( PDF ) A Chiquimato desidrogenase de Mycobacterium tuberculosis: mutagênese sítio-direcionada, expressão, purificação e caracterização da enzima mutante K69A

Download PDF

ads:

UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL

CENTRO DE BIOTECNOLOGIA

PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA CELULAR E MOLECULAR

A chiquimato desidrogenase de Mycobacterium tuberculosis:

mutagênese sítio-direcionada, expressão, purificação e

caracterização da enzima mutante K69A

Valnês da Silva Rodrigues Junior

Orientador: Prof. Dr. Luiz Augusto Basso

Dissertação submetida ao Programa de

Pós-graduação em Biologia Celular e

Molecular do Centro de Biotecnologia da

UFRGS como pré-requisito para a obtenção

do grau de Mestre.

Porto Alegre, junho de 2008

ads:

Livros Grátis

http://www.livrosgratis.com.br

Milhares de livros grátis para download.

Este trabalho foi desenvolvido no Centro de Pesquisas em Biologia

Molecular e Funcional (CPBMF) da Pontifícia Universidade Católica do Rio

Grande do Sul.

Agências Financiadoras:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES);

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq);

Programa Millennium, Ministério da Ciência e Tecnologia – CNPq;

Ministério da Saúde – Departamento de Ciência e Tecnologia – UNESCO.

ads:

AGRADECIMENTOS

Aos meus orientadores, Diógenes Santiago Santos e Luiz Augusto

Basso pela confiança depositada e pelo apoio intelectual sempre prestado;

À minha comissão de acompanhamento, Professora Jeniffer Saffi e, em

especial, ao Professor Giancarlo Pasquali, pela atenção e pela cuidadosa

revisão desta dissertação;

Aos Professores Arthur G. Fett Neto e Jeverson Frazzon pela revisão

dos manuscritos e sugestões;

Aos colegas e amigos do CPBMF, pela amizade, companheirismo, e por

serem exemplo concreto de equipe de trabalho: Ana Letícia, Ana Paula, Anne,

Adriana, Adriano, Ardala, Bruna, Cândida, Christiano, Cristiane, Cristopher,

Clarissa, Cláudia, Daiana, Ekaterine, Eraldo, Fábio, Fernanda, Gaby, Gisele,

Glecy, Heique, Isabel, Jacqueline, Jocelei, Jordana, Juleane, Léia, Leonardo,

Luís, Nani, Igor, Paula, Paulo, Priscila, Raquel, Renilda, Rodrigo, Sara, Thiago,

Zé Eduardo;

À Sílvia e ao Luciano pela gentileza e atenção;

A todos os meus amigos e familiares pelas sinceras demonstrações de

apoio e carinho;

Por fim, e mais importante, aos meus pais, Dilza e Valnês, por todo o

amor e dedicação.

ÍNDICE

1 INTRODUÇÃO........................................................................................10

1.1 Tuberculose................................................................................10

1.2 Via do ácido chiquímico.............................................................16

1.3 Chiquimato desidrogenase........................................................18

2 OBJETIVOS............................................................................................24

3 MÉTODOS E RESULTADOS.................................................................25

3.1 Planejamento das mutações.....................................................26

3.2 Manuscrito 1................................................................................28

3.3 Manuscrito 2................................................................................61

4 DISCUSSÃO...........................................................................................73

4.1 Mutagênese sítio-direcionada do gene aroE...........................73

4.2 Super-expressão das proteínas mutantes...............................75

4.3 Purificação da enzima mutante K69A.......................................78

4.4 Caracterização da enzima mutante K69A.................................80

5 REFERÊNCIAS BIBLIOGRÁFICAS.......................................................84

6 ANEXOS.................................................................................................94

6.1 Alinhamentos de sequências de chiquimato

desidrogenases................................................................................................94

6.2 Seqüência de aminoácidos da MtbSD......................................99

6.3 Seqüência de nucleotídeos do gene aroE..............................100

6.4 Géis de agarose a 2 % com as mutações realizadas............101

6.5 Carta de submissão do artigo “Screening of experimental

conditions to express soluble shikimate dehydrogenase mutants from

Mycobacterium tuberculosis H37Rv” à revista Protein Expression and

Purification.....................................................................................................102

6.6 Carta de submissão do artigo “The conserved Lysine 69

residue plays a catalytic role in Mycobacterium tuberculosis shikimate

dehydrogenase” à revista Journal of Bacteriology....................................103

LISTA DE ABREVIATURAS

DHQ-SD – desidroquinato desidratase-chiquimato desidrogenase;

DHS – 3-desidrochiquimato;

DNA – ácido desoxirribunucléico;

DOTS - Directly Observed Treatment Short-course;

HIV – vírus da imunodeficiência humana;

IPTG – isopropil-beta-D-tiogalactopiranosídeo;

Kcat – constante catalítica;

Kcat/Km – eficiência catalítica;

Kd – constante de dissociação;

kDa – quilodaltons;

Km – constante de Michaelis-Menten;

LB – Luria-Bertani;

MDR-TB – cepa de Mycobacterium tuberculosis resistente a múltiplas drogas;

MtbSD – chiquimato desidrogenase de Mycobacterium tuberculosis;

NADP

- nicotinamida adenina dinucleotídeo fosfato, forma oxidada;

NADPH – nicotinamida adenina dinucleotídeo fosfato, forma reduzida;

OMS – Organização Mundial da Saúde;

PCR – reação em cadeia da DNA polimerase;

SD – chiquimato desidrogenase;

SDS-PAGE – eletroforese em gel de poliacrilamida sob condições

desnaturantes com dodecil sulfato de sódio;

SHK – chiquimato ou ácido chiquímico;

TB – tuberculose;

Vmáx – velocidade máxima de reação;

XDR-TB – tuberculose extensivamente resistente;

RESUMO

As enzimas da via do chiquimato são alvos atraentes para o

desenvolvimento de agentes para tratar a tuberculose já que esta via é

essencial para Mycobacterium tuberculosis e está ausente em humanos. A

enzima chiquimato desidrogenase de M. tuberculosis (MtbSD), codificada pelo

gene aroE, catalisa a quarta reação na via do chiquimato. Estudos de estrutura

tridimensional, de perfis de pH e de mutagênese sítio-direcionada envolvendo

muitas chiquimato desidrogenases sugerem a participação da Lisina-69 e do

Aspartato-105 (numeração de acordo com a seqüência da MtbSD) na catálise

e/ou na ligação ao substrato. A determinação das propriedades cinéticas de

enzimas mutantes pode permitir importantes proposições acerca do papel

destes resíduos para a enzima MtbSD. A mutagênese foi realizada usando

uma técnica de amplificação por PCR para as seguintes proteínas mutantes:

K69A, K69H, K69I, K69Q, D105A, D105N. Testes de diversas condições

experimentais foram feitos para obter a expressão das proteínas MtbSD

mutantes na fração solúvel. Além disso, empregamos um protocolo de

purificação otimizado para obter as enzimas MtbSD não mutante e K69A

aparentemente homogêneas. Realizamos ensaios cinéticos em estado

estacionário e medidas espectrofluorimétricas destas duas enzimas, e os

resultados indicam que o resíduo conservado Lisina-69 tem função catalítica e

não está envolvido na ligação ao substrato para a MtbSD. Estudos estruturais,

de mutagênese sítio-direcionada e de cinética enzimática podem trazer

importantes contribuições para o desenho racional de novos e efetivos

fármacos para tratar a tuberculose.

ABSTRACT

The shikimate pathway is an attractive target for the development of

antitubercular agents because it is essential in Mycobacterium tuberculosis but

absent in humans. Mycobacterium tuberculosis aroE-encoded shikimate

dehydrogenase (MtbSD) catalyzes the forth reaction in the shikimate pathway.

Three-dimensional structure studies, pH-rate profiles and site-directed

mutagenesis studies involving many shikimate dehydrogenases have

suggested participation of Lysine-69 and Aspartate-105 (M. tuberculosis

numbering) in catalysis and/or substrate binding. Importantly, investigation of

the kinetic properties of mutant enzymes can bring important insights about the

role of these residues for the MtbSD enzyme. Mutagenesis was performed

using a PCR-amplification technique for the following mutant proteins: K69A,

K69H, K69I, K69Q, D105A, D105N. Screening of experimental conditions has

been performed to obtain the expression of the MtbSD mutant proteins in the

soluble fraction. In addition, an improved purification protocol was used to

obtain homogeneous wild-type MtbSD and K69A mutant enzymes. We have

carried out steady-state kinetic assays and spectrofluorimetric measurements

for the wild type and the K69A enzymes. Results indicate that the conserved

Lysine-69 residue in MtbSD plays a catalytic role and is not involved in

substrate binding. Enzyme kinetics, site-directed mutagenesis and structural

studies provide a framework on which to base the rational design of new and

effective agents to treat tuberculosis.

1 INTRODUÇÃO

1.1 Tuberculose

A tuberculose (TB) humana é uma doença infecto-contagiosa causada

principalmente pelo bacilo Mycobacterium tuberculosis, uma bactéria aeróbica

que causa infecção usualmente nos pulmões (COLE et al., 1998). A TB foi

responsável por milhões de mortes no passado, quando não existia tratamento

adequado para a doença e se desconhecia seu agente causal. No século XIX,

a TB foi uma doença avassaladora, com altas taxas de transmissão e que

levava a um número de mortes muito elevado. Esta época corresponde ao

início da revolução industrial, onde houve o surgimento dos aglomerados

urbanos, muitas vezes sem estruturas de higiene e habitação, o que

colaborava para a disseminação e o estabelecimento de inúmeras doenças,

dentre elas a TB (DORMANDY, 2002). Na Inglaterra vitoriana, a TB foi

romantizada e suas vítimas se tornaram padrão de beleza dada a esqualidez e

a brancura pálida e também porque já não era uma doença exclusiva das

camadas pobres, atingindo, inclusive, muitos intelectuais da época (DUCATI et

al., 2006).

Somente em 1882, o médico e bacteriologista alemão Robert Koch

tornou pública a identificação do M. tuberculosis como agente etiológico da TB,

durante o IV Congresso Mundial de TB (KAUFMANN et al., 2003). O M.

tuberculosis é geralmente transmitido entre os indivíduos através do ar por

aerossóis que contêm o bacilo. Essas pequenas gotículas podem permanecer

por longos períodos de tempo em ambientes fechados. Quando inalada, a

micobactéria é fagocitada pelos macrófagos alveolares nos bronquíolos

respiratórios e nos alvéolos. O bacilo inalado poderá ou não estabelecer a

infecção e isso dependerá da virulência bacteriana e da capacidade bactericida

dos macrófagos do hospedeiro (DUNLAP et al., 2000).

A descoberta da estreptomicina, em 1944, marcou a era de ouro no

desenvolvimento de drogas para tratar a TB; a seguir, outros fármacos usados

atualmente no tratamento da doença foram introduzidos, são eles: ácido p-

aminosalicílico (1946), isoniazida (1952), ciclosserina (1955), canamicina

(1957), rifampicina (1965), etionamida (1966), etambutol (1968) e pirazinamida

(1970) (DUNCAN, 2003). O desenvolvimento destes fármacos e o emprego de

medidas profiláticas proporcionaram uma diminuição no número de mortes, que

se manteve por algumas décadas (BLOOM e MURRAY, 1992; DANIEL, 1997)

Contudo, a TB ressurgiu com força e é, atualmente, considerada a

principal causa de morte devido a um único agente infeccioso (ENARSON e

MURRAY, 1996). A epidemia do vírus da imunodeficiência humana (HIV), a

deterioração dos programas de saúde pública visando o controle da TB, a

multiplicação de aglomerados urbanos sem estrutura sanitária e o número

elevado de pessoas sem moradia são alguns dos fatores apontados como

responsáveis pelo aumento dos números de TB em muitos países, inclusive

desenvolvidos (BLOOM e MURRAY, 1998). Em 1993, a Organização Mundial

da Saúde (OMS) declarou a TB como emergência de saúde global, estimando-

se que um terço da população humana esteja infectada pelo bacilo e que na

última década 30 milhões de pessoas morreram desta doença (CORBETT et

al., 2003; DYE et al., 1999). Outros números mostram que 9 milhões de

pessoas são infectadas com o bacilo anualmente, o que leva a 2 milhões de

mortes, principalmente na África e na Ásia (WHO, 2006).

Assim, a TB permanece como uma das principais causas de morte em

todo o mundo devido, também, à grande capacidade de adaptação do bacilo,

que consegue sobreviver a variadas condições dentro e fora do hospedeiro

humano. O M. tuberculosis tem sido apontado como o patógeno de maior

sucesso no planeta, de todos os tempos, conseguindo muitas vezes

permanecer silencioso e latente dentro do hospedeiro, desviando das defesas

do sistema imune (ENSERINK, 2001; WICKELGREN, 2000). O bacilo pode

permanecer dormente até que as defesas do hospedeiro sejam diminuídas

como no caso da infecção pelo HIV e por imunossupressão por fármacos. Com

o aumento no número de infectados com o HIV, torna-se preocupante o

numero de hospedeiros ativamente contaminados e capazes de transmitir a

doença (MANABE e BISHAI, 2000).

TB e HIV são tão proximamente relacionados que o termo co-epidemia

tem sido usado para descrever sua relação. A taxa de reativação da TB latente

em pessoas imunocompetentes é de 0,2 % por ano. Já em pacientes com HIV,

este risco de reativação da TB latente pode chegar até 13,3 % ao ano,

dependendo do nível de imunossupressão (KNIGGE et al., 2000). Pacientes

HIV-poitivos que são infectados com TB desenvolvem a TB ativa em uma tava

de 37 % nos primeiros 6 meses; já nos pacientes imunocompetentes, essa taxa

é de até 5 % nos dois primeiros anos. Além disso, pacientes HIV-positivos

apresentam mal-absorção de algumas drogas, talvez devido à enteropatia

relacionada ao HIV, o que pode comprometer os tratamentos da TB e também

levar ao surgimento de cepas resistentes a fármacos usados para tratar a TB

(SEPKOWITZ, 1995).

O tratamento da TB teve melhoria significativa com a expansão do

programa Directly Observed Treatment Short-course (DOTS), que combina

compromisso político, serviços de microscopia, suprimento de medicamentos,

sistemas de monitoramento e observação direta ao tratamento (PASQUALOTO

e FERREIRA, 2001). Atualmente, o tratamento recomendado pela OMS

consiste na administração combinada dos fármacos isoniazida, rifampicina,

pirazinamida e etambutol durante dois meses. O tratamento deve prosseguir

por mais quatro meses, quando se administra isoniazida e rifampicina.

Infelizmente, alguns países não conseguem implantar o programa DOTS para

a totalidade dos seus pacientes, reforçando a hipótese de que tratamentos

mais curtos e com menores efeitos colaterais melhorariam a adesão do

paciente e isso levaria a uma maior eficácia no tratamento da TB (DUNCAN,

2003).

De fato, tratamentos inapropriados e a não adesão do paciente ao

tratamento são comumente associados com a emergência de cepas de TB

resistentes a múltiplas drogas (MDR-TB), cujos isolados são resistentes a pelo

menos isoniazida e rifampicina, dois dos principais fármacos usados no

tratamento padrão da TB (DUNCAN, 2003; BASSO e BLANCHARD, 1998).

Pacientes com MDR-TB devem ser tratados com uma combinação de

drogas de segunda linha que, além de serem significativamente mais caras,

possuem mais efeitos tóxicos e são menos efetivas que as drogas de primeira

linha (O’BRIEN e NUNN, 2001). Em países industrializados, o tratamento

normal custa em torno de 2.000 dólares por paciente, mas alcança 250.000

dólares para pacientes com MDR-TB (PASQUALOTO e FERREIRA, 2001).

Casos de coinfecção de HIV e MDR-TB alcançam taxas de mortalidade

próximas a 100 %, e esta é definida como a infecção oportunista mais maligna

associada à AIDS (FÄTKENHEUER et al., 1999). Cerca de 300.000 novos

casos de MDR-TB são diagnosticados a cada ano, sendo que de 4 a 20 %

destes são classificados como TB extensivamente resistente (XDR-TB),

definida como casos de TB cujos isolados são resistentes à isoniazida,

rifampicina e a pelo menos três das seis principais classes de drogas de

segunda linha (aminoglicosídeos, polipetídeos, fluoroquinolonas, tiamidas,

ciclosserina e ácido p-aminosalicílico) (DORMAN e CHAISSON, 2007; CDC,

2006). XDR-TB está sendo relatada em todo o mundo, inclusive nos Estados

Unidos, onde a TB estava sendo considerada sob controle. A ocorrência já

difundida de XDR-TB traz discussões sobre a drástica situação de casos de TB

virtualmente incuráveis e aponta para a urgente necessidade de introduzir

novos e eficazes fármacos anti-TB (DORMAN e CHAISSON, 2007).

Já se passaram quase 40 anos desde a introdução da última droga para

tratar a TB. Estima-se que o desenvolvimento completo de uma nova droga

anti-TB custe de 100 a 800 milhões de dólares (DUNCAN, 2003).

Considerando-se que 95 % dos casos de TB ocorram em países

subdesenvolvidos e em desenvolvimento, a indústria farmacêutica parece não

estar suficientemente atraída, em termos financeiros, para o desenvolvimento

de novos fármacos para tratar a TB (O’BRIEN e NUNN, 2001).

Em 1998, Stewart Cole e colaboradores publicaram a seqüência

completa do genoma de M. tuberculosis (COLE et al., 1998) proporcionando

novas abordagens de pesquisas sobre este microrganismo e, até mesmo,

abrindo perspectivas para o futuro desenvolvimento de fármacos para tratar a

TB.

