
DYDVVYLKPLAGMYK-PADRE by a mAb 3F8.A2 specific
for MSP1
19
was estimated first. This mAb recognizes a confor-
mation-dependent epitope [11]. As shown in Fig. 2A, the dif-
ferent recombinant proteins were equally well recognized by
the anti-MSP1
19
MAb.
The comparative analysis of the reactivity of the recombi-
nant proteins with sera from 50 individuals naturally exposed
Table 2
Binding values of the peptide DYDVVYLKPLAGMYK to different HLA DR
molecules
HLA-DR molecule IC50 nM values
DR1 (DRB1*0101) 0.73
a
DR5 (DRB1*1101) 376
a
DR2w2 B1(DRB1*0501) 793
a
DR2w2 B2 (DRB5*0101) 0.080
a
DR4w4 (DR401) 1636
DR4w15 (DR405) 2053
DR6w19 (DRB1*1302) 5849
DR7 (DRB1*0701) 7294
a
IC50 binding values lower than 1000 are significant.
MW
kDa
97-
45
6
66-
45-
30-
20-
14-
MW
kDa
123
97-
66-
45-
30-
20-
14-
Fig. 1. SDS-PAGE analysis of recombinant proteins of P. vivax MSP1
19
puri-
fied from E. coli. Proteins were submitted to 12.5% SDS-PAGE under reduc-
ing (left panel) or non-reducing (right panel) conditions and stained with silver
nitrate. Lanes are: 1 and 4, mol. weight standards; 2 and 5, His
6
MSP1
19
-
DYDVVYLKPLAGMYK; 3 and 6, His
6
MSP1
19
-DYDVVYLKPLAGMYK-
PADRE.
Table 3
Antibody titers of C57BL/10.A mice immunized with the recombinant pro-
teins in different adjuvant formulations
Recombinant antigen
a
Adjuvant Antibody titers
after the first
dose (log)
Antibody titers
after the second
dose (log)
e CFA/IFA <2.0
b
<2.0
b
His
6
MSP1
19
CFA/IFA 3.81 Æ 0.85
b
4.90 Æ 0.15
b
His
6
MSP1
19
-
DYDVVYLKPLAGMYK
CFA/IFA 5.56 Æ 0.35
b
5.61 Æ 0.60
b
GST- MSP1
19
CFA/IFA 5.24 Æ 0.38
b
5.16 Æ 0.39
b
His
6
MSP1
19
IFA 3.80 Æ 0.42
c
4.55 Æ 0.21
c
His
6
MSP1
19
-
DYDVVYLKPLAGMYK
IFA 4.40 Æ 0.24
c
5.38 Æ 0.15
c
GST-MSP1
19
IFA 4.17 Æ 0.15
c
4.63 Æ 0.29
c
a
C57BL/10.A mice were immunized as described in Section 2. Results are
expressed as the mean of six mice Æ SD of log antibody titers detected
4 weeks after the first or second immunizing dose.
b
The results obtained for the different groups were compared statistically
using one-way ANOVA followed by the Tukey HSD test. After the first or sec-
ond dose, the antibody titers of mice immunized with His
6
MSP1
19
were lower
than the mouse group injected with His
6
MSP1
19
-DYDVVYLKPLAGMYK or
GST-MSP1
19
(P < 0.01 in both cases). Mice immunized with adjuvant only
had significantly lower antibody titers than mice immunized with the different
recombinant proteins (P < 0.01 in all cases).
c
After the first dose, antibody titers of mice immunized with the different
recombinant proteins in IFA were not different from each other. After the
second dose, antibody titers of mice immunized with His
6
MSP1
19
DYDV-
VYLKPLAGMYK were higher than those immunized with His
6
MSP1
19
or
GST- MSP1
19
(P < 0.01 and P < 0.05 respectively).
2133D.S. Rosa et al. / Microbes and Infection 8 (2006) 2130e2137
to P. vivax malaria is shown in Fig. 2B and C. Each panel pres-
ents a comparison of the reactivity of pairs of proteins with 50
individual serum samples. We observed that a high determina-
tion coefficient (r
2
) was obtained when we compared the re-
activity of human antibodies to recombinant proteins
(r
2
¼ 0.987), indicating that the epitopes recognized in these
proteins are very similar.
3.4. Antibody immune response of non-human primates
immunized with His
6
MSP1
19
-DYDVVYLKPLAGMYK
PADRE in different adjuvant formulations
No adverse post-immunization systemic effects such as loss
of weight, fever, skin erythema, skin warmth or abscesses
were observed in any groups, with the exception of marmosets
immunized with IFA. These animals presented ulcerative ab-
scesses 2e3 days after the first dose, and were treated with
a powder consisting of bacitracin, neomycin and zinc oxide.
After treatment, the lesions resolved.
Fig. 3 summarizes the kinetics of the anti-MSP1
19
IgG an-
tibody response induced following a series of immunizations
with the His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE in
different adjuvant formulations. Serum samples from pre-
immunized animals showed negligible antibody titers to
His
6
-MSP1
19
as estimated by ELISA. Also, animals immu-
nized with adjuvant alone (Quil A or Quil A plus CpG ODN
2006) failed to seroconvert during the entire experiment.
Six weeks after the first immunization, all animals that re-
ceived the antigen in each of the different adjuvant formula-
tions sero-converted. The three animals that received the
antigen in IFA presented high antibody titers after a single im-
munizing dose. A second immunization with this formulation
increased only modestly the antibody titers. However, 6 weeks
after the third dose, the antibody titers reached their highest
value 6.45-fold higher than the titers observed after the second
dose. A subsequent dose did not improve these titers.
In spite of the promising results obtained when we used the
His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE in IFA, anti-
body titers observed in the presence of other adjuvant formu-
lations were lower. Animals administered with the antigen in
the presence of Quil A (either alone or in combination with
CpG ODN 2006 or MPL/TDM) presented the peak antibody
response at 6 weeks after the fourth dose. The mean antibody
titers of each group ranged from 4.40 to 4.70. These titers were
O.D (492nm)
0
1
2
3
4
A
BC
4.000
8.000
16.000
32.000
64.000
128.000
256.000
512.000
GST
MSP1
19
MSP1
19
-DYDVVYLKPLAGMYK
MSP1
19
-DYDVVYLKPLAGMYK-PADRE
Mab dilution
His
6
-MSP1
19
His
6
-MSP1
19
0.0 0.5 1.0 1.5 2.0
0.0 0.5 1.0 1.5 2.0
His
6
-MSP1
19
-DYDVVYLKPLAGMYK
0.0
0.5
1.0
1.5
2.0
0.0
0.5
1.0
1.5
2.0
r ²=0.987
His
6
-MSP1
19
-
DYDVVYLKPLAGMYK-PADRE
r ²=0.987
Fig. 2. Comparison of the reactivity of the recombinant proteins of MSP1
19
with 50 sera from individuals with patent malaria infection caused by P. vivax. (A) Each
line represents antibody titration curves using an anti-MSP1
19
MAb. Results are expressed as the average OD
492
of each dilution tested in duplicate. (B) and (C)
Reactivity of serum samples against the indicated recombinant proteins. Most of the serum samples were tested at a final dilution of 1:1600, except those with very
high titers which were diluted to such a concentration that their OD
492
was between 1.0 and 2.0. Symbols represent the average OD
492
of each serum sample tested
in duplicate. The values of the determination coefficient (r
2
) are shown in each panel.
2134 D.S. Rosa et al. / Microbes and Infection 8 (2006) 2130e2137
5.12 or 2.57-fold lower than the titers of marmosets immu-
nized with the antigen in IFA.
Marmosets immunized with the antigen in CpG ODN 2006
or in MPL/TDM presented at 6 weeks after the fourth dose,
antibodies titers varying from 3.20 to 3.40. These titers were
80.51- or 51.30-fold lower than the titers of marmosets immu-
nized with the antigen in IFA.
4. Discussion
To develop an effective recombinant P. vivax vaccine can-
didate to be administered to humans, we need a formulation
containing a recombinant protein that can elicit high titers of
antibodies specific for the MSP1
19
epitope in individuals
with different class II HLA haplotypes. For this purpose, in
earlier studies, we generated a bacterial recombinant protein
containing the P. vivax MSP1
19
epitope linked to a synthetic
universal epitope (PADRE) [12e14]. Because PADRE is an
artificial epitope, it should not induce parasite-specific mem-
ory T cells that can be boosted during infection. This fact
may represent a problem for the vaccine efficacy. To circum-
vent this problem, we identified a putative human promiscuous
T cell epitope present in the 33 kDa C-terminal region of
P. vivax MSP1 (DYDVVYLKPLAGMYK). Direct binding as-
says showed that this peptide binds to HLA-DRB1*0101,
DRB1*1101, DRB1*0501, and DRB5*0101. These four
HLA-DR haplotypes will cover approximately 60% of the
general population in Brazil (E. Cunha-Neto and J. Kalil, un-
published results).
The helper activity of this epitope was further confirmed in
experiments where we showed increased immunogenicity in
mice of recombinant proteins containing His
6
MSP1
19
linked
to the epitope DYDVVYLKPLAGMYK. In addition to its
helper activity, it is important to mention that the epitope
DYDVVYLKPLAGMYK is highly conserved among all
strains of P. vivax sequenced so far [20,21]. In an earlier study,
Caro-Aguilar et al. [22] searched for HLA-DR binding epitopes
using a panel of 86 peptides based on the P. vivax MSP1, and
failed to detect DYDVVYLKPLAGMYK as a putative T cell
epitope. The most likely explanation for this discrepancy relies
on the fact that the sequence DYDVVYLKPLAGMYK was
split between his peptides #67 and #68 [22].
From the comparative analysis of the recognition of the
three recombinant proteins (Fig. 2) by a panel of sera collected
from individuals naturally exposed to malaria, we concluded
that these of proteins shared most epitopes and that the addi-
tion of the T-cell helper epitope(s) did not modify the recogni-
tion of His
6
MSP1
19
by human antibodies.
Subsequently, we used the antigen His
6
MSP1
19
-DYDV
VYLKPLAGMYK-PADRE in pre-clinical immunological
studies in non-human primates. To this end, we used the com-
mon marmoset (Callithrix jacchus), a small New World mon-
key. These animals are extremely abundant in Brazil (South
America), easily bred and maintained in captivity. To these
general features, we can add the outbred nature of these ani-
mals, immunological similarity with human beings and the
best characterized New World monkey Mhc system [23,24].
Based on that, we believe this lower primate could provide
an acceptable and less expensive alternative for pre-clinical
immunological experiments considering that extensive studies
will be required for the evaluation of the immunogenicity of
recombinant vaccines.
Although these monkeys can be a useful model for pre-clin-
ical immunizations, there might be a limitation for their use
for malaria challenges. In earlier studies, malarial infections
of Callithrix penicillata with P. falciparum were rarely
achieved [25]. We plan to evaluate in the future whether
Callithrix jacchus is also refractory to infection with P. vivax
blood stages.
Using the common marmoset as a model, we tested safety
and immunogenicity of His
6
MSP1
19
-DYDVVYLKPLAG
MYK-PADRE in the presence of different adjuvants. No ad-
verse post-immunization systemic or local effects were
observed in any monkey that received the antigen in the adju-
vants Quil A, CpG ODN 2006 or MPL/TDM. In contrast, all
three monkeys immunized with IFA suffered local abscesses.
Overall, these results indicated that the administration of
His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE was safe when
administered in adjuvants other than IFA.
Weeks
012182430
Log antibody titers
2
3
4
5
6
Rec. Protein + QuilA
Rec. Protein + CpG ODN 2006
Rec. Protein + MPL/TDM
Rec. Protein + QuilA + CpG ODN 2006
Rec. Protein + QuilA + MPL/TDM
Rec. Protein + IFA
Saline + QuilA
Saline + QuilA + MPL/TDM
1
st
2
nd
3
rd
4
th
Immunizing dose
Recombinant protein = His
6
MSP1
19
-DYDVVYLKPLAGMYK-PADRE
6
Fig. 3. Kinetics of the anti-MSP1
19
IgG antibody response induced following
a series of immunizations with the recombinant protein His
6
MSP1
19
-DYDV
VYLKPLAGMYK-PADRE in different adjuvant formulations. Groups of
three monkeys (C. jacchus jacchus) were immunized s.c. with 100 mgof
the recombinant protein emulsified in different adjuvant formulations. The
antibody titers were determined by ELISA before each immunizing dose.
Results are presented in log as the mean Æ SD. The results obtained for
the different groups were compared statistically using one-way ANOVA fol-
lowed by the Tukey HSD test. The results are presented in supplementary
Tables 1e3.
2135D.S. Rosa et al. / Microbes and Infection 8 (2006) 2130e2137
In animals vaccinated with His
6
MSP1
19
-DYDVVYLK-
PLAGMYK-PADRE emulsified in IFA, antibody titers were
very high demonstrating that this recombinant protein can be
highly immunogenic. IFA is used as a water-in-oil emulsion
that is based on mineral oil and the surfactant mannide mono-
oleate. This adjuvant was initially tested in human trials in
1950. Its use was stopped after vaccine trials because it caused
severe local reactions in a number of vaccinated individuals.
Its mode of action is still unclear, however its potency is cer-
tain (reviewed in ref. [26]).
Two of the adjuvants that we used are described as TLR ac-
tivators. The MPL or CpG ODN 2006 activates TLR-4 or
TLR-9, respectively [27]. Unfortunately, these adjuvants failed
to perform at the level of the QuilA or the IFA when used in-
dividually. Also, when added to the QuilA, they did not im-
prove its adjuvant activity (Fig. 3).
QuilA, a saponin derived from the bark of Chilean tree,
Quillaja saponaria, is still being studied on its mechanisms
of adjuvanticity [28]. In our trial, it performed better than
MPL or CpG ODN 2006 but still provided lower antibody ti-
ters than IFA.
The reason for such difference in the antibody titers
among the animals injected with the distinct adjuvants is
not clear. In BALB/c mice, we described similar findings.
Administration of His
6
MSP1
19
-PADRE in CFA/IFA elicited
higher antibody titers than the antigen in CpG ODN, MPL/
TDM or Quil A [26]. On the other hand, in C57BL/6 mice,
the immunogenicity of His
6
MSP1
19
-PADRE administered in
CpG ODN, MPL/TDM or Quil A was similar to that obtained
in CFA/IFA. The improvement was likely due to the fact that
this mouse strain developed T cells specific to PADRE epi-
tope [14]. We concluded that the presence of strong T helper
epitopes such as PADRE improved the performance of
weaker adjuvant such as CpG ODN, MPL/TDM or Quil A.
Based on the mouse studies, we may speculate that the differ-
ences in the antibody titers observed in monkeys immunized
with the distinct adjuvants could be due to the lack of a strong
T cell epitope.
In spite of the fact that the antibody titers obtained with the
adjuvant QuilA were not as high as IFA, we considered that
our vaccination trials provided important information. Firstly,
we established that the recombinant protein His
6
MSP1
19
-
DYDVVYLKPLAGMYK-PADRE can be highly immuno-
genic in primates. Secondly, we developed a new monkey
model that opens the possibility to explore other adjuvant
formulations. Many of these adjuvants are currently being
tested with recombinant proteins based on the MSP1 or other
P. falciparum antigens [29,30]. We may use this information
to select the next group of adjuvants to be tested. Thirdly,
the serum generated during these trials can be tested in func-
tional assays.
It is important to mention that both T cell epitopes that we
introduced (DYDVVYLKPLAGMYK and PADRE) were de-
signed/selected to bind to human HLA-DR molecules. There-
fore, it is possible that this recombinant protein may perform
better in humans than in monkeys. Nevertheless, our results
support previous studies that concluded that a major challenge
in the development of subunit vaccines for malaria or other in-
fectious diseases will be the identification of safe and potent
adjuvants capable of inducing immune responses as high as
CFA/IFA.
Acknowledgements
This work was supported by grants from FAPESP, The
Millennium Institute for Vaccine Development and Technol-
ogy (CNPq - 420067/2005-1) and UNDP/World Bank/WHO/
TDR ID 990259. The authors are indebted to Dr J. W. Barn-
well (CDC, Atlanta) who provided the mAb anti-MSP1
19
.
I.S.S., J.K., L.E.M., E.C.N and M.M.R. were supported by fel-
lowships from CNPq. D.S.R., F.T. and D.Y.B. were supported
by fellowships from FAPESP.
References
1 K. Mendis, B.J. Sina, P. Marchesini, R. Carter, The neglected burden of
Plasmodium vivax malaria, Am. J. Trop. Med. Hyg 64 (2001) 97e106.
2 M.J. Blackman, H. Heidrich, S. Donachie, J.S. McBride, A.A. Holder, A
single fragment of a malaria merozoite surface protein remains on the
parasite during red cell invasion and is the target of invasion-inhibiting
antibodies, J. Exp. Med 172 (1990) 379e382.
3 R.A. O’Donnell, A. Saul, A.F. Cowman, B.S. Crabb, Functional conserva-
tion of the malaria vaccine antigen MSP-1
19
across distantly related
Plasmodium species, Nat. Med 6 (2000) 91e95.
4 R.A. O’Donnell, T.F. de Koning-Ward, R.A. Burt, M. Bockarie,
J.C. Reeder, A.F. Cowman, B.S. Crabb, Antibodies against merozoite sur-
face protein (MSP)-1(19) are a major component of the invasion-inhibitory
response in individuals immune to malaria, J. Exp. Med 193 (2001)
1403e1412.
5 L.M. Spencer Valero, S.A. Ogun, S.L. Fleck, I.T. Ling, T.J. Scott-Finnigan,
M.J. Blackman, A.A. Holder, Passive immunization with antibodies
against three distinct epitopes on Plasmodium yoelii merozoite surface
protein 1 suppresses parasitemia, Infect. Immun. 66 (1998) 3925e3930.
6 T.M. Daly, C.A. Long, A recombinant 15-kilodalton carboxyl-terminal
fragment of Plasmodium yoelii 17XL merozoite surface protein-1 induces
a protective immune response in mice, Infect. Immun. 61 (1993)
2462e2467.
7 K.L.R.L. Perera, S.M. Handunnetti, I. Holm, S. Longacre, K. Mendis,
Baculovirus merozoite surface protein 1 C-terminal recombinant antigens
are highly protective in a natural primate model for human Plasmodium
vivax malaria, Infect. Immun. 66 (1998) 1500e1506.
8 A.W. Stowers, V. Cioce, R.L. Shimp, M. Lawson, G. Hui, O. Muratova,
D.C. Kaslow, R. Robinson, C.A. Long, L.H. Miller, Efficacy of two alter-
nate vaccines based on Plasmodium falciparum merozoite surface protein 1
in an Aotus challenge trial, Infect. Immun. 69 (2001) 1536e1546.
9 I.S. Soares, G. Levitus, J.M. Souza, H.A. del Portillo, M.M. Rodrigues,
Acquired immune responses to the N- and C-terminal regions of Plasmo-
dium vivax merozoite surface protein 1 in individuals exposed to malaria,
Infect. Immun. 65 (1997) 1606e1614.
10 I.S. Soares, M.G. Cunha, M.N. Silva, J.M. Souza, H.A. del Portillo,
M.M. Rodrigues, Longevity of the naturally acquired antibody responses
to the N- and C-terminal regions of Plasmodium vivax MSP1, Am. J.
Trop. Med. Hyg. 60 (1999) 357e363.
11 I.S. Soares, J.W. Barnwell, M.U. Ferreira, M.G. Cunha, J.P. Laurino,
B.A. Castilho, M.M. Rodrigues, A Plasmodium vivax vaccine candidate
displays limited allele polymorphism, which does not restrict recognition
by antibodies, Mol. Med. 5 (1999) 459e470.
12 M.G. Cunha, M.M. Rodrigues, I.S. Soares, Comparison of the immuno-
genic properties of recombinant proteins representing the Plasmodium
vivax vaccine candidate MSP1
19
expressed in distinct bacterial vectors,
Vaccine 20 (2001) 385e396.
2136 D.S. Rosa et al. / Microbes and Infection 8 (2006) 2130e2137
13 M.H. Rodrigues, M.G. Cunha, R.L. Machado, O.C. Ferreira Jr.,
M.M. Rodrigues, I.S. Soares, Serological detection of Plasmodium vivax
malaria using recombinant proteins corresponding to the 19-kDa C-termi-
nal region of the merozoite surface protein-1, Malar. J. 2 (2003) 39.
14 D.S. Rosa, F. Tzelepis, M.G. Cunha, I.S. Soares, M.M. Rodrigues, The pan
HLA DR-binding epitope improves adjuvant-assisted immunization with
a recombinant protein containing a malaria vaccine candidate, Immunol.
Lett. 92 (2004) 259e268.
15 R. Stephens, F.R. Albano, S. Quin, B.J. Pascal, V. Harrison, B. Stockinger,
D. Kioussis, H.U. Weltzien, J. Langhorne, Malaria-specific transgenic
CD4(þ) T cells protect immunodeficient mice from lethal infection and
demonstrate requirement for a protective threshold of antibody production
for parasite clearance, Blood 106 (2005) 1676e1684.
16 T. Sturniolo, E. Bono, J. Ding, L. Raddrizzani, O. Tuereci, U. Sahin,
M. Braxenthaler, F. Gallazzi, M.P. Protti, F. Sinigaglia, J. Hammer, Gener-
ation of tissue-specific and promiscuous HLA ligand databases using DNA
microarrays and virtual HLA class II matrices, Nat. Biotechnol. 17 (1999)
555e561.
17 J. Hammer, C. Belunis, D. Bolin, J. Papadopoulos, R. Walsky, J. Higelin,
W. Danho, F. Sinigaglia, Z.A. Nagy, High-affinity binding of short peptides
to major histocompatibility complex class II molecules by anchor combi-
nations, Proc. Natl. Acad. Sci. U.S.A. 91 (1994) 4456e4460.