1.2 Via do ácido chiquímico

A via do ácido chiquímico (Figura 1) liga o metabolismo dos carboidratos

com a biossíntese de compostos aromáticos, convertendo eritrose-4-fosfato em

corismato, que é o precursor para a síntese de metabólitos importantes como

aminoácidos aromáticos, ubiquinona e folato (PARISH e STOKER, 2002). Esta

via é essencial no metabolismo de algas, plantas, bactérias, parasitos do filo

Apicomplexa e fungos, mas é ausente em mamíferos (BENTLEY, 1990;

ROBERTS et al., 1998). Assim, as enzimas desta via recebem muita atenção

como potenciais alvos para o desenvolvimento de fármacos antimicrobianos

não tóxicos, herbicidas e drogas antiparasitárias (COGGINS et al., 2003). Um

grande exemplo do emprego exitoso de inibidores específicos desta via é o

glifosato, inibidor da 5-enolpiruvilchiquimato-3-fosfato sintase e um dos

herbicidas de amplo espectro mais usados em todo o mundo. Este composto

também demonstrou atividade inibitória do crescimento de parasitos do filo

apicomplexo in vitro (AMRHEIN et al., 1980; ROBERTS et al., 1998). É

comprovado que a via do chiquimato é crucial para a viabilidade de M.

tuberculosis (PARISH e STOKER, 2002). Já que esta via está ausente no

hospedeiro humano e é essencial para a micobactéria, suas sete enzimas são

alvos atrativos para o desenvolvimento de agentes que possam tratar a TB

(PARISH e STOKER, 2002; BENTLEY, 1990). Com o objetivo de desenhar

racionalmente novas e efetivas drogas antimicobacterianas, muitos estudos de

caracterização molecular e bioquímica têm envolvido as enzimas da via do

chiquimato de M. tuberculosis como, por exemplo, 3-desóxi-D-arabino-

heptulosonato-7-fosfato sintase (RIZZI et al., 2005), desidroquinato sintase

(MENDONÇA et al., 2007), chiquimato quinase (PEREIRA et al., 2004), 5-

enolpiruvilchiquimato-3-fosfato sintase (OLIVEIRA et al., 2003) e corismato

sintase (DIAS et al., 2004; FERNANDES et al., 2007).

Figura 1: A via do ácido chiquímico, mostrando seus sete passos enzimáticos

(BASSO et al., 2005).

1.3 Chiquimato desidrogenase

A quarta reação enzimática da via do ácido chiquímico é catalisada pela

chiquimato desidrogenase (SD, EC 1.1.1.25), que é codificada pelo gene aroE

de M. tuberculosis e catalisa a redução reversível do 3-desidrochiquimato

(DHS) em chiquimato (SHK), na presença do NADPH como o doador de

hidreto (Figura 2; BENTLEY, 1990).

Figura 2: Reação catalisada pela enzima chiquimato desidrogenase (MtbSD).

Em plantas, a SD é parte de uma enzima bifuncional, a desidroquinato

desidrogenase-chiquimato desidrogenase (DHQ-SD) (DEKA et al., 1994;

SINGH e CHRISTENDAT, 2006). Em fungos e leveduras, a SD compõe um

complexo enzimático pentafuncional (CHARLES et al., 1986; DUNCAN et al.,

1987). Em bactérias, estudos bioquímicos e filogenéticos identificaram a

existência de três subclasses de SD, até então: AroE, YdiB e SD-like. AroE é a

SD de ocorrência mais ampla e é uma enzima monofuncional. YdiB e SD-like

foram identificadas em um número reduzido de microorganismos; YdiB é uma

SD bifuncional que também catalisa a redução reversível do desidroquinato a

quinato. Até então, a SD-like é uma enzima não muito bem caracterizada, e foi

sugerida como monofuncional em H. influenzae, catalisando a oxidação do

SHK a DHS com uma constante catalítica bastante reduzida se comparada

com a da AroE (MICHEL et al., 2003; SINGH et al., 2005). Recentemente, um

estudo relatou inibidores específicos da SD de Helicobacter pylori, o que

reforça a importância do desenvolvimento de novos agentes antimicrobianos e

da diversificação de alvos para novas drogas (HAN et al., 2006).

A enzima SD de M. tuberculosis (MtbSD), codificada pelo gene aroE

(Rv2552c), possui 269 aminoácidos e pertence à superfamília das

oxirredutases dependentes de NAD(P)H, que atuam em rotas anabólicas e

catabólicas (BENACH et al., 2003); além disso, encontra-se na forma de

dímero em solução (FONSECA et al., 2006).

Em 2002, foi publicada a clonagem do gene aroE da cepa M.

tuberculosis H37Rv em vetor de expressão pET23a(+) (Novagen

) e a

expressão da enzima recombinante na fração solúvel, em células de

Escherichia coli BL21(DE3) (MAGALHÃES et al., 2002). Em seguida, nosso

grupo publicou a purificação da enzima recombinante, sua caracterização

cinética e estudos estruturais (FONSECA et al., 2006; ARCURI et al., 2008).

Além disso, foram propostos os mecanismos cinético e químico da reação

catalisada pela MtbSD (FONSECA et al., 2007). Entretanto, as bases

moleculares da ligação ao substrato DHS e da redução catalítica ainda não

foram completamente elucidadas.

Estudos de alinhamento de várias seqüências de SDs demonstram que

os aminoácidos lisina (Lis, K) da posição 69 e aspartato (Asp, D) da posição

105 (Lis69 e Asp105, numeração de acordo com a seqüência da AroE de M.

tuberculosis) são, entre outros resíduos, completamente conservados nas

cadeias polipeptídicas das seguintes enzimas: AroE de M. tuberculosis, E. coli,

H. influenzae, Methanococcus jannaschii, Thermus thermophilus, Neisseria

meningitides, H. pylori, Archaeoglobus fulgidus, Aquiflex aeolicus, Bacillus

subtilis, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas

aeruginosa, YdiB de E. coli, Corynebacterium glutamicum, SD-like de

Haemophilus influenzae, DHQ-SD de Arabidopsis thaliana e Lycopersicon

esculentum (MICHEL et al., 2003; HAN et al., 2006; FONSECA et al., 2007; YE

et al., 2003; BAGAUTDINOV e KUNISHIMA, 2007, Anexo 6.1). A seguir,

referir-se-á aos números dos resíduos sempre de acordo com a numeração da

seqüência polipeptídica da MtbSD.

Estudos das estruturas cristalinas das enzimas AroE e YdiB de E. coli

sugerem que Lis69 e Asp105 estejam localizados no sítio de ligação ao

substrato destas enzimas e que estes resíduos provavelmente tenham um

papel fundamental na catálise acido-básica da reação da SD neste organismo

(MICHEL et al., 2003). Ainda em 2003, outro estudo de cristalografia reforçou

esta nova proposição para a YdiB de E. coli, onde o resíduo conservado

Asp105 possivelmente atue como catalisador ácido-básico durante a

transferência de hidreto (BENACH et al., 2003).

As estruturas tridimensionais da AroE de H. influenzae e de M.

jannaschii sugerem Lis69 e Asp105, dentre outros resíduos, como parte do sítio

ativo destas enzimas e que estes aminoácidos possam contribuir para a

catálise (YE et al., 2003; PADYANA e BURLEY, 2003). Muito importante foi a

determinação dos complexos ternários da AroE de T. termophilus e A. aeolicus

com o cofator NADP

e o substrato SHK; estas estruturas permitiram uma boa

compreensão sobre o mecanismo enzimático (Figura 3; BAGAUTDINOV e

KUNISHIMA, 2007; GAN et al., 2007).

Figura 3: Visão do SHK ligado ao complexo ternário AroE de Thermus

termophilus:NADP(H):SHK (BAGAUTDINOV e KUNISHIMA, 2007).

Todas essas estruturas revelaram uma arquitetura geral bem

conservada para estas enzimas, composta de dois domínios: o domínio

catalítico N-terminal, onde Lis69 e Asp105 estão localizados, e o domínio C-

terminal, de ligação ao NAD(P); estes dois domínios estão separados por um

grande sulco central, onde está localizado o sítio catalítico destas enzimas

(Figura 4).

A determinação da estrutura cristalina, estudos de mutagênese e de

efeito de pH indicam que Lis69 e Asp105 estão criticamente envolvidos na

catálise na enzima SD-like de H. influenzae (SINGH et al., 2005). Entretanto,

um trabalho de mutagênese sítio-direcionada envolvendo a enzyma YdiB de E.

coli sugere que estes dois aminoácidos são muito importantes para a ligação

ao substrato e que a catálise não ocorre por um mecanismo geral ácido-básico,

como fora inicialmente sugerido (LINDNER et al., 2005). Recentemente, outra

análise de enzimas mutantes mostrou que o resíduo que corresponde à Lis69 e

ao Asp105 da enzima DHQ-SD de A. thaliana tem grande importância na

atividade catalítica desta enzima (SINGH e CHRISTENDAT, 2006). Estudos do

efeito do pH com a SD de A. aeolicus também indica que um resíduo,

provavelmente a Lis69, funciona como uma base durante a catálise (GAN et

al., 2007). Nosso grupo publicou a determinação dos mecanismos cinético e

químico da MtbSD, incluindo os efeitos do pH, e os dados são consistentes

com a provável participação de um resíduo lisina tanto na catálise quanto na

ligação ao substrato (FONSECA et al., 2007).

Figura 4: Modelo estrutural do monômero da enzima MtbSD em complexo com o

NADP

, composta pelos domínios catalítico e de ligação ao NADP

(ARCURI et al.,

2008).

Com base nestes estudos, os resíduos Lis da posição 69 e Asp da posição 105

da enzima SD de M. tuberculosis foram escolhidos para investigação da sua

importância, se alguma, na ligação do substrato e/ou na catálise enzimática,

por meio da técnica de mutagênese sítio-direcionada.

2 OBJETIVOS

Este trabalho foi desenvolvido com vistas a determinar o papel da cadeia

lateral de aminoácidos do sítio ativo da enzima SD de M. tuberculosis,

buscando o melhor entendimento do seu mecanismo cinético e, assim, a

caracterização refinada deste alvo molecular. Os nossos resultados poderão

servir como base para o desenho racional de fármacos para o tratamento da

tuberculose.

Para tanto, alguns objetivos específicos foram traçados:

I. Planejamento das mutações e projeção de oligonucleotídeos

iniciadores específicos para as mutações desejadas;

II. Mutagênese sítio-direcionada do gene aroE de M. tuberculosis

H37Rv;

III. Seqüenciamento do gene aroE após a técnica de mutagênese;

IV. Super-expressão e purificação das proteínas mutantes;

V. Caracterização cinética da proteína mutante K69A e comparação

com o perfil da enzima não mutante.

3 MÉTODOS E RESULTADOS

Incialmente, idealizamos as mutações a serem realizadas. Este

planejamento inicial do trabalho está apresentado na próxima seção, intitulada

“Planejamento das mutações”.

As seções de métodos e de resultados serão apresentadas na forma de

manuscritos, intitulados “Screening of experimental conditions to express

soluble shikimate dehydrogenase mutants from Mycobacterium

tuberculosis H37Rv” e “The conserved Lysine 69 residue plays a catalytic

role in Mycobacterium tuberculosis shikimate dehydrogenase”, já

submetidos (Anexos 6.5 e 6.6).

No primeiro manuscrito constam os métodos e resultados referentes à

mutagênese sítio-direcionada, à super-expressão das enzimas MtbSD

mutantes na fração solúvel e à purificação da proteína mutante K69A. No

segundo manuscrito está descrita a caracterização cinética da MtbSD mutante

K69A.

3.1 Planejamento das mutações

Quatro resíduos foram escolhidos para substituir a Lis, totalizando quatro

enzimas mutantes distintas (Figura 5):

- Alanina (Ala, A): com esta mutação se consegue retirar a cadeia carbônica

e também o grupamento amino da Lis;

- Histidina (His, H): assim como a Lis, é um aminoácido básico; pode-se

investigar, portanto, se o grupamento básico da Lis tem algum papel importante

para esta enzima;

- Glutamina (Gln, Q): possui uma cadeia lateral com três carbonos e um

grupamento amida que permite que este resíduo mantenha a propriedade de

realizar interações por meio de pontes de hidrogênio, assim como a Lis pode

realizar pelo seu grupamento amino;

- Isoleucina (Ile, I): assim como a Lis, possui em sua cadeia lateral quatro

carbonos unidos por ligações simples; logo, possui a propriedade de fazer

interações do tipo van der Waals.

Duas enzimas mutantes foram idealizadas para estudar o papel do

aminoácido Asp, são os seguintes resíduos substituintes (Figura 6):

- Ala: retira-se o grupamento carboxílico do Asp;

- Asparagina (Asn, N): possui uma cadeia lateral com dois carbonos e um

grupamento amida que permite que este resíduo mantenha a propriedade de

realizar interações através de pontes de hidrogênio, assim como o Asp pode

realizar pelo seu grupamento carboxílico.

Figura 5: Resíduos idealizados para substituir a Lisina 69 da MtbSD.

Figura 6: Resíduos idealizados para substituir o Aspartato 105 da MtbSD.

3.2 Manuscrito 1

Screening of experimental conditions to express soluble shikimate

dehydrogenase mutants from Mycobacterium tuberculosis H37Rv

Valnês S. Rodrigues-Junior

1,2

, Luiz A. Basso

*, and Diógenes S. Santos

Centro de Pesquisas em Biologia Molecular e Funcional, Pontifícia

Universidade Católica do Rio Grande do Sul (PUCRS), Porto Alegre – RS,

90619-900, Brazil.

Programa de Pós-graduação em Biologia Celular e

Molecular, Centro de Biotecnologia, Universidade Federal do Rio Grande do

Sul (UFRGS), Porto Alegre – RS, Brazil.

Keywords: Mycobacterium tuberculosis, shikimate pathway, shikimate

dehydrogenase, site-directed mutagenesis, protein expression, protein

purification

*Corresponding authors: Luiz A. Basso or Diógenes S. Santos

Mailing address: Av. Ipiranga 6681 – Tecnopuc – Prédio 92ª

90619-900, Porto Alegre, RS, Brazil

Phone/Fax: +55 51 33203629

E-mail addresses: [email protected] or [email protected]

Short title: Mycobacterium tuberculosis shikimate dehydrogenase

ABSTRACT

The shikimate pathway is an attractive target for the development of

antitubercular agents because it is essential in Mycobacterium tuberculosis, the

causative agent of tuberculosis, but absent in humans. Mycobacterium

tuberculosis aroE-encoded shikimate dehydrogenase (MtbSD) catalyzes the

forth reaction in the shikimate pathway. Three-dimensional structure studies,

pH-rate profiles and site-directed mutagenesis studies involving many shikimate

dehydrogenases have suggested participation of Lysine and Aspartate amino

acid side chains in catalysis and/or substrate binding. Importantly, investigation

of the kinetic properties of mutant enzymes can bring important insights about

the role of these residues for the MtbSD enzyme. Mutagenesis was performed

using a PCR-amplification technique for the following mutant proteins: K69A,

K69H, K69I, K69Q, D105A, D105N. Screening of E. coli strains, growth

temperature, hours of growth, and the need for isopropyl β-D-

thiogalactopyranoside (IPTG) induction, cell disruption methods, and additives

were employed to optimize MtbSD production yield. In addition, an improved

purification protocol to obtain homogeneous MtbSD is presented. The kinetic

parameters for the wild type enzyme were also determined. Enzyme kinetics,

site-directed mutagenesis and structural studies provide a framework on which

to base the rational design of new agents with antitubercular activity. However,

the availability of sufficient amounts of proteins of M. tuberculosis still remains

an essential and laborious step. The results presented here show that

optimization of expression, disruption and purification protocols resulted in a

higher yield of functional MtbSDs enzyme, which is an essential step towards

target-based development of chemotherapeutic agents to treat tuberculosis.

ABREVIATIONS USED

TB, tuberculosis; MDR-TB, multi-drug resistant strains of Mycobacterium

tuberculosis; XDR-TB, extensively-drug resistant tuberculosis; SD, shikimate

dehydrogenase; MtbSD, Mycobacterium tuberculosis shikimate dehydrogenase;

DHS, 3-dehydroshikimate; SHK, shikimate; NADPH, reduced form of

nicotinamide adenine dinucleotide phosphate; DHQ-SD, dehydroquinate

dehydratase-shikimate dehydrogenase; PCR, polymerase chain reaction; DNA,

deoxyribonucleic acid; LB, Luria-Bertani; IPTG, isopropyl β-D-

thiogalactopyranoside; OD

600

, optical density at 600 nm; SDS-PAGE, sodium

dodecyl sulfate polyacrylamide gel electrophoresis.

INTRODUCTION

Tuberculosis (TB), caused by Mycobacterium tuberculosis, continues to

be a threat to human health worldwide. It has been estimated that one-third of

the world population is infected with the tubercle bacilli and that in the last

decade 30 million people died from this disease [1]. Among the possible factors

involved in the resurgence of TB are the epidemic of the human

immunodeficiency virus, the increase in the homeless population, and the

decline in health care structures and national surveillance [2]. Inappropriate

treatment regimens and patient noncompliance in completing the therapies are

commonly associated with the emergence of multi-drug resistant TB (MDR-TB),

whose isolates are resistant to at least isoniazid and rifampicin, two pivotal

drugs used in the standard treatment of TB [3,4]. More recently, the emergence

of extensively drug resistant TB (XDR-TB) strains were also described [5],

which are also a contributing factor to the alarming emergence of TB cases

worldwide. XDR-TB is defined as resistant to isoniazid and rifampicin and at

least three of the six main classes of second-line drugs (aminoglycosides,

polypeptides, fluoroquinolones, thioamides, cycloserine, and para-

aminosalicylic acid) and its high occurrence raises the prospect of virtually

incurable TB [5,6]. Hence, the alarming rise of strains of M. tuberculosis

resistant to current drugs stimulates an urgent need to discover novel

antitubercular agents acting on new drug targets.