18 E. Atherton, R.C. Sheppard, Solid Phase Peptide Synthesis: A Practical
Approach, IRL Press, Oxford, 1989, 152 pp.
19 S. Southwood, J. Sidney, A. Kondo, M.F. del Guercio, E. Appella,
S. Hoffman, R.T. Kubo, R.W. Chesnut, H.M. Grey, A. Sette, Several com-
mon HLA-DR types share largely overlapping peptide binding repertoires,
J. Immunol. 160 (1998) 3363e3673.
20 C. Putaporntip, S. Jongwutiwes, S. Seethamchai, H. Kanbara, K. Tanabe,
Intragenic recombination in the 3
0
portion of the merozoite surface protein
1 gene of Plasmodium vivax, Mol. Biochem. Parasitol. 109 (2000)
111e119.
21 C. Putaporntip, S. Jongwutiwes, N. Sakihama, M.U. Ferreira, W.G. Kho,
A. Kaneko, H. Kanbara, T. Hattori, K. Tanabe, Mosaic organization and
heterogeneity in frequency of allelic recombination of the Plasmodium
vivax merozoite surface protein-1 locus, Proc. Natl. Acad. Sci. U.S.A. 99
(2002) 16348e16353.
22 I. Caro-Aguilar, A. Rodriguez, J.M. Calvo-Calle, F. Guzman, P. De la
Vega, M.E. Patarroyo, M.R. Galinski, A. Moreno, Plasmodium vivax
promiscuous T-helper epitopes defined and evaluated as linear peptide
chimera immunogens, Infect. Immun. 70 (2002) 3479e3492.
23 R.E. Bontrop, N. Otting, N.G. de Groot, G.G. Doxiadis, Major histocom-
patibility complex class II polymorphisms in primates, Immunol. Rev. 167
(1999) 339e350.
24 C.P. Genain, S.L. Hauser, Experimental allergic encephalomyelitis in the
New World monkey Callithrix jacchus, Immunol, Rev. 183 (2001)
159e172.
25 E.M. Rocha, L.H. Pereira, V.E. V.E do Rosario, A.U. Krettli, Refractori-
ness of Callithrix penicillata red blood cells to Plasmodium falciparum
in vivo and in vitro, J. Parasitol. 74 (1988) 514e515.
26 L.H. Miller, A. Saul, S. Mahanty, Revisiting Freund’s incomplete adju-
vant for vaccines in the developing world, Trends Parasitol 21 (2005)
412e414.
27 D. van Duin, R. Medzhitov, A.C. Shaw, Triggering TLR signaling in
vaccination, Trends Immunol. 27 (2006) 49e55.
28 M. Singh, D.T. O’Hagan, Recent advances in vaccine adjuvants, Pharm.
Res. 19 (2002) 715e728.
29 S. Pichyangkul, M. Gettayacamin, R.S. Miller, J.A. Lyon, E. Angov,
P. Tongtawe, D.L. Ruble, D.G. Heppner Jr., K.E. Kester, W.R. Ballou,
C.L. Diggs, G. Voss, J.D. Cohen, D.S. Walsh, Pre-clinical evaluation of
the malaria vaccine candidate P. falciparum MSP1(42) formulated with
novel adjuvants or with alum, Vaccine 22 (2004) 3831e3840.
30 L.J. Carvalho, S.G. Oliveira, M. Theisen, F.A. Alves, M.C. Andrade,
G.M. Zanini, M.C. Brigido, C. Oeuvray, M.M. Povoa, J.A. Muniz,
P. Druilhe, C.T. Daniel-Ribeiro, Immunization of Saimiri sciureus
monkeys with Plasmodium falciparum merozoite surface protein-3 and
glutamate-rich protein suggests that protection is related to antibody levels,
Scand. J. Immunol. 59 (2004) 363e372.
2137D.S. Rosa et al. / Microbes and Infection 8 (2006) 2130e2137
125
Anexo 2
Vaccine 25 (2007) 6007–6017
Role of interferon-␥ during CpG oligodeoxynucleotide-adjuvanted
immunization with recombinant proteins
Daniela Santoro Rosa
a
, Karina R. Bastos
b
, Daniel Youssef Bargieri
a
, Fanny Tzelepis
a
,
Auro Nomizo
c
, Momtchilo Russo
b
, Irene S. Soares
d
, Mauricio M. Rodrigues
a,∗
a
CINTERGEN and Department of Microbiology, Immunology and Parasitology, Federal University of S˜ao Paulo,
Rua Mirassol, 207, S˜ao Paulo 04044-010, SP, Brazil
b
Department of Immunology, Institute of Biomedical Sciences, University of S˜ao Paulo, Av. Prof. Lineu Prestes,
1730, S˜ao Paulo CEP-05508-900, SP, Brazil
c
Department of Clinical Analysis, Toxicology and Bromatology, Faculty of Pharmaceutical Sciences of Ribeir˜ao Preto,
University of S˜ao Paulo, Av. Prof. Zeferino Vaz, S/N, Ribeir˜ao Preto 14040-903, SP, Brazil
d
Departamento de An´alises Cl´ınicas e Toxicol´ogicas, Faculdade de Ciˆencias Farmacˆeuticas,
University of S˜ao Paulo, Av. Prof. Lineu Prestes, 580, Bloco 17, S˜ao Paulo 05508-900, SP, Brazil
Received 3 March 2007; received in revised form 18 April 2007; accepted 13 May 2007
Available online 6 June 2007
Abstract
Synthetic oligonucleotides (ODNs) containing immunostimulatory CpG motifs (CpG) are a new class of adjuvants suitable for the devel-
opment of recombinant vaccines. Here we describe that endogenous interferon (IFN) was critical for the adjuvant activity of CpG ODN as
genetically deficient mice developed significantly lower IgG antibody titers following immunization with recombinant proteins. In contrast,
the absence of endogenous IL-12/IL-23 or IL-4 had little impact on the magnitude of the antibody response but instead caused a dramatic
change in the pattern of IgG isotypes. The dependence on IFN-␥ was specific for CpG ODN and it was not observed with other adjuvants
tested. IFN-␥ was produced by NK, dendritic cells, CD4
+
and CD8
+
T cells stimulated in vitro with CpG ODN. Adoptive transfer experiments
confirmed that CD4
+
or CD8
+
T cells were in fact relevant sources of IFN-␥ in vivo. Following CpG ODN injection, splenic dendritic cells
from IFN-␥ deficient mice did not up-regulate CD86 or CD40 expression, suggesting a role for these molecules. The importance of CD28
(CD86 ligand) was confirmed using CD28 deficient mice which presented severely impaired immune responses following CpG ODN-assisted
immunization.
© 2007 Elsevier Ltd. All rights reserved.
Keywords: IFN-␥; CpG ODN; Adjuvant; Cytokines; Recombinant vaccines
1. Introduction
To generate efficient immune responses, recombinant
vaccines will most likely require the co-administration of
adjuvants. A number of clinically acceptable adjuvant formu-
lations are being described which perform better than alum,
the most used currently licensed adjuvant for human use.
∗
Corresponding author at: CINTERGEN, UNIFESP-Escola Paulista de
Medicina, Rua Mirassol, 207, S
˜
ao Paulo 04023-062, SP, Brazil.
Tel.: +55 11 5084 8807; fax: +55 11 5571 1095.
E-mail address: [email protected] (M.M. Rodrigues).
These new adjuvants are being actively studied in subunit
vaccines against a variety of infectious agents and neoplastic
cells (for a review, see [1]).
Synthetic oligonucleotides (ODNs) containing immunos-
timulatory CpG motifs (CpG) are a new class of adjuvants
that are being proposed for the development of vaccines based
on recombinant antigens. Most important is the fact that,
in experimental models, the administration of recombinant
antigens in combination with CpG ODN can success-
fully generate protective immune responses to a variety of
pathogens including viruses, bacteria, fungi and protozoan
parasites [2].
0264-410X/$ – see front matter © 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.vaccine.2007.05.031
6008 D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017
In previous studies, we found that a recombinant bacterial
protein containing a Plasmodium vivax malaria vaccine can-
didate linked to the Pan-Allelic DR Epitope (His
6
MSP1
19
-
PADRE) elicited strong antibody immune response when
administered to C57BL/6 mice in the presence of CpG
ODN 1826. After only two immunizing doses, this
antigen/adjuvant combination generated antibody titers
equivalent to those obtained by immunization with com-
plete/incomplete Freund’s adjuvant in terms of magnitude,
affinity, IgG subclasses and longevity [3,4].
While the adjuvant property of CpG ODN is encourag-
ing, we found that little is known regarding its mechanisms
of action in vivo during active immunizations with recombi-
nant proteins. The present study was designed to evaluate the
role of selected cytokines after administration of recombinant
antigen His
6
MSP1
19
-PADRE admixed with the adjuvant
CpG ODN 1826.
2. Materials and methods
2.1. Animals
Six- to 8-week-old female mice of different inbred
mouse strains were used. Wild type (WT) C57BL/6 (H-2
b
),
IFN-␥ deficient (IFN-␥
−/−
), IL-12/IL-23 p40 deficient (IL-
12
−/−
), IL-4 deficient (IL-4
−/−
), CD8 (CD8
−/−
) and CD28
(CD28
−/−
) mice were purchased from the University of S
˜
ao
Paulo, Brazil. WT 129Sv (H-2
b
) and IFN-␣/ receptor defi-
cient (IFN-␣/ R
−/−
) mice were kindly provided by Dr. L.F.
Reis from the Ludwig Institute for Cancer Research, Brazil.
Recombinase activation genes deficient mice (Rag
−/−
) were
kindly provided by Dr. Milena B. Soares (FIOCRUZ, Brazil).
2.2. Reagents
CpG ODN 1826 (TCCATGACG
TTCCTGACGTT) and
the control CpG ODN 1982 (TCCAGGACTTCTCTCA-
GGTT) were synthesized with a nuclease-resistant phos-
phorothioate backbone and was purchased from Coley
Pharmaceuticals (Wellesley, MA), QuilA from Super-
fos Biosector (Vedbaek, Denmark), Cholera Toxin from
Sigma–Aldrich and complete or incomplete Freund’s adju-
vant (CFA/IFA) from Sigma–Aldrich. Goat anti-mouse IgG
or IgG subclasses (1, 2a, 2b and 2c) were purchased from
KPL or Southern Technologies, respectively.
Purified PK136 mAb (anti-NK1.1 mAb) was obtained
from hibridoma culture supernatants. The following
mAbs were purchased from BD Biosciences: cytochrome-
conjugated anti-CD4 (clone GK 1.5), PerCP-conjugated
anti-CD8 (clone 53-6.7), PE conjugated anti-CD11c (den-
dritic cell marker) anti-NK1.1, anti-B7.1(CD80), anti-B7.2
(CD86), anti-CD40 (costimulatory molecule) and FITC
conjugated anti-IFN-␥, anti-CD11c and anti-TCR chain.
Anti-CD4 or anti-CD8 coated magnetic beads were obtained
from Miltenyi Biotech (Auburn, CA).
2.3. Recombinant proteins and immunizations
The expression and purification of the recombinant pro-
teins His
6
MSP1
19
-PADRE and His
6
MSP1
19
were performed
exactly as described earlier [3,4]. His
6
MSP1
19
contains
the amino acids (AA) 1616–1704 of P. vivax MSP1
19
.
His
6
MSP1
19
-PADRE contains in addition to the P. vivax
MSP1
19
, 13 AA representing the Pan-Allelic DR epitope
(PADRE, AKFVAAWTLKAAA [5]).
Recombinant trans-sialidase contains the catalytic domain
of the enzyme from Trypanosoma cruzi (AA 33–680) and was
generated and purified as described earlier [6–8].
Mice were immunized twice, 4 weeks apart, with 10 gof
recombinant protein in the presence of the following adjuvant
formulations: (i) 10 g of CpG ODN 1826; (ii) 25 g of Quil
A; or (iii) 0.05 ml of CFA/IFA. Animals were injected s.c. in
the two hind footpads with the recombinant antigen mixed
with adjuvant. A volume of 50 l was injected into each hind
footpad. Four weeks later, each animal received a booster
injection of the same antigen s.c. at the base of the tail. Fig. 2
shows a third and fourth dose of the antigen injected s.c. at
the base of the tail 8 and 12 weeks after the first dose.
For intranasal immunization, mice were immunized three
times, 2 weeks apart, with 10 g of recombinant protein
admixed with 2.5 g of Cholera Toxin or 10 g of CpG-
ODN 1826. Following anesthesia with Ketamin (40 mg/kg)
and Xilazin (16 mg/kg), the antigen/adjuvant formulation in
a final volume of 16 l, was slowly placed (drop by drop)
with a micropippete in both nostrils.
Control mice received only the diluent PBS and adjuvant.
Mice were bled 4 weeks after each immunization through the
tail vein and individual serum samples were stored at −20
◦
C
until used.
2.4. Immunological assays
Antibodies to MSP1
19
in the mice sera were detected by
ELISA, essentially as described previously [3,4]. The antigen
added to the plates was the recombinant protein His
6
-MSP1
19
(200 ng/well) and the secondary antibody, conjugated to per-
oxidase, was goat anti-mouse IgG diluted 1:4000 (KPL,
Gaithersburg, MD). Each serum was analyzed in serial dilu-
tions from 1:100 up to 1:1,638,400. The individual titers were
considered as the highest dilution of serum that presented
an OD
492
higher than 0.1. The results are presented as the
mean of log antibody titers ± S.D. of 4–12 animals per group.
The results are representative of at least two independent
experiments.
ELISA to detect the subclass of mouse IgG was performed
as described above, except that the secondary antibodies
were antibodies specific for mouse IgG1, IgG2a or IgG2c
and IgG2b diluted 1:2000 (Southern Biotechnology, Birm-
ingham, AL).
For the T cell proliferation assay, mice were immunized
subcutaneously as described above and 4 weeks after the sec-
ond dose, splenocytes were prepared after red blood cells lysis
D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017 6009
using ACK buffer (0.15 M NH
4
Cl, 1 mM KHCO
3
, 0.1 mM
Na
2
EDTA). Cells were washed three times in plain RPMI
and resuspended in 1 ml of cell culture medium consisting
of RPMI 1640 medium, pH 7.4, supplemented with 2 mM
l-glutamine, 10 mM Hepes, 0.2% sodium bicarbonate, 1%
non-essential amino acid solution (all obtained from Life
Technologies), 59 mg/l of penicillin, 133 mg/l of strepto-
mycin, 1 mM sodium pyruvate, 5 × 10
−5
M 2-ME, and 2%
normal human serum AB (all obtained from Sigma). The
viability of the cells was evaluated using 0.2% Trypan Blue
exclusion dye to discriminate between live and dead cells.
Cell concentration was estimated with the aid of a Neubauer
chamber and adjusted to 1.5 × 10
6
cells/ml in cell culture
medium. The cells were cultivated in flat-bottom 96-well
plates (Corning) in a final volume of 200 l in triplicate.
The recombinant protein were added to the cultures at final
concentration of 10 g/ml. After 5 days, 0.5 Ci of [methyl-
3
H]-thymidine (Amersham) was added to each well. At the
end of the incubation period (18–20 h later), lymphocytes
were collected with the aid of a semi-automatic cell harvester.
Stimulation indexes (SI) were obtained by dividing the cpm
of cultures with antigen by the cpm of cultures containing
medium only. The results were expressed as the mean SI of
triplicate cultures.
For IFN-␥ determination, 10
6
spleen cells of na
¨
ıve mice
were cultivated in flat-bottom 96-well plates in a final volume
of 200 l in triplicate. The CpG ODN 1826 and the control
CpG 1982 were added to the culture at final concentrations of
0.1 and 1 g/ml. After 48 h, the supernatants were collected
for cytokine determination. Cytokine concentration was esti-
mated by capture ELISA using antibodies and recombinant
cytokines purchased from Pharmingen (San Diego, CA)
exactly as described previously [8]. Cytokine concentration
in each sample was determined from standard curves per-
formed in parallel with known concentrations of recombinant
mouse IFN-␥. The detection limit of the assays was 0.2 ng/ml.
For in vitro intracellular IFN-␥ detection, 2 × 10
6
spleen
cells of na
¨
ıve mice were cultured in a final volume of 200 l
with 10 g/ml CpG ODN 1826 or medium alone. After 18 h
of culture, 10 g/ml of Brefeldin A (Sigma–Aldrich) was
added to each well. After 4 h of incubation, cells were first
stained for surface markers (anti-CD4, anti-CD8, anti-CD11c
and anti-NK1.1 from BD Pharmingen) on ice for 30 min. The
cells were washed and fixed with Cytofix/Cytoperm
TM
(BD
Pharmingen) for 20 min. Following permeabilization with
Perm Wash
TM
(BD Pharmingen), cells were then stained with
FITC-conjugated anti-IFN-␥ (BD Pharmingen) for 30 min on
ice. Samples were washed with Perm Wash, ressuspended
in FACS buffer and acquired on a FACSCalibur
TM
(Becton
Dickinson) flow cytometer and analyzed using Cellquest Pro
software.
2.5. In vivo depletion of NK1.1
+
cells
WT mice were treated i.p. with 100 g of purified
PK136 mAb (anti-NK1.1mAb), on days −4 and −1. On
day 0, the mice were immunized as described above. Anti-
NK1.1 mAb was given i.p. twice weekly until the end of
the experiment. This regimen resulted in more than 90%
depletion of NK1.1 cells as estimated by immunofluores-
cence analysis using a FACSCalibur
TM
(Becton Dickinson)
flow cytometer of spleen cells stained with PE-anti-NK1.1.
Analysis of depletion using antibodies to DX5, a marker
that is used extensively to identify NK cells in mouse
strains that do not express NK1.1, showed that more
than 65% of DX5+ cells were depleted (data not shown).
The discrepancy between NK1.1 and DX5 stainings prob-
ably reflects the presence of a DX5 + NK1.1 popula-
tion.
2.6. MACS purification of CD4
+
and CD8
+
T cells and
cell transfer
Single cell suspension from spleens of WT C57BL/6 mice
were depleted of erythrocytes, and CD4
+
or CD8
+
T cells
were purified using the MACS separation system (Miltenyi
Biotec, Bergisch Gladbach, Germany), according to the man-
ufacturer’s protocols. Briefly, (3–5) × 10
8
splenocytes were
washed with MACS buffer (PBS, 0.5% BSA, 2 mM EDTA)
and resuspended in MACS buffer containing CD4 or CD8
magnetic beads. After 15 min of incubation at 4
◦
C, the cells
were centrifuged, resuspended in MACS buffer and purified
using magnetic LS columns. As estimated by FACS analysis,
after enrichment, 94.84% of the cells were CD4
+
and 88.08%
were CD8
+
.
Spleen cells from WT mice were collected in RPMI
medium and 8 × 10
7
cells transferred i.p. to IFN-␥
−/−
mice.
Alternatively, we separated CD4
+
or CD8
+
spleen cells
with anti-CD4 or anti-CD8 coated magnetic beads. IFN-
␥
−/−
mice received i.p. (1–1.5) × 10
7
or (5–7.5) × 10
6
of
purified CD4
+
or CD8
+
cells, respectively. One day after
the adoptive transfer, mice were immunized as described
above.
2.7. Dendritic cell (DC) preparation
WT and IFN-␥
−/−
mice were injected intravenously with
10 g of CpG ODN 1826 or PBS. Twenty-four hours later,
spleens were removed, cut unto small fragments and digested
for 30 min at 37
◦
C in Hank’s balanced salt solution (Life
Technologies) containing 400 U/ml of collagenase type II
(Life Technologies). The reaction was stopped after 5 min
incubation with 0.1 M EDTA. After centrifugation, the cells
were resuspended in a dense 30% BSA solution, overlaid
with 1 ml of PBS, and centrifuged for 30 min. A DC-enriched
cell population was obtained as a low-density cell fraction
and stained with the following antibodies: FITC-anti-CD11c,
PE anti-CD80, CD86 and CD40. Samples were resuspended
in FACS buffer and acquired on a FACSCalibur
TM
(Becton
Dickinson) flow cytometer and analyzed using CellQuest Pro
software.
6010 D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017
2.8. Statistical analysis
One-way ANOVA and Tukey’s honestly significantly
different (HSD) test were used to compare the possible dif-
ferences between the mean values of the different groups.
3. Results
Initially, we determined the possible participation of dif-
ferent cytokines during the antibody immune response to
the epitope His
6
MSP1
19
in mice immunized with recombi-
nant protein His
6
MSP1
19
-PADRE admixed with the adjuvant
CpG ODN 1826. We compared the magnitude of the antibody
immune response and the IgG isotype pattern in immu-
nized WT, IFN-␣/ R
−/−
, IFN-␥
−/−
, IL-12
−/−
and IL-4
−/−
mice. As described earlier [3,4], high antibody titers were
observed in the sera of WT mice of the H-2
b
haplotype (129
or C57BL/6) after s.c. administration of two doses of recom-
binant protein in the presence of this adjuvant (Fig. 1A). In
contrast, the antibody titers of immunized IFN-␣/ R
−/−
or
IFN-␥
−/−
mice were 20.41- or 38.91-fold lower than WT
controls, respectively (P < 0.01 in both cases, Fig. 1A). The
reduction of IgG was not restricted to a single subclass as
we observed significant lower titers of IgG1, IgG2a or IgG2c
and IgG2b (Fig. 1B).
IL-12
−/−
or IL-4
−/−
mice immunized in parallel dis-
played antibody titers similar to WT animals (Fig. 1A).
Nevertheless, we found that the absence of these cytokines
dramatically changed the ratio of specific IgG1/IgG2c when
compared to WT controls (Fig. 1B). The absence of endoge-
nous IL-12/IL-23 or IL-4 caused a significant decrease of
IgG2c or IgG1, respectively. Control animals immunized
with the adjuvant only had negligible antibody immune
responses to His
6
MSP1
19
(data not shown [3,4]).
Subsequently, we determined the impact on the antibody
immune response of sequential immunizations of IFN-␥
−/−
mice with His
6
MSP1
19
-PADRE admixed with CpG ODN
1826. As shown in Fig. 2A, after the second dose, the anti-
body titers of WT C57BL/6 mice were 790-fold higher than
the titers of IFN-␥
−/−
mice (P < 0.0001). After the third
and fourth doses, there was a significant increase in the
antibody titers of the IFN-␥
−/−
mice. Nevertheless, the differ-
ences between WT and IFN-␥
−/−
mice were still significant,
varying between 5- and 10-fold (P < 0.01 and P < 0.0001,
respectively).
To determine whether the lower antibody titers seen in the
IFN-␥
−/−
mice were restricted to the recombinant protein
His
6
MSP1
19
-PADRE or to the adjuvant CpG ODN 1826, we
performed experiments using a different recombinant antigen
and two other adjuvants. We used as a second recombinant
antigen the catalytic domain of the enzyme trans-sialidase,
which is being actively studied as a candidate vaccine against
American trypanosomiasis [7]. The administration of two
or three doses of the recombinant protein trans-sialidase
and the adjuvant CpG ODN 1826 generated antibody titers
Fig. 1. Magnitude and IgG subclasses of the antibody immune response
of mice immunized with the recombinant protein His
6
MSP1
19
-PADRE
admixed with the adjuvant CpG ODN 1826. Mice were immunized s.c. with
two doses of 10 gofHis
6
MSP1
19
-PADRE and 10 g of CpG ODN 1826,
4 weeks apart. Results are expressed as the mean of 7–10 mice ± S.D. of
log antibody titers detected 4 weeks after the second immunizing dose. (A)
Antibody titers of WT 129 mice immunized with His
6
MSP1
19
-PADRE were
higher than those of IFN-␣/ R
−/−
animals (P < 0.01). Antibody titers of WT
C57BL/6, IL-12
−/−
or IL-4
−/−
mice were higher than those of IFN-␥
−/−
mice (P < 0.01 in all cases). (B) Antibody titers of distinct IgG subclasses.
in WT mice 79.61- or 3.98-fold higher than the titers of
IFN-␥
−/−
mice (Fig. 2A) (P < 0.0001 or P < 0.05, respecti-
vely).
We next evaluated the importance of endogenous IFN-␥ in
animals immunized with His
6
MSP1
19
-PADRE in the pres-
ence of the adjuvants Quil A or CFA/IFA. We found that the
administration of two doses of the antigen in these adjuvants
generated antibody titers in IFN-␥
−/−
mice not statistically
different from WT controls (Fig. 2A) (P > 0.05 in both
cases).
D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017 6011
Fig. 2. Magnitude and IgG subclasses of the antibody immune response
of WT mice and IFN-␥
−/−
mice immunized with different recombinant
proteins in distinct adjuvant formulations. Mice were immunized s.c. with
two doses of 10 gofHis
6
MSP1
19
-PADRE or recombinant trans-sialidase
(TS), 4 weeks apart, in the presence of the indicated adjuvants. Results
are expressed as the mean of 6 mice ± S.D. of log antibody titers detected
4 weeks after the immunizing dose as indicated. (A) After the second,
third or fourth immunizing dose with His
6
MSP1
19
-PADRE, antibody titers
of WT mice were higher than those of IFN-␥
−/−
mice (P < 0.01 in each
case). After the second or third immunizing dose with recombinant trans-
sialidase, antibody titers of WT mice were higher than those of IFN-␥
−/−
(P < 0.0001 or P < 0.05, respectively). Antibody titers of WT mice and IFN-
␥
−/−
mice immunized with His
6
MSP1
19
-PADRE in the presence of the
adjuvants QuilA or CFA/IFA were not different from each other (P > 0.05).
(B) Antibody titers of distinct IgG subclasses.
We used the sera of mice immunized four times with
the recombinant antigen and the adjuvant CpG ODN 1826
to determine whether the IgG1/IgG2c ratio was different
between WT and IFN-␥
−/−
mice. We found that in IFN-
␥
−/−
mice, the IgG1/IgG2c ratio was 112.4-fold higher that
in the WT animals. This increase in the IgG1/IgG2c ratio
observed after the fourth dose was due to the fact that the
IgG1 and IgG2b titers were similar in WT and IFN-␥
−/−
mice. However, the titers of IgG2c were significantly lower
in IFN-␥
−/−
mice (Fig. 2B). Likewise, in IFN-␥
−/−
mice
injected with adjuvants Quil A or CFA/IFA, the IgG1/IgG2c
ratio was 12.8- or 25-fold higher than in WT mice, respec-
tively. These difference between WT and IFN-␥
−/−
mice
reflected a significantly lower concentration of specific IgG2c
(Fig. 2B).
According to our results, IFN-␥ had two distinct roles
during adjuvant-assisted immune response induced by the
recombinant protein His
6
MSP1
19
-PADRE. In the presence
of the adjuvant CpG ODN 1826, but not the other adjuvants,
this cytokine was critical during the expansion phase of the
immune response. In addition, when any of the three adju-
vants were used, IFN-␥ was important for the modulation of
the IgG subclasses.
We extended our study to the immunization by the mucosal
route (intranasal). We observed that IFN-␥
−/−
mice immu-
nized with His
6
MSP1
19
-PADRE admixed with the adjuvant
CpG ODN 1826 had and antibody response 11.48- or 5.75-
fold lower than WT animals after two or three doses of the
adjuvant/antigen formulation (Fig. 3A). Also these animals
had an increase in the ratio of IgG1/IgG2c (Fig. 3B). In con-
trast, IFN-␥
−/−
mice immunized with His
6
MSP1
19
-PADRE
admixed with the adjuvant CT had specific antibody titers
similar to WT animals following two or three doses of anti-
gen (Fig. 3A). Still, these animals had an increase in the ratio
of IgG1/IgG2c (Fig. 3B). Those results confirm and extend
the ones provided above indicating a role for the IFN-␥ during
induction of immune responses performed in the presence of
the adjuvant CpG ODN 1826.
To determine whether IFN-␥
−/−
mice were also impaired
on T cell immune responses, we performed T cell pro-
liferation assay using spleen cells from WT or IFN-␥
−/−
immunized animals. Spleen cells were re-stimulated in
vitro with the recombinant protein. In six independent
experiments, antigen-specific T cell proliferation of spleen
cells from WT mice was higher than IFN-␥
−/−
mice
(Fig. 4). Control mice immunized with adjuvant only did not
present antigen-specific T-cell proliferative response (data
not shown).
We then investigated the cell type responsible for the
production of IFN-␥ during the early phase of the immune
response. Previous studies have reported that CpG ODN stim-
ulates different mouse and human cell types to secrete IFN-␥.
DCs, NK, CD4 and CD8 T cells were among the cell types
that could secrete this cytokine after in vitro or in vivo stim-
ulation with CpG ODN [9–15]. We reproduced these results
detecting the IFN-␥ in the supernatant of splenic cells cul-
tures and using intracellular cytokine staining. As shown in
Fig. 5, stimulation of splenic cells with CpG ODN, but not
with non-CpG ODN, stimulated the secretion of considerable
amounts of IFN-␥. Using intracellular staining, we detected
that the CD4
+
, CD8
+
, CD11c
+
and NK1.1
+
cells accounted
for the IFN-␥ secreting cells (Fig. 6). The total amount of
IFN-␥
+
splenic cells was ∼0.55%. The predominant IFN-␥
+
6012 D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017
Fig. 3. Magnitude and IgG subclasses of the antibody immune response
of WT mice and IFN-␥
−/−
mice immunized with His
6
MSP1
19
-PADRE by
the intranasal route in distinct adjuvant formulations. Mice were immunized
three times, 2 weeks apart, with 10 g of recombinant protein admixed with
2.5 g of Cholera Toxin (CT) or 10 g of CpG ODN 1826. Results are
expressed as the mean of 6 mice ± S.D. of log antibody titers detected 2
weeks after the second or third immunizing dose. The antibody titers of
IFN-␥
−/−
mice immunized with His
6
MSP1
19
-PADRE admixed with CpG
ODN 1826 were lower than titers of WT mice (P = 0.01 after two doses and
P = 0.0087 after three doses). Titers of WT or IFN-␥
−/−
mice immunized
with His
6
MSP1
19
-PADRE admixed in CT were not statistically different
after two or three doses (P > 0.05 in both cases).
cells were NK1.1
+
(0.22%, Fig. 6H). CD8
+
, CD4
+
or CD11c
+
represented 0.14, 0.08 and 0.04, respectively.
Because NK cells were a major source of IFN-␥, we initi-
ated our search by depleting WT mice of the NK1.1
+
cells. We
found that extensive treatment of WT mice with anti-NK1.1
mAb failed to reduce the antibody titers after administration
of His
6
MSP1
19
-PADRE admixed with CpG ODN 1826 (data
not shown). Adoptive transfer of spleen cells from RAG
−/−
mice containing more than 50% NK1.1
+
cells to IFN-␥
−/−
Fig. 4. Impaired T-cell proliferation following immunization of IFN-␥
−/−
mice with His
6
MSP1
19
-PADRE admixed with CpG ODN 1826. For the
T cell proliferation assay, WT or IFN-␥
−/−
mice were immunized s.c.
with 10 g of recombinant protein His
6
MSP1
19
-PADRE admixed with CpG
ODN 1826. Four weeks after immunization, spleen cells were re-stimulated
in vitro with 10 g/ml of the recombinant protein. [
3
H]-TdR incorporation
was estimated after 5 days in culture. Results are expressed as average of SI
of triplicate cultures. In each experiment, pooled cells of three mice were
used.
mice failed to recover the immune response (data not shown).
Although negative, these results indicated that there were
other sources of IFN-␥ in vivo. Similar studies were per-
formed using CD8
−/−
mice. No inhibition on the antibody
response was observed following immunization of these mice
(data not shown).
Because in vitro CD4
+
and CD8
+
T cells also secreted
IFN-␥ upon stimulation with CpG ODN 1826, we trans-
ferred purified CD4
+
or CD8
+
T cells from WT animals to the
IFN-␥
−/−
mice prior to the administration of His
6
MSP1
19
-
PADRE admixed with the adjuvant CpG ODN 1826. As
Fig. 5. IFN-␥ production by spleen cells following stimulation with CpG
ODN 1826. Splenocytes derived from na
¨
ıve mice were cultured with medium
alone or different concentrations of CpG ODN 1826 or non-CpG ODN 1982.
After 48 h, the concentration of IFN-␥ in the supernatants was detected by
ELISA.
D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017 6013
Fig. 6. Intracellular detection of IFN-␥ in different splenic cell subsets after in vitro stimulation. Spleen cells were stimulated in vitro with medium alone (left
panels) or 10 g of CpG ODN 1826 (right panels). Forty-eight hours after stimulation, splenic cells were stained for intracellular IFN-␥. CD4
+
T cells: panels
A and B; CD8
+
T cells: panels C and D; CD11c
+
: panels E and F; Nk1.1
+
cells: panels G and H.
detected by FACS, purified T cells had no detectable NK1.1
+
or CD11c
+
cells (data not shown). Transfer of purified cells
prior to immunization led to a significant increase in the
antibody immune response of IFN-␥
−/−
mice (Fig. 7A).
The magnitude of the antibody immune response of these
mice was similar to immunized WT controls. However, we
observed a significant difference between these animals and
the WT control mice when we compared the specific IgG
isotypes. While WT mice displayed an IgG1/IgG2c ratio of
3.2, IFN-␥
−/−
mice that received total spleen cells, puri-
fied CD4
+
or CD8
+
cells displayed a ratio of IgG1/IgG2c
that varied from 64.6 to 513 (Fig. 7B). We interpreted these
results as indication that these animals had sufficient IFN-␥
to expand the immune response. Nevertheless, later during
the immune response, their IFN-␥ production was not suf-
ficient for the appropriate Ig switch to IgG2c. The immune
response of these mice ressembled the IL-12
−/−
mice which
also displayed a high IgG1/IgG2c ratio (Fig. 1B).
Subsequently, we addressed the question of how the IFN-
␥ could be acting early to promote the immune response.
One possibility was that this cytokine could be impor-
tant in vivo for the maturation of DC. To address this
question, we injected or not CpG ODN 1826 i.v. and eval-
uated the expression of costimulatory molecules on the
surface of splenic DC of WT and IFN-␥
−/−
mice. Follow-
ing CpG ODN injection, the expression of the costimulatory
6014 D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017
Fig. 7. Evaluation of the importance of IFN-␥-secreting spleen cells for
antibody immune response of mice immunized with the recombinant protein
His
6
MSP1
19
-PADRE admixed with CpG ODN 1826. Mice were immunized
s.c. with two doses of 10 gofHis
6
MSP1
19
-PADRE, 4 weeks apart, in the
presence of 10 g of CpG ODN 1826. Results are expressed as the mean
of 4–6 mice ± S.D. of log antibody titers detected 4 weeks after the second
immunizing dose. (A) IFN-␥
−/−
mice were adoptively transferred or not
with 8 × 10
7
spleen cells or (1–1.5) × 10
7
purified CD4
+
or (5–7.5) × 10
6
of purified CD8
+
cells. Antibody titers of IFN-␥
−/−
mice injected with non-
fractionated spleen or CD4
+
or CD8
+
cells were higher than those of IFN-
␥
−/−
mice (P < 0.01 in all cases). Antibody titers of immunized WT mice
(positive controls) were statistically higher than those of IFN-␥
−/−
mice
(P < 0.01), but not of IFN-␥
−/−
mice injected with non-fractionated spleen
or CD4
+
or CD8
+
cells (P > 0.05). (B) Specific antibodies of distinct IgG
subclasses.
molecules CD86 and CD40 (Fig. 8A and C, respectively),
but not CD80 (Fig. 8E), were upregulated on the surface of
splenic DC. In contrast, DC of IFN-␥
−/−
mice fail to up-
regulate the expression of any of these surface molecules
(Fig. 8B, D and F).
These results suggest that CD86 and CD40 could be
important for the priming of specific T cells and the gener-
ation of a powerfull immune response to these recombinant
proteins. We tested whether in fact CD86 and/or CD80 inter-
action to CD28 could be of importance for the immune
response by immunizing CD28
−/−
mice with His
6
MSP1
19
-
PADRE admixed with CpG ODN 1826. CD28
−/−
mice failed
completely to respond to His
6
MSP1
19
-PADRE following
two or three doses (Fig. 9). Therefore, it seems that in fact
the CD28 interaction with CD86 and/or CD80 is a critical
step for the development of an immune reponse adjuvanted
by CpG ODN.
4. Discussion
Using genetically deficient mice, we described apparently
non-overlapping participation of IFNs, IL-12/IL-23 and IL-4
during the development of an antibody immune response fol-
lowing the administration of a recombinant protein admixed
with the adjuvant CpG ODN 1826. We concluded that
IFN-␣/ or ␥ were critical during the expansion phase of
the immune response. In contrast, the absence of IL-4 or
IL-12/IL-23 did not interfere with the overall magnitude
of the immune response but caused significant shifts in
the ratio of serum IgG1/IgG2c. In general, the results we
obtained with IFN-␣/ R
−/−
or IL-12
−/−
or IL-4
−/−
mice
were in agreement with previous studies suggesting a role
for these cytokines during adjuvant-assisted immunization
[16–18].
The low levels of specific antibody observed in the sera
of IFN-␥
−/−
mice were completely unexpected. According
to our results, endogenous IFN-␥ played two distinct func-
tions during adjuvant-assisted antibody immune response to
recombinant antigens. During the expansion phase of the
immune response, IFN-␥ was critical for the adjuvant activity
of CpG ODN 1826. The presence of IFN-␥ was important for
the generation of specific IgG1, IgG2b and IgG2c antibodies.
In addition, we observed that after immunization, IFN-␥
−/−
mice displayed significantly lower in vitro T-cell proliferative
response of spleen cells when compared to WT mice. Later
on during the immune response, IFN-␥ also participated in
the switch to IgG2c, a fact that was common to the three
adjuvants that we tested; this had been described previously
for other adjuvants [16,18].
The importance of IFN-␥ during the expansion of the
antibody immune response had been previously noted. IFN-
␥
−/−
BALB/c mice immunized with the recombinant protein
P2P30-MSP1-19 in liposomes displayed very low antibody
titers when compared to WT BALB/c mice [16]. However,
in this report, the authors did not attempt to identify the
cells that were responsible for the secretion of this cytokine
in vivo. In experiments of adoptive transfer, we found that
non-fractionated WT spleen cells, or purified CD4
+
or CD8
+
cells restored the ability of IFN-␥
−/−
mice to mount a sig-
nificant immune response after the administration of the
recombinant antigen His
6
MSP1
19
-PADRE admixed with the
adjuvant CpG ODN 1826. After in vivo injection of CpG
ODN, both cell types have previously been described as capa-
D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017 6015
Fig. 8. Cell surface expression of co-stimulatory molecules CD80, CD86 and CD40 on splenic DCs of WT or IFN-␥
−/−
mice following injection of CpG ODN
1826. Twenty-four hours after i.v. injection of PBS or 10 g of CpG ODN 1826, low density spleen cells of WT (A, C, E) or IFN-␥
−/−
(B, D, F) mice were
stained with FITC-labeled anti-CD11c and with PE-labeled anti-CD86 (A and B), CD40 (C and D) and CD80 (E and F). Broken lines: Fc control; thin black
lines: PBS; filled histograms: CpG ODN 1826. The expression of surface markers was analyzed by acquiring 30,000 events. Cells gated for CD11c expression
are depicted as histograms and Geo mean values are shown.
ble of producing IFN-␥ mRNA [15]. Nevertheless, it is still
not clear what type of interactions are required in vivo after the
administration of CpG ODN to activate these cells to secrete
IFN-␥. In contrast, spleen cells from RAG
−/−
mice (which
contains NK1.1
+
and CD11c
+
) and in vitro generated WT
DCs failed to restore the immune response when transferred
to IFN-␥
−/−
mice (data not shown). Although these negative
results should not rule out a role for DCs or NK cells, they
argue that CD4
+
or CD8
+
cells may be more relevant sources
of this cytokine in vivo. These results are in agreement with
a previously published study which pointed memory CD8
+
T cells as an early source of IFN-␥ in mice injected with
lipopolysaccharide, type I IFN or with poly(I:C) [19].
The precise molecular mechanism and the cell types that
are targets for the IFN-␥ also remain to be fully clarified. CpG
ODN can directly stimulate DCs maturation. We observed
that the expression of certain costimulatory molecules (CD86
and CD40) is impaired following CpG ODN injection in
IFN-␥
−/−
mice. This experiment suggested an important par-
ticipation for these molecules during CpG ODN adjuvanted
immunization. By using CD28
−/−
mice, we confirmed that
in fact CD28 interaction with CD86 and/or CD80 is a critical
step for the development of an immune response to recom-
binant proteins adjuvanted by CpG ODN. Earlier studies
also indicated a critical role for CD28 during activation of
specific CD4 Th1 cells following immunization with ovalbu-
6016 D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017
Fig. 9. Magnitude of the antibody immune response of WT mice and
CD28
−/−
mice immunized with His
6
MSP1
19
-PADRE. Mice were immu-
nized three times, 4 weeks apart, with 10 g of recombinant protein admixed
with 10 g of CpG-ODN 1826. Results are expressed as the mean of 4
mice ± S.D. of log antibody titers detected 2 weeks after the second or third
immunizing dose. The antibody titers of CD28
−/−
mice immunized with
His
6
MSP1
19
-PADRE admixed with CpG ODN 1826 were lower than titers
of WT mice (P < 0.001 in both cases).
min admixed with ISS-ODN [20]. In addition to the CD28,
CD40–CD154 interaction has been seen as important for
the activation of these ovalbumin-specific CD4 Th1 cells
[20].
In addition to the expression of costimulatory molecules, it
is possible that IFN-␥ may enhance the expression of TLR-9
receptor in myeloid dendritic cells allowing them to respond
to CpG ODN activation or improving the maturation pro-
cess and the antigen-presentation function of these cells [21].
Alternatively, IFN-␥ may induce the synthesis of selected
chemokines and chemokine receptors that may be critical for
the adjuvant properties of CpG ODN. Finally, IFN-␥ may
act directly on antigen-specific CD4 or B cells [22]. These
experiments will be only possible to be performed using the
IFN-␥ receptor deficient mice reconstituted with different
populations of WT cells.
In summary, our work suggests that following immuniza-
tion with recombinant proteins admixed with CpG ODN,
IFN-␥ plays critical role for the development of the immune
response acting at least in part through a mechanism that
up-regulates CD86 expression on DCs.
Acknowledgments
This work was supported by grants from FAPESP,
CNPq and UNDP/World Bank/WHO/TDR ID 990259. The
authors are in great debt with Dr. Elaine G. Rodrigues
(UNIFESP-EPM) for providing essential help during this
work. D.S.R., D.Y.B., F.T. and K.R.B. are recipients of
fellowships from FAPESP and M.R., I.S.S. and M.M.R.
from CNPq. The authors have no conflicting financial inte-
rests.
References
[1] Singh M, O’Hagan DT. Recent advances in vaccine adjuvants. Pharm
Res 2002;19:715–28.
[2] Klinman DM. Immunotherapeutic uses of CpG oligodeoxynucleotides.
Nat Rev Immunol 2004;4:249–58.