The shikimate pathway links the metabolism of carbohydrates to the

biosynthesis of aromatic compounds, converting erythrose 4-phosphate in

chorismate, which is the precursor for the synthesis of important metabolites,

such as aromatic amino acids, ubiquinone and folate [7]. This pathway is

essential for algae, higher plants, bacteria, and fungi, but it is absent in

mammals [8]. Importantly, the shikimate pathway has been shown to be

essential for the viability of M. tuberculosis [7]. Since this pathway is absent in

human host and is essential for mycobacteria, its seven enzymes are attractive

targets for the development of antitubercular agents [7,8]. With a view to the

design of effective antimycobacterial drugs, efforts have been made to

characterize at the molecular and biochemical levels many enzymes from this

pathway in Mycobacterium tuberculosis, such as 3-deoxy-D-arabino-

heptulosonate 7-phosphate synthase [9], dehydroquinate synthase [10],

shikimate kinase [11], 5-enolpyruvylshikimate-3-phosphate synthase [12] and

chorismate synthase [13,14].

The fourth reaction of the shikimate pathway is the aroE-encoded

shikimate dehydrogenase (SD, EC 1.1.1.25) in M. tuberculosis that catalyzes

the reversible reduction of 3-dehydroshikimate (DHS) to shikimate (SHK) in the

presence of NADPH as the hydride donor [8] (Figure 1).

Figure 1: The shikimate dehydrogenase-catalyzed reaction.

In plants, SD is part of a bifunctional dehydroquinate dehydratase-

shikimate dehydrogenase (DHQ-SD) enzyme [15,16]. In fungi and yeast, SD

participates of a pentafunctional enzyme complex [17,18]. In bacteria,

biochemical and phylogenetic studies have identified the existence of three

subclasses of SD to date: AroE, YdiB, and SD-like. AroE is a widely distributed

monofunctional enzyme. YdiB and SD-like enzymes have been identified in a

lower number of organisms. The ydiB-encoded protein is a bifunctional SD

enzyme that also catalyses the reversible reduction of dehydroquinate to

quinate. SD-like is not well characterized, and was suggested to be

monofunctional in Haemophilus influenzae, catalyzing the oxidation of SHK with

a lower rate when compared with that of AroE [19,20]. Recent report of specific

inhibitors against the shikimate dehydrogenase from Helicobacter pylori has

reinforced the importance of the target diversity and the introduction of novel

effective antimicrobial agents [21]. Our group has previously reported cloning,

expression, purification, kinetic properties and structural studies of the aroE-

encoded shikimate dehydrogenase from M. tuberculosis (MtbSD) [22-25].

However, the molecular basis of DHS recognition and the catalytic mechanism

for MtbSD are not yet known.

Multiple sequence alignment studies showed that the amino acids lysine

in the position 69 and aspartate in the position 105 (Lys69 and Asp105, M.

tuberculosis numbering) are, amongst other residues, fully conserved in the

polypeptide chain of the following aligned enzymes: AroE from M. tuberculosis,

Escherichia coli, Haemophilus influenzae, Methanococcus jannaschii, Thermus

thermophilus, Neisseria meningitides, Helicobacter pylori, Archaeoglobus

fulgidus, Aquiflex aeolicus, Pseudomonas aeruginosa, YdiB from Escherichia

coli, Corynebacterium glutamicum, SD-like from Haemophilus influenzae, SD

parts of Arabidopsis thaliana and Lycopersicon esculentum DHQ-SDs

[19,21,24,26,27]. In the following, we will refer to residues according to the M.

tuberculosis AroE numbering. Crystal structure determination of AroE and YdiB

proteins from E. coli suggest that a lysine and an aspartate (Lys69 and Asp105

in MtbSD) residues are located in the substrate binding site and probably play

critical roles in the acid-base catalysis of the SD reaction in this organism [19].

In the same year, other crystallographic work reinforced this novel proposal for

YdiB from E. coli, in which the conserved aspartate residue (Asp105 in MtbSD)

is supposed to act as the acid-base catalyst during the hydride transfer [28].

Three-dimensional structures of both H. influenzae and M. jannaschii AroE

suggest conserved lysine and aspartate, amongst other residues, as part of the

active site of these enzymes and that these amino acids may contribute to

catalysis [26,29]. Importantly, ternary complexes for AroE from both Thermus

termophilus and Aquiflex aeolicus in complex with NADP

-SHK were

determined and provided important insights into the enzymatic mechanism

[27,30]. These structures have revealed a common overall architecture of these

enzymes, comprising two domains: the N-terminal catalytic domain, where the

conserved lysine and aspartate residues (Lys69 and Asp105 in MtbSD) are

located, and the C-terminal NAD(P)-binding domain. Mutagenesis studies,

determination of the crystal structure and pH-rate profiles indicate important

roles in catalysis for the lysine and aspartate residues in the SD-like enzyme

from H. influenzae [20]. However, a site-directed mutagenesis work on the YdiB

enzyme from E. coli suggests important roles for these amino acids in substrate

binding and that catalysis does not occur through a general acid-base

mechanism, as initially thought [31]. More recently, another mutational analysis

has shown that the corresponding lysine and aspartate residues play critical

roles in the catalytic activity of Arabidopsis thaliana DHQ-SD enzyme [16]. The

pH-rate profile of the A. aeolicus SD also indicates that a residue, probably a

lysine, functions as a general base during catalysis [30]. We have recently

reported determination of kinetic and chemical mechanisms for MtbSD,

including pH-rate profiles, and the data are consistent with the probable

participation of a lysine residue in catalysis and/or substrate binding [24].

In an attempt to probe the role, if any, of Lys69 and Asp105 residues in

MtbSD, we replaced Lys69 residue by alanine, isoleucine, histidine and

glutamine, and Asp105 by alanine and asparagine. Here, we describe site-

directed mutagenesis and an expression protocol to obtain both wild type and

mutant enzymes in soluble form. In addition, we developed a new and improved

purification protocol to obtain homogeneous wild type MtbSD. We have also

used this protocol to purify the K69A mutant.

Enzyme kinetics and structural studies provide a framework on which to

base the target-based rational design of new agents with antitubercular activity.

However, the availability of sufficient amounts of proteins of M. tuberculosis still

remains an essential and laborious step. Unfortunately, even when a genome

can be sequenced, only up to 20 % of the protein targets can produce soluble

proteins under very basic experimental conditions [32]. Thus, expression of

proteins in soluble form has been identified as an important bottleneck in efforts

to determine biological activity and crystal structure of M. tuberculosis proteins

[33]. It should be pointed out that expression of MtbSD in soluble and active

form proved to be laborious to achieve [22]. Accordingly, the results here

described represent an important step towards providing recombinant MtbSD

proteins to allow functional and structural efforts on which to base the rational

design of antitubercular agents.

MATERIALS AND METHODS

Site-directed mutagenesis of the aroE gene

Mutagenesis experiments were performed using the QuickChange site-

directed mutagenesis kit from Stratagene, according to the manufacturer’s

instructions. This technique consists of a PCR-amplification procedure that uses

the PfuTurbo

DNA polymerase and a pair of specific antiparallel primers,

carrying codons for the required substitutions. The oligonucleotide primers were

individually designed, and both primers must contain the desired mutation as

given in Table 1. The recombinant vector, pET23a(+)::aroE, was used as

template since the method allows specific mutations in virtually any double-

stranded plasmid. The PCR amplification program was as follows: one step of

95º C for 30 s, 16 cycles at 95º C for 30 s, 55º C for 1 min, and 68º C for 10

min, followed by a final extension step at 68º C for 10 min. The PCR products

were treated with DpnI endonuclease to select for the mutation-containing

synthesized DNA. The mutant aroE genes were entirely sequenced to both

confirm the insertion of the desired mutation and to ensure that no unwanted

mutations were introduced by the PCR step.

Table 1

Designed primers for the desired mutations

3.2 In bold are the nucleotides corresponding to the substituting amino acid

Overexpression and release of the mutant MtbSD

Recombinant protein expression tests were carried out at various

experimental conditions including screening of E. coli strains, growth

temperature, hours of growth, and the need for isopropyl β-D-

thiogalactopyranoside (IPTG) induction. In addition, we tried to solubilize the

insoluble aggregates with 50 mM Tris-HCl, pH 7.8 buffer containing the agents

sarcosyl, triton X-100, zwittergent 3-14 or urea. The concentrations employed

were as follows: 0.2, 1 or 2 % for sarcosyl; 0.1, 1 or 2 % for triton X-100; 0.1, 1,

3 or 6 M for urea; 0.1, 0.5 or 5 % for zwittergent 3-14. The solubilization test

consisted of treating the insoluble fraction with each agent for 30 minutes of

stirring at 4 ºC. Finally, the disruption methods of French press and freeze-thaw

Mutant Mutagenic primer*

K69A forward 5’ ggtgtttcgg tgaccatgcc gggcgcgttc gccgccctgc ggttcg 3’

K69A reverse 5’ cgaaccgcag ggcggcgaac gcgcccggcat ggtcaccga aacacc 3’

K69I forward 5’ ggtgtttcgg tgaccatgcc gggcatcttc gccgccctgc ggttcg 3’

K69I reverse 5’ cgaaccgcag ggcggcgaag atgcccggcat ggtcaccga aacacc 3’

K69H forward 5’ ggtgtttcgg tgaccatgcc gggccacttc gccgccctgc ggttcg 3’

K69H reverse 5’ cgaaccgcag ggcggcgaag tggcccggcat ggtcaccga aacacc 3’

K69Q forward 5’ ggtgtttcgg tgaccatgcc gggccagttc gccgccctgc ggttcg 3’

K69Q reverse 5’ cgaaccgcag ggcggcgaac tggcccggcat ggtcaccga aacacc 3’

D105A forward 5’ ggctggcggg ccgacaacac cgcgatcgac ggggtggccg gggcg 3’

D105A reverse 5’ cgccccggcc accccgtcga tcgcggtgtt gtcggcccgc cagcc 3’

D105N forward 5’ ggctggcggg ccgacaacac caacatcgac ggggtggccg gggcg 3’

D105N reverse 5’ cgccccggcc accccgtcga tgttggtgtt gtcggcccgc cagcc 3’

were tested. Satisfactory results were obtained with the E. coli C41 (DE3)

strain, grown at 37 ºC for 24 h with IPTG induction. The optimized protein

expression protocol and release of the soluble recombinant proteins are given

hereafter. The recombinant plasmid pET23a(+)::aroE (either wild-type or

mutants) was transformed into E. coli C41 (DE3) electrocompetent cells by

electroporation, and selected on LB agar plates containing 50 µg mL

-1

ampicillin. Single colonies were used to inoculate 2 L of LB medium containing

50 µg mL

-1

ampicillin, and 1 mM IPTG was added to cultures reaching an OD

600

of 0.4 – 0.6. The cells were grown for additional 24 h at 37º C at 180 rpm, after

induction. Cells (5 g) were harvested by centrifugation at 14,900g for 30 min at

4º C, and stored at -20 ºC. The freeze-thaw method was used to release the

proteins in the soluble fraction [34]. Cells were placed into metal containers,

allowing fast temperature equilibrium to be reached, and placed into a dry-

ice/ethanol bath for 2 min and transferred to an ice-water bath for 8 min, and

this cycle was repeated 5 times. These cells were dissolved in 25 mL of 50 mM

Tris-HCl, pH 7.8 and placed on ice for additional 30 min. The sample was

centrifuged at 4 ºC for 1h at 48,000g and the soluble fraction containing the

protein of interest was collected and employed in the optimization of

recombinant protein purification protocols.

Purification steps

The sample containing the soluble enzyme was incubated with 1 % (w/v)

of streptomycin sulfate for 30 min and centrifuged at 48,000g for 30 min. The

supernatant was dialyzed against 50 mM Tris-HCl, pH 7.8 (buffer A), using a

dialysis tubing with molecular weight exclusion limit of 12-14 kDa. Ammonium

sulphate was added to a final concentration of 1 M. The sample was clarified by

centrifugation and the supernatant was loaded on a Phenyl-Sepharose Fast

Flow hydrophobic interaction column pre-equilibrated with 50 mM Tris-HCl, pH

7.8, 1 M (NH

)

(buffer B). The column was washed with 10 column

volumes of buffer B and the bound proteins were fractionated with a 20-column

volume linear gradient from 1 to 0 M (NH

)

. The fractions containing

MtbSD were pooled, concentrated to 10 mL and loaded on a Sephacryl S-200

HR column pre-equilibrated with buffer A. Fractions containing the recombinant

protein were pooled and loaded on a MonoQ anion exchange column previously

equilibrated with buffer A. The column was washed with 5 column volumes of

buffer A and the adsorbed proteins were eluted using a 20-column volume

linear gradient (0- 100%) of 50 mM Tris-HCl, 0.5 M NaCl, pH 7.8 buffer. The

fractions containing the purified protein were pooled, concentrated and dialyzed

against the enzymatic assay buffer. All the purification steps were performed at

4 ºC. Samples of the purification steps were analyzed by SDS-PAGE [35] and

the protein content was determined by the Bradford method [36], using the Bio-

Rad protein assay kit (Bio-Rad) and bovine serum albumin as standard.

RESULTS AND DISCUSSION

Sequence alignment analysis of many shikimate dehydrogenase

polypeptide chains showed that, amongst other amino acids, lysine and

aspartate residues (Lys69 and Asp105 in MtbSD) are fully conserved, and it has

been suggested that these residues are of fundamental importance in catalysis

and/or substrate binding [19,21,26,27]. Three-dimensional structure

determination of shikimate dehydrogenase enzymes (AroE, YdiB and SD-like)

from several organisms have also suggested the involvement of these amino

acids in catalysis and/or substrate binding and have revealed the conserved

overall architecture of the shikimate dehydrogenase family, composed by a

catalytic domain and a NAD(P)-binding domain [19,20,26,27,29-31]. In addition,

site-directed mutagenesis results have confirmed the importance of lysine and

aspartate for catalysis (in SD-like from H. influenzae and A. thaliana DHQ-SD)

and for substrate binding (in YdiB from E. coli) [16,20,31]. Based on structural

and functional studies, it is likely that the conserved lysine in the position 69 and

aspartate in the position 105 of the MtbSD enzyme may play an important role

either in catalysis or binding or both. To investigate the functional role of these

residues, we have replaced Lys69 with alanine, isoleucine, histidine or

glutamine, and Asp105 with alanine or asparagine by site-directed

mutagenesis. The PCR-amplification mutagenesis technique proved to be an

effective procedure, allowing mutation in the double-stranded recombinant

plasmid, pET23a(+)::aroE. It should be pointed out the importance of treating

the PCR product with the DpnI endonuclease that specifically digests the

methylated DNA template, and selects for the mutation-containing synthesized

DNA.

After sequencing of the recombinant genes in their entirety, the mutant

plasmids were transformed in E. coli for protein expression tests. Recombinant

protein expression of MtbSD has proved to be a difficult task to achieve [22].

Thus, a range of variable experimental conditions were tried to improve

recombinant protein expression. Tests in LB medium using various E. coli

strains, at different cultivation temperatures, either with or without IPTG

induction (Table 2) as well as cell growth for additional 3, 6, 12, 18, 24, or 36

hours of cultures after reaching an OD

600

of 0.4 – 0.6. Disappointingly, these

attempts to express the wild-type and mutant MtbSDs in soluble form were

unsuccessful. The best recombinant protein expression protocol of MtbSD

K69A mutant in insoluble form was using E. coli C41(DE3) strain, grown at 37

ºC for 24 hours after induction with 1 mM IPTG, and cell disruption by

sonication (Figure 2). The need for the presence of IPTG to allow expression is

consistent with the use of the vector pET23a(+). The pET expression system

uses the powerful T7 RNA polymerase, under control of IPTG-inducible lacUV5

promoter, to transcribe genes of interest [37].

Table 2

Expression tests for the MtbSD mutant enzymes

E. coli strain Strain characteristics

Temperature

tested (º C)

1 mM IPTG

induction

BL21(DE3) 37 Yes

BL21(DE3) 37 No

BL21(DE3) 30 Yes

BL21(DE3) 30 No

BL21(DE3) 20 Yes

BL21(DE3)

Deficiency of the

protease lon e ompT,

reducing the degradation

of the expressed

recombinant proteins

20 No

C41(DE3) 37 Yes

C41(DE3) 37 No

C41(DE3) 30 Yes

C41(DE3)

Derived from BL21(DE3);

prevents cell death

associated with

expression of many

recombinant toxic

proteins

20 Yes

C43(DE3) 37 Yes

C43(DE3) 37 No

C43(DE3) 30 Yes

C43(DE3)

Derived from C41(DE3);

express a different set of

toxic proteins as

compared with C41(DE3)

20 Yes

C41(DE3)pLysS 37 Yes

C41(DE3)pLysS 37 No

C43(DE3)pLysS 37 Yes

C43(DE3)pLysS

Express T7 lysozyme,

natural inhibitor of T7

RNA polymerase;

stabilize recombinant

encoding mainly toxic

proteins

37 No

Figure 2: SDS-PAGE analysis of protein extracts from the mutant SD K69A in

E. coli C41(DE3) host cells grown at 37 ºC for 24 h. Lane 1, molecular weight

marker Low Range (Bio-Rad); Lanes 2-5, soluble fractions: 2, control without

IPTG; 3, K69A without IPTG; 4, control with 1 mM IPTG; 5, K69A with 1 mM

IPTG; Lanes 6-9, insoluble fractions: 6, control without IPTG; 7, K69A without

IPTG; 8, control with 1 mM IPTG; 9, K69A with 1 mM IPTG.

After cellular growth under the conditions determined above, we tried to

solubilize the insoluble bodies using the detergents sarcosyl, triton X-100,

zwittergent 3-14, or with the chaotropic agent urea. Solubilization of

recombinant wild-type and K69A MtbSD enzymes in inclusion bodies was

achieved by either treating the pellet with the denaturant agent urea (3 or 6M) or

by treating with the non ionic detergent zwittergent 3-14 (5 %). These soluble

fractions were dialyzed against Tris HCl 50 mM pH 7.8 buffer and the protein of

interest remained in the soluble fraction after in vitro refolding (Figure 3).

Figure 3: SDS-PAGE analysis of total protein extracts from the K69A SD mutant

after solubilization using 5 % zwittergent 3-14. Lane 1, soluble protein fraction

after disruption by sonication; 2, insoluble protein fraction after sonication; 3,

soluble protein fraction after zwittergent 3-14 treatment; 4, insoluble protein

fraction after zwittergent; 5, soluble protein fraction after in vitro refolding; 6,

insoluble protein fraction after refolding; 7, Bench Mark Protein Ladder

(Invitrogen).