[3] Cunha MG, Rodrigues MM, Soares IS. Comparison of the immuno-
genic properties of recombinant proteins representing the Plasmodium
vivax vaccine candidate MSP1
19
expressed in distinct bacterial vectors.
Vaccine 2001;20:385–96.
[4] Rosa DS, Tzelepis F, Cunha MG, Soares IS, Rodrigues MM. The pan
HLA DR-binding epitope improves adjuvant-assisted immunization
with a recombinant protein containing a malaria vaccine candidate.
Immunol Lett 2004;92:259–68.
[5] Alexander J, Sidney J, Southwood S, Ruppert J, Oseroff C, Maewal C,
et al. Development of high potency universal DR-restricted helper epi-
topes by modification of high affinity DR-blocking peptides. Immunity
1994;1:751–61.
[6] Ribeir
˜
ao M, Pereira-Chioccola VL, Eichinger D, Rodrigues MM,
Schenkman S. Temperature differences for trans-glycosylation and
hydrolysis reaction reveal an acceptor binding site in the catalytic
mechanism of the Trypanosoma cruzi trans-sialidase. Glycobiology
1997;7:1237–46.
[7] Costa F, Franchin G, Pereira-Chioccola VL, Ribeir
˜
ao M, Schenkman
S, Rodrigues MM. Immunization with a plasmid DNA containing the
gene of trans-sialidase reduces Trypanosoma cruzi infection in mice.
Vaccine 1998;16:768–74.
[8] Rodrigues MM, Ribeirao M, Pereira-Chioccola V, Renia L, Costa F.
Predominance of CD4 Th1 and CD8 Tc1 cells revealed by characteri-
zation of the cellular immune response generated by immunization with
a DNA vaccine containing a Trypanosoma cruzi gene. Infect Immun
1999;67:3855–63.
[9] Cowdery JS, Chace JH, Yi AK, Krieg AM. Bacterial DNA
induces NK cells to produce IFN-␥ I in vivo and increases
the toxicity of lipopolysaccharides. J Immunol 1996;156:4570–
5.
[10] Klinman DM, Yi A, Beaucage SL, Conover J, Krieg AM. CpG motifs
expressed by bacterial DNA rapidly induce lymphocytes to secrete
IL-6, IL-12 and IFN-␥. Proc Natl Acad Sci USA 1996;93:2879–
83.
[11] Krieg AM, Homan LL, Yi AK, Harty JT. CpG DNA induces sustained
IL-12 expression in vivo and resistance to Listeria monocytogenes chal-
lenge. J Immunol 1998;161:2428–34.
[12] Iho S, Yamamoto T, Takahashi T, Yamamoto S. Oligodeoxynucleotides
containing palindrome sequences with internal 5*-CpG-3* act directly
on human NK and activated T cells to induce IFN-␥ production in vitro.
J Immunol 1999;163:3642–52.
[13] Zelenay S, Elias F, Flo J. Immunostimulatory effects of plas-
mid DNA and synthetic oligodeoxynucleotides. Eur J Immunol
2003;33:1382–92.
[14] Shah JA, Darrah PA, Ambrozak DR, Turon TN, Mendez S, Kir-
man J, et al. Dendritic cells are responsible for the capacity of
CpG oligodeoxynucleotides to act as an adjuvant for protective
vaccine immunity against Leishmania major in mice. J Exp Med
2003;198:281–91.
[15] Lipford GB, Sparwasser T, Zimmermann S, Heeg K, Wagner H.
CpG-DNA-mediated transient lymphadenopathy is associated with a
state of Th1 predisposition to antigen-driven responses. J Immunol
2000;165:1228–35.
[16] Hui GS, Hashimoto CN. Pathways for potentiation of immuno-
genicity during adjuvant-assisted immunizations with Plasmodium
falciparum major merozoite surface protein 1. Infect Immun 1998;66:
5329–36.
[17] Le Bon A, Schiavoni G, D’Agostino G, Gresser L, Belardelli F, Tough
DF. Type I interferons potently enhance humoral immunity and can pro-
mote isotype switching by stimulating dendritic cells in vivo. Immunity
2001;14:461–70.
D.S. Rosa et al. / Vaccine 25 (2007) 6007–6017 6017
[18] Van Uden JH, Tran CH, Carson DA, Raz E. Type I interferon is required
to mount an adaptive response to immunostimulatory DNA. Eur J
Immunol 2001;31:3281–90.
[19] Kambayashi T, Assarsson E, Lukacher AE, Ljunggren HG, Jensen
PE. Memory CD8
+
T cells provide an early source of IFN-gamma.
J Immunol 2003;170:2399–408.
[20] Cho HJ, Hayashi T, Datta SK, Takabayashi K, Van Uden JH, Horner
A, et al. IFN-alpha beta promote priming of antigen-specific CD8
+
and
CD4
+
T lymphocytes by immunostimulatory DNA-based vaccines. J
Immunol 2002;168:4907–13.
[21] Uchijima M, Nagata T, Aoshi T, Koide Y. IFN-gamma overcomes low
responsiveness of myeloid dendritic cells to CpG DNA. Immunol Cell
Biol 2005;83:92–5.
[22] Whitmire JK, Benning N, Whitton JL. Cutting edge: early IFN-gamma
signaling directly enhances primary antiviral CD4
+
T cell responses. J
Immunol 2005;175:5624–8.
137
Anexo 3
Original article
Plasmodium vivax apical membrane antigen-1: comparative recognition
of different domains by antibodies induced during
natural human infection
Bruno C. Mu
´
falo
a
, Fernanda Gentil
a
, Daniel Y. Bargieri
b
, Fabio T.M. Costa
c
,
Mauricio M. Rodrigues
b
, Irene S. Soares
a,
*
a
Departamento de Ana´lises Clı´nicas e Toxicolo´gicas, Faculdade de Cieˆncias Farmaceˆuticas, Universidade de S
~
ao Paulo, Avenida Prof. Lineu Prestes,
580, Cidade Universita´ria, 05508-900, S
~
ao Paulo, SP, Brazil
b
CINTERGEN, Universidade Federal de S
~
ao Paulo-Escola Paulista de Medicina, Rua Mirassol, 207, 04044-010, S
~
ao Paulo, SP, Brazil
c
Departamento de Parasitologia, Instituto de Biologia, Universidade Estadual de Campinas, 13083-970, Campinas, SP, Brazil
Received 9 May 2008; accepted 14 July 2008
Available online 22 July 2008
Abstract
The Apical Membrane Antigen-1 (AMA-1) of Plasmodium sp. has been suggested as a vaccine candidate against malaria. This protein seems
to be involved in merozoite invasion and its extra-cellular portion contains three distinct domains: DI, DII, and DIII. Previously, we described
that Plasmodium vivax AMA-1 (PvAMA-1) ectodomain is highly immunogenic in natural human infections. Here, we expressed each domain,
separately or in combination (DI-II or DII-III), as bacterial recombinant proteins to map immunodominant epitopes within the PvAMA-1
ectodomain. IgG recognition was assessed by ELISA using sera of P. vivax-infected individuals collected from endemic regions of Brazil or
antibodies raised in immunized mice. The frequencies of responders to recombinant proteins containing the DII were higher than the others and
similar to the ones observed against the PvAMA-1 ectodomain. Moreover, ELISA inhibition assays using the PvAMA-1 ectodomain as substrate
revealed the presence of many common epitopes within DI-II that are recognized by human immune antibodies. Finally, immunization of mice
with the PvAMA-1 ectodomain induced high levels of antibodies predominantly to DI-II. Together, our results indicate that DII is particularly
immunogenic during natural human infections, thus indicating that this region could be used as part of an experimental sub-unit vaccine to
prevent vivax malaria.
Ó 2008 Elsevier Masson SAS. All rights reserved.
Keywords: Malaria; Plasmodium vivax; Apical Membrane Antigen-1
1. Introduction
Plasmodium vivax is highly prevalent and represents a poten-
tially fatal infection [1]. Unfortunately no effective means for
prevention are available and the development of vaccine can be
considered a priority. In the past few years, we have studied
several aspects of the immune responses against multiple anti-
gens of the erythrocytic stages of P. vivax parasites in individuals
from malaria endemic areas of Brazil [2e4]. The aim of this
study is to determine highly immunogenic regions of these
antigens that can be used for the development of recombinant
sub-unit vaccines [5,6].
The erythrocytic stages of the malaria parasite are respon-
sible for the clinical symptoms associated with the infection. A
vaccine against these stages would act therapeutically by
reducing the severity of the clinical symptoms. Proteins
expressed in the merozoite parasite form play critical roles
during the invasion of red blood cells (RBC) and are respon-
sible for the perpetuation of the parasite life cycle. The Apical
Membrane Antigen-1 (AMA-1) is a well-characterized and
functionally important merozoite protein and is currently
considered a major candidate antigen for a malaria vaccine
* Corresponding author. Tel.: þ55 11 3091 3641; fax: þ55 11 3813 2197.
1286-4579/$ - see front matter Ó 2008 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.micinf.2008.07.023
Microbes and Infection 10 (2008) 1266e1273
www.elsevier.com/locate/micinf
(revised in Ref. [7]). This protein comprises of several regions
including a pro-sequence, an ectoplasmic domain, a single
transmembrane region, and a small C-terminal cytoplasmic
domain [8]. AMA-1 is synthesized in the late schizont stage of
the asexual life cycle of the Plasmodium falciparum parasite
[9] and accumulates in the micronemes of developing mero-
zoites [10,11]. Just prior to the RBC invasion, the mature form
of the protein is transported to the merozoite surface
membrane as a 66-kDa protein [12].
Homologues of AMA-1 are present in all Plasmodium
species studied, Toxoplasma gondii [13] and Babesia [14],
supporting the hypothesis of an essential and similar function
mediated by AMA-1 among apicomplexan parasites. Targeted
gene disruption of AMA-1 has been unsuccessful in both
Plasmodium sp. [15] and Toxoplasma gondii [16], further
substantiating the essential role of AMA-1 during the life
cycles of these intra-cellular parasites. Genetics studies of
trans-species complementation further supported the evidence
that AMA-1 retains functional conservation among the
distantly related species of Plasmodium [15,17].
Immunoepidemiological studies have shown that AMA-1 is
highly immunogenic in natural human infections [4,18,19].
Moreover, the immunization of rodents and primates with
recombinant proteins based on the sequence of the AMA-1
ectodomain of distinct species of Plasmodium provided strong
evidence that AMA-1 is among the most promising antigens to
be used as a sub-unit malaria vaccine [7]. Based on these
promising results, human phase I clinical trials are being
carried out by independent groups using recombinant proteins
of P. falciparum AMA-1 (PfAMA-1) [7].
The AMA-1 ectodomain contains three distinct domains (I, II,
and III) defined by eight intra-molecular disulfide bonds [20].
Structural studies using X-ray crystallography or NMR of P.
vivax AMA-1 (PvAMA-1) and PfAMA-1 show that domains I
and II consists of two intimately associated PAN domains that are
generally associated with binding to protein, carbohydrate
receptors or ligands [21e24].Indeed,COS-7cellsexpressing
recombinant domains I and II of the Plasmodium yoelii AMA-1
were demonstrated to bind to mouse and rat RBC [25]. These
results, together with the mapping of an epitope recognized by
the invasion-inhibitory mAb 4G2, which is specific for PfAMA-
1, within the PAN domain suggest a critical role for domain II in
the attachment/invasion of RBC [21,26].
Based on the previous large body of work indicating the
biological and immunological importance of the AMA-1
protein, the current study was designed to identify immuno-
logically relevant portions of the PvAMA-1 ectodomain
recognized by human antibodies from individuals naturally
exposed to P. vivax infection and by immunization in mice.
2. Materials and methods
2.1. Construction of recombinant plasmids for
expression in Escherichia coli
Selected regions of the P. vivax AMA-1 ectodomain (di, dii,
diii, di-ii and dii-iii) were cloned into the pET-28a vector
(Novagen) for expression in E. coli BL-21
(D
E3). The
constructs containing di, dii, diii, di-ii and dii-iii were obtained
by PCR; a plasmid expressing the AMA-1 ectodomain
(encoding amino acids 43e445) of a Brazilian isolate of P.
vivax [4] was used as a template. Forward and reverse primers
used for PCR amplification for each of the constructs are listed
on Table 1. The PCR-amplified products were cloned into the
pMOSBlue blunt ended vector (Amersham Biosciences) and
positive clones were selected by DNA restriction endonuclease
analyses and further confirmed by nucleotide sequence
analyses.
2.2. Expression and purification of the recombinant
AMA-1 domains
The pET-28a plasmid is inducible with isopropyl-1-thio-b-
D-galactopyranoside (IPTG) and foreign proteins are expressed
with a covalently attached N-terminal His
6
tag. The inserts
were removed from the pMOSBlue vector with BamHI and
EcoRI (or SstI) and ligated into the pet-28a vector, which was
treated with the same enzymes. The recombinant plasmids
were transformed into E. coli BL-21(DE3) expression host
cells (Novagen). Protein expression was obtained by inocu-
lating 8 ml of a culture grown overnight in 200 ml of Luria
broth (Invitrogen) containing 30 mg/ml kanamicin (Sigma).
The culture was grown with continuous shaking at 37
Ctoan
optical density of 0.6e0.8 at 600 nm and then induced for 3 h
under constant agitation at 37
C in the presence of 0.1 mM
IPTG (Invitrogen). The recombinant proteins were obtained
from supernatant (DII) or pellet (DI, DIII, DI-II, DII-III, and
ectodomain) as follows.
2.2.1. Purification of the domain II of PvAMA-1
from bacterial supernatant
The bacterial pellet was obtained by centrifugation and
resuspended in sonication buffer (sodium phosphate buffer
20 mM, pH 8.0, 0.5 M NaCl, 1 mg/ml lysozime and 1 mM
PMSF). The bacteria were lysed on ice with the aid of a son-
icator (Branson model 450, Danbury, CT). Three sonication
cycles consisting of 1 min and 30 s pulses at 1 min intervals
were then applied. The bacterial lysate was centrifuged at
27,000g for 15 min at 4
C. The supernatant was applied to
a column with Ni
2þ
-NTA-Agarose resin (Quiagen) previously
equilibrated (sodium phosphate buffer 20 mM, pH 8.0, 0.5 M
NaCl). Bound proteins were eluted with a linear 0e0.4 M
Imidazole (Sigma) gradient in wash buffer (sodium phosphate
buffer 20 mM, pH 8.0, 0.5 M NaCl, 1 mM PMSF and 20%
glycerin, pH 7.0). Fractions were analyzed by SDS-PAGE and
stained with Coomassie blue. Fractions containing the
recombinant proteins with a high degree of purity were pooled
and dialyzed against 20 mM TriseHCl, pH 8.0. After centri-
fugation at 18,000g for 30 min at 4
C and filtration through
a 0.22 mm membrane, the recombinant protein was purified by
ion-exchange chromatography using a Mono Q column (GE-
Amersham) equilibrated with 20 mM TriseHCl, pH 8.0,
coupled to an FPLC system (Pharmacia). The proteins were
eluted with a linear 0e1 M NaCl gradient in TriseHCl buffer.
1267B.C. Mu´falo et al. / Microbes and Infection 10 (2008) 1266e1273
Fractions were analyzed by SDS-PAGE and stained with
Coomassie blue. Fractions containing the recombinant protein
with a high degree of purity were pooled and extensively
dialyzed against PBS containing 1 mM PMSF and protein
concentration was determined by the Bradford method (Bio-
Rad) using bovine serum albumin (BSA, Sigma) as the
standard.
2.2.2. Purification of the domains I, III, I-II, and II-III
from bacterial pellet
The pellet was processed for protein purification essentially as
described previously for the PvAMA-1 ectodomain, obtaining
[4] with some modifications. Briefly, the bacterial pellet was
obtained by centrifugation and resuspended in sonication buffer
(sodium phosphate buffer 20 mM, pH 8.0, 0.2 M NaCl, EDTA
10 mM, 1 mg/ml lysozime and 1 mM PMSF). The pellet con-
taining the inclusion bodies was washed four times with 10 mM
sodium phosphate buffer, pH 8.0, 1% 3-[(3-cholamidopropyl)-
dimethylammonio]-2-hydroxy-1-propanesulfonate (CHAPSO,
Sigma). Inclusion bodies were solubilized under continuous
agitation in 10 mM sodium phosphate buffer, pH 8.0, 0.5 M
NaCl, 10% (vol/vol) glycerol containing 8 M urea, at 37
Cfor
2 h. After centrifugation at 23,000g at 4
C for 30 min, the
supernatant was loaded onto a 1 ml column of pre-equilibrated
Ni
2þ
-NTA Superflow resin (Qiagen). The column was exten-
sively washed with solubilization buffer containing 5 mM
imidazole and then washed stepwise with decreasing concen-
trations of urea (6e0 M) in refolding buffer (20 mM sodium
phosphate buffer, pH 8.0, 0.5 M NaCl, 10% glycerol, 5 mM
imidazole, 0.5 mM oxidized glutathione, 5 mM reduced gluta-
thione and 0.1% Triton X-100). The column was then washed
with five bed volumes of refolding buffer containing 80 mM
imidazole to remove contaminating E. coli proteins. The bound
protein was eluted with refolding buffer containing a linear 0.1e
0.4 M imidazole gradient. The fractions, containing highly
purified recombinant protein, were extensively dialyzed against
50 mM sodium phosphate buffer, pH 8.0, 150 mM NaCl, 50%
glycerol, 0.1 mM DTT, pooled and stored at À20
C. The protein
concentration was determined as described above.
2.3. Immunoblotting
Recombinant proteins were subjected to SDS-PAGE under
reducing conditions and electrophoretically transferred onto
nitrocellulose membranes (Hybond ECL, Amersham).
Molecular mass standards (Fermentas Life Sciences) were
visualized with Ponceau S staining solution, and the
membrane was blocked overnight at 4
C in blocking buffer
(PBS containing 5% dry non-fat milk and 2.5% BSA (PBSe
milkeBSA)). A mouse monoclonal anti-Histidine tag (anti-his
tag, GE Healthcare) diluted 1:500 was incubated with the
membrane for 1 h. After extensive washes in PBS containing
0.05% of Tween 20 (PBSeTween) bound antibodies were
detected by incubating the immunoblot membranes with goat
anti-mouse IgG coupled to peroxidase diluted 1:500 (KPL)
followed by development of the chemoluminescent reaction
with enhanced chemiluminescence’s reagent (ECL, Amer-
sham Biosciences) and exposure to Hyperfilm.
2.4. Subjects
In the present study, blood samples of 125 individuals were
obtained after verbal consent and divided in two groups. One
consisted of 100 samples collected from patients with patent
P. vivax malaria in endemic regions in the state of Para
´
(north
of Brazil), while the second group was comprised of 25
individuals from the city of S
~
ao Paulo who had never been
exposed to malaria (negative controls). Clinical and laboratory
data were reported elsewhere for all individuals, including
those never exposed to malaria [2,3]. The study protocol was
approved by the Ethics Committee of the Faculty of Phar-
maceutical Sciences of the University of S
~
ao Paulo.
2.5. Detection of human IgG antibodies by ELISA
Human IgG antibodies against AMA-1 domains were
detected by ELISA as described earlier [2e4]. The amount of
recombinant protein was adjusted to provide the same OD
492
when an anti-His tag MAb was used as follows: 300 ng/well to
DI-II, 200 ng/well to DI, DIII and ectodomain, 100 ng/well to
DII, and 50 ng/well to DII-III. Cutoff points were set at five
standard deviations (except to the ectodomain, for which three
standard deviations were used) above the mean OD
492
of sera
from the 25 individuals never exposed to malaria. The inhi-
bition assays were performed with ELISA plates coated with
the bacterial recombinant protein representing the AMA-1
ectodomain. In Fig. 3 (AeC), the indicated recombinant
domains were added at different concentrations (twofold
dilutions ranging from 10 mg/ml to 3 ng/ml). Each serum from
individuals TAI01, TAI07, and TAI08 were diluted to provide
0.8e1.2 OD
492
, and the percentage of inhibition for each
serum sample was calculated as follows: [OD
492
in the
Table 1
Oligonucleotide primers used in the construction of recombinant plasmids
Recombinant plasmids 5
0
/3
0
Function Restriction enzime
pET-28a-AMA-1 (I, I-II) CGCGGATCCCCTACCGTTGAGAGAAGC Sense BamHI
pET-28a-AMA-1(I) ACGGAGCTCCTAGGGGCATTTTTTATCCCAATC Antisense SstI
pET-28a-AMA-1(II, II-III) CGCGGATCCCGTAAAAATTTAGGAAACGCC Sense BamHI
pET-28a-AMA-1(II) CTCGAATTCCTACTCCGGGCCTACTTCTTG Antisense EcoRI
pET-28a-AMA-1(III) CGCGGATCCTTCCCCTGCAGCATATATAAA Sense BamHI
pET-28a-AMA-1(III, II-III) CTCGAATTCCTATAGTAGCATCTGCTTGTTCGA Antisense EcoRI
pET-28a-AMA-1(I-II) ACGGAGCTCCTACTCCGGGCCTACTTCTTG Antisense SstI
1268 B.C. Mu´falo et al. / Microbes and Infection 10 (2008) 1266e1273
presence of inhibitor/OD
492
in the absence of inhibitor] Â 100.
In Fig. 4D, the different domains or ectodomain were added to
a final concentration of 10 mg/ml. The ELISA was then per-
formed as described above.
2.6. Immunization of mice with the recombinant
PvAMA-1 ectodomain
Three doses of the recombinant protein (5 mg/animal),
based on the PvAMA-1 ectodomain [4], were used to immu-
nize six- to eight-week-old female BALB/c mice, two weeks
apart, via the s.c. route in the two hind footpads. A volume of
50 or 100 ml was given in each footpad (first dose) or at the
base of the tail (second and third dose), respectively.