However, the control experiment in which wild-type MtbSD was

solubilized by urea or zwittergent 3-14 showed that no measurable enzyme

activity could be detected. Although inclusion body formation can greatly

simplify protein purification, there is no guarantee that the in vitro refolding will

yield large amounts of biologically active product. Moreover, inclusion body

purification schemes present a number of problems such as: use of denaturants

that are expensive and can cause irreversible modifications of protein structure

that will elude all of the most sophisticated analytical tests, refolding usually

must be done in very dilute solution and the protein reconcentrated, and

refolding encourages protein isomerization leading to precipitation during

storage [38]. Since we aim at comparing steady-state kinetic parameters of the

mutant enzymes with those of the wild-type to determine the catalytic

mechanism of MtbSD, the use of these solubilizing agents should be avoided.

Accordingly, efforts were made to express recombinant MtbSD proteins in its

soluble form. The use of French press (Cell Disrupter System, Constant

Systems Ltd, UK) as the cell disruption method, unfortunately, led to

recombinant proteins in the insoluble fraction at all pressures tested: 20, 24, 27,

32 and 40 kpsi (40 kpsi = 2700 bar for 18 mm cylinder diameter). On the other

hand, the freeze-thaw method was able to yield K69I, K69Q, K69H and D105N

mutant proteins in soluble form (Figure 4). This method had previously been

described to be an efficient procedure in releasing the soluble and active wild-

type MtbSD [22]. The freeze-thaw is not a lysis method and release of soluble

proteins is through transient pores in the cellular envelope [34]. No differences

were observed when 5, 10 or 15 cycles of the freeze-thaw procedure were

tested (data not shown), and 5 cycles was then chosen. SDS-PAGE with

Coomassie blue staining analysis showed a protein band with an apparent

molecular mass of approximately 27 kDa, which is in agreement with the

expected molecular mass value [23].

Figure 4: SDS-PAGE analysis of soluble protein extracts after 5 cycles of the

freezing-and-thawing disruption method. Lanes 1, 3, 5, 7, control; 2, SD K69I

mutant; 4, K69Q; 6, K69H; 8, D105N; 9, Bench Mark Protein Ladder

(Invitrogen).

A purification protocol using four chromatographic steps was previously

described [23]. Here, we describe optimization of recombinant MtbSD protein

purification protocol using three chromatographic steps (Table 3). This

optimized protocol resulted in increased homogeneous recombinant protein

yield (13.5 %) as compared to a previous protocol (8.9 %). Moreover, the

protocol here described resulted in an 11.8-fold purification as compared to 8.5-

fold purification as previously described. The latter needed 49 g of E. coli

BL21(DE3) host cells harboring the recombinant pET23a(+)::aroE gene to yield

10.8 mg of homogeneous MtbSD (0.2 mg MtbSD/g cells). The protocol here

described yields 1.5 mg of homogeneous MtbSD protein from 5 g of E. coli

C41(DE3) host cells (0.3 mg MtbSD/g cells) that represents an improvement of

approximately 50 % in the recombinant protein yield. The optimized protein

purification protocol here described removed the first anion-exchange Q-

Sepharose Fast Flow column step and thus the supernatant of streptomycin

precipitation step was loaded on a hydrophobic interaction Phenyl Sepharose

Fast Flow column.

Table 3

Improved purification protocol for MtbSD

The results presented are for a purification protocol from 5 g of E. coli host cells

U mL

-1

It should be pointed out that the purification protocol described here does

not depend on a histidine tag for the purification purpose of recombinant

proteins. The strategies to obtain homogeneous shikimate dehydrogenases

from H. pylori [21] and H. influenzae [26], YdiB protein from E. coli [28], SD-like

enzyme from H. influenzae [20] employed recombinant proteins with histidine

tags. Recombinant MtbSD has also been tagged to a histidine tract to facilitate

protein purification [39]. Although many protocols use histidine tags to facilitate

protein purification by the nickel-affinity chromatography strategy, adding

histidine tags may alter the protein structure and the biological activity [40,41].

Although addition of histidine tags to recombinant proteins facilitate purification

protocols, we have made efforts to produce recombinant MtbSD without any

Purification

step

Total protein

(mg)

Total

activity (U)

Specific activity

(U mg

-1

)

Purification

(fold)

Yield

(%)

Crude extract 130.3 156.5 1.2 1 100

Phenyl-

Sepharose FF

25.1 113.0 4.5 3.8 72.2

Sephacryl S-

200

8.9 81.9 9.2 7.7 52.3

Mono-Q HR 1.5 21.2 14.1 11.8 13.5

fusion partner to avoid any possible effect that the latter may have on the

enzyme. Thus improvement of protocols previously described was the strategy

of choice, which proved fruitful because homogeneous recombinant K69A

(Figure 5) and wild-type (data not shown) MtbSD proteins were obtained by a

three-step purification protocol, as assessed by SDS-PAGE, with increased

protein yield (Table 3).

Figure 5: SDS-PAGE analysis of the protein fractions from purification steps of

the mutant K69A MtbSD. Lane 1, crude protein extract, injected on Phenyl

Sepharose FF; 2, pooled protein fractions injected on Sephacryl S-200; 3,

pooled protein fractions injected on Mono-Q HR; 4, Bench Mark Protein Ladder

(Invitrogen); 5, purified K69A MtbSD enzyme.

To ascertain that the apparent steady-state kinetics parameters of

recombinant MtbSD proteins were comparable with the ones using a previously

reported protocol [23], determination of Km and Vmax were carried out for wild-

type MtbSD. All kinetic experiments were performed in potassium phosphate

100 mM buffer since in phosphate [24] the catalytic rate value for this enzyme

seems to be larger than when the assay is carried out in Tris-HCl buffer [23].

The values obtained for the apparent steady-state kinetic parameters were as

follows: Km = 29 (±2 µM) for DHS, Km = 11 (±1 µM) for DHS, k

cat

= 50 (±1) s

-1

These values are in agreement with previously reported parameters [23,24]. It

should be noted that here we determined apparent steady-state kinetic

parameters and not true parameters as described elsewhere [24]. These data

provide a solid foundation on which to base analysis of recombinant MtbSD

mutant enzymes to determine the amino acid residues that are essential for

catalysis and/or binding of the substrates.

Here we report, to the best of our knowledge, the first site-directed

mutagenesis work on MtbSD. We also describe an efficient expression protocol

and an improved recombinant protein purification protocol that should be

employed to obtain homogeneous MtbSD mutant proteins. It should be pointed

out that expression and purification of functional wild-type and mutants of

MtbSD have proved a laborious goal to achieve. This is probably the reason for

only a scarce number of papers having appeared on studies of MtbSD

mechanism of action. A thorough characterization of wild-type and mutants of

MtbSD should provide a better understanding of the catalytic and chemical

mechanisms of this enzyme. However, these studies hinge on the availability of

MtbSD proteins in soluble and functional forms. We thus hope that the results

here presented will pave the way for the target-based rational design of novel

effective antimicrobial agents.

ACKNOWLEDGMENTS

Financial support for this work was provided by Millennium Initiative Program

MCT-CNPq, Ministry of Health-Department of Science and Technology (Brazil)

to D.S.S. and L.A.B. D.S.S. and L.A.B. also acknowledge grants awarded by

CNPq, FINEP, and PRONEX/FAPERGS/CNPq. D.S.S. (CNPq, 304051/1975-

06) and L.A.B. (CNPq, 520182/99-5) are research career awardees from the

National Council for Scientific and Technological Development of Brazil. We are

grateful to Professor John W. Frost, Department of Chemistry of Michigan State

University, for his generous gift of 3-dehydroshikimate substrate.

REFERENCES

[1] C. Dye, S. Scheele, P. Dolin, V. Pathania, M.C. Raviglione, Global burden of

tuberculosis: estimated incidence, prevalence, and mortality by country, JAMA

282 (1999) 677-686.

[2] R.B. Bloom, C.J.L. Murray, Tuberculosis: commentary on a reemergent

killer, Science 257 (1998) 1055-1064.

[3] K. Duncan, Progress in TB drug development and what is still needed,

Tuberculosis 83 (2003) 201-207.

[4] L.A. Basso, J.S. Blanchard, Resistance to antitubercular drugs, Adv. Exp.

Med. Biol. 456 (1998) 115-144.

[5] CDC (Centers for Disease Control and Prevention), Emergence of

Mycobacterium tuberculosis with extensive resistance to second-line drugs-

worldwide, Morb. Mortal. Wkly. Rep. 55 (2006) 301-305.

[6] S.E. Dorman, R.E. Chaisson, From magic bullets back to the Magic

Mountain: the rise of extensively drug-resistant tuberculosis, Nat. Med. 13

(2007) 295-298.

[7] T. Parish, N.G. Stoker, The common aromatic amino acid biosynthesis

pathway is essential in Mycobacterium tuberculosis, Microbiology 148 (2002)

3069-3077.

[8] R. Bentley, The shikimate pathway – a metabolic tree with many branches,

Crit. Rev. Biochem. Mol. Biol. 25 (1990) 307-384.

[9] C. Rizzi, J. Frazzon, F. Ely, P.G. Weber, I.O. Fonseca, M. Gallas, J.S.

Oliveira, M.A. Mendes, B.M. Souza, M.S. Palma, D.S. Santos, L.A. Basso,

DAHP synthase from Mycobacterium tuberculosis H37Rv: cloning, expression,

and purification of functional enzyme, Protein Expr. Purif. 40 (2005) 23-30.

[10] J.D. Mendonça, F. Ely, M.S. Palma, J. Frazzon, L.A. Basso, D.S. Santos,

Functional charaterization by genetic complementation of aroB-encoded

dehydroquinate synthase from Mycobacterium tuberculosis H37Rv and its

heterologous expression and purification, J. Bacteriol. 189 (2007) 6246-6252.

[11] J.H. Pereira, J.S. Oliveira, F. Canduri, M.V. Dias, M.S. Palma, L.A. Basso,

D.S. Santos, W.F. de Azevedo Jr, Structure of shikimate kinase from

Mycobacterium tuberculosis reveals the binding of shikimic acid, Acta

Crystallogr. D Biol. Crystallogr. 60 (2004) 2310-2319.

[12] J.S. Oliveira, M.A. Mendes, M.S. Palma, L.A. Basso, D.S. Santos, One-

step purification of 5-enolpyruvylshikimate-3-phosphate synthase enzyme from

Mycobacterium tuberculosis, Protein Expr. Purif. 28 (2003) 287-292.

[13] M.V. Dias, F. Ely, F. Canduri, J.H. Pereira, J. Frazzon, L.A. Basso, M.S.

Palma, W.F. de Azevedo Jr, D.S. Santos, Crystallization and preliminary X-ray

crystallographic analysis of chorismate synthase from Mycobacterium

tuberculosis, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 2003-2005.

[14] C.L. Fernandes, A. Breda, D.S. Santos, L.A. Basso, O.N. Souza, A

structural model for chorismate synthase from Mycobacterium tuberculosis in

complex with coenzyme and substrate, Comput. Biol. Med. 37 (2007) 149-158.

[15] R.K. Deka, I.A. Anton, B. Dunbar, J.R. Coggins, The characterisation of the

shikimate pathway enzyme dehydroquinase from Pisum sativum, FEBS Lett.

349 (1994) 397-402.

[16] S.A. Singh, D. Christendat, Structure of Arabidopsis dehydroquinate

dehydratase-shikimate dehydrogenase and implications for metabolic

channeling in the shikimate pathway, Biochemistry 45 (2006) 7787-7796.

[17] I.G. Charles, J.W. Keyte, W.J. Brammar, M. Smith, A.R. Hawkins, The

isolation and nucleotide sequence of the complex AROM locus of Aspergillus

nidulans, Nucleic Acids Res. 14 (1986) 2201-2213.

[18] K. Duncan, R.M. Edwards, J.R. Coggins, The pentafunctional AroM

enzyme of Saccharomyces cerevisiae is a mosaic of monofunctional domains,

Biochem. J. 246 (1987) 375-386.

[19] G. Michel, A.W. Roszak, V. Sauvé, J. Maclean, A. Matte, J.R. Coggins, M.

Cygler, A.J. Lapthorn, Structures of shikimate dehydrogenase AroE and its

paralog YdiB, J. Biol. Chem. 278 (2003) 19463-19472.

[20] S. Singh, S. Korolev, O. Koroleva, T. Zarembinski, F. Collart, A.

Joachimiak, D. Christendat, Crystal structure of a novel shikimate

dehydrogenase from Haemophilus influenzae, J. Biol. Chem. 280 (2005) 17101-

17108.

[21] C. Han, L. Wang, K. Yu, L. Chen, L. Hu, K. Chen, H. Jiang, X. Shen,

Biochemical characterization and inhibitor discovery of shikimate

dehydrogenase from Helicobacter pylori, FEBS J. 273 (2006) 4682-4692.

[22] M.L. Magalhães, C.P. Pereira, L.A. Basso, D.S. Santos, Cloning and

expression of functional shikimate dehydrogenase (EC 1.1.1.25) from

Mycobacterium tuberculosis H37Rv, Protein Expr. Purif. 26 (2002) 59-64.

[23] I.O. Fonseca, M.L.B. Magalhães, J.S. Oliveira, R.G Silva, M.A. Mendes,

M.S. Palma, D.S. Santos, L.A. Basso, Functional shikimate dehydrogenase

from Mycobacterium tuberculosis H37Rv: purification and characterization,

Protein Expr. Purif. 46 (2006) 429-437.

[24] I.O. Fonseca, R.G. Silva, C.L. Fernandes, O.N. de Souza, L.A. Basso, D.S.

Santos, Kinetic and chemical mechanisms of shikimate dehydrogenase from

Mycobacterium tuberculosis, Arch. Biochem. Biophys. 457 (2007) 123-133.

[25] H.A. Arcuri, J.C. Borges, I.O. Fonseca, J.H. Pereira, J.R. Neto, L.A. Basso,

D.S. Santos, W.F. de Azevedo Jr, Structural studies of shikimate 5-

dehydrogenase from Mycobacterium tuberculosis, Proteins 7 February 2008.

ói:10.1002/prot.21953.

[26] S. Ye, F. von Delf, A. Brooun, M.W. Knuth, R.V. Swanson, D.E. McRee,

The crystal structure of shikimate dehydrogenase (AroE) reveals a unique

NADPH binding mode, J. Bacteriol. 185 (2003) 4144-4151.

[27] B. Bagautdinov, N. Kunishima, Crystal structures of shikimate

dehydrogenase AroE from Thermus thermophilus HB8 and its cofactor and

substrate complexes: insights into the enzymatic mechanism, J. Mol. Biol. 373

(2007) 424-438.

[28] J. Benach, I. Lee, W. Edstrom, A.P. Kuzin, Y. Chiang, T.B. Acton, G.T.

Montelione, J.F. Hunt, The 2.3-Å crystal structure of the shikimate 5-

dehydrogenase orthologue YdiB from Escherichia coli suggests a novel

catalytic environment for an NAD-dependent dehydrogenase, J. Biol. Chem.

278 (2003) 19176-19182.

[29] A.K. Padyana, S.K. Burley, Crystal structure of shikimate 5-dehydrogenase

(SDH) bound to NADP: insights into function and evolution, Structure 11 (2003)

1005-1013.

[30] J. Gan, Y. Wu, P. Prabakaran, Y. Gu, Y. Li, M. Andrykovitch, H. Liu, Y.

Gong, H. Yan, X. Ji, Structural and biochemical analyses of shikimate

dehydrogenase AroE from Aquiflex aeolicus: implications for the catalytic

mechanism, Biochemistry 46 (2007) 9513-9522

[31] H.A. Lindner, G. Nadeau, A. Matte, G. Michel, R. Ménard, M. Cygler, Site-

directed mutagenesis of the active site region in the quinate/shikimate 5-

dehydrogenase YdiB of Escherichia coli, J. Biol. Chem. 280 (2005) 7162-7169.

[32] S.A. Lesley, P. Kuhn, A. Godzik, A.M. Deacon, I. Mathews, A. Kreusch, G.

Spraggon, H.E. Klock, D. McMullan, T. Shin, J. Vincent, A. Robb, L.S. Brinen,

M.D. Miller, T.M. McPhillips, M.A. Miller, D. Scheibe, J.M. Canaves, C. Guda, L.

Jaroszewski, T.L. Selby, M.A. Elsliger, J. Wooley, S.S. Taylor, K.O. Hodgson,

I.A. Wilson, P.G. Schultz, R.C. Stevens, Structural genomics of the Thermotoga

maritima proteome implemented in a high-throughput structure determination

pipeline. Proc. Natl. Acad. Aci. USA 99 (2002) 11664-11669.

[33] R. Vicentelli, C. Bignon, A. Gruez, S. Canaan, G. Sulzenbacher, M. Tegoni,

V. Campanacci, C. Cambillau, Medium-scale structural genomics: strategies for

protein expression and crystallization, Acc. Chem. Res. 36 (2003) 197-225.

[34] B.H. Johnson, M.H. Hecht, Recombinant proteins can be isolated from E.

coli cells by repeated cycles of freezing and thawing, Biotechnology 12 (1994)

1357-1360.

[35] U.K. Laemmli, Cleavage of structural proteins during the assembly of the

head of bacteriophage T4, Nature 227 (1970) 680-685.

[36] M.M. Bradford, R.A. McRorie, W.L. Williams, A rapid and sensitive method

for the quantitation of microgram quantities of protein utilizing the principle of

protein-dye binding, Anal. Biochem. 72 (1976) 248-254.

[37] K.C. Kelley, K.J. Huestis, D.A. Austen, C.T. Sanderson, M.A. Donoghue,

S.K. Stickel, E.S. Kawasaki, M.S. Osburne, Regulation of sCD4-183 gene

expression from phage-T7-based vectors in Escherichia coli, Gene 156 (1995)

33-36.