Recombinant protein was emulsified in Freund’s Complete
(1st dose) and Incomplete (2nd and 3rd) Adjuvant (Sigma). As
a negative control, mice received only adjuvant in saline
solution. Serum samples were collected for analysis 10 days
after the third immunization and pooled. Experiments were
performed in accordance with the guidelines approved by the
Ethics Committee for Animal Handling of the Faculty of
Pharmaceutical Sciences of the University of S
~
ao Paulo.
2.7. Detection of mouse IgG antibodies to PvAMA-1
Antibodies to PvAMA-1 in the pool of sera from mice were
detected by ELISA, essentially as described in Ref. [5].
ELISA plates were coated with the different domains or the
AMA-1 ectodomain at the same concentration used in the
assays to detect human IgG antibodies. The pool of sera was
tested at serial dilutions starting from 1:50.The secondary
antibody conjugated to peroxidase was goat anti-mouse IgG
(KPL) diluted 1:1000. Detection of IgG subclass and IgM
responses was performed as described above, except that the
secondary antibody was specific to mouse IgG1, IgG2a,
IgG2b, IgG3, or IgM (purchased from Southern Technologies)
diluted 1:8000. The results are expressed as the average OD
492
of each antibody dilution tested in duplicate Æ SD.
2.8. Statistical analysis
Differences between proportions of responders were
analyzed using the Chi-square test.
3. Results
3.1. Expression of different PvAMA-1 domains and
comparative recognition by human immune antibodies
A schematic representation of the recombinant proteins
used in this study is shown in Fig. 1. These proteins represent
the entire ectodomain of PvAMA-1 [4], each of the three
domains separately, or the domains in combination (DI-II or
DII-III). The analysis of the migration pattern of the purified
recombinant proteins by SDS-PAGE, performed under dena-
turing conditions in the presence of the reducing agent 2-ME,
showed that the proteins migrated with apparent molecular
mass of 30 kDa (DI), 26 kDa (DII), 18 kDa (DIII), 46 kDa
(DI-II) and 36 kDa (DII-III) (Fig. 2A). All five recombinant
AMA-1 proteins were recognized by immunoblotting with
a MAb anti-his tag (Fig. 2B).
Serum IgG antibodies from individuals living in different
endemic areas from the Brazilian Amazonian Region were
tested for recognition of the recombinant AMA-1 domains.
Initially, 100 serum samples collected from individuals with
patent infection were tested by ELISA using six recombinant
proteins as antigens. The six proteins represented distinct
AMA-1 domains (DI, DII, DIII, DI-II, DII-III and ectodo-
main). As shown in Fig. 3, 70% of all subjects recognized the
recombinant AMA-1 spanning the entire ectodomain, thus
confirming that this protein is highly immunogenic during
natural human infections. Based on that, we analyzed the
prevalence of individuals who presented IgG antibodies to
each domain (Fig. 3). We observed that the frequency of
antibodies against DII, DI-II and DII-III was not statistically
different from the prevalence observed against the ectodomain
or against each other (P > 0.05, Chi-Square test). Neverthe-
less, these frequencies were significantly higher than the
frequencies against DI or DIII (13% or 12%, respectively,
P < 0.05, Chi-Square test). No difference was observed when
we compared the frequencies of responders to DI and DIII
(P > 0.05, Chi-Square test).
Next, we performed inhibition assays using antigen plates
coated with PvAMA-1 ectodomain as the target and different
soluble recombinant proteins as the inhibitory molecules.
Initially, inhibition assays were performed with three serum
samples collected from individuals with patent P. vivax
infections. The inhibitory curves obtained from each of the
serum samples are shown in Fig. 4AeC. While recombinant
proteins DI-II and the ectodomain inhibited binding at similar
levels, the other recombinant proteins failed to do so. We then
extended this same type of analysis to 41 other serum samples
from individuals with patent P. vivax infections. The soluble
recombinant proteins were added to a final concentration of
10 mg/ml. The average inhibition Æ SD obtained to proteins
DI, DII, DIII, DI-II, DII-III, or ectodomain were 35.5 Æ 10.3,
10.6 Æ 7.9%, 29.6 Æ 21.1%, 73.0 Æ 11.7%, 28.0 Æ 11%, or
94.8 Æ 2.2, respectively (Fig. 4D). These results indicated that
during natural infection in humans, most of the antibodies
specific for the ectodomain were directed to epitopes present
in the DI-II domains.
3.2. Specificity of the antibody responses induced after
immunization with the PvAMA-1 ectodomain
The immunogenicity of the PvAMA-1 ectodomain was
evaluated in BALB/c mice. IgG antibodies from mice immu-
nized with the PvAMA-1 ectodomain predominantly recog-
nized DI-II with antibody titers similar to the ones observed
against the ectodomain itself (Fig. 5A). It was noteworthy how
immunization generated significant antibody levels to other
recombinant proteins containing domain II (DII and DII-III).
As expected, control mice did not present specific antibodies
to PvAMA-1 (data not shown). In order to determine the
1269B.C. Mu´falo et al. / Microbes and Infection 10 (2008) 1266e1273
quality of the humoral immune responses, we measured the
IgG subclasses or IgM from mice immunized with PvAMA-1
ectodomain. Fig. 5B shows that these animals developed high
IgG1, IgG2a and IgG2b levels. We also measured the IgG
subclasses generated to the distinct AMA-1 domains and the
results were similar to full length ectodomain (data not
shown).
4. Discussion
Recombinant proteins based on the sequence of P. vivax
AMA-1 are highly immunogenic to humans during natural
infections in Brazil and Sri Lanka [4,19]. The rationale of the
present study was to identify the region of this molecule target
of human immune antibodies. For that purpose, we generated
five bacterial recombinant proteins representing each of the
domains separately or in combination (DI-II and DII-III).
Their recognition by IgG antibodies were evaluated using P.
vivax-infected sera collected from endemic regions in Brazil.
A total of 70% of the individuals displayed antibodies to the
recombinant protein representing de AMA-1 ectodomain.
Among the polypeptides representing different domains, the
proteins containing domain II were most frequently recog-
nized by human antibodies. In contrast, the frequencies of
individuals with IgG antibodies to individual DI and DIII were
significantly lower. These findings provide the first observa-
tions on human antibody responses to individual P. vivax
AMA-1 domains and suggest that the DII is particularly
immunogenic during natural human infections.
An important observation from our study was the fact that
sera from individuals living in distinct areas in West Africa
where malaria is caused only by P. falciparum and individuals
from Brazil who had their sera collected during the first
malarial infection and were unequivocally diagnosed as being
caused by P. falciparum reacted with DII of PvAMA-1. The
percentage of responders was 43.5% (data not shown).
Detailed studies will be required to determine whether sera
from P. vivax-infected individuals recognize recombinant
proteins representing the P. falciparum AMA-1. Our obser-
vation corroborates with a recent study showing that a murine
Domain I
206 AA
137 AA
Domain II
Domain III
102 AA
Domain I - II
343 AA
Domain II-III
239 AA
NH
2
COOH
Signal
peptide
Citoplasmatic
region
TM
region
Ectodomain cystein-rich
Ectodomain (I-III)
445 AA
Fig. 1. Schematic diagram of the structure of PvAMA-1 and the recombinant proteins studied. Selected regions of the P. vivax AMA-1 were expressed in E. coli.
They consisted of a protein representing the entire ectodomain of PvAMA-1, each of the three domains separately (DI, DII and DIII) or in combination (DI-II or
DII-III). D ¼ domain.
1 23 45
45
–
BA
MW 1 2 3 4 5
116
–
66
–
45
–
MW
35
–
25
–
18
–
14
–
35
–
25
–
18
–
14
–
Fig. 2. SDS-PAGE and immunoblotting analysis of the recombinant proteins representing the different domains of P. vivax AMA-1. A. Recombinant proteins
(1 mg) were added to each lane of an SDS-PAGE 15% performed under reducing conditions and stained with Coomassie blue. B. Immunoblotting analysis of the
recombinant proteins studied using a mouse anti-his tag MAb. Lanes, 1: DI; 2: DII; 3: DIII; 4: DI-II; 5: DII-III. D ¼ domain.
1270 B.C. Mu´falo et al. / Microbes and Infection 10 (2008) 1266e1273
monoclonal antibody raised DIII of PvAMA-1 recognizes
a conserved cross-species epitope of Plasmodium [27]. The
cross-recognition between P. falciparum and P. vivax AMA-1
by human antibodies may also have immunological conse-
quences at the level of acquired immunity and vaccine
development in areas where both malarias are prevalent.
The reasons why the recombinant proteins based on
domains I and III of PvAMA-1 were poorly recognized by
human immune IgG antibodies are unknown. However, since
these antigens are expressed in E. coli, it is possible that the
refolding of these recombinant proteins presents significant
conformational discrepancies in comparison to the native
AMA-1. Indeed, DI and DIII contain more disulfide bonds
than DII, bonds that can be difficult to pair during the
refolding of these proteins in E. coli. This may explain why the
recombinant protein representing domain II was the only
soluble protein in aqueous buffer. Although we do not have
data on the conformation of proteins DI-II and DII-III, we
found that the frequencies of the responses to recombinant
proteins containing these domains were similar to the ones
observed against DII or ectodomain, suggesting that these
60
80
DI DII DIII DI-II DII-III Ectodomain
% of positive sera
0
20
40
Fig. 3. Proportions of individuals infected by P. vivax with serum IgG anti-
bodies against recombinant antigens of PvAMA-1, tested by ELISA. Serum
samples (n ¼ 100) were tested at a dilution of 1:100. The cutoff values for each
recombinant protein were: DI, 0.052; DII, 0.052; DIII, 0.099; DI-II, 0.015;
DII-III, 0.078; ectodomain, 0.207. D ¼ domain.
OD
492
0,2
0,4
0,6
0,8
1,0
1,2
1,4
DI
DII
DIII
DI-II
DII-III
Ectodomain
TAI07
OD
492
0,2
0,4
0,6
0,8
1,0
1,2
TAI01
A
B
Inhibitor concentration
(
u
g
/ml
)
0246810
OD
492
0,0
0,2
0,4
0,6
0,8
1,0
TAI08
Inhibitor concentration (ug/ml)
0 2 46810
0,0
Inhibitor concentration (ug/ml)
0246810
0,0
AMA-1 domains
(
inhibitors
)
DII DII DIII DI-II DII-III Ectodomain
% of inhibition
0
20
40
60
80
100
120
n=13
n=12
n=27
n=28
n=30
n=31
D
C
Fig. 4. ELISA inhibition assay. ELISA plates were coated with the recombinant protein representing the entire PvAMA-1 ectodomain. In panels A, B and C, the
soluble recombinant domains were added at different concentrations (twofold dilutions ranging from 10 mg/ml to 3 ng/ml) in each well. The human sera (TAI01,
TAI07 or TAI08, respectively) at a final dilution of 1:2000 were added after the soluble protein. Results are expressed as average OD
492
of each inhibitor
concentration tested in duplicate Æ SD. In panel D, the percentages represent the mean of inhibition in the presence of 10 mg/ml of each inhibitor Æ SD. A total of
44 samples were included in this analysis.
1271B.C. Mu´falo et al. / Microbes and Infection 10 (2008) 1266e1273
proteins are properly folded to some extent. Our findings
confirm and build on previous observations using different
domains of P. falciparum AMA-1. This study demonstrated
that proteins DI-II and DII-III were immunogenic, while DII
was the most immunogenic of the three single domains [28].
In addition, using an ELISA inhibition assay, we demonstrated
that most human immune antibodies reactive to the recombi-
nant protein representing the ectodomain were inhibited by the
recombinant protein representing DI-II region. This observa-
tion indicated that most of the relevant epitopes were main-
tained within DI-II. In contrast, the recombinant protein
representing the DII region, which was highly recognized by
indirect ELISA, was poorly inhibitory.
AMA-1 polymorphism present in circulating human para-
site populations might compromise the development of
a vaccine. In the specific case of PvAMA-1, there are few
molecular studies on its genetic diversity across the entire gene
in comparison to P. falciparum [29e31]. Recently, the anal-
ysis of the nucleotide diversity in Sri Lankan parasite isolates
showed evidence for a strong diversifying selection in domain
II of PvAMA-1 [31]. However, no polymorphism was detected
in the domain II loop, which was shown to include the P.
falciparum AMA-1 epitope recognized by the invasion-
inhibitory mAb 4G2 [21,26]. The extension of the poly-
morphism of domain II in Brazil is still unknown and
molecular epidemiological studies should be carried out.
To evaluate the immunogenic properties of the PvAMA-1
ectodomain, we immunized mice with the purified protein
emulsified in Freund’s adjuvant. We observed that the mice
immunized with the PvAMA-1 ectodomain were able to
generate antibodies to all five recombinant domains. However,
the DI-II was the most predominantly recognized. Taken
together, these results demonstrated that the majority of the
antibodies against the ectodomain produced during natural
exposure in humans or by experimental immunization
recognize the region represented by the recombinant DI-II.
Previous immunization studies revealed that domains I and II
of PfAMA-1 are targets of inhibitory antibodies in growth
inhibition assay [17,28]. Together with our data they suggest
that these regions may serve as a candidate for a sub-unit
vaccine against malaria.
In summary, we successfully described recombinant
proteins representing the most common target of human
immune antibodies within P. vivax AMA-1. This study may
serve as a guideline for developing a recombinant protein that
can be used for a sub-unit vaccine trial against malaria.
Acknowledgments
This work was supported by grants from Fundac¸
~
ao de
Amparo a
`
Pesquisa do Estado de S
~
ao Paulo (FAPESP, 2004/
00768-7), Fundac¸
~
ao Carlos Chagas Filho de Amparo a
`
Pes-
quisa do Estado do Rio de Janeiro (FAPERJ, E-26/110.305/
2007) and The Millennium Institute for Vaccine Development
and Technology (CNPq, 420067/2005-1). BCM, FTMC,
MMR and ISS are supported by fellowships from CNPq. FG
and DYB are supported by fellowships from CAPES and
FAPESP, respectively.
References
[1] J.K. Baird, Neglect of Plasmodium vivax malaria, Trends. Parasitol. 23
(2007) 533e539.
[2] I.S. Soares, G. Levitus, J.M. Souza, H.A. Del Portillo, M.M. Rodrigues,
Acquired immune responses to the N- and C-terminal regions of Plas-
modium vivax merozoite surface protein 1 in individuals exposed to
malaria, Infect. Immun. 65 (1997) 1606e1614.
[3] M.H.C. Rodrigues, M.G. Cunha, R.L. Machado, O.C. Ferreira Jr.,
M.M. Rodrigues, I.S. Soares, Serological detection of Plasmodium vivax
malaria using recombinant proteins corresponding to the 19-kDa C-
terminal region of the merozoite surface protein-1, Malar. J. 2 (2003) 39.
AB
2,0
IgG1
IgG2a
IgG2b
IgG3
IgM
2,5
3,0
3,5
100
400
800
1,600
3,200
6,400
12,800
25,600
51,200
102,400
204,800
Reciprocal antibod
y
dilution
200
Reciprocal antibod
y
dilution
0,0
0,5
1,0
1,5
100
400
800
1,600
3,200
6,400
12,800
25,600
51,200
102,400
50
200
OD
492
2,0
2,5
3,0
3,5
0,0
0,5
1,0
1,5
OD
492
DI
DII
DIII
DI-II
DII-III
Ectodomain
Fig. 5. Immunogenicity of PvAMA-1 ectodomain in mice. A. AMA-1 ectodomain specific IgG antibodies were generated in immunized mice (3 doses) with 5 mg
of the protein in the presence of Freund’s Adjuvant. ELISA plates were coated with the different domains of PvAMA-1 ectodomain. The pool of serum (n ¼ 6) was
tested at serial dilutions starting from 1:50. B. ELISA plates were coated with the recombinant protein representing PvAMA-1 ectodomain. The PvAMA-1-specific
IgG1, IgG2a, IgG2b, IgG3, and IgM levels are indicated. The results are expressed as the average OD
492
of each antibody dilution tested in duplicate Æ SD. Data
are representative of two experiments performed with similar results.
1272 B.C. Mu´falo et al. / Microbes and Infection 10 (2008) 1266e1273
[4] M.H.C. Rodrigues, K.M. Rodrigues, T.R. Oliveira, A.N. Comodo,
M.M. Rodrigues, C.H. Kocken, A.W. Thomas, I.S. Soares, Antibody
response of naturally infected individuals to recombinant Plasmodium
vivax apical membrane antigen-1, Int. J. Parasitol. 35 (2005) 185e192.
[5] M.G. Cunha, M.M. Rodrigues, I.S. Soares, Comparison of the immu-
nogenic properties of recombinant proteins representing the Plasmodium
vivax vaccine candidate MSP1(19) expressed in distinct bacterial vectors,
Vaccine 20 (2001) 385e396.
[6] D.S. Rosa, L.K. Iwai, F. Tzelepis, D.Y. Bargieri, M.A. Medeiros,
I.S. Soares, J. Sidney, A. Sette, J. Kalil, L.E. Mello, E. Cunha-Neto,
M.M. Rodrigues, Immunogenicity of a recombinant protein containing
the Plasmodium vivax vaccine candidate MSP1(19) and two human
CD4þ T-cell epitopes administered to non-human primates (Callithrix
jacchus jacchus), Microbes. Infect. 8 (2006) 2130e2137.
[7] E.J. Remarque, B.W. Faber, C.H.M. Kocken, A.W. Thomas, Apical
membrane antigen 1: a malaria vaccine candidate in review, Trends
Parasitol. 24 (2008) 74e84.
[8] A.P. Waters, A.W. Thomas, J.A. Deans, G.H. Mitchell, D.E. Hudson,
L.H. Miller, T.F. McCutchan, S. Cohen, A merozoite receptor protein
from Plasmodium knowlesi is highly conserved and distributed
throughout Plasmodium, J. Biol. Chem. 265 (1990) 17974e17979.
[9] M.G. Peterson, V.M. Marshall, J.A. Smythe, P.E. Crewther, A. Lew,
A. Silva, R.F. Anders, D.J. Kemp, Integral membrane protein located in
the apical complex of Plasmodium falciparum, Mol. Cell. Biol. 9 (1989)
3151e3154.
[10] J. Healer, S. Crawford, S. Ralph, G. McFadden, A.F. Cowman, Inde-
pendent translocation of two micronemal proteins in developing Plas-
modium falciparum merozoites, Infect. Immun. 70 (2002) 5751e5758.
[11] L.H. Bannister, J.M. Hopkins, A.R. Dluzewski, G. Margos, I.T. Williams,
M.J. Blackman, C.H. Kocken, A.W. Thomas, G.H. Mitchell, Plasmodium
falciparum apical membrane antigen 1 (PfAMA-1) is translocated within
micronemes along subpellicular microtubules during merozoite devel-
opment, J. Cell. Sci. 116 (2003) 3825e3834.
[12] D.L. Narum, A.W. Thomas, Differential localization of full-length and
processed forms of PF83/AMA-1 an apical membrane antigen of Plasmo-
dium falciparum merozoites, Mol. Biochem. Parasitol. 67 (1994) 59e68.
[13] C.G. Donahue, V.B. Carruthers, S.D. Gilk, G.E. Ward, The Toxoplasma
homolog of Plasmodium apical membrane antigen-1 (AMA-1) is
a microneme protein secreted in response to elevated intracellular
calcium levels, Mol. Biochem. Parasitol. 111 (2000) 15e30.
[14] F.R. Gaffar, A.P. Yatsuda, F.F. Franssen, E. de Vries, Erythrocyte
invasion by Babesia bovis merozoites is inhibited by polyclonal anti-
sera directed against peptides derived from a homologue of Plasmo-
dium falciparum apical membrane antigen 1, Infect. Immun. 72 (2004)
2947e2955.
[15] T. Triglia, J. Healer, S.R. Caruana, A.N. Hodder, R.F. Anders,
B.S. Crabb, A.F. Cowman, Apical membrane antigen 1 plays a central
role in erythrocyte invasion by Plasmodium species, Mol. Microbiol. 38
(2000) 706e718.
[16] A.B. Hehl, C. Lekutis, M.E. Grigg, P.J. Bradley, J.F. Dubremetz,
E. Ortega-Barria, J.C. Boothroyd, Toxoplasma gondii homologue of
Plasmodium apical membrane antigen 1 is involved in invasion of host
cells,
Infect.
Immun.
68 (2000) 7078e7086.
[17] J.T. Healer, T. Triglia, A.N. Hodder, A.W. Gemmill, A.F. Cowman,
Functional analysis of Plasmodium falciparum apical membrane antigen
1 utilizing interspecies domains, Infect. Immun. 73 (2005) 2444e2451.
[18] A.W. Thomas, J.F. Trape, C. Rogier, A. Goncalves, V.E. Rosario,
D.L. Narum, High prevalence of natural antibodies against Plasmodium
falciparum 83-kilodalton apical membrane antigen (PF83/AMA-1) as
detected by capture-enzyme-linked immunosorbent assay using full-
length baculovirus recombinant PF83/AMA-1, Am. J. Trop. Med. Hyg.
51 (1994) 730e740.
[19] T. Wickramarachchi, P.H. Premaratne, K.L.R. L Perera, S. Bandara,
C.H.M. Kocken, A.W. Thomas, S.M. Handunnetti, P.V. Udagama-Ran-
deniya, Natural human antibody responses to Plasmodium vivax apical
membrane antigen 1 under low transmission and unstable malaria
conditions in Sri Lanka, Infect. Immun. 74 (2006) 798e801.
[20] A.N. Hodder, P.E. Crewther, M.L.S.M. Matthew, G.E. Reid, R.L. Moritz,
R.J. Simpson, R.F. Anders, The disulfide bond structure of Plasmodium
apical membrane antigen-1, J. Biol. Chem. 271 (1996) 29446e29452.