[38] C.H. Schein, Production of soluble recombinant proteins in bacteria,

Biotechnology 7 (1989) 1141-1149.

[39] X. Zhang, S. Zhang, F. Hao, X. Lai, H. Yu, Y. Huang, H. Wang, Expression,

purification and properties of shikimate dehydrogenase from Mycobacterium

tuberculosis, J. Biochem. Mo. Biol. 38 (2005) 624-631.

[40] A. Chant, C.M. Kraemer-Pecore, R. Watkin, G.G. Kneale, Attachment of a

histidine tag to the minimal zinc finger protein of the Aspergillus nidulans gene

regulatory protein AreA causes a conformational change at the DNA-binding

site, Protein Expr. Purif. 39 (2005) 152-159.

[41] I. Fonda, M. Kenig, V. Gaberck-Porekar, P. Prostovaek, V. Menart,

Attachment of histidine tags to recombinant tumor necrosis factor-alpha

drastically changes its properties, Sci. World J. 2 (2002) 1312-1325.

3.3 Manuscrito 2

The conserved Lysine 69 residue plays a catalytic role in Mycobacterium

tuberculosis shikimate dehydrogenase

Valnês S. Rodrigues-Junior

1,2

, Diógenes S. Santos

* and Luiz A. Basso

Centro de Pesquisas em Biologia Molecular e Funcional, Pontifícia

Universidade Católica do Rio Grande do Sul (PUCRS), Porto Alegre - RS,

90619-900, Brazil.

Programa de Pós-graduação em Biologia Celular e

Molecular, Centro de Biotecnologia, Universidade Federal do Rio Grande do

Sul (UFRGS), Porto Alegre - RS, Brazil.

Keywords: Mycobacterium tuberculosis, shikimate pathway, shikimate

dehydrogenase, site-directed mutagenesis

*Corresponding authors: Luiz A. Basso or Diógenes S. Santos

Mailing address: Av. Ipiranga 6681 – Tecnopuc – Prédio 92A

90619-900, Porto Alegre, RS, Brazil

Phone/Fax: +55 51 33203629

E-mail addresses: [email protected] or [email protected]

Short title: Role of Lysine 69 in MtbSD

ABSTRACT

The Mycobacterium tuberculosis shikimate dehydrogenase (MtbSD) is a

target for the development of antitubercular agents. Structural and functional

studies indicate that Lysine69 may be involved in catalysis and/or substrate

binding in MtbSD. Here we show that this residue plays a catalytic role and is

not involved in substrate binding.

Tuberculosis (TB) remains a major global health concern. It has been

estimated that one-third of the world population is infected with Mycobacterium

tuberculosis, the causative agent of TB, and that 30 million people died from

this disease in the last decade (1). Among the possible factors involved in the

resurgence of TB are the epidemic of the human immunodeficiency virus, the

increase in the homeless population, and the decline in health care structures

and national surveillance (2). Inappropriate treatment regimens and patient

noncompliance in completing the therapies are commonly associated with the

emergence of multi-drug resistant TB (MDR-TB), defined as strains of M.

tuberculosis resistant to at least isoniazid and rifampicin, two pivotal drugs used

in the standard treatment of TB (3, 4). More recently, it has been reported the

emergence of extensively drug-resistant (XDR) TB cases, defined as cases in

persons with TB whose isolates are resistant to isoniazid and rifampicin as well

as resistant to any one of the fluoroquinolone drugs and to at least one of the

three injectable second-line drugs (5). XDR-TB is widespread raising the

prospect of virtually incurable TB worldwide (6). There is thus an urgent need

for new drugs to improve the treatment of MDR- and XDR-TB, and to provide

more effective drugs to shorten the duration of TB treatment.

The shikimate pathway is an attractive target for the development of

herbicides and antimicrobial agents because it is essential in algae, higher

plants, bacteria, and fungi, but absent from mammals (7). The mycobacterial

shikimate pathway leads to the biosynthesis of precursors of aromatic amino

acids, naphthoquinones, menaquinones, and mycobactins (8). This pathway

has been shown to be essential for the viability of M. tuberculosis (9).

Accordingly, the enzymes of the shikimate pathway represent promising targets

for the development of non-toxic antimycobacterial agents. Shikimate

dehydrogenase (SD; EC 1.1.1.25), the fourth enzyme of this pathway, catalyzes

the NADPH-dependent reduction of 3-dehydroshikimate (DHS) to shikimate

(SHK). We have previously reported the cloning and expression of functional

aroE-encoded SD from M. tuberculosis H37Rv strain (MtbSD) (10). We have

also reported purification to homogeneity of recombinant functional MtbSD, N-

terminal amino acid sequencing, electrospray ionization mass spectrometry

analysis, size exclusion chromatography, determination of the apparent kinetic

parameters for all substrates, thermal stability, and activation energy for the

enzyme-catalyzed chemical reaction (11). More recently, we have described the

kinetic and chemical mechanisms of recombinant MtbSD (12). Multiple

sequence alignment, homology modeling, and pH-rate profiles suggest that the

side chain of Lys-69 in the DHS/SHK binding site of MtbSD may play a role in

substrate binding and/or catalysis (12, 13). Here we describe site-directed

mutagenesis, steady-state kinetics and fluorimetric measurements to probe the

role of Lys-69 in MtbSD and provide insight into the molecular basis of

DHS/SHK recognition and/or catalysis.

A previously constructed pET-23a(+)::aroE recombinant vector (10) was

used as a template for site-directed PCR-based mutagenesis using a Quick

Change site-directed mutagenesis kit (Stratagene, La Jolla, CA). Mutagenesis

primers were designed to change AAG (encoding a lysine residue) to GCG

(encoding an alanine residue). The synthetic oligonucleotides employed as

primers were as follows: 5’ ggtgtttcggtgaccatgccgggcgcgttcgccgccctgcggttcg 3’

(forward) and 5’ cgaaccgcagggcggcgaacgcgcccggcatggtcaccgaaacacc 3’

(reverse) (in bold is the codon for alanine). The PCR amplification program

using PfuTurbo

DNA polymerase was as follows: one step of 95º C for 30 s, 16

cycles at 95º C for 30 s, 55º C for 1 min, and 68º C for 10 min, followed by a

final extension step at 68º C for 10 min. The PCR product was treated with DpnI

endonuclease that specifically digests the methylated DNA template, and

selects for the mutation-containing synthesized DNA. Sequencing of mutagenic

aroE gene in pET-23a(+) vector from a single colony confirmed that the

mutation was introduced into the expected site and that no unwanted mutations

were introduced by the PCR amplification step (data not shown). This

recombinant plasmid was introduced into E. coli C41 (DE3) host cells

(Novagen, Madison, WI) by electroporation. Single colonies were used to

inoculate 2 L of LB medium containing 50 µg mL

-1

ampicillin, and 1 mM

isopropyl β-D-thiogalactopyranoside (IPTG) was added to cultures reaching an

600

of 0.4 - 0.6, and grown for 24 h at 37º C at 180 rpm. Cells (5 g) were

harvested by centrifugation at 14,900g for 30 min at 4º C, and stored at -20º C.

The freeze-thaw method was used to release the proteins in the soluble fraction

as previously described (10). The purification protocol was essentially as

previously described (11) except for removal of the first anionic exchange

chromatographic step (a thorough description of this improved protocol will be

described elsewhere – manuscript in preparation). Samples of the purification

steps were analyzed by SDS-PAGE (14) and the protein content was

determined by the Bradford method (15), using the Bio-Rad protein assay kit

(Bio-Rad) and bovine serum albumin as standard.

Steady-state kinetics measurements of homogeneous MtbSD K69A mutant

activity were carried out for the forward direction at 25º C in 100 mM potassium

phosphate buffer, pH 7.3, by monitoring the decrease in absorbance at 340 nm

(ε=6220 M

-1

for NADPH) accompanying the conversion of NADPH and

DHS to NADP

and SHK. The K69A activity was measured at various final

concentrations of DHS (20, 50, 70, 100, 150, 200, 250, 300 µM) while NADPH

was maintained at a saturating level (200 µM), and various concentrations of

NADPH (20, 30, 50, 70, 100, 150, 200, 250 µM) while DHS was maintained at a

saturating level (250 µM). The wild-type (WT) SD activity was measured at

various concentrations of DHS (10, 20, 30, 40, 50, 80, 100 µM) while NADPH

was maintained at a saturating level (200 µM), and various concentrations of

NADPH (5, 10, 15, 20, 40, 50 µM) while DHS was maintained at a saturating

level (250 µM). All measurements were in duplicate. Kinetic constants were

obtained by non-linear regression analysis of the kinetic data using the

SigmaPlot software (SPSS, Inc) and the Michaelis-Menten equation (v = V

max

[S]/K

+ [S]). The apparent steady-state kinetic parameters (Table 1) show that

the catalytic constant (k

cat

) value for wild-type MtbSD (50 s

-1

) is 68-fold larger

than K69A (0.73 s

-1

). There was a modest increase in the K

values for DHS

(K69A=76 μM; WT MtbSD=29 μM) and NADPH (K69A=30 μM; WT MtbSD=11

μM). The apparent second-order rate constant (k

cat

) values for DHS

(K69A=9.6 x 10

-1

; WT MtbSD=1.7 x 10

-1

) and NADPH (K69A=24 x

-1

; WT MtbSD=4.5 x 10

-1

) may apparently indicate that the mutant

has a lower specificity constant for both substrates. However, it should be noted

that the dominant feature is a decrease in the catalytic constant and only a

modest decrease in the Michaelis-Menten constants for both substrates. These

results suggest that the Lysine69 residue in MtbSD is involved in catalysis and

plays a minor role in substrate binding. To confirm this proposal,

spectrofluorimetric assays were carried out to determine the dissociation

constant for enzyme-substrate binary complex formation. Fluorescence titration

of substrate was carried out at 25 ºC making microliter additions of

concentrated substrate solutions to 2 mL of 1 µM of MtbSD monitoring the

intrinsic protein fluorescence (λexc=300 nm; 310 ≤ λem ≤ 450nm; maximum

λem at 340 nm). The fluorescence intensity at varying DHS concentration (2-

450 µM) yielded dissociation constant (Kd) values of 32 (± 4) µM for WT MtbSD

and 134 (± 21) µM for K69A mutant (Table 1).

TABLE 1

Apparent steady-state kinetic parameters and equilibrium binding constants for wild type and

K69A mutant MtbSD

steady-state kinetic parameters

spectroscopic measurements of intrinsic protein fluorescence

Interestingly, measurements of changes in nucleotide fluorescence upon

NADPH binding to WT MtbSD (λexc=370 nm; 380 ≤ λem ≤ 600nm; maximum

λem at 445 nm) did not show any saturation, which indicates a very large Kd

value. This is consistent with a steady-state ordered bi-bi mechanism with DHS

binding first followed by NADPH binding to MtbSD active site (12). The steady-

Parameter Wild type K69A

max

(U mg

-1

)

110 ± 2 1.61 ± 0.03

DHS (µM)

29 ± 2 76 ± 4

NADPH (µM)

11.0 ± 0.6 30 ± 2

cat

-1

)

50 ± 1 0.73 ± 0.01

cat

DHS (M

-1

)

1.7 (± 0.1) x 10

9.6 (± 0.5) x 10

cat

NADPH (M

-1

)

4.5 (± 0.2) x 10

24 (± 2) x 10

Kd DHS (µM)

32 ± 4 134 ± 21

state kinetics and spectrofluorimetric measurements indicate that the conserved

Lys69 residue in MtbSD plays a critical role in catalysis, but plays no role in

substrate binding.

Analysis of the three-dimensional structures for the ternary complexes of

SDs from Thermus termophilus (16) and Aquifex aeolicus (17) in complex with

NADP

and SHK suggest that the protonated lysine residue (Lys64 in T.

termophilus and Lys70 in A. aeolicus) interacts with carbon-3 of DHS, thereby

acting as an acid-base catalytic group that donates a proton to the carbonyl of

DHS during reduction and that removes a proton during oxidation of SHK. The

Lys67 in Haemophilus influenzae SD (18) and Lys385 in Arabidopsis thaliana

dehydroquinate dehydratase-SD (19) play a critical role in catalysis.

Interestingly, substitution of the conserved lysine residue (Lys71) in E. coli

quinate/shikimate dehydrogenase YdiB with alanine caused only a modest

decrease in k

cat

and a large increase in K

for SHK (20). These results

demonstrate that enzymes that catalyze the same chemical reaction may do so

by employing different catalytic mechanisms. Based on double isotope effects

and pH-rate profiles, we have previously proposed that the chemical

mechanism for MtbSD involves hydride transfer and solvent proton transfer in a

concerted mechanism, and an amino acid residue with pK

value of 8.9 is

involved in catalysis. Here we demonstrate that the MtbSD Lys69 is important

for catalysis and is likely involved in stabilization of the developing negative

charge at the hydride-accepting C-3 carbonyl oxygen of DHS for the forward

reaction. This knowledge should assist in the rational design of antitubercular

agents.

ACKNOWLEDGMENTS

This work was supported by Millennium Initiative Program MCT-CNPq, Ministry

of Health-Department of Science and Technology (Brazil) to D.S.S. and L.A.B.

D.S.S. and L.A.B. also acknowledge grants awarded by CNPq, FINEP, and

PRONEX/FAPERGS/CNPq. D.S.S. (CNPq, 304051/1975-06) and L.A.B.

(CNPq, 520182/99-5) are research career awardees from the National Council

for Scientific and Technological Development of Brazil. We are grateful to

Professor John W. Frost, Department of Chemistry of Michigan State University,

for his generous gift of 3-dehydroshikimate substrate.

REFERENCES

1. Dye, C., S. Scheele, P. Dolin, V. Pathania, and M. C. Raviglione, 1999.

Global burden of tuberculosis: estimated incidence, prevalence, and

mortality by country. JAMA 282:677-686.

2. Bloom, B. R. and C. J. L. Murray. 1998. Tuberculosis: commentary on a

reemergent killer. Science 257:1055-1064.

3. Duncan, K. 2003. Progress in TB drug development and what is still

needed. Tuberculosis 83:201-207.

4. Basso, L.A., and J. S. Blanchard. 1998. Resistance to antitubercular

drugs. Adv. Exp. Med. Biol. 456:115-144.

5. Centers of Disease Control and Prevention. 2006. Emergence of

Mycobacterium tuberculosis with extensive resistance to second-line drugs-

worldwide. MMWR Morb. Mortal. Wkly. Rep. 55:301-305.

6. Dorman, S. E., and R. E. Chaisson. 2007. From magic bullets back to the

Magic Mountain: the rise of extensively drug-resistant tuberculosis. Nat.

Med. 13:295-298.

7. Bentley, R. 1990. The shikimate pathway – a metabolic tree with many

branches. Crit. Rev. Biochem. Mol. Biol. 25:307-384.

8. Ducati, R .G., L. A. Basso, and D. S. Santos. 2007. Mycobacterial

shikimate pathway enzymes as targets for drug design. Current Drug

Targets. 8:423-435.

9. Parish, T., and N. G. Stoker. 2002. The common aromatic amino acid

biosynthesis pathway is essential in Mycobacterium tuberculosis.

Microbiology. 148:3069-3077.

10. Magalhães, M. L. B., C. P. Pereira, L. A. Basso, and D. S. Santos. 2002.

Cloning and expression of functional shikimate dehydrogenase (EC

1.1.1.25) from Mycobacterium tuberculosis H37Rv. Prot. Expr. Purif. 26:59-

64.

11. Fonseca, I. O., M. L. B. Magalhães, J. S. Oliveira, R. G. Silva, M. A.

Mendes, M. S. Palma, D. S. Santos, and L. A. Basso. 2006. Functional

shikimate dehydrogenase from Mycobacterium tuberculosis H37Rv:

purification and characterization. Prot. Expr. Purif. 46:429-437.

12. Fonseca, I. O., R. G. Silva, C. L. Fernandes, O. N. de Souza, L. A. Basso,

and D. S. Santos. 2007. Kinetic and chemical mechanisms of shikimate

dehydrogenase from Mycobacterium tuberculosis. Arch. Biochem. Biophys.

457:123-133.

13. Arcuri, H.A., J. C. Borges, I. O. Fonseca, J. H. Pereira, J. R. Neto, L. A.

Basso, D. S. Santos, and W. F. de Azevedo. 7 February 2008. Structural

studies of shikimate 5-dehydrogenase from Mycobacterium tuberculosis.

Proteins. doi:10.1002/prot.21953.

14. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of

the head of bacteriophage T4. Nature 227:680-685.

15. Bradford, M. M., R. A. McRorie, and W. L. Williams. 1976. A rapid and

sensitive method for the quantitation of microgram quantities of protein

utilizing the principle of protein-dye binding, Anal. Biochem. 72:248-254.

16. B. Bagautdinov, B., and N. Kunishima. 2007. Crystal structures of

shikimate dehydrogenase AroE from Thermus thermophilus HB8 and its

cofactor and substrate complexes: insights into the enzymatic mechanism.

2007. J. Mol. Biol. 373:424-438.

17. Gan, J., Y. Wan, P. Praakaran, Y. Gu, Y. Li, M. Andrykovitch, H. Liu, Y.

Gong, H. Yan, and X. Ji. 2007. Structural and biochemical analyses of

shikimate dehydrogenase AroE from Aquiflex aeolicus: implications for the

catalytic mechanism. Biochemistry. 46:9513-9522.

18. Singh, S., S. Korolev, O. Koroleva, T. Zarembinski, F. Collart, A.

Joachimiak, and D. Christendat. 2005. Crystal structure of a novel

shikimate dehydrogenase from Haemophilus influenzae. J. Biol. Chem.

280:17101-17108.

19. Singh, S. A., and D. Christendat. 2006. Structure of Arabidopsis

dehydroquinate dehydratase—shikimate dehydrogenase and implications

for metabolic channeling in the shikimate pathway. Biochemistry. 45:7787-

7796.

20. Lindner, H. A., G. Nadeau, A. Matte, G. Michel, R. Ménard, and M.

Cygler. 2005. Site-directed mutagenesis of the active site region in the

quinate/shikimate 5-dehydrogenase YdiB of Escherichia coli. J. Biol. Chem.

280:7162-7169.

4 DISCUSSÃO

4.1 Mutagênese sítio-direcionada do gene aroE

Estudos de alinhamentos de seqüências de muitas SD mostram que,

dentre outros aminoácidos, os resíduos Lis e Asp (Lis69 e Asp105 da MtbSD)

são completamente conservados e sugerem a provável importância destes

aminoácidos para a catálise e/ou ligação ao substrato (MICHEL et al., 2003;

HAN et al., 2006; FONSECA et al., 2007; YE et al., 2003; BAGAUTDINOV e

KUNISHIMA, 2007). A determinação da estrutura tridimensional de enzimas SD

(AroE, YdiB e SD-like) de muitos organismos também sugere o envolvimento

destes aminoácidos na catálise e/ou ligação ao substrato e revela a

conservação do padrão estrutural dentre as enzimas da família da SD (MICHEL

et al., 2003; SINGH et al., 2005; YE et al., 2003; BAGAUTDINOV e

KUNISHIMA, 2007; PADYANA e BURLEY, 2003; GAN et al., 2007; LINDNER

et al., 2005). Além disso, estudos de mutagênese sítio-direcionada confirmaram

a importância destes dois resíduos para a catálise (na SD-like de H. influenzae

e na DHQ-SD de A. thaliana) e para a ligação ao substrato (na YdiB de E. coli;

LINDNER et al., 2005; SINGH e CHRISTENDAT, 2006; SINGH et al., 2005).

Baseados em estudos estruturais e funcionais, é provável que os resíduos

conservados Lis69 e Asp105 tenham importância na catálise, na ligação ao

substrato, ou em ambos, na enzima MtbSD. Para investigar a importância, se

existir alguma, destes resíduos nós substituímos a Lis69 por Ala, Ile, His ou

Gln, e o Asp105 por Ala ou Asn através da técnica de mutagênese sítio-

direcionada. Primeiramente, projetamos os pares de oligonucleotídeos

iniciadores para as mutações desejadas, seguindo as instruções do fabricante:

ambos devem conter a mutação e anelar à seqüência oposta de cada fita do

plasmídeo; devem possuir de 25 a 45 bases; a trinca correspondente ao

aminoácido substituinte deve estar aproximadamente no meio da seqüência

iniciadora; cada oligonucleotídeo iniciador deve ter um conteúdo mínimo de 40

% de citosina e guanina (Tabela 1 do Manuscrito 1). A técnica de mutagênese

através de amplificação por PCR foi um procedimento eficaz, que permitiu

mutação no plasmídeo recombinante dupla fita, pET23a(+)::aroE. Cabe

ressaltar a importância de tratar o produto da amplificação por PCR com a

endonuclease DpnI. Esta enzima cliva especificamente o DNA metilado que

fora usado como molde, selecionando, assim, o DNA sintetizado possivelmente

contendo a mutação e excluindo o DNA não mutado. Após os procedimentos

de mutagênese, clones de cada mutação tiveram seu DNA plasmidial clivado

com as enzimas de restrição NdeI e BamHI, flanqueando o gene de interesse,

para verificar a presença do plasmídeo recombinante possivelmente mutado

(Anexo 6.4).

Na seqüência, alguns dos clones cujos plasmídeos liberaram o inserto

adequadamente foram enviados para o seqüenciamento de DNA. As

seqüências dos genes aroE mutantes foram verificadas para confirmar a

alteração dos nucleotídeos desejados e também para certificar que nenhuma

outra mutação indesejada tenha sido introduzida aleatoriamente durante o

passo de PCR (dados não mostrados).

4.2 Super-expressão das proteínas mutantes

Após os resultados do seqüenciamento, os plasmídeos mutantes foram

eletroporados em células de E. coli para testes de expressão protéica. Um

protocolo de expressão da enzima MtbSD recombinante havia sido descrito

usando a cepa de E. coli BL21 (DE3), sem indução com IPTG (MAGALHÃES et

al., 2002). Infelizmente, não foi observada a expressão das proteínas mutantes

na fração solúvel, nem na insolúvel, seguindo este protocolo. Então, testamos

outras condições de crescimento como temperaturas reduzidas de cultura,

outras cepas de E. coli, com e sem indução por IPTG (Tabela 2 do Manuscrito

1), além de diferentes tempos de crescimento. Conseguimos a expressão

destas proteínas na cepa E. coli C41 (DE3), com crescimento por 24 h a 37º C

e a 180 rpm, depois da indução com 1 mM de IPTG e rompimento celular por

sonicação (Figura 2 do Manuscrito 1). A necessidade da adição de IPTG para

favorecer a expressão é consistente com o uso do vetor pET23a(+). O sistema

de expressão pET utiliza a T7 RNA polimerase, sob controle do promotor

lacUV5 induzido por IPTG, para transcrever genes de interesse (KELLEY et al.,

1995).

Depois da multiplicação celular nas condições determinadas acima,

testamos a solubilização das proteínas de interesse, insolúveis, usando os

detergentes sarcosil, triton X-100, zwittergent 3-14 ou o agente caotrópico

uréia. Assim, conseguimos obter uma fração da proteína mutante K69A na

fração solúvel após tratar o agregado insolúvel com o agente desnaturante

uréia (3 e 6 M) e com o detergente não-iônico zwittergent 3-14 na concentração

de 5 %; a proteína de interesse permaneceu na fração solúvel após refolding in

vitro (Figura 3 do Manuscrito 1). Entretanto, os procedimentos de unfolding e

refolding podem causar modificações irreversíveis na estrutura protéica,

inclusive podem afetar a sua atividade biológica (SCHEIN, 1989).

De fato, quando testamos a atividade da enzima MtbSD sem mutação

após utilizar os protocolos de solubilização que utilizam uréia e zwittergent 3-

14, esta enzima não apresentou atividade mensurável (dados não mostrados).

Já que o nosso objetivo é comparar os perfis cinéticos das proteínas mutantes

com o da não mutante, o uso destes agentes que podem modificar a atividade

enzimática deve ser evitado. Então, os nossos esforços foram focalizados no

sentido de obter a expressão destas proteínas na fração solúvel.

O método de rompimento celular que utiliza a prensa de French levou as

proteínas recombinantes de interesse à fração insolúvel após testes com

variadas pressões (dados não mostrados). Felizmente, o método de

congelamento e descongelamento foi testado e, com sucesso, conseguiu

liberar uma fração das proteínas de interesse do citoplasma da célula (Figura 4

do Manuscrito 1).

Este método havia sido previamente usado para obter a enzima MtbSD

não mutada na fração solúvel e em sua forma ativa (MAGALHÃES et al., 2002).

Cabe ressaltar que este não é um método de lise como a sonicação e a prensa

de French; as proteínas solúveis são liberadas através de poros transientes

que se formam na membrana celular durante os ciclos de congelamento e

descongelamento (JOHNSON e HECHT, 1994).

De uma maneira geral, dificuldades na expressão de proteínas na fração

solúvel são consideradas importantes empecilhos aos estudos bioquímicos e

cristalográficos das proteínas de M. tuberculosis (VICENTELLI et al., 2003).

Anteriormente, a expressão da MtbSD na fração solúvel havia sido uma tarefa

difícil de atingir (MAGALHÃES et al., 2002). O protocolo de expressão

estabelecido aqui representa um importante passo para conseguir as proteínas

mutantes na fração solúvel e que permitirá os estudos funcionais desejados.

4.3 Purificação da enzima mutante K69A

Conseguimos purificar a enzima mutante K69A até a aparente

homogeneidade utilizando um protocolo otimizado em relação ao descrito

anteriormente (FONSECA et al., 2006). Este novo protocolo envolve três

etapas cromatográficas, enquanto o anterior possui quatro. Com o protocolo

otimizado obteve-se aumentos de 8,9 para 13,5 % no rendimento da

purificação e de 8,5 para 11,8 na taxa de purificação (Tabela 3 do Manuscrito

1).

O protocolo anterior produzia 10,8 mg de MtbSD homogênea a partir de

49 g de células E. coli BL21(DE3) (0,2 mg MtbSD/g célula). O protocolo

utilizado neste trabalho produz 1,5 mg da proteína MtbSD a partir de 5 g de

células E. coli C41(DE3) (0,3 mg MtbSD/g célula), o que representa um

aumento próximo a 50 % na produção desta proteína recombinante. Além

disso, deve-se ressaltar que este protocolo de purificação não utiliza a adição

de cauda de histidina a fim de facilitar a purificação de proteínas

recombinantes. As estratégias para purificar as enzimas AroE de H. pylori

(HAN et al., 2006), AroE de H. influenzae (YE et al., 2003), YdiB de E. coli

(BENACH et al., 2003), SD-like de H. influenzae (SINGH et al., 2005) resultam

em proteínas recombinantes com caudas extras de histidina. Um protocolo de

purificação que adiciona cauda de histidina à SD recombinante de M.

tuberculosis já foi publicado (ZHANG et al., 2005).

Embora muitos protocolos que utilizam esta estratégia de cromatografia

de afinidade por níquel compreendam uma única coluna de purificação, a

adição de cauda de histidina pode alterar significativamente a estrutura protéica

e sua atividade biológica (CHANT et al., 2005; FONDA et al., 2002). Tendo isto

em mente, evitou-se utilizar técnicas que pudessem alterar o perfil protéico e

impedir que nossos objetivos de caracterização enzimática fossem alcançados.

Assim, as enzimas MtbSD sem mutação e a mutante K69A (Figura 5 do

Manuscrito 1) foram purificadas até a aparente homogeneidade usando o

protocolo de apenas três passos cromatográficos. Determinamos os

parâmetros cinéticos aparentes da enzima MtbSD não mutante após

purificação utilizando o protocolo otimizado (Tabela 1 do Manuscrito 2). Os

valores de Km e Vmáx determinados neste trabalho são muito semelhantes às

constantes aparentes já publicadas para esta enzima (FONSECA et al., 2006),

provando que o protocolo de purificação otimizado resulta na enzima MtbSD

ativa e permitindo futuras análises funcionais das proteínas mutantes após

purificação por este protocolo.

4.4 Caracterização da enzima mutante K69A

Depois da purificação da enzima MtbSD K69A, realizamos

imediatamente os experimentos de caracterização enzimática, determinando as

constantes cinéticas aparentes, Km e Vmáx desta enzima mutante, no sentido

direto da reação.

Os parâmetros cinéticos aparentes (Tabela 1 do Manuscrito 2) mostram

que o valor da constante catalítica (Kcat) da enzima MtbSD sem mutação é 68

vezes maior do que o valor da K69A. Foram observados aumentos modestos

nos valores de Km

para o DHS e para o NADPH. A enzima mutante apresentou

diminuição de 182 vezes na eficiência catalítica (Kcat/Km) para o substrato

DHS e de 189 vezes para o cofator NADPH. A diminuição na eficiência

catalítica foi devida predominantemente ao valor de Kcat diminuído, com pouco

efeito dos ligeiros aumentos nas constantes de Michaelis-Menten para ambos

os substratos. De fato, o valor de Kcat para a enzima mutante permaneceu

apenas 1,46 % daquele da enzima não mutante.

Estes resultados sugerem que a o resíduo Lis69 da MtbSD está

envolvido na catálise e que tem pouca ou nenhuma importância na ligação ao

substrato. Para confirmar essa proposição, ensaios de espectrofluorimetria

foram realizados para determinar a constante de dissociação (Kd) para a

formação do complexo binário enzima-substrato. Os resultados destes

experimentos apontam diferenças modestas nos valores de Kd para as

enzimas MtbSD não mutante e K69A (Tabela 1 do Manuscrito 2). Assim,

ensaios cinéticos em estado estacionário e medidas espectrofluorimétricas

indicam que o resíduo conservado Lis69 tem importante função na catálise e

que não está envolvido na ligação ao substrato na enzima MtbSD.

Análise de estruturas tridimensionais dos complexos ternários de SDs de

Thermus termophilus (BAGAUTDINOV e KUNISHIMA, 2007) e de Aquifex

aeolicus (GAN et al., 2007) complexados com NADP

and SHK sugerem que o

resíduo protonado Lis (Lis64 de T. termophilus and Lis70 in A. aeolicus)

interage com o carbono-3 do DHS, atuando, então, como um grupo catalítico

ácido-básico que doa um próton para o grupamento carbonila do DHS durante

a redução e que remove um próton durante a oxidação do SHK.

A Lis67 da SD-like de Haemophilus influenzae (SINGH et al., 2005) e a

Lis385 da DHQ-SD de Arabidopsis thaliana (SINGH e CHRISTENDAT, 2006)

têm função crítica na catálise. Interessantemente, a substituição do resíduo Lis

conservado (Lis71) na quinato/SD YdiB de E. coli por Ala causou apenas uma

pequena diminuição no Kcat e um grande aumento no Km do SHK (LINDNER

et al., 2005). Estes resultados demonstram que enzimas que catalisam as

mesmas reações químicas podem usar mecanismos catalíticos diferentes.

Aqui, demonstramos que a Lis69 da MtbSD é importante para a catálise e que

provavelmente esteja envolvida na estabilização da carga negativa gerada no

átomo oxigênio da carbonila do DHS, na reação direta.

De certa forma, parecia intrigante que os resultados de mutagênese

sítio-direcionada para as enzimas SDs, até então, sugeriam papéis diferentes

para este resíduo nestas enzimas: a Lis69 (numeração de acordo com a

sequência da MtbSD) é crucial para a catálise na enzima DHQ-SD de A.

thaliana (SINGH e CHRISTENDAT, 2006) e na SD-like de H. influenzae

(SINGH et al., 2005), mas é importante somente para a ligação ao substrato na

YdiB de E. coli (LINDNER et al., 2005).

As enzimas AroE, YdiB e SD-like têm estruturas tridimensionais muito

similares mas suas propriedades bioquímicas como especificidade por

substratos e parâmetros cinéticos são muito distintos (SINGH et al., 2005).

Embora AroE, YdiB e SD-like consigam catalisar a reação de chiquimato

desidrogenase, esta pode ser somente uma atividade secundária para YdiB e

SD-like; YdiB possui outros substratos específicos, catalisando a redução

reversível do desidroquinato a quinato; os valores de Kcat para YdiB de E. coli

e para SD-like de H. influenza são muito baixos comparados aos Kcat das

enzimas AroE. (LINDNER et al., 2005; SINGH et al., 2005). Estas diferenças

funcionais e bioquímicas podem estar relacionadas com os prováveis distintos

papéis que o resíduo Lis69 possa ter dentre as enzimas da família chiquimato

desidrogenase.

Os nossos resultados estão de acordo com os estudos de mutagênese

envolvendo a enzima bifuncional DHQ-SD de A. thaliana e a SD-like de H.

influenzae, já que os valores de Kcat estão bastante diminuídos e mudanças

insignificantes são observadas nos valores de Km e nos resultados de

fluorimentria, comparando a enzima mutante K69A com a não mutante.

(SINGH et al., 2005; SINGH e CHRISTENDAT, 2006).

Este trabalho apresentou a primeira identificação de um aminoácido

cataliticamente importante para a enzima MtbSD, através da técnica de

mutagênese sítio-direcionada. A purificação e os ensaios cinéticos das outras

enzimas mutantes K69I, K69H, K69Q, D105A, D105N poderão ajudar a melhor

caracterizar o mecanismo catalítico desta enzima de M. tuberculosis. Um

entendimento mais detalhado, a nível molecular, das enzimas da via do

chiquimato pode servir como base para o desenho racional de novos e efetivos

agentes antimicrobianos.

5 REFERÊNCIAS BIBLIOGRÁFICAS

Amrhein, N.; Deus, B.; Gehrke, P.; Steinrucken, H.C. The site of the inhibition of

the shikimate pathway by glyphosate. II. Interference of glyphosate with

chorismate formation in vivo and in vitro, Plant Physiol. 66 (1980) 830-834.

Arcuri, H.A.; Borges, J.C.; Fonseca, I.O.; Pereira, J.H.; Neto, J.R.; Basso, L.A.;

Santos, D.S.; de Azevedo Jr, W.F. Structural studies of shikimate 5-

dehydrogenase from Mycobacterium tuberculosis, Proteins 7 February 2008.

doi:10.1002/prot.21953.

Bagautdinov, B. & Kunishima, N. Crystal structures of shikimate dehydrogenase

AroE from Thermus thermophilus HB8 and its cofactor and substrate

complexes: insights into the enzymatic mechanism, J. Mol. Biol. 373 (2007)

424-438.

Basso, L.A. & Blanchard, J.S. Resistance to antitubercular drugs, Adv. Exp.

Med. Biol. 456 (1998) 115-144.

Basso, L.A.; da Silva, L.H.; Fett-Neto, A.G.; de Azevedo Jr, W.F.; Moreira, I.S.;

Palma, M.S.; Calixto, J.B.; Astolfi Filho, S.; dos Santos, R.R.; Soares, M.B.;

Santos, D.S. The use of biodiversity as source of new chemical entities against

defined molecular targets for treatment of malaria, tuberculosis, and T-cell

mediated diseases – a review, Mem. Inst. Oswaldo Cruz 100 (2005) 475-506.

Benach, J.; Lee, I.; Edstrom, W.; Kuzin, A.P.; Chiang, Y.; Acton, T.B.;

Montelione, G.T.; Hunt, J.F. The 2.3-Å crystal structure of the shikimate 5-

dehydrogenase orthologue YdiB from Escherichia coli suggests a novel

catalytic environment for an NAD-dependent dehydrogenase, J. Biol. Chem.

278 (2003) 19176-19182.

Bentley, R. The shikimate pathway – a metabolic tree with many branches, Crit.

Rev. Biochem. Mol. Biol. 25 (1990) 307-384.

Bloom, R.B. & Murray, C.J.L. Tuberculosis: commentary on a reemergent killer,

Science 257 (1992) 1055-1064.