[21] J.C. Pizarro, B. Vulliez-Le Normand, M.L. Chesne-Seck, C.R. Collins,
C. Withers-Martinez, F. Hackett, M.J. Blackman, B.W. Faber,
E.J. Remarque, C.H. Kocken, A.W. Thomas, G.A. Bentley, Crystal
structure of the malaria vaccine candidate apical membrane antigen 1,
Science 308 (2005) 408e411.
[22] T. Bai, M. Becker, A. Gupta, P. Strike, V.J. Murphy, R.F. Anders,
A.H. Batchelor, Structure of AMA1 from Plasmodium falciparum reveals
a clustering of polymorphisms that surround a conserved hydrophobic
pocket, Proc. Natl. Acad. Sci. U.S.A. 102 (2005) 12736e12741.
[23] M. Nair, M.G. Hinds, A.M. Coley, A.N. Hodder, M. Foley, R.F. Anders,
R.S. Norton, Structure of domain III of the blood-stage malaria vaccine
candidate, Plasmodium falciparum apical membrane antigen 1 (AMA1),
J. Mol. Biol. 322 (2002) 741e753.
[24] Z.P. Feng, D.W. Keizer, R.A. Stevenson, S. Yao, J.J. Babon, V.J. Murphy,
R.F. Anders, R.S. Norton, Structure and inter-domain interactions of
domain II from the blood-stage malarial protein, apical membrane
antigen 1, J. Mol. Biol. 350 (2005) 641e656.
[25] T.S. Fraser, S.H. Kappe, D.L. Narum, K.M. VanBuskirk, J.H. Adams,
Erythrocyte-binding activity of Plasmodium yoelii apical membrane
antigen-1 expressed on the surface of transfected COS-7 cells, Mol.
Biochem. Parasitol. 117 (2001) 49e59.
[26] C.R. Collins, C. Withers-Martinez, G.A. Bentley, A.H. Batchelor,
A.W. Thomas, M.J. Blackman, Fine mapping of an epitope recognized by an
invasion-inhibitory monoclonal antibody on the malaria vaccine candidate
apical membrane antigen 1, J. Biol. Chem. 282 (2007) 7431e7441.
[27] S. Igonet, B. Vulliez-Le Normand, G. Faure, M.M. Riottot,
C.H.M. Kocken, A.W. Thomas, G.A. Bentley, Cross-reactivity studies of
an anti-Plasmodium vivax apical membrane antigen 1 monoclonal anti-
body: binding and structural characterisation, J. Mol. Biol. 366 (2007)
1523e1537.
[28] P.V. Lalitha, L.A. Ware, A. Barbosa, S. Dutta, J.K. Moch, J.D. Haynes,
B.B. Fileta, C.E. White, D.E. Lanar, Production of the subdomains of the
Plasmodium falciparum apical membrane antigen 1 ectodomain and
analysis of the immune response, Infect. Immun. 72 (2004) 4464e4470.
[29] Q. Cheng, Q.A. Saul, Sequence analysis of the apical membrane antigen
1 (AMA-1) of Plasmodium vivax, Mol. Biochem. Parasitol. 65 (1994)
183e187.
[30] M. Figtree, C.J. Pasay, R. Slade, Q. Cheng, N. Cloonan, J. Walker,
A. Saul, Plasmodium vivax synonymous substitution frequencies;
evolution and population structure deduced from diversity in AMA 1 and
MSP
1 genes,
Mol. Biochem. Parasitol. 108 (2000) 56e66.
[31] A.M. Gunasekera, T. Wickramarachchi, D.E. Neafsey, I. Ganguli,
L. Perera, P.H. Premaratne, D. Hartl, S.M. Handunnetti, P.V. Udagama-
Randeniya, D.F. Wirth, Genetic diversity and selection at the Plasmo-
dium vivax apical membrane antigen-1 (PvAMA-1) locus in a Sri Lankan
population, Mol. Biol. Evol. 24 (2007) 939e947.
1273B.C. Mu´falo et al. / Microbes and Infection 10 (2008) 1266e1273
146
REFERÊNCIAS BIBLIOGRÁFICAS
147
[1] Laveran A. A new parasite found in the blood of malarial patients. Parasitic
origin of malarial attacks. Bull Mem Soc Med Hosp (Paris) 1880;17:158-64.
[2] Ross R. Mosquitoes and malaria. Br Med J 1899:432-3.
[3] Grassi B, A. Bignami, and G. Bastianelli. Ulteriori ricerche sul ciclo dei
parassiti malarici umani nel corpo del zanzarone. Atti Reale Accad Lincei 1899;5:8-
21.
[4] Perkins SL, Austin C. Four New Species of Plasmodium from New Guinea
Lizards: Integrating Morphology and Molecules. The Journal of parasitology 2008
Sep 29:1.
[5] Singh B, Kim Sung L, Matusop A, Radhakrishnan A, Shamsul SS, Cox-
Singh J, et al. A large focus of naturally acquired Plasmodium knowlesi infections
in human beings. Lancet 2004 Mar 27;363(9414):1017-24.
[6] Cox-Singh J, Singh B. Knowlesi malaria: newly emergent and of public
health importance? Trends in parasitology 2008 Sep;24(9):406-10.
[7] Doolan DL, Dobano C, Baird JK. Acquired immunity to malaria. Clinical
microbiology reviews 2009 Jan;22(1):13-36, Table of Contents.
[8] WHO. World malaria report. 2008.
[9] Hay SI, Guerra CA, Tatem AJ, Noor AM, Snow RW. The global distribution
and population at risk of malaria: past, present, and future. The Lancet infectious
diseases 2004 Jun;4(6):327-36.
148
[10] Mendis K, Sina BJ, Marchesini P, Carter R. The neglected burden of
Plasmodium vivax malaria. The American journal of tropical medicine and hygiene
2001 Jan-Feb;64(1-2 Suppl):97-106.
[11] Yapabandara AM, Curtis CF. Vectors and malaria transmission in a gem
mining area in Sri Lanka. J Vector Ecol 2004 Dec;29(2):264-76.
[12] Sithiprasasna R, Lee WJ, Ugsang DM, Linthicum KJ. Identification and
characterization of larval and adult anopheline mosquito habitats in the Republic of
Korea: potential use of remotely sensed data to estimate mosquito distributions.
International journal of health geographics 2005 Jul 13;4:17.
[13] Nagao Y, Dachlan YP, Soedarto, Hidajati S, Yotopranoto S,
Kusmartisnawati, et al. Distribution of two species of malaria, Plasmodium
falciparum and Plasmodium vivax, on Lombok Island, Indonesia. The Southeast
Asian journal of tropical medicine and public health 2003 Sep;34(3):495-500.
[14] de Barros FS, de Aguiar DB, Rosa-Freitas MG, Luitgards-Moura JF, Gurgel
Hda C, Honorio NA, et al. Distribution summaries of malaria vectors in the northern
Brazilian Amazon. J Vector Ecol 2007 Dec;32(2):161-7.
[15] Tadei WP, Dutary Thatcher B. Malaria vectors in the Brazilian amazon:
Anopheles of the subgenus Nyssorhynchus. Revista do Instituto de Medicina
Tropical de Sao Paulo 2000 Mar-Apr;42(2):87-94.
[16] Besansky NJ, Hill CA, Costantini C. No accounting for taste: host preference
in malaria vectors. Trends in parasitology 2004 Jun;20(6):249-51.
[17] Brooke BD. kdr: can a single mutation produce an entire insecticide
resistance phenotype? Transactions of the Royal Society of Tropical Medicine and
Hygiene 2008 Jun;102(6):524-5.
149
[18] Sachs J, Malaney P. The economic and social burden of malaria. Nature
2002 Feb 7;415(6872):680-5.
[19] Amino R, Thiberge S, Martin B, Celli S, Shorte S, Frischknecht F, et al.
Quantitative imaging of Plasmodium transmission from mosquito to mammal.
Nature medicine 2006 Feb;12(2):220-4.
[20] Amino R, Menard R, Frischknecht F. In vivo imaging of malaria parasites--
recent advances and future directions. Current opinion in microbiology 2005
Aug;8(4):407-14.
[21] Sturm A, Amino R, van de Sand C, Regen T, Retzlaff S, Rennenberg A, et
al. Manipulation of host hepatocytes by the malaria parasite for delivery into liver
sinusoids. Science (New York, NY 2006 Sep 1;313(5791):1287-90.
[22] Sturm A, Heussler V. Live and let die: manipulation of host hepatocytes by
exoerythrocytic Plasmodium parasites. Medical microbiology and immunology
2007 Sep;196(3):127-33.
[23] Krotoski WA. Discovery of the hypnozoite and a new theory of malarial
relapse. Transactions of the Royal Society of Tropical Medicine and Hygiene
1985;79(1):1-11.
[24] Anstey NM, Russell B, Yeo TW, Price RN. The pathophysiology of vivax
malaria. Trends in parasitology 2009 May;25(5):220-7.
[25] Bustamante C, Batista CN, Zalis M. Molecular and biological aspects of
antimalarial resistance in Plasmodium falciparum and Plasmodium vivax. Current
drug targets 2009 Mar;10(3):279-90.
150
[26] Boutlis CS, Riley EM, Anstey NM, de Souza JB.
Glycosylphosphatidylinositols in malaria pathogenesis and immunity: potential for
therapeutic inhibition and vaccination. Current topics in microbiology and
immunology 2005;297:145-85.
[27] Parroche P, Lauw FN, Goutagny N, Latz E, Monks BG, Visintin A, et al.
Malaria hemozoin is immunologically inert but radically enhances innate responses
by presenting malaria DNA to Toll-like receptor 9. Proceedings of the National
Academy of Sciences of the United States of America 2007 Feb 6;104(6):1919-24.
[28] Kochar DK, Das A, Kochar SK, Saxena V, Sirohi P, Garg S, et al. Severe
Plasmodium vivax malaria: a report on serial cases from Bikaner in northwestern
India. The American journal of tropical medicine and hygiene 2009 Feb;80(2):194-
8.
[29] Collins WE, Jeffery GM. A retrospective examination of sporozoite- and
trophozoite-induced infections with Plasmodium falciparum: development of
parasitologic and clinical immunity during primary infection. The American journal
of tropical medicine and hygiene 1999 Jul;61(1 Suppl):4-19.
[30] Collins WE, Jeffery GM. A retrospective examination of secondary
sporozoite- and trophozoite-induced infections with Plasmodium falciparum:
development of parasitologic and clinical immunity following secondary infection.
The American journal of tropical medicine and hygiene 1999 Jul;61(1 Suppl):20-35.
[31] Collins WE, Jeffery GM. A retrospective examination of sporozoite- and
trophozoite-induced infections with Plasmodium falciparum in patients previously
infected with heterologous species of Plasmodium: effect on development of
parasitologic and clinical immunity. The American journal of tropical medicine and
hygiene 1999 Jul;61(1 Suppl):36-43.
151
[32] Collins WE, Jeffery GM, Roberts JM. A retrospective examination of
reinfection of humans with Plasmodium vivax. The American journal of tropical
medicine and hygiene 2004 Jun;70(6):642-4.
[33] Collins WE, Jeffery GM. A retrospective examination of sporozoite-induced
and trophozoite-induced infections with Plasmodium ovale: development of
parasitologic and clinical immunity during primary infection. The American journal
of tropical medicine and hygiene 2002 May;66(5):492-502.
[34] Struik SS, Riley EM. Does malaria suffer from lack of memory?
Immunological reviews 2004 Oct;201:268-90.
[35] Rogerson SJ, Hviid L, Duffy PE, Leke RF, Taylor DW. Malaria in pregnancy:
pathogenesis and immunity. The Lancet infectious diseases 2007 Feb;7(2):105-17.
[36] Nussenzweig V, Nussenzweig RS. Rationale for the development of an
engineered sporozoite malaria vaccine. Advances in immunology 1989;45:283-
334.
[37] Chakravarty S, Cockburn IA, Kuk S, Overstreet MG, Sacci JB, Zavala F.
CD8+ T lymphocytes protective against malaria liver stages are primed in skin-
draining lymph nodes. Nature medicine 2007 Sep;13(9):1035-41.
[38] Overstreet MG, Cockburn IA, Chen YC, Zavala F. Protective CD8 T cells
against Plasmodium liver stages: immunobiology of an 'unnatural' immune
response. Immunological reviews 2008 Oct;225:272-83.
[39] Tsuji M, Romero P, Nussenzweig RS, Zavala F. CD4+ cytolytic T cell clone
confers protection against murine malaria. The Journal of experimental medicine
1990 Nov 1;172(5):1353-7.
152
[40] Tsuji M, Zavala F. T cells as mediators of protective immunity against liver
stages of Plasmodium. Trends in parasitology 2003 Feb;19(2):88-93.
[41] Tsuji M, Miyahira Y, Nussenzweig RS, Aguet M, Reichel M, Zavala F.
Development of antimalaria immunity in mice lacking IFN-gamma receptor. J
Immunol 1995 May 15;154(10):5338-44.
[42] Chakravarty S, Baldeviano GC, Overstreet MG, Zavala F. Effector CD8+ T
lymphocytes against liver stages of Plasmodium yoelii do not require gamma
interferon for antiparasite activity. Infection and immunity 2008 Aug;76(8):3628-31.
[43] Kumar KA, Sano G, Boscardin S, Nussenzweig RS, Nussenzweig MC,
Zavala F, et al. The circumsporozoite protein is an immunodominant protective
antigen in irradiated sporozoites. Nature 2006 Dec 14;444(7121):937-40.
[44] Gruner AC, Mauduit M, Tewari R, Romero JF, Depinay N, Kayibanda M, et
al. Sterile protection against malaria is independent of immune responses to the
circumsporozoite protein. PloS one 2007;2(12):e1371.
[45] Tsuji M, Mombaerts P, Lefrancois L, Nussenzweig RS, Zavala F, Tonegawa
S. Gamma delta T cells contribute to immunity against the liver stages of malaria in
alpha beta T-cell-deficient mice. Proceedings of the National Academy of Sciences
of the United States of America 1994 Jan 4;91(1):345-9.
[46] Miller LH, Hoffman SL. Research toward vaccines against malaria. Nature
medicine 1998 May;4(5 Suppl):520-4.
[47] Holder AA. The carboxy-terminus of merozoite surface protein 1: structure,
specific antibodies and immunity to malaria. Parasitology 2009 Oct;136(12):1445-
56.
153
[48] Good MF, Xu H, Wykes M, Engwerda CR. Development and regulation of
cell-mediated immune responses to the blood stages of malaria: implications for
vaccine research. Annual review of immunology 2005;23:69-99.
[49] Bull PC, Lowe BS, Kortok M, Molyneux CS, Newbold CI, Marsh K. Parasite
antigens on the infected red cell surface are targets for naturally acquired immunity
to malaria. Nature medicine 1998 Mar;4(3):358-60.
[50] Carter R, Mendis KN, Miller LH, Molineaux L, Saul A. Malaria transmission-
blocking vaccines--how can their development be supported? Nature medicine
2000 Mar;6(3):241-4.
[51] Kester KE, Cummings JF, Ockenhouse CF, Nielsen R, Hall BT, Gordon DM,
et al. Phase 2a trial of 0, 1, and 3 month and 0, 7, and 28 day immunization
schedules of malaria vaccine RTS,S/AS02 in malaria-naive adults at the Walter
Reed Army Institute of Research. Vaccine 2008 Apr 24;26(18):2191-202.
[52] Kester KE, Cummings JF, Ofori-Anyinam O, Ockenhouse CF, Krzych U,
Moris P, et al. Randomized, Double-Blind, Phase 2a Trial of Falciparum Malaria
Vaccines RTS,S/AS01B and RTS,S/AS02A in Malaria-Naive Adults: Safety,
Efficacy, and Immunologic Associates of Protection. The Journal of infectious
diseases 2009 Aug 1;200(3):337-46.
[53] Alloueche A, Milligan P, Conway DJ, Pinder M, Bojang K, Doherty T, et al.
Protective efficacy of the RTS,S/AS02 Plasmodium falciparum malaria vaccine is
not strain specific. The American journal of tropical medicine and hygiene 2003
Jan;68(1):97-101.
[54] Alonso PL, Sacarlal J, Aponte JJ, Leach A, Macete E, Aide P, et al. Duration
of protection with RTS,S/AS02A malaria vaccine in prevention of Plasmodium
154
falciparum disease in Mozambican children: single-blind extended follow-up of a
randomised controlled trial. Lancet 2005 Dec 10;366(9502):2012-8.
[55] Alonso PL, Sacarlal J, Aponte JJ, Leach A, Macete E, Milman J, et al.
Efficacy of the RTS,S/AS02A vaccine against Plasmodium falciparum infection and
disease in young African children: randomised controlled trial. Lancet 2004 Oct 16-
22;364(9443):1411-20.
[56] Bejon P, Lusingu J, Olotu A, Leach A, Lievens M, Vekemans J, et al.
Efficacy of RTS,S/AS01E vaccine against malaria in children 5 to 17 months of
age. The New England journal of medicine 2008 Dec 11;359(24):2521-32.
[57] Inselburg J, Bathurst IC, Kansopon J, Barr PJ, Rossan R. Protective
immunity induced in Aotus monkeys by a recombinant SERA protein of
Plasmodium falciparum: further studies using SERA 1 and MF75.2 adjuvant.
Infection and immunity 1993 May;61(5):2048-52.
[58] McCoubrie JE, Miller SK, Sargeant T, Good RT, Hodder AN, Speed TP, et
al. Evidence for a common role for the serine-type Plasmodium falciparum serine
repeat antigen proteases: implications for vaccine and drug design. Infection and
immunity 2007 Dec;75(12):5565-74.
[59] Krzych U, Lyon JA, Jareed T, Schneider I, Hollingdale MR, Gordon DM, et
al. T lymphocytes from volunteers immunized with irradiated Plasmodium
falciparum sporozoites recognize liver and blood stage malaria antigens. J
Immunol 1995 Oct 15;155(8):4072-7.
[60] May J, Lell B, Luty AJ, Meyer CG, Kremsner PG. HLA-DQB1*0501-
restricted Th1 type immune responses to Plasmodium falciparum liver stage
antigen 1 protect against malaria anemia and reinfections. The Journal of
infectious diseases 2001 Jan 1;183(1):168-72.
155
[61] Daubersies P, Thomas AW, Millet P, Brahimi K, Langermans JA, Ollomo B,
et al. Protection against Plasmodium falciparum malaria in chimpanzees by
immunization with the conserved pre-erythrocytic liver-stage antigen 3. Nature
medicine 2000 Nov;6(11):1258-63.
[62] Daubersies P, Ollomo B, Sauzet JP, Brahimi K, Perlaza BL, Eling W, et al.
Genetic immunisation by liver stage antigen 3 protects chimpanzees against
malaria despite low immune responses. PloS one 2008;3(7):e2659.
[63] Perlaza BL, Zapata C, Valencia AZ, Hurtado S, Quintero G, Sauzet JP, et al.
Immunogenicity and protective efficacy of Plasmodium falciparum liver-stage Ag-3
in Aotus lemurinus griseimembra monkeys. European journal of immunology 2003
May;33(5):1321-7.
[64] Rodrigues MH, Rodrigues KM, Oliveira TR, Comodo AN, Rodrigues MM,
Kocken CH, et al. Antibody response of naturally infected individuals to
recombinant Plasmodium vivax apical membrane antigen-1. International journal
for parasitology 2005 Feb;35(2):185-92.
[65] Mufalo BC, Gentil F, Bargieri DY, Costa FT, Rodrigues MM, Soares IS.
Plasmodium vivax apical membrane antigen-1: comparative recognition of different
domains by antibodies induced during natural human infection. Microbes and
infection / Institut Pasteur 2008 Oct;10(12-13):1266-73.
[66] Remarque EJ, Faber BW, Kocken CH, Thomas AW. Apical membrane
antigen 1: a malaria vaccine candidate in review. Trends in parasitology 2008
Feb;24(2):74-84.
[67] Roestenberg M, Remarque E, de Jonge E, Hermsen R, Blythman H, Leroy
O, et al. Safety and immunogenicity of a recombinant Plasmodium falciparum
156
AMA1 malaria vaccine adjuvanted with Alhydrogel, Montanide ISA 720 or AS02.
PloS one 2008;3(12):e3960.
[68] Sultan AA, Thathy V, Frevert U, Robson KJ, Crisanti A, Nussenzweig V, et
al. TRAP is necessary for gliding motility and infectivity of plasmodium sporozoites.
Cell 1997 Aug 8;90(3):511-22.
[69] Flanagan KL, Plebanski M, Akinwunmi P, Lee EA, Reece WH, Robson KJ,
et al. Broadly distributed T cell reactivity, with no immunodominant loci, to the pre-
erythrocytic antigen thrombospondin-related adhesive protein of Plasmodium
falciparum in West Africans. European journal of immunology 1999
Jun;29(6):1943-54.
[70] Weedall GD, Preston BM, Thomas AW, Sutherland CJ, Conway DJ.
Differential evidence of natural selection on two leading sporozoite stage malaria
vaccine candidate antigens. International journal for parasitology 2007
Jan;37(1):77-85.
[71] Webster DP, Dunachie S, Vuola JM, Berthoud T, Keating S, Laidlaw SM, et
al. Enhanced T cell-mediated protection against malaria in human challenges by
using the recombinant poxviruses FP9 and modified vaccinia virus Ankara.
Proceedings of the National Academy of Sciences of the United States of America
2005 Mar 29;102(13):4836-41.
[72] Blackman MJ, Heidrich HG, Donachie S, McBride JS, Holder AA. A single
fragment of a malaria merozoite surface protein remains on the parasite during red
cell invasion and is the target of invasion-inhibiting antibodies. The Journal of
experimental medicine 1990 Jul 1;172(1):379-82.