CDC (Centers for Disease Control and Prevention), Emergence of

Mycobacterium tuberculosis with extensive resistance to second-line drugs-

worldwide, Morb. Mortal. Wkly. Rep. 55 (2006) 301-305.

Chant, A.; Kraemer-Pecore, C.M.; Watkin, R.; Kneale, G.G. Attachment of a

histidine tag to the minimal zinc finger protein of the Aspergillus nidulans gene

regulatory protein AreA causes a conformational change at the DNA-binding

site, Protein Expr. Purif. 39 (2005) 152-159.

Charles, I.G.; Keyte, J.W.; Brammar, W.J.; Smith, M.; Hawkins, A.R. The

isolation and nucleotide sequence of the complex AROM locus of Aspergillus

nidulans, Nucleic Acids Res. 14 (1986) 2201-2213.

Coggins, J.R.; Abell, C.; Evans, L.B.; Fredrickson, M.; Robinson, D.A.; Roszak,

A.W.; Lapthorn, A.P. Experiences with the shikimate pathway-enzymes as

targets for rational drug design, Biochem. Soc. Trans. 31 (2003) 548-552.

Cole, S.T.; Brosch, R.; Parkhill, J.; Garnier, T.; Churcher, C.; Harris, D.; Gordon,

S.V.; Eiglmeier, K.; Gas, S.; Barry, C.E.; Tekaia, F.; Badcock, K.; Basham, D.;

Brown, D.; Chillingworth, T.; Connor, R.; Davies, R.; Devlin, K.; Feltwell, T.;

Gentles, S.; Hamlin, N.; Holroyd, S.; Hornsby, T.; Jagels, K.; Krogh, A.;

McLean, J.; Moule, S.; Murphy, L.; Oliver, K.; Osborne, J.; Quail, M.A.;

Rajandream, M.A.; Rogers, J.; Rutter, S.; Seeger, K.; Skelton, J.; Squares, R.;

Squares, S.; Sulston, J.E.; Taylor, K.; Whitehead, S.; Barrell, B.G. Deciphering

the biology of Mycobacterium tuberculosis from the complete genome

sequence, Nature 393 (1998) 537-544.

Corbett, E.L.; Watt, C.J.; Walker, N.; Maher, D.; Williams, B.G.; Raviglione,

M.C.; Dye, D. The growing burden of tuberculosis, Arch. Intern. Med. 163

(2003) 1009-1021.

Daniel, T.M. Captain of death: the story of tuberculosis, University of Rochester

Press, New York, 1997.

Deka, R.K.; Anton, I.A.; Dunbar, B.; Coggins, J.R. The characterisation of the

shikimate pathway enzyme dehydroquinase from Pisum sativum, FEBS Lett.

349 (1994) 397-402.

Dias, M.V.; Ely, F.; Canduri, F.; Pereira, J.H.; Frazzon, J.; Basso, L.A.; Palma,

M.S.; de Azevedo Jr, W.F.; Santos, D.S. Crystallization and preliminary X-ray

crystallographic analysis of chorismate synthase from Mycobacterium

tuberculosis, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 2003-2005.

Dorman, S.E. & Chaisson, R.E. From magic bullets back to the Magic Mountain:

the rise of extensively drug-resistant tuberculosis, Nat. Med. 13 (2007) 295-298.

Dormandy, T. The white death: a history of tuberculosis, New York University

Press, 2002.

Ducati, R.G.; Ruffino-Neto, A.; Basso, L.A.; Santos, D.S. The resumption of

comsumption – a review on tuberculosis, Mem. Inst. Oswaldo Cruz 101 (2006)

679-714.

Duncan, K. Progress in TB drug development and what is still needed,

Tuberculosis 83 (2003) 201-207.

Duncan, K.; Edwards, R.M.; Coggins, J.R. The pentafunctional arom enzyme of

Saccharomyces cerevisiae is a mosaic of monofunctional domains, Biochem. J.

246 (1987) 375-386.

Dunlap, N.E.; Bass, J.; Fujiwara, P.; Hopewell, P.; Horsburgh Jr., C.R.;

Slafinger, M.; Simone, P.M. Diagnostic standards and classification of

tuberculosis in adults and children, Am. J. Respir. Crit. Care Med. 161 (2000)

1376-1395.

Dye, C.; Scheele, S.; Dolin, P.; Pathania, V.; Raviglione, M.C. Global burden of

tuberculosis: estimated incidence, prevalence, and mortality by country, JAMA

282 (1999) 677-686.

Enarson, D.A. & Murray, J.F. Global epidemiology of tuberculosis. In WM Rom,

S Garay (eds) Tuberculosis, Little, Brown and Co., Boston, (1996) 57-75.

Enserink, M. Driving a stake into resurgent TB, Science 293 (2001) 234-235.

Fätkenheuer, G.; Taelman, H.; Lepage, P.; Schwenk, A.; Werzel, R. The return

of tuberculosis, Diagn. Microbiol. Infect. Dis. 34 (1999) 139-146.

Fernandes, C.L.; Breda, A.; Santos, D.S.; Basso, L.A.; Souza, O.N. A structural

model for chorismate synthase from Mycobacterium tuberculosis in complex

with coenzyme and substrate, Comput. Biol. Med. 37 (2007) 149-158.

Fonda, I.; Kenig, M.; Gaberck-Porekar, V.; Prostovaek, P.; Menart, V.

Attachment of histidine tags to recombinant tumor necrosis factor-alpha

drastically changes its properties, Sci. World J. 2 (2002) 1312-1325.

Fonseca, I.O.; Magalhães, M.L.B.; Oliveira, J.S.; Silva, R.G.; Mendes, M.A.;

Palma, M.S.; Santos, D.S.; Basso, L.A. Functional shikimate dehydrogenase

from Mycobacterium tuberculosis H37Rv: purification and characterization,

Protein Expr. Purif. 46 (2006) 429-437.

Fonseca, I.O.; Silva, R.G.; Fernandes, C.L.; de Souza, O.N.; Basso, L.A.;

Santos, D.S. Kinetic and chemical mechanisms of shikimate dehydrogenase

from Mycobacterium tuberculosis, Arch. Biochem. Biophys. 457 (2007) 123-

133.

Gan, J.; Wu, Y.; Prabakaran, P.; Gu, Y.; Li, Y.; Andrykovitch, M.; Liu, H.; Gong,

Y.; Yan, H.; Ji, X. Structural and biochemical analyses of shikimate

dehydrogenase AroE from Aquiflex aeolicus: implications for the catalytic

mechanism, Biochemistry 46 (2007) 9513-9522.

Han, C.; Wang, L.; Yu, K.; Chen, L.; Hu, L.; Chen, K.; Jiang, H.; Shen, X.

Biochemical characterization and inhibitor discovery of shikimate

dehydrogenase from Helicobacter pylori, FEBS J. 273 (2006) 4682-4692.

Johnson, B.H. & Hecht, M.H. Recombinant proteins can be isolated from E. coli

cells by repeated cycles of freezing and thawing, Biotechnology 12 (1994)

1357-1360.

Kaufmann, S.H.E. A short history of Robert Koch’s fight against tuberculosis:

Those who do not remember the past are condemned to repeat it, Tuberculosis

83 (2003) 86-90.

Kelley, K.C.; Huestis, K.J.; Austen, D.A.; Sanderson, C.T.; Donoghue, M.A.;

Stickel, S.K.; Kawasaki, E.S.; Osburne, M.S. Regulation of sCD4-183 gene

expression from phage-T7-based vectors in Escherichia coli, Gene 156 (1995)

33-36.

Knigge, A.; Morr, H.; Killian, A. Tuberculosis and HIV/AIDS. Epidemics:

Opportunities for cross support. Disease Control (Tuberculosis) and Health

Promotion AIDS Control in Developing Contries. Deutsche Gesellschaft für

Technische Zusammenarbeit (GTZ) GmbH, 2000.

Lindner, H.A.; Nadeau, G.; Matte, A.; Michel, G.; Ménard, R.; Cygler, M. Site-

directed mutagenesis of the active site region in the quinate/shikimate 5-

dehydrogenase YdiB of Escherichia coli, J. Biol. Chem. 280 (2005) 7162-7169.

Magalhães, M.L.; Pereira, C.P.; Basso, L.A.; Santos, D.S. Cloning and

expression of functional shikimate dehydrogenase (EC 1.1.1.25) from

Mycobacterium tuberculosis H37Rv, Protein Expr. Purif. 26 (2002) 59-64.

Manabe, Y.C. & Bishai, W.R. Latent Mycobacterium tuberculosis-persistence,

patience, and winning by waiting, Nat. Med. 6 (2000) 1327-1329.

Mendonça, J.D.; Ely, F.; Palma, M.S.; Frazzon, J.; Basso, L.A.; Santos, D.S.

Functional charaterization by genetic complementation of aroB-encoded

dehydroquinate synthase from Mycobacterium tuberculosis H37Rv and its

heterologous expression and purification, J. Bacteriol. 189 (2007) 6246-6252.

Michel, G.; Roszak, A.W.; Sauvé, V.; Maclean, J.; Matte, A.; Coggins, J.R.;

Cygler, M.; Lapthorn, A.J. Structures of shikimate dehydrogenase AroE and its

paralog YdiB, J. Biol. Chem. 278 (2003) 19463-19472.

O’Brien, R.J. & Nunn, P.P. The need for new drugs against tuberculosis, Am. J.

Respir. Crit. Care Med 162 (2001) 1055-1058.

Oliveira, J.S.; Mendes, M.A.; Palma, M.S.; Basso, L.A.; Santos, D.S. One-step

purification of 5-enolpyruvylshikimate-3-phosphate synthase enzyme from

Mycobacterium tuberculosis, Protein Expr. Purif. 28 (2003) 287-292.

Padyana, A.K. & Burley, S.K. Crystal structure of shikimate 5-dehydrogenase

(SDH) bound to NADP: insights into function and evolution, Structure 11 (2003)

1005-1013.

Parish, T. & Stoker, N.G. The common aromatic amino acid biosynthesis

pathway is essential in Mycobacterium tuberculosis, Microbiology 148 (2002)

3069-3077.

Pasqualoto, K.F & Ferreira, E.I. An approach for the rational design of new

antituberculosis agents, Curr. Drug Targets 2 (2001) 427-437.

Pereira, J.H.; Oliveira, J.S.; Canduri, F.; Dias, M.V.; Palma, M.S.; Basso, L.A.;

Santos, D.S.; de Azevedo Jr, W.F. Structure of shikimate kinase from

Mycobacterium tuberculosis reveals the binding of shikimic acid, Acta

Crystallogr. D Biol. Crystallogr. 60 (2004) 2310-2319.

Rizzi, C.; Frazzon, J.; Ely, F.; Weber, P.G.; Fonseca, I.O.; Gallas, M.; Oliveira,

J.S.; Mendes, M.A.; Souza, B.M.; Palma, M.S.; Santos, D.S.; Basso, L.A. DAHP

synthase from Mycobacterium tuberculosis H37Rv: cloning, expression, and

purification of functional enzyme, Protein Expr. Purif. 40 (2005) 23-30.

Roberts, F.; Roberts, C.W.; Johnson, J.J.; Kyle, D.E.; Krell, T.; Coggins, J.R.;

Coombs, G.H.; Milhous, W.K.; Tzipori, S.; Ferguson, D.J.; Chakrabarti, D.;

McLeod, R. Evidence for the shikimate pathway in apicomplexan parasites,

Nature 393 (1998) 801-805.

Schein, C.H. Production of soluble recombinant proteins in bacteria,

Biotechnology 7 (1989) 1141-1149.

Sepkowitz, K.A.; Raffalli, J.; Riley, L.; Kiehn, T.E.; Armstrong, D. Tuberculosis in

the AIDS era, Clin. Microbiol. Rev. 8 (1995) 180-199.

Singh, S.; Korolev, S.; Koroleva, O.; Zarembinski, T.; Collart, F.; Joachimiak, A.;

Christendat, D. Crystal structure of a novel shikimate dehydrogenase from

Haemophilus influenzae, J. Biol. Chem. 280 (2005) 17101-17108.

Singh, S.A. & Christendat, D. Structure of Arabidopsis dehydroquinate

dehydratase-shikimate dehydrogenase and implications for metabolic

channeling in the shikimate pathway, Biochemistry 45 (2006) 7787-7796.

Vicentelli, R.; Bignon, C.; Gruez, A.; Canaan, S.; Sulzenbacher, G.; Tegoni, M.;

Campanacci, V.; Cambillau, C. Medium-scale structural genomics: strategies for

protein expression and crystallization, Acc. Chem. Res. 36 (2003) 197-225.

WHO (World Health Organization). Global tuberculosis control: surveillance,

planning, financing. WHO report 2006. World Health Organization, Geneva,

Switzerland, 2006.

Wickelgren, I. New clues to how the TB bacillus persists, Science 288 (2000)

1314-1315.

Ye, S.; von Delf, F.; Brooun, A.; Knuth, M.W.; Swanson, R.V.; McRee, D.E. The

crystal structure of shikimate dehydrogenase (AroE) reveals a unique NADPH

binding mode, J. Bacteriol. 185 (2003) 4144-4151.

Zhang, X.; Zhang, S.; Hao, F.; Lai, X.; Yu, H.; Huang, Y.; Wang, H. Expression,

purification and properties of shikimate dehydrogenase from Mycobacterium

tuberculosis, J. Biochem. Mo. Biol. 38 (2005) 624-631.

6 ANEXOS

6.1 Alinhamentos de sequências de chiquimato desidrogenases

Alinhamento múltiplo de seqüências das enzimas AroE de E. coli, Vibrio cholerae,

QutB de E. nidulans, Qa-3 de N. crassa, YdiB de E. coli e L. monocytogenes, DHQ-SD

de Lycopersicon esculentum (MICHEL et al., 2003).

Alinhamento de seqüências de SD de várias bactérias: E. coli, H. influenzae, N.

meningitidis, M. jannaschii, A. fulgidus, M. tuberculosis e H. pylori (HAN et al., 2006).

Alinhamento múltiplo de seqüências das enzimas AroE de Mycobacterium

tuberculosis, AroE de E. coli e YdiB de E. coli (FONSECA et al., 2007).

Alinhamento múltiplo de seqüências de AroE dos seguintes organismos: H. influenzae,

Helicobacter pylori, Aquifex aeolicus, Bacillus subtilis, Staphylococcus aureus,

Streptococcus pneumoniae, Thermotoga marítima, E. coli, Pseudomonas aeruginosa,

Neisseria gonorrhoeae, Methanococcus jannaschii e Pyrococcus furiosus (YE et al.,

2003).

Alinhamento múltiplo de seqüências das enzimas AroE de Thermus thermophilus, E.

coli, H. influenzae e M. jannaschii, YdiB de E. coli e Corynebacterium glutamicum, SD-

like de H. influenzae, DHQ-SD de A. thaliana (BAGAUTDINOV e KUNISHIMA, 2007).

6.2 Seqüência dos resíduos de aminoácidos da MtbSD

MSEGPKKAGV LGSPIAHSRS PQLHLAAYRA LGLHDWTYER IECGAAELPV

VVGGFGPEWV GVSVTMPGKF AALRFADERT ARADLVGSAN TLVRTPHGWR

ADNTDIDGVA GALGAAAGHA LVLGSGGTAP AAVVGLAELG VTDITVVARN

SDKAARLVDL GTRVGVATRF CAFDSGGLAD AVAAAEVLVS TIPAEVAAGY

AGTLAAIPVL LDAIYDPWPT PLAAAVGSAG GRVISGLQML LHQAFAQVEQ

FTGLPAPREA MTCALAALD

Os resíduos em vermelho foram mutados

100

6.3 Seqüência de nucleotídeos do gene aroE de M. tuberculosis

1 atgagcgaag gtcccaaaaa agccggcgtg cttggttcgc cgatcgcgca ttcccgctcc

61 ccgcagctgc acctggccgc ctaccgggcg ttggggctgc acgactggac ctatgagcgc

121 atcgaatgcg gtgcggccga gttgcccgtc gtggtcggtg gtttcggacc ggagtgggtc

181 ggtgtttcgg tgaccatgcc gggcaagttc gccgccctgc ggttcg

ccga cgagcgcacc

241 gcacgcgcgg accttgtcgg ttcggccaac accctggttc ggacgccgca tggctggcgg

301 gccgacaaca ccgacatcga cggggtggcc ggggcg

ttgg gggcggctgc tggacacgcg

361 ctggtgctgg ggtccggggg gaccgcaccg gcggccgtgg tggggctggc cgaactcggg

421 gtcaccgaca tcaccgtggt ggcgcgcaac tcggacaagg cggcccggct ggtggacctg

481 ggcacacggg tcggcgtggc gacccggttc tgcgcgttcg acagcggtgg gttggccgat

541 gcggtggccg ccgcggaagt gctggtcagc accattccag cggaggtggc cgcggggtat

601 gccggcacct tggccgcgat cccggtgctg ttggacgcca tctacgatcc gtggcccaca

661 ccgctggccg ccgcggtcgg atcggcgggc gggcgggtga tcagcgggct gcagatgttg

721 ctgcatcagg cgttcgcgca ggtggagcag ttcaccgggc tacccgcccc ccgcgaagcg

781 atgacttgcg cgctggccgc gttggactag

Em negrito estão as seqüências definidas como base para o desenho do par de

oligonucleotídeos iniciadores para cada mutação: de 181 a 226 para as mutações da

lisina 69 e de 292 a 336 para as mutações do aspartato 105; em vermelho estão as

duas trincas de nucleotídeos mutadas.

101

6.4 Géis de agarose a 2 %

A B C

D E F

Eletroforese em gel de agarose a 2 % do vetor pET23a(+) contendo

ou não o inserto de interesse, aroE, após a mutagênese sítio-direcionada e

após clivagem com as enzimas de restrição NdeI e BamHI. Possíveis

mutações: A, K69A; B, K69I; C, K69H; D, K69Q; E, D105A; F, D105N. N = não

clivado; C = clivado; M = marcador 1 Kb plus DNA Ladder.