157
[73] Chitarra V, Holm I, Bentley GA, Petres S, Longacre S. The crystal structure
of C-terminal merozoite surface protein 1 at 1.8 A resolution, a highly protective
malaria vaccine candidate. Molecular cell 1999 Apr;3(4):457-64.
[74] Babon JJ, Morgan WD, Kelly G, Eccleston JF, Feeney J, Holder AA.
Structural studies on Plasmodium vivax merozoite surface protein-1. Molecular and
biochemical parasitology 2007 May;153(1):31-40.
[75] Blackman MJ, Ling IT, Nicholls SC, Holder AA. Proteolytic processing of the
Plasmodium falciparum merozoite surface protein-1 produces a membrane-bound
fragment containing two epidermal growth factor-like domains. Molecular and
biochemical parasitology 1991 Nov;49(1):29-33.
[76] Morgan WD, Birdsall B, Frenkiel TA, Gradwell MG, Burghaus PA, Syed SE,
et al. Solution structure of an EGF module pair from the Plasmodium falciparum
merozoite surface protein 1. Journal of molecular biology 1999 May 28;289(1):113-
22.
[77] Saul A, Miller LH. A robust neutralization test for Plasmodium falciparum
malaria. The Journal of experimental medicine 2001 Jun 18;193(12):F51-4.
[78] O'Donnell RA, Saul A, Cowman AF, Crabb BS. Functional conservation of
the malaria vaccine antigen MSP-119across distantly related Plasmodium species.
Nature medicine 2000 Jan;6(1):91-5.
[79] Combe A, Giovannini D, Carvalho TG, Spath S, Boisson B, Loussert C, et
al. Clonal conditional mutagenesis in malaria parasites. Cell host & microbe 2009
Apr 23;5(4):386-96.
158
[80] Wipasa J, Elliott S, Xu H, Good MF. Immunity to asexual blood stage
malaria and vaccine approaches. Immunology and cell biology 2002 Oct;80(5):401-
14.
[81] Corran PH, O'Donnell RA, Todd J, Uthaipibull C, Holder AA, Crabb BS, et al.
The fine specificity, but not the invasion inhibitory activity, of 19-kilodalton
merozoite surface protein 1-specific antibodies is associated with resistance to
malarial parasitemia in a cross-sectional survey in The Gambia. Infection and
immunity 2004 Oct;72(10):6185-9.
[82] Okech BA, Corran PH, Todd J, Joynson-Hicks A, Uthaipibull C, Egwang TG,
et al. Fine specificity of serum antibodies to Plasmodium falciparum merozoite
surface protein, PfMSP-1(19), predicts protection from malaria infection and high-
density parasitemia. Infection and immunity 2004 Mar;72(3):1557-67.
[83] John CC, O'Donnell RA, Sumba PO, Moormann AM, de Koning-Ward TF,
King CL, et al. Evidence that invasion-inhibitory antibodies specific for the 19-kDa
fragment of merozoite surface protein-1 (MSP-1 19) can play a protective role
against blood-stage Plasmodium falciparum infection in individuals in a malaria
endemic area of Africa. J Immunol 2004 Jul 1;173(1):666-72.
[84] Daly TM, Long CA. A recombinant 15-kilodalton carboxyl-terminal fragment
of Plasmodium yoelii yoelii 17XL merozoite surface protein 1 induces a protective
immune response in mice. Infection and immunity 1993 Jun;61(6):2462-7.
[85] Ling IT, Ogun SA, Holder AA. Immunization against malaria with a
recombinant protein. Parasite immunology 1994 Feb;16(2):63-7.
[86] Tian JH, Kumar S, Kaslow DC, Miller LH. Comparison of protection induced
by immunization with recombinant proteins from different regions of merozoite
159
surface protein 1 of Plasmodium yoelii. Infection and immunity 1997
Aug;65(8):3032-6.
[87] Hirunpetcharat C, Tian JH, Kaslow DC, van Rooijen N, Kumar S, Berzofsky
JA, et al. Complete protective immunity induced in mice by immunization with the
19-kilodalton carboxyl-terminal fragment of the merozoite surface protein-1
(MSP1[19]) of Plasmodium yoelii expressed in Saccharomyces cerevisiae:
correlation of protection with antigen-specific antibody titer, but not with effector
CD4+ T cells. J Immunol 1997 Oct 1;159(7):3400-11.
[88] Jeamwattanalert P, Mahakunkijcharoen Y, Kittigul L, Mahannop P,
Pichyangkul S, Hirunpetcharat C. Long-lasting protective immune response to the
19-kilodalton carboxy-terminal fragment of Plasmodium yoelii merozoite surface
protein 1 in mice. Clin Vaccine Immunol 2007 Apr;14(4):342-7.
[89] Ogun SA, Dumon-Seignovert L, Marchand JB, Holder AA, Hill F. The
oligomerization domain of C4-binding protein (C4bp) acts as an adjuvant, and the
fusion protein comprised of the 19-kilodalton merozoite surface protein 1 fused with
the murine C4bp domain protects mice against malaria. Infection and immunity
2008 Aug;76(8):3817-23.
[90] Perera KL, Handunnetti SM, Holm I, Longacre S, Mendis K. Baculovirus
merozoite surface protein 1 C-terminal recombinant antigens are highly protective
in a natural primate model for human Plasmodium vivax malaria. Infection and
immunity 1998 Apr;66(4):1500-6.
[91] Stowers AW, Cioce V, Shimp RL, Lawson M, Hui G, Muratova O, et al.
Efficacy of two alternate vaccines based on Plasmodium falciparum merozoite
surface protein 1 in an Aotus challenge trial. Infection and immunity 2001
Mar;69(3):1536-46.
160
[92] Stowers AW, Chen Lh LH, Zhang Y, Kennedy MC, Zou L, Lambert L, et al.
A recombinant vaccine expressed in the milk of transgenic mice protects Aotus
monkeys from a lethal challenge with Plasmodium falciparum. Proceedings of the
National Academy of Sciences of the United States of America 2002 Jan
8;99(1):339-44.
[93] Ahlborg N, Ling IT, Howard W, Holder AA, Riley EM. Protective immune
responses to the 42-kilodalton (kDa) region of Plasmodium yoelii merozoite surface
protein 1 are induced by the C-terminal 19-kDa region but not by the adjacent 33-
kDa region. Infection and immunity 2002 Feb;70(2):820-5.
[94] Levitus G, Mertens F, Speranca MA, Camargo LM, Ferreira MU, del Portillo
HA. Characterization of naturally acquired human IgG responses against the N-
terminal region of the merozoite surface protein 1 of Plasmodium vivax. The
American journal of tropical medicine and hygiene 1994 Jul;51(1):68-76.
[95] Soares IS, Levitus G, Souza JM, Del Portillo HA, Rodrigues MM. Acquired
immune responses to the N- and C-terminal regions of Plasmodium vivax
merozoite surface protein 1 in individuals exposed to malaria. Infection and
immunity 1997 May;65(5):1606-14.
[96] Cunha MG, Rodrigues MM, Soares IS. Comparison of the immunogenic
properties of recombinant proteins representing the Plasmodium vivax vaccine
candidate MSP1(19) expressed in distinct bacterial vectors. Vaccine 2001 Nov
12;20(3-4):385-96.
[97] Park JW, Moon SH, Yeom JS, Lim KJ, Sohn MJ, Jung WC, et al. Naturally
acquired antibody responses to the C-terminal region of merozoite surface protein
1 of Plasmodium vivax in Korea. Clinical and diagnostic laboratory immunology
2001 Jan;8(1):14-20.
161
[98] Dutta S, Ware LA, Barbosa A, Ockenhouse CF, Lanar DE. Purification,
characterization, and immunogenicity of a disulfide cross-linked Plasmodium vivax
vaccine candidate antigen, merozoite surface protein 1, expressed in Escherichia
coli. Infection and immunity 2001 Sep;69(9):5464-70.
[99] Dutta S, Kaushal DC, Ware LA, Puri SK, Kaushal NA, Narula A, et al.
Merozoite surface protein 1 of Plasmodium vivax induces a protective response
against Plasmodium cynomolgi challenge in rhesus monkeys. Infection and
immunity 2005 Sep;73(9):5936-44.
[100] Kim S, Ahn HJ, Kim TS, Nam HW. ELISA detection of vivax malaria with
recombinant multiple stage-specific antigens and its application to survey of
residents in endemic areas. The Korean journal of parasitology 2003
Dec;41(4):203-7.
[101] Rodrigues MH, Cunha MG, Machado RL, Ferreira OC, Jr., Rodrigues MM,
Soares IS. Serological detection of Plasmodium vivax malaria using recombinant
proteins corresponding to the 19-kDa C-terminal region of the merozoite surface
protein-1. Malaria journal 2003 Nov 14;2(1):39.
[102] Sierra AY, Barrero CA, Rodriguez R, Silva Y, Moncada C, Vanegas M, et al.
Splenectomised and spleen intact Aotus monkeys' immune response to
Plasmodium vivax MSP-1 protein fragments and their high activity binding
peptides. Vaccine 2003 Oct 1;21(27-30):4133-44.
[103] Park SK, Lee KW, Hong SH, Kim DS, Lee JH, Jeon BH, et al. Development
and evaluation of an immunochromatographic kit for the detection of antibody to
Plasmodium vivax infection in South Korea. Yonsei medical journal 2003 Aug
30;44(4):747-50.
162
[104] Espinosa AM, Sierra AY, Barrero CA, Cepeda LA, Cantor EM, Lombo TB, et
al. Expression, polymorphism analysis, reticulocyte binding and serological
reactivity of two Plasmodium vivax MSP-1 protein recombinant fragments. Vaccine
2003 Mar 7;21(11-12):1033-43.
[105] Sachdeva S, Ahmad G, Malhotra P, Mukherjee P, Chauhan VS.
Comparison of immunogenicities of recombinant Plasmodium vivax merozoite
surface protein 1 19- and 42-kiloDalton fragments expressed in Escherichia coli.
Infection and immunity 2004 Oct;72(10):5775-82.
[106] Rosa DS, Iwai LK, Tzelepis F, Bargieri DY, Medeiros MA, Soares IS, et al.
Immunogenicity of a recombinant protein containing the Plasmodium vivax vaccine
candidate MSP1(19) and two human CD4+ T-cell epitopes administered to non-
human primates (Callithrix jacchus jacchus). Microbes and infection / Institut
Pasteur 2006 Jul;8(8):2130-7.
[107] Gibson HL, Tucker JE, Kaslow DC, Krettli AU, Collins WE, Kiefer MC, et al.
Structure and expression of the gene for Pv200, a major blood-stage surface
antigen of Plasmodium vivax. Molecular and biochemical parasitology 1992
Feb;50(2):325-33.
[108] Kaslow DC, Kumar S. Expression and immunogenicity of the C-terminus of
a major blood-stage surface protein of Plasmodium vivax, Pv200(19), secreted
from Saccharomyces cerevisiae. Immunology letters 1996 Jul;51(3):187-9.
[109] Soares IS, Oliveira SG, Souza JM, Rodrigues MM. Antibody response to the
N and C-terminal regions of the Plasmodium vivax Merozoite Surface Protein 1 in
individuals living in an area of exclusive transmission of P. vivax malaria in the
north of Brazil. Acta tropica 1999 Jan 15;72(1):13-24.
163
[110] Longacre S, Mendis KN, David PH. Plasmodium vivax merozoite surface
protein 1 C-terminal recombinant proteins in baculovirus. Molecular and
biochemical parasitology 1994 Apr;64(2):191-205.
[111] Soares IS, Rodrigues MM. Immunogenic properties of the Plasmodium vivax
vaccine candidate MSP1(19) expressed as a secreted non-glycosylated
polypeptide from Pichia pastoris. Parasitology 2002 Mar;124(Pt 3):237-46.
[112] Han HJ, Park SG, Kim SH, Hwang SY, Han J, Traicoff J, et al. Epidermal
growth factor-like motifs 1 and 2 of Plasmodium vivax merozoite surface protein 1
are critical domains in erythrocyte invasion. Biochemical and biophysical research
communications 2004 Jul 23;320(2):563-70.
[113] Pitabut N, Panichakorn J, Mahakunkijcharoen Y, Hirunpetcharat C,
Looareesuwan S, Khusmith S. IgG antibody profile to c-terminal region of
Plasmodium vivax merozoite surface protein-1 in Thai individuals exposed to
malaria. The Southeast Asian journal of tropical medicine and public health 2007
Jan;38(1):1-7.
[114] Lim KJ, Park JW, Sohn MJ, Lee S, Oh JH, Kim HC, et al. A direct sandwich
ELISA to detect antibodies against the C-terminal region of merozoite surface
protein 1 could be a useful diagnostic method to identify Plasmodium vivax
exposed persons. Parasitology research 2002 Sep;88(9):855-60.
[115] Park JW, Yoo SB, Oh JH, Yeom JS, Lee YH, Bahk YY, et al. Diagnosis of
vivax malaria using an IgM capture ELISA is a sensitive method, even for low
levels of parasitemia. Parasitology research 2008 Aug;103(3):625-31.
[116] Morais CG, Soares IS, Carvalho LH, Fontes CJ, Krettli AU, Braga EM. IgG
isotype to C-terminal 19 kDa of Plasmodium vivax merozoite surface protein 1
164
among subjects with different levels of exposure to malaria in Brazil. Parasitology
research 2005 Apr;95(6):420-6.
[117] Lim KJ, Park JW, Yeom JS, Lee YH, Yoo SB, Oh JH, et al. Humoral
responses against the C-terminal region of merozoite surface protein 1 can be
remembered for more than 30 years in persons exposed to Plasmodium vivax.
Parasitology research 2004 Mar;92(5):384-9.
[118] Pasay MC, Cheng Q, Rzepczyk C, Saul A. Dimorphism of the C terminus of
the Plasmodium vivax merozoite surface protein 1. Molecular and biochemical
parasitology 1995 Mar;70(1-2):217-9.
[119] Soares IS, Barnwell JW, Ferreira MU, Gomes Da Cunha M, Laurino JP,
Castilho BA, et al. A Plasmodium vivax vaccine candidate displays limited allele
polymorphism, which does not restrict recognition by antibodies. Molecular
medicine (Cambridge, Mass 1999 Jul;5(7):459-70.
[120] Barrero CA, Delgado G, Sierra AY, Silva Y, Parra-Lopez C, Patarroyo MA.
Gamma interferon levels and antibody production induced by two PvMSP-1
recombinant polypeptides are associated with protective immunity against P.vivax
in Aotus monkeys. Vaccine 2005 Jul 1;23(31):4048-53.
[121] Rosa DS, Tzelepis F, Cunha MG, Soares IS, Rodrigues MM. The pan HLA
DR-binding epitope improves adjuvant-assisted immunization with a recombinant
protein containing a malaria vaccine candidate. Immunology letters 2004 Apr
15;92(3):259-68.
[122] Holder AA, Freeman RR. Biosynthesis and processing of a Plasmodium
falciparum schizont antigen recognized by immune serum and a monoclonal
antibody. The Journal of experimental medicine 1982 Nov 1;156(5):1528-38.
165
[123] Holder AA, Freeman RR. The three major antigens on the surface of
Plasmodium falciparum merozoites are derived from a single high molecular weight
precursor. The Journal of experimental medicine 1984 Aug 1;160(2):624-9.
[124] Siddiqui WA, Tam LQ, Kramer KJ, Hui GS, Case SE, Yamaga KM, et al.
Merozoite surface coat precursor protein completely protects Aotus monkeys
against Plasmodium falciparum malaria. Proceedings of the National Academy of
Sciences of the United States of America 1987 May;84(9):3014-8.
[125] Holder AA. The precursor to major merozoite surface antigens: structure
and role in immunity. Progress in allergy 1988;41:72-97.
[126] Tanabe K, Mackay M, Goman M, Scaife JG. Allelic dimorphism in a surface
antigen gene of the malaria parasite Plasmodium falciparum. Journal of molecular
biology 1987 May 20;195(2):273-87.
[127] Conway DJ, Cavanagh DR, Tanabe K, Roper C, Mikes ZS, Sakihama N, et
al. A principal target of human immunity to malaria identified by molecular
population genetic and immunological analyses. Nature medicine 2000
Jun;6(6):689-92.
[128] Tolle R, Fruh K, Doumbo O, Koita O, N'Diaye M, Fischer A, et al. A
prospective study of the association between the human humoral immune
response to Plasmodium falciparum blood stage antigen gp190 and control of
malarial infections. Infection and immunity 1993 Jan;61(1):40-7.
[129] Galamo CD, Jafarshad A, Blanc C, Druilhe P. Anti-MSP1 block 2 antibodies
are effective at parasite killing in an allele-specific manner by monocyte-mediated
antibody-dependent cellular inhibition. The Journal of infectious diseases 2009 Apr
15;199(8):1151-4.
166
[130] Kabilan L, Sharma VP, Kaur P, Ghosh SK, Yadav RS, Chauhan VS. Cellular
and humoral immune responses to well-defined blood stage antigens (major
merozoite surface antigen) of Plasmodium falciparum in adults from an Indian zone
where malaria is endemic. Infection and immunity 1994 Feb;62(2):685-91.
[131] Egan AF, Chappel JA, Burghaus PA, Morris JS, McBride JS, Holder AA, et
al. Serum antibodies from malaria-exposed people recognize conserved epitopes
formed by the two epidermal growth factor motifs of MSP1(19), the carboxy-
terminal fragment of the major merozoite surface protein of Plasmodium
falciparum. Infection and immunity 1995 Feb;63(2):456-66.
[132] Stanisic DI, Richards JS, McCallum FJ, Michon P, King CL, Schoepflin S, et
al. Immunoglobulin G subclass-specific responses against Plasmodium falciparum
merozoite antigens are associated with control of parasitemia and protection from
symptomatic illness. Infection and immunity 2009 Mar;77(3):1165-74.
[133] Torres KJ, Clark EH, Hernandez JN, Soto-Cornejo KE, Gamboa D, Branch
OH. Antibody response dynamics to the Plasmodium falciparum conserved
vaccine candidate antigen, merozoite surface protein-1 C-terminal 19kD (MSP1-
19kD), in Peruvians exposed to hypoendemic malaria transmission. Malaria journal
2008;7:173.
[134] Branch OH, Udhayakumar V, Hightower AW, Oloo AJ, Hawley WA, Nahlen
BL, et al. A longitudinal investigation of IgG and IgM antibody responses to the
merozoite surface protein-1 19-kiloDalton domain of Plasmodium falciparum in
pregnant women and infants: associations with febrile illness, parasitemia, and
anemia. The American journal of tropical medicine and hygiene 1998
Feb;58(2):211-9.
[135] Egan AF, Morris J, Barnish G, Allen S, Greenwood BM, Kaslow DC, et al.
Clinical immunity to Plasmodium falciparum malaria is associated with serum
167
antibodies to the 19-kDa C-terminal fragment of the merozoite surface antigen,
PfMSP-1. The Journal of infectious diseases 1996 Mar;173(3):765-9.
[136] Osier FH, Fegan G, Polley SD, Murungi L, Verra F, Tetteh KK, et al. Breadth
and magnitude of antibody responses to multiple Plasmodium falciparum
merozoite antigens are associated with protection from clinical malaria. Infection
and immunity 2008 May;76(5):2240-8.
[137] Singer LM, Mirel LB, ter Kuile FO, Branch OH, Vulule JM, Kolczak MS, et al.
The effects of varying exposure to malaria transmission on development of
antimalarial antibody responses in preschool children. XVI. Asembo Bay Cohort
Project. The Journal of infectious diseases 2003 Jun 1;187(11):1756-64.
[138] Nebie I, Diarra A, Ouedraogo A, Soulama I, Bougouma EC, Tiono AB, et al.
Humoral responses to Plasmodium falciparum blood-stage antigens and
association with incidence of clinical malaria in children living in an area of
seasonal malaria transmission in Burkina Faso, West Africa. Infection and
immunity 2008 Feb;76(2):759-66.
[139] Riley EM, Allen SJ, Wheeler JG, Blackman MJ, Bennett S, Takacs B, et al.
Naturally acquired cellular and humoral immune responses to the major merozoite
surface antigen (PfMSP1) of Plasmodium falciparum are associated with reduced
malaria morbidity. Parasite immunology 1992 May;14(3):321-37.
[140] Lyon JA, Angov E, Fay MP, Sullivan JS, Girourd AS, Robinson SJ, et al.
Protection induced by Plasmodium falciparum MSP1(42) is strain-specific, antigen
and adjuvant dependent, and correlates with antibody responses. PloS one
2008;3(7):e2830.
[141] Dent AE, Bergmann-Leitner ES, Wilson DW, Tisch DJ, Kimmel R, Vulule J,
et al. Antibody-mediated growth inhibition of Plasmodium falciparum: relationship
168
to age and protection from parasitemia in Kenyan children and adults. PloS one
2008;3(10):e3557.
[142] Darko CA, Angov E, Collins WE, Bergmann-Leitner ES, Girouard AS, Hitt
SL, et al. The clinical-grade 42-kilodalton fragment of merozoite surface protein 1
of Plasmodium falciparum strain FVO expressed in Escherichia coli protects Aotus
nancymai against challenge with homologous erythrocytic-stage parasites.
Infection and immunity 2005 Jan;73(1):287-97.
[143] Burghaus PA, Wellde BT, Hall T, Richards RL, Egan AF, Riley EM, et al.
Immunization of Aotus nancymai with recombinant C terminus of Plasmodium
falciparum merozoite surface protein 1 in liposomes and alum adjuvant does not
induce protection against a challenge infection. Infection and immunity 1996
Sep;64(9):3614-9.