N C M C C C C N N N

C C C C

N N N

5000 pb

2000 pb

1000 pb

850 pb

C C C C N

N N N

N C

N C N C N C N C N C N C M

102

6.5 Carta de submissão do artigo “Screening of experimental conditions to

express soluble shikimate dehydrogenase mutants from Mycobacterium

tuberculosis H37Rv” à revista Protein Expression and Purification

From: PEP (ELS) [mailto:[email protected]]

Sent: Tue 5/13/2008 10:59 AM

To: Luiz Augusto Basso

Subject: Protein Expression and Purification: Submission Confirmation

Title: Screening of experimental conditions to express soluble shikimate dehydrogenase

mutants from Mycobacterium tuberculosis H37Rv

Corresponding Author: Dr. Luiz Augusto Basso

Authors: Valnês S Rodrigues-Junior, MSc; Diogenes S Santos, PhD

Dear Dr. Basso,

This is to confirm that the above-mentioned manuscript has been received for

consideration in Protein Expression and Purification.

You will be able to check on the progress of your manuscript by logging on to the

Elsevier Editorial System for Protein Expression and Purification as an author:

http://ees.elsevier.com/prep/

Your username is: LBASSO

Your password is:

Your paper will be given a manuscript number shortly and you will soon receive an e-

mail with this number for your reference.

Thank you for submitting your manuscript to Protein Expression and Purification.

Should you have any questions, please feel free to contact our office.

Kind regards,

Susan Ikeda

Protein Expression and Purification

Journal Manager

Elsevier

525 B Street, Suite 1900

San Diego, CA 92101-4495

USA

Phone: 619 699 6793

Fax: 619 699 6211

E-mail: [email protected]

103

6.6 Carta de submissão do artigo “The conserved Lysine 69 residue plays a

catalytic role in Mycobacterium tuberculosis shikimate dehydrogenase” à revista

Journal of Bacteriology

From: [email protected] [mailto:[email protected]]

Sent: Wed 4/30/2008 11:23 AM

To: Luiz Augusto Basso

Subject: Manuscript submission (JB00598-08 Version 1)

Dr Luiz A. Basso

Pontificia Universidade Catolica do Rio Grande do Sul - PUCRS

Faculdade de Biociências - Centro de Pesquisas em Biologia Molecular e Funcional

Av. Ipiranga, 6681

TECNOPUC - Predio 92A

Porto Alegre, Rio Grande do Sul 90619-900

Brazil

Re: The conserved Lysine 69 residue plays a catalytic role in Mycobacterium tuberculosis

shikimate dehydrogenase (JB00598-08 Version 1)

Dear Dr. Basso:

You have successfully submitted your manuscript via the Rapid Review system. The control

number of your manuscript is JB00598-08 Version 1. Take note of this number, and refer to it in

any correspondence with the Journals Department or with the editor. You may log onto the

Rapid Review system at any time to see the current status of your manuscript and the name of

the editor handling it. The URL is http://www.rapidreview.com/ASM2/author.html

, and your user

name is labasso. To find contact information for the editor handling your manuscript, go to the

following URL: http://www.asm.org/journals/editors.asp

In submitting your manuscript to the Journal of Bacteriology (JB), the author(s) guarantees that

a manuscript with substantially the same content has not been submitted or published

elsewhere and that all of the authors are aware of and agree to the submission.

104

By publishing in the journal, the authors agree that any DNAs, viruses, microbial strains, mutant

animal strains, cell lines, antibodies, and similar materials newly described in the article are

available from a national collection or will be made available in a timely fashion, at reasonable

cost, and in limited quantities to members of the scientific community for noncommercial

purposes. The authors guarantee that they have the authority to comply with this policy either

directly or by means of material transfer agreements through the owner.

Similarly, the authors agree to make available computer programs, originating in the authors'

laboratory, that are the only means of confirming the conclusions reported in the article but that

are not available commercially. The program(s) and suitable documentation regarding its (their)

use may be provided by any of the following means: (i) as a program transmitted via the

Internet, (ii) as an Internet server-based tool, or (iii) as a compiled or assembled form on a

suitable medium (e.g., magnetic or optical). It is expected that the material will be provided in a

timely fashion and at reasonable cost to members of the scientific community for

noncommercial purposes. The authors guarantee that they have the authority to comply with

this policy either directly or by means of material transfer agreements through the owner.

If your manuscript is accepted for publication, a condition of acceptance is that you assign

each letter of acceptance after the manuscript has been scheduled for publication.

If your manuscript is accepted for publication in a 2008 issue, page charges (subject to change

without notice) will be assessed at $65 per printed page for the first eight pages and $200 for

each page in excess of eight for a corresponding author who is an ASM member or $75 per

printed page for the first eight pages and $250 for each page in excess of eight for a

nonmember corresponding author. A corresponding author who is not a member may join ASM

to obtain the member rate. If the research was not supported, you may send a request for a

waiver of page charges to the Director, Journals. For more details, including type of articles not

charged, see the Instructions to Authors.

105

IMPORTANT NOTICE: For its primary-research journals, ASM posts online PDF versions of

manuscripts that have been peer reviewed and accepted but not yet copyedited. This feature is

called “JB Accepts” and is accessible from the Journals website. The manuscripts are

published online as soon as possible after acceptance, on a weekly basis, before the

copyedited, typeset versions are published. They are posted “As Is” (i.e., as submitted by the

authors at the modification stage), and corrections/changes are NOT accepted. Accordingly,

there may be differences between the JB Accepts version and the final, typeset version. The

manuscripts remain listed on the JB Accepts page until the final, typeset versions are posted, at

which point they are removed from the JB Accepts page and become available only through

links from the final, typeset version. They are under subscription access control until 4 months

after the typeset versions are posted, when access to all forms becomes free to everyone. Any

supplemental material intended, and accepted, for publication is not posted until publication of

the final, typeset article.

Thank you for submitting your manuscript for consideration.

Jack Kenney

Production Editor

Journal of Bacteriology (JB)

106

CURRICULUM VITÆ

RODRIGUES-JUNIOR, V. R.

1. DADOS PESSOAIS

Nome: Valnês da Silva Rodrigues Junior

Local e data de nascimento: São Borja, Rio Grande do Sul, Brasil, 12 de

setembro de 1982

Endereço profissional: Av. Ipiranga, 6681; TecnoPUC prédio 92ª

Telefone profissional: (51) 3320-3629

E-mail: [email protected]

2. FORMAÇÃO

Farmácia (Universidade Federal do Rio Grande do Sul, 2001-2005);

Mestrado em Biologia Celular e Molecular (Universidade Federal do Rio

Grande do Sul, 2006-2008)

3. ESTÁGIOS

Laboratório de Parasitologia, Departamento de Microbiologia, Instituto de

Biociências, Universidade Federal do Rio Grande do Sul.

Orientação: Profa. Dra. Marilise B. Rott e Profa. Dra. Márcia B. Mentz

Período: Mar 2002 – Mar 2003 Iniciação Científica – Voluntário

Projeto de pesquisa: “Levantamento epidemiológico de parasitas em areias

de recreação de parques públicos da cidade de Porto Alegre, RS”.

Laboratório de Erros Inatos do Metabolismo, Departamento de Bioquímica,

Instituto de Biociências, Universidade Federal do Rio Grande do Sul.

Orientação: Prof. Dr. Clovis Milton Duval Wannmacher

Período: Abr 2003 – Dez 2005 Bolsista de Iniciação Científica – CNPq

Projeto de pesquisa: “Estudo dos mecanismos de neurotoxicidade de

aminoácidos em aminoacidopatias”.

107

4. ARTIGOS COMPLETOS PUBLICADOS

RECH, V. C., FEKSA, L. R., FLECK, R. M. M., ATHAYDES, G. A.,

DORNELLES, P. K. B., RODRIGUES-JUNIOR, V. S., WANNMACHER, C.

M. D. Cysteamine prevents inhibition of thiol-containing enzymes caused by

cystine or cystine dimethylester loading in rat brain cortex. Metabolic Brain

Disease 11111, p.PMID: 18418703, 2008.

OLIVEIRA, P. R. P., RODRIGUES-JUNIOR, V. S., RECH, V. C.,

WANNMACHER, C. M. D. Cystine inhibits creatine kinase activity in pig

retina. Archives of Medical Research 38 : 164-169, 2007.

RECH, V. C., ATHAYDES, G. A., FEKSA, L. R., DORNELLES, P. K. B.,

RODRIGUES-JUNIOR, V. S., DUTRA FILHO, C. S., WYSE, A. T. S.,

WAJNER, M., WANNMACHER, C. M. D. Inhibition of creatine kinase activity

by cystine in the kidney of young rats. Pediatric Research 60 : 190-195,

2006.

CORNELIO, A. R., RODRIGUES-JUNIOR, V. S., RECH, V. C., WYSE, A. T.

S., DUTRA FILHO, C. S., WAJNER, M., WANNMACHER, C. M. D. Inhibition

of creatine kinase activity from rat cerebral cortex by 3-hydroxykynurenine.

Brain Research 1124 : 188-196, 2006.

FLECK, R. M. M., RODRIGUES-JUNIOR, V. S., GIACOMAZZI, J.,

PARISSOTO, D., DUTRA FILHO, C. S., WYSE, A. T. S., WAJNER, M.,

WANNMACHER, C. M. D. Cysteamine prevents and reverses the inhibition

of creatine kinase activity caused by cystine in rat brain cortex.

Neurochemistry International 46 : 391-397, 2005.

MENTZ, M. B., ROTT, M. B., VIEIRA, S. J., BALDO, G., RODRIGUES-

JUNIOR, V. S. Freqüência de ovos de Toxocara spp. Em três parques

públicos da cidade de Porto Alegre, Rio Grande do Sul, Brasil. Revista de

Patologia Tropical 33 : 105-112, 2004.

CORNELIO, A. R., RODRIGUES-JUNIOR, V. S., WYSE, A. T. S., DUTRA

FILHO, C. S., WAJNER, M., WANNMACHER, C. M. D. Tryptophan reduces

creatine kinase activity in the brain cortex of rats. International Journal of

Developmental Neuroscience 22 : 95-101, 2004.

5. RESUMOS E TRABALHOS APRESENTADOS EM CONGRESSOS

DOCKHORN, P. E., SELBACH, B. P., RODRIGUES-JUNIOR, V. S.,

SANTOS, D. S., BASSO, L. A. Mutagênese sítio-direcionada do gene guaC

e das proteínas mutantes In: XIX Salão de Iniciação Científica UFRGS,

2007, Porto Alegre, Brasil.

108

RODRIGUES-JUNIOR, V. S., FONSECA, I. O., SANTOS, D. S., BASSO, L.

A. Purification and initial characterization of the mutant shikimate

dehydrogenase K69A from Mycobacterium tuberculosis H37Rv In: IX

Reunião Anual do Programa de Pós-Graduação em Biologia Celular e

Molecular da UFRGS, 2007, Porto Alegre, Brasil.

RODRIGUES-JUNIOR, V. S., BASSO, L. A., SANTOS, D. S. Site-directed

mutagenesis of the aroE-encoded shikimate dehydrogenase from

Mycobacterium tuberculosis H37Rv and expression of the mutant proteins

In: XXXVI Annual Meeting of the Brazilian Society for Biochemistry and

Molecular Biology (SBBq) and X International Union of Biochemistry and

Molecular Biology (IUBMB) Conference, 2007, Salvador, Brasil.

RODRIGUES-JUNIOR, V. S., BASSO, L. A., SANTOS, D. S. Site-directed

mutagenesis of the aroE-encoded shikimate dehydrogenase from

Mycobacterium tuberculosis H37Rv In: VIII Reunião Anual do Programa de

Pós-Graduação em Biologia Celular e Molecular do Centro de Biotecnologia

da UFRGS, 2006, Porto Alegre, Brasil.

ATHAYDES, G. A., RECH, V. C., STEFANELLO, A., DORNELLES, P. K. B.,

RODRIGUES-JUNIOR, V. S., FEKSA, L. R., WANNMACHER, C. M. D. A

administração crônica de cistina e de éster de dimetilcistina altera as

atividades da creatinaquinase e da piruvatoquinase de rim de rato In: XVII

Salão de Iniciação Científica UFRGS, 2005, Porto Alegre, Brasil.

DORNELLES, P. K. B., STEFANELLO, A., RODRIGUES-JUNIOR, V. S.,

CÉ, N., FEKSA, L. R., RECH, V. C., WANNMACHER, C. M. D. Atividade da

piruvatoquinase e creatinaquinase em coração de ratos submetidos a

modelo de cistinose In: XVII Salão de Iniciação Científica UFRGS, 2005,

Porto Alegre, Brasil.

CÉ, N., FLECK, R. M. M., RODRIGUES-JUNIOR, V. S., RECH, V. C.,

ATHAYDES, G. A., DORNELLES, P. K. B., WAJNER, M., WANNMACHER,

C. M. D. Chronic administration of cystine or dimethylcistine reduces

creatine kinase activity in rat brain cortex In: Reunião Anual da Sociedade

Brasileira de Bioquímica e Biologia Molecular (SBBq), 2005, Águas de

Lindóia, Brasil.

DORNELLES, P. K. B., FEKSA, L. R., RECH, V. C., RODRIGUES-JUNIOR,

V. S., ATHAYDES, G. A., WYSE, A. T. S., DUTRA FILHO, C. S., WAJNER,

M., WANNMACHER, C. M. D. Chronic administration of cystine reduces

pyruvate kinase activity in rat heart In: Reunião Anual da Sociedade

Brasileira de Bioquímica e Biologia Molecular (SBBq), 2005, Águas de

Lindóia, Brasil.

KOCH, G. D. W., FLECK, R. M. M., FEKSA, L. R., STEFANELLO, A.,

RODRIGUES-JUNIOR, V. S., WANNMACHER, C. M. D. Efeito da

administração crônica de cistina e do éster de dimetilcistina sobre as

atividades da creatinaquinase e da piruvatoquinase em córtex cerebral de

ratos jovens In: XVII Salão de Iniciação Científica UFRGS, 2005, Porto

109

Alegre, Brasil.

RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., CÉ, N., RECH, V. C.,

WANNMACHER, C. M. D. Efeito da 3-hidróxiquinurenina sobre a atividade

da creatinaquinase de córtex cerebral de ratos jovens In: XVII Salão de

Iniciação Científica UFRGS, 2005, Porto Alegre, Brasil.

RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., WYSE, A. T. S., DUTRA

FILHO, C. S., WAJNER, M., WANNMACHER, C. M. D. Inhibition of creatine

kinase activity from rat cerebral córtex by 3-hydroxykynurenine In: Reunião

Anual da Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq),

2005, Águas de Lindóia, Brasil.

RODRIGUES-JUNIOR, V. S., RECH, V. C., OLIVEIRA, P. R.,

WANNMACHER, C. M. D. Cistina inibe in vitro a atividade da

creatinaquinase em retina de porcos In: XVI Salão de Iniciação Científica

UFRGS, 2004, Porto Alegre, Brasil.

RODRIGUES-JUNIOR, V. S., OLIVEIRA, P. R., WAJNER, M., RECH, V. C.,

DUTRA FILHO, C. S., WYSE, A. T. S., WANNMACHER, C. M. D. Cystine

inhibits in vitro creatine kinase activity in retina from pig In: Reunião Anual

da Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq), 2004,

Caxambu, Brasil.

RECH, V. C., ATHAYDES, G. A., DORNELLES, P. K. B., RODRIGUES-

JUNIOR, V. S., GANTÚS, C. B., STEFANELLO, A., DUTRA FILHO, C. S.,

WYSE, A. T. S., WAJNER, M., WANNMACHER, C. M. D. Cystine inhibits

the in vitro creatine kinase activity in rat kidney probably by oxidation of thiol

groups In: Society for the Study of Inborn Errors of Metabolism 41st Annual

Symposium, 2004, Amsterdam. Journal of Inherited Metabolic Disease.

Kluwer Academic Publishers, 2004. v.27. p.63 - 63

CORNELIO, A. R., GANTÚS, C. B., RODRIGUES-JUNIOR, V. S.,

ATHAYDES, G. A., WYSE, A. T. S., WANNMACHER, C. M. D. Tryptophan

reduces creatine kinase activity in rat brain cortex In: Reunião Anual da

Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq), 2004,

Caxambu, Brasil.

RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., WANNMACHER, C. M. D.

3-Hidóxiquinurenina inibe a atividade da creatinaquinase de córtex cerebral

de ratos jovens In: XXX Semana Acadêmica de Estudos Farmacêuticos,

2004, Porto Alegre, Brasil.

MENTZ, M. B., ROTT, M. B., VIEIRA, S. J., BALDO, G., RODRIGUES-

JUNIOR, V. S. Levantamento epidemiológico de parasitos em areias de

recreação de 3 parques públicos do município de Porto Alegre, RS In:

XXXIX Congresso da Sociedade Brasileira de Medicina Tropical, 2003,

Belém, Brasil.

110

RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., ATHAYDES, G. A.,

WANNMACHER, C. M. D. Triptofano inibe a atividade da creatinaquinase

em córtex cerebral de ratos jovens In: XV Salão de Iniciação Científica

UFRGS, 2003, Porto Alegre, Brasil.

CORNELIO, A. R., RODRIGUES-JUNIOR, V. S., ATHAYDES, G. A.,

DUTRA FILHO, C. S., WYSE, A. T. S., WAJNER, M., WANNMACHER, C.

M. D. Tryptophan reduces creatine kinase activity in rat brain cortex In: IV

Congresso Latinoamericano de Errores Innatos del Metabolismo y Pesquina

Neonatal, 2003, Puerto Iguazú, Paraguai.

ROTT, M. B., MENTZ, M. B., VIEIRA, S. J., BALDO, G., RODRIGUES-

JUNIOR, V. S. Estudo parasitológico das areias utilizadas para recreação

em 3 parques públicos do município de Porto Alegre-RS In: XIV SALÃO DE

INICIAÇÃO CIENTÍFICA, 2002, Porto Alegre, Brasil.

Livros Grátis
( http://www.livrosgratis.com.br )
 
Milhares de Livros para Download:
 
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas

Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
 
 