[144] Saul A, Lawrence G, Smillie A, Rzepczyk CM, Reed C, Taylor D, et al.
Human phase I vaccine trials of 3 recombinant asexual stage malaria antigens with
Montanide ISA720 adjuvant. Vaccine 1999 Aug 6;17(23-24):3145-59.
[145] Kumar S, Yadava A, Keister DB, Tian JH, Ohl M, Perdue-Greenfield KA, et
al. Immunogenicity and in vivo efficacy of recombinant Plasmodium falciparum
merozoite surface protein-1 in Aotus monkeys. Molecular medicine (Cambridge,
Mass 1995 Mar;1(3):325-32.
[146] Pan W, Huang D, Zhang Q, Qu L, Zhang D, Zhang X, et al. Fusion of two
malaria vaccine candidate antigens enhances product yield, immunogenicity, and
antibody-mediated inhibition of parasite growth in vitro. J Immunol 2004 May
15;172(10):6167-74.
[147] Chang SP, Gibson HL, Lee-Ng CT, Barr PJ, Hui GS. A carboxyl-terminal
fragment of Plasmodium falciparum gp195 expressed by a recombinant
169
baculovirus induces antibodies that completely inhibit parasite growth. J Immunol
1992 Jul 15;149(2):548-55.
[148] Ramon G. Sur la toxine et surranatoxine diphtheriques. Ann Inst Pasteur
1924;38:1-7.
[149] Glenny AT, Pope CG, Waddington H, Wallace U. The antigenic value of
toxoid precipitated by potassium alum. J Pathol Bacteriol 1926;29:38-45.
[150] Freund J, Casals J, Hosmer EP. Sensitization and antibody formation after
injection of tubercle bacilli and paraffin oil. Proc Soc Exp Biol Med 1937;37:509-13.
[151] Pashine A, Valiante NM, Ulmer JB. Targeting the innate immune response
with improved vaccine adjuvants. Nature medicine 2005 Apr;11(4 Suppl):S63-8.
[152] Wu Y, Ellis RD, Shaffer D, Fontes E, Malkin EM, Mahanty S, et al. Phase 1
trial of malaria transmission blocking vaccine candidates Pfs25 and Pvs25
formulated with montanide ISA 51. PloS one 2008;3(7):e2636.
[153] Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA. The
dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent
antifungal response in Drosophila adults. Cell 1996 Sep 20;86(6):973-83.
[154] Anderson KV, Bokla L, Nusslein-Volhard C. Establishment of dorsal-ventral
polarity in the Drosophila embryo: the induction of polarity by the Toll gene product.
Cell 1985 Oct;42(3):791-8.
[155] Anderson KV, Jurgens G, Nusslein-Volhard C. Establishment of dorsal-
ventral polarity in the Drosophila embryo: genetic studies on the role of the Toll
gene product. Cell 1985 Oct;42(3):779-89.
170
[156] Medzhitov R, Preston-Hurlburt P, Janeway CA, Jr. A human homologue of
the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997 Jul
24;388(6640):394-7.
[157] Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, et al. Defective
LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene.
Science (New York, NY 1998 Dec 11;282(5396):2085-8.
[158] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate
immunity. Cell 2006 Feb 24;124(4):783-801.
[159] Kwissa M, Kasturi SP, Pulendran B. The science of adjuvants. Expert review
of vaccines 2007 Oct;6(5):673-84.
[160] Abdulla S, Oberholzer R, Juma O, Kubhoja S, Machera F, Membi C, et al.
Safety and immunogenicity of RTS,S/AS02D malaria vaccine in infants. The New
England journal of medicine 2008 Dec 11;359(24):2533-44.
[161] Sacarlal J, Aide P, Aponte JJ, Renom M, Leach A, Mandomando I, et al.
Long-Term Safety and Efficacy of the RTS,S/AS02A Malaria Vaccine in
Mozambican Children. The Journal of infectious diseases 2009 Aug 1;200(3):329-
36.
[162] Li S, Locke E, Bruder J, Clarke D, Doolan DL, Havenga MJ, et al. Viral
vectors for malaria vaccine development. Vaccine 2007 Mar 30;25(14):2567-74.
[163] Heppner DG, Jr., Kester KE, Ockenhouse CF, Tornieporth N, Ofori O, Lyon
JA, et al. Towards an RTS,S-based, multi-stage, multi-antigen vaccine against
falciparum malaria: progress at the Walter Reed Army Institute of Research.
Vaccine 2005 Mar 18;23(17-18):2243-50.
171
[164] Ogutu BR, Apollo OJ, McKinney D, Okoth W, Siangla J, Dubovsky F, et al.
Blood stage malaria vaccine eliciting high antigen-specific antibody concentrations
confers no protection to young children in Western Kenya. PloS one
2009;4(3):e4708.
[165] Grdic D, Ekman L, Schon K, Lindgren K, Mattsson J, Magnusson KE, et al.
Splenic marginal zone dendritic cells mediate the cholera toxin adjuvant effect:
dependence on the ADP-ribosyltransferase activity of the holotoxin. J Immunol
2005 Oct 15;175(8):5192-202.
[166] Boberg A, Gaunitz S, Brave A, Wahren B, Carlin N. Enhancement of
epitope-specific cellular immune responses by immunization with HIV-1 peptides
genetically conjugated to the B-subunit of recombinant cholera toxin. Vaccine 2008
Sep 19;26(40):5079-82.
[167] Nystrom-Asklin J, Adamsson J, Harandi AM. The adjuvant effect of CpG
oligodeoxynucleotide linked to the non-toxic B subunit of cholera toxin for induction
of immunity against H. pylori in mice. Scandinavian journal of immunology 2008
May;67(5):431-40.
[168] Kim HJ, Kim JK, Seo SB, Lee HJ, Kim HJ. Intranasal vaccination with
peptides and cholera toxin subunit B as adjuvant to enhance mucosal and
systemic immunity to respiratory syncytial virus. Archives of pharmacal research
2007 Mar;30(3):366-71.
[169] Asahi-Ozaki Y, Itamura S, Ichinohe T, Strong P, Tamura S, Takahashi H, et
al. Intranasal administration of adjuvant-combined recombinant influenza virus HA
vaccine protects mice from the lethal H5N1 virus infection. Microbes and infection /
Institut Pasteur 2006 Oct;8(12-13):2706-14.
172
[170] Matoba N, Geyer BC, Kilbourne J, Alfsen A, Bomsel M, Mor TS. Humoral
immune responses by prime-boost heterologous route immunizations with CTB-
MPR(649-684), a mucosal subunit HIV/AIDS vaccine candidate. Vaccine 2006 Jun
5;24(23):5047-55.
[171] Dell K, Koesters R, Linnebacher M, Klein C, Gissmann L. Intranasal
immunization with human papillomavirus type 16 capsomeres in the presence of
non-toxic cholera toxin-based adjuvants elicits increased vaginal immunoglobulin
levels. Vaccine 2006 Mar 20;24(13):2238-47.
[172] Hirunpetcharat C, Stanisic D, Liu XQ, Vadolas J, Strugnell RA, Lee R, et al.
Intranasal immunization with yeast-expressed 19 kD carboxyl-terminal fragment of
Plasmodium yoelii merozoite surface protein-1 (yMSP119) induces protective
immunity to blood stage malaria infection in mice. Parasite immunology 1998
Sep;20(9):413-20.
[173] Sun JB, Czerkinsky C, Holmgren J. Sublingual 'oral tolerance' induction with
antigen conjugated to cholera toxin B subunit generates regulatory T cells that
induce apoptosis and depletion of effector T cells. Scandinavian journal of
immunology 2007 Aug-Sep;66(2-3):278-86.
[174] Sun JB, Raghavan S, Sjoling A, Lundin S, Holmgren J. Oral tolerance
induction with antigen conjugated to cholera toxin B subunit generates both
Foxp3+CD25+ and Foxp3-CD25- CD4+ regulatory T cells. J Immunol 2006 Dec
1;177(11):7634-44.
[175] Sanchez J, Holmgren J. Cholera toxin structure, gene regulation and
pathophysiological and immunological aspects. Cell Mol Life Sci 2008
May;65(9):1347-60.
173
[176] D'Ambrosio A, Colucci M, Pugliese O, Quintieri F, Boirivant M. Cholera toxin
B subunit promotes the induction of regulatory T cells by preventing human
dendritic cell maturation. Journal of leukocyte biology 2008 Sep;84(3):661-8.
[177] McCluskie MJ, Davis HL. Oral, intrarectal and intranasal immunizations
using CpG and non-CpG oligodeoxynucleotides as adjuvants. Vaccine 2000 Oct
15;19(4-5):413-22.
[178] McCluskie MJ, Weeratna RD, Davis HL. The potential of
oligodeoxynucleotides as mucosal and parenteral adjuvants. Vaccine 2001 Mar
21;19(17-19):2657-60.
[179] Freytag LC, Clements JD. Mucosal adjuvants. Vaccine 2005 Mar
7;23(15):1804-13.
[180] Ramos HC, Rumbo M, Sirard JC. Bacterial flagellins: mediators of
pathogenicity and host immune responses in mucosa. Trends in microbiology 2004
Nov;12(11):509-17.
[181] Yonekura K, Maki-Yonekura S, Namba K. Complete atomic model of the
bacterial flagellar filament by electron cryomicroscopy. Nature 2003 Aug
7;424(6949):643-50.
[182] Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR, et al. The
innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.
Nature 2001 Apr 26;410(6832):1099-103.
[183] Smith KD, Andersen-Nissen E, Hayashi F, Strobe K, Bergman MA, Barrett
SL, et al. Toll-like receptor 5 recognizes a conserved site on flagellin required for
protofilament formation and bacterial motility. Nature immunology 2003
Dec;4(12):1247-53.
174
[184] Means TK, Hayashi F, Smith KD, Aderem A, Luster AD. The Toll-like
receptor 5 stimulus bacterial flagellin induces maturation and chemokine
production in human dendritic cells. J Immunol 2003 May 15;170(10):5165-75.
[185] Arimilli S, Johnson JB, Clark KM, Graff AH, Alexander-Miller MA, Mizel SB,
et al. Engineered expression of the TLR5 ligand flagellin enhances paramyxovirus
activation of human dendritic cell function. Journal of virology 2008
Nov;82(22):10975-85.
[186] Merlo A, Calcaterra C, Menard S, Balsari A. Cross-talk between toll-like
receptors 5 and 9 on activation of human immune responses. Journal of leukocyte
biology 2007 Sep;82(3):509-18.
[187] Agrawal S, Agrawal A, Doughty B, Gerwitz A, Blenis J, Van Dyke T, et al.
Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce
distinct Th responses via differential modulation of extracellular signal-regulated
kinase-mitogen-activated protein kinase and c-Fos. J Immunol 2003 Nov
15;171(10):4984-9.
[188] Didierlaurent A, Ferrero I, Otten LA, Dubois B, Reinhardt M, Carlsen H, et al.
Flagellin promotes myeloid differentiation factor 88-dependent development of
Th2-type response. J Immunol 2004 Jun 1;172(11):6922-30.
[189] Bates JT, Uematsu S, Akira S, Mizel SB. Direct stimulation of tlr5+/+
CD11c+ cells is necessary for the adjuvant activity of flagellin. J Immunol 2009 Jun
15;182(12):7539-47.
[190] Sanders CJ, Franchi L, Yarovinsky F, Uematsu S, Akira S, Nunez G, et al.
Induction of adaptive immunity by flagellin does not require robust activation of
innate immunity. European journal of immunology 2009 Feb;39(2):359-71.
175
[191] Miao EA, Alpuche-Aranda CM, Dors M, Clark AE, Bader MW, Miller SI, et al.
Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1beta via
Ipaf. Nature immunology 2006 Jun;7(6):569-75.
[192] Franchi L, Amer A, Body-Malapel M, Kanneganti TD, Ozoren N, Jagirdar R,
et al. Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin
1beta in salmonella-infected macrophages. Nature immunology 2006 Jun;7(6):576-
82.
[193] Lamkanfi M, Amer A, Kanneganti TD, Munoz-Planillo R, Chen G,
Vandenabeele P, et al. The Nod-like receptor family member Naip5/Birc1e restricts
Legionella pneumophila growth independently of caspase-1 activation. J Immunol
2007 Jun 15;178(12):8022-7.
[194] Zamboni DS, Kobayashi KS, Kohlsdorf T, Ogura Y, Long EM, Vance RE, et
al. The Birc1e cytosolic pattern-recognition receptor contributes to the detection
and control of Legionella pneumophila infection. Nature immunology 2006
Mar;7(3):318-25.
[195] Vinzing M, Eitel J, Lippmann J, Hocke AC, Zahlten J, Slevogt H, et al. NAIP
and Ipaf control Legionella pneumophila replication in human cells. J Immunol
2008 May 15;180(10):6808-15.
[196] Ren T, Zamboni DS, Roy CR, Dietrich WF, Vance RE. Flagellin-deficient
Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity.
PLoS pathogens 2006 Mar;2(3):e18.
[197] Newton SM, Jacob CO, Stocker BA. Immune response to cholera toxin
epitope inserted in Salmonella flagellin. Science (New York, NY 1989 Apr
7;244(4900):70-2.
176
[198] McEwen J, Levi R, Horwitz RJ, Arnon R. Synthetic recombinant vaccine
expressing influenza haemagglutinin epitope in Salmonella flagellin leads to partial
protection in mice. Vaccine 1992;10(6):405-11.
[199] Ben-Yedidia T, Tarrab-Hazdai R, Schechtman D, Arnon R. Intranasal
administration of synthetic recombinant peptide-based vaccine protects mice from
infection by Schistosoma mansoni. Infection and immunity 1999 Sep;67(9):4360-6.
[200] Cuadros C, Lopez-Hernandez FJ, Dominguez AL, McClelland M, Lustgarten
J. Flagellin fusion proteins as adjuvants or vaccines induce specific immune
responses. Infection and immunity 2004 May;72(5):2810-6.
[201] Chauhan N, Kumar R, Badhai J, Preet A, Yadava PK. Immunogenicity of
cholera toxin B epitope inserted in Salmonella flagellin expressed on bacteria and
administered as DNA vaccine. Molecular and cellular biochemistry 2005
Aug;276(1-2):1-6.
[202] Huleatt JW, Jacobs AR, Tang J, Desai P, Kopp EB, Huang Y, et al.
Vaccination with recombinant fusion proteins incorporating Toll-like receptor
ligands induces rapid cellular and humoral immunity. Vaccine 2007 Jan
8;25(4):763-75.
[203] Wang BZ, Quan FS, Kang SM, Bozja J, Skountzou I, Compans RW.
Incorporation of membrane-anchored flagellin into influenza virus-like particles
enhances the breadth of immune responses. Journal of virology 2008
Dec;82(23):11813-23.
[204] Huleatt JW, Nakaar V, Desai P, Huang Y, Hewitt D, Jacobs A, et al. Potent
immunogenicity and efficacy of a universal influenza vaccine candidate comprising
177
a recombinant fusion protein linking influenza M2e to the TLR5 ligand flagellin.
Vaccine 2008 Jan 10;26(2):201-14.
[205] Song L, Nakaar V, Kavita U, Price A, Huleatt J, Tang J, et al. Efficacious
recombinant influenza vaccines produced by high yield bacterial expression: a
solution to global pandemic and seasonal needs. PloS one 2008;3(5):e2257.
[206] Adar Y, Singer Y, Levi R, Tzehoval E, Perk S, Banet-Noach C, et al. A
universal epitope-based influenza vaccine and its efficacy against H5N1. Vaccine
2009 Mar 26;27(15):2099-107.
[207] Le Moigne V, Robreau G, Mahana W. Flagellin as a good carrier and potent
adjuvant for Th1 response: study of mice immune response to the p27 (Rv2108)
Mycobacterium tuberculosis antigen. Molecular immunology 2008 May;45(9):2499-
507.
[208] Braga CJ, Rittner GM, Munoz Henao JE, Teixeira AF, Massis LM, Sbrogio-
Almeida ME, et al. Paracoccidioides brasiliensis vaccine formulations based on the
gp43-derived P10 sequence and the Salmonella enterica FliC flagellin. Infection
and immunity 2009 Apr;77(4):1700-7.
[209] Pino O, Martin M, Michalek SM. Cellular mechanisms of the adjuvant activity
of the flagellin component FljB of Salmonella enterica Serovar Typhimurium to
potentiate mucosal and systemic responses. Infection and immunity 2005
Oct;73(10):6763-70.
[210] Lee SE, Kim SY, Jeong BC, Kim YR, Bae SJ, Ahn OS, et al. A bacterial
flagellin, Vibrio vulnificus FlaB, has a strong mucosal adjuvant activity to induce
protective immunity. Infection and immunity 2006 Jan;74(1):694-702.
178
[211] McDonald WF, Huleatt JW, Foellmer HG, Hewitt D, Tang J, Desai P, et al. A
West Nile virus recombinant protein vaccine that coactivates innate and adaptive
immunity. J Infect Dis 2007 Jun 1;195(11):1607-17.
[212] Honko AN, Sriranganathan N, Lees CJ, Mizel SB. Flagellin is an effective
adjuvant for immunization against lethal respiratory challenge with Yersinia pestis.
Infection and immunity 2006 Feb;74(2):1113-20.
[213] Mizel SB, Graff AH, Sriranganathan N, Ervin S, Lees CJ, Lively MO, et al.
Flagellin-F1-V fusion protein is an effective plague vaccine in mice and two species
of nonhuman primates. Clin Vaccine Immunol 2009 Jan;16(1):21-8.
[214] Burdelya LG, Krivokrysenko VI, Tallant TC, Strom E, Gleiberman AS, Gupta
D, et al. An agonist of toll-like receptor 5 has radioprotective activity in mouse and
primate models. Science (New York, NY 2008 Apr 11;320(5873):226-30.
[215] Sfondrini L, Rossini A, Besusso D, Merlo A, Tagliabue E, Menard S, et al.
Antitumor activity of the TLR-5 ligand flagellin in mouse models of cancer. J
Immunol 2006 Jun 1;176(11):6624-30.
[216] Bueno LL, Fujiwara RT, Soares IS, Braga EM. Direct effect of Plasmodium
vivax recombinant vaccine candidates AMA-1 and MSP-119 on the innate immune
response. Vaccine 2008 Feb 26;26(9):1204-13.
[217] Bueno LL, Morais CG, Soares Ida S, Bouillet LE, Bruna-Romero O, Fontes
CJ, et al. Plasmodium vivax recombinant vaccine candidate AMA-1 plays an
important role in adaptive immune response eliciting differentiation of dendritic
cells. Vaccine 2009 Sep 18;27(41):5581-8.
179
ABSTRACT
The C-terminal region of Plasmodium merozoite surface protein 1
(MSP1
19
) is being studied as one of the main targets for the development of a
vaccine against malaria. Several studies have shown high imunogenicity of this
region in experimental immunizations when injected in the presence of strong
adjuvant formulations.
In the present study we evaluate the possibility of using recombinant
proteins based on the sequence of MSP1
19
to immunize mice by a mucosal route.
Also, we generate new recombinant proteins consisting in the genetic fusion of the
MSP1
19
to the flagellin FliC (flagellar protein of Salmonella enterica Typhimurium),
to increase the immunogenicity of the antigen.
Initially, we evaluated the capacity of the molecules cholera toxin (CT),
heat-labile E. coli enterotixin (LT) or CpG ODN 1826, to act as adjuvants in
mucosal intranasal immunization of mice with the recombinant proteins
His
6
PvMSP1
19
or His
6
PvMSP1
19
-PADRE (containing the universal T helper epitope
PADRE). When administered in the presence of CT or LT, both recombinant
proteins were highly immunogenic by the intranasal route. CpG ODN 1826 was
less efficient as adjuvant by this route. The addition of CpG ODN 1826 in CT
adjuvanted immunizations increased the specific IgG2c titers. These results
showed that CT and LT are potent mucosal adjuvants in immunizations with
recombinant malaria antigens and that CpG ODN 1826 can, in this case, be used
as a tool to modulate the pattern of the immune response.
Subsequently, we expressed a recombinant protein consisting of the
sequence of PvMSP1
19
-PADRE genetically fused to FliC (His
6
FliC-PvMSP1
19
-
PADRE). We showed that this fusion protein preserved the antigenic properties of
PvMSP1
19
and the ability of flagellin to activate TLR5. The immunization of mice
using this recombinant fusion protein induced high titers of specific antibodies and
the presence of antigen-specific IFN-γ producing cells in the spleen. The addition of
CpG ODN 1826 in the vaccine formulations modulated the immune response by
augmenting the specific titers of IgG2c. In addition, sera from immunized mice
recognized the parasite in indirect immunofluorescence assay (IFA). Our results
180
provided a new class of malaria vaccine formulation with intrinsic adjuvant property
capable of stimulating specific humoral and cellular immune responses when
administered alone or in the presence of other adjuvants.
Finally, we expressed a recombinant protein containing the sequence of
Plamodium falciparum MSP1
19
(PfMSP1
19
) fused to FliC (His
6
FliC-PfMSP1
19
). This
fusion protein retained the capacity of flagellin to activate TLR5. Immunization of
mice with the His
6
FliC-PfMSP1
19
alone induced high titers of specific antibodies
and IFN-γ producing cells. The addition of adjuvants such as CpG ODN 1826 or
Quil-A (saponin of Quillaja saponaria) increased the levels of IgG2c and the
cellular immune response, measured by the IFN-γ secretion by immune spleen
cells in culture. In addition, sera from immunized rabbits recognized the parasites
in IFA and inhibited parasite growth in vitro. These results provide evidences that
the fusion of malaria antigens to flagellin is an inexpensive and viable alternative
for the development of a malaria vaccine.
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
