Download PDF
ads:
Universidade Federal do Rio de Janeiro
Instituto de Bioquímica Médica
Renata de Moraes Maciel dos Santos
Estudos funcionais de duas histona acetiltransferases de
Schistosoma mansoni: SmGCN5 e SmCBP1
Rio de Janeiro
2008
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
Universidade Federal do Rio de Janeiro
Instituto de Bioquímica Médica
Renata de Moraes Maciel dos Santos
Estudos funcionais de duas histona acetiltransferases
de
Schistosoma mansoni: SmGCN5 e SmCBP1
Tese de Doutorado apresentada ao Programa de Pós-
graduação em Instituto de Bioquímica Médica, da
Universidade Federal do Rio de Janeiro - UFRJ,
como parte dos requisitos necessários à obtenção do
título de Doutora em Química Biológica
.
Orientador: Marcelo Rosado Fantappié
Rio de Janeiro
2008
ads:
II
Ficha Catalográfica:
Santos, Renata de Moraes Maciel dos.
Estudos funcionais de duas histona acetiltransferases de Schistosoma mansoni:
SmGCN5 e SmCBP1 / Renata de Moraes Maciel dos Santos. Rio de Janeiro:
UFRJ/IBqM, 2008
xv, 124 f.: il.
Tese (Doutorado em Química Biológica) – UFRJ, Instituto de Bioquímica
Médica / Programa de Pós-Graduação em Química Biológica, 2008
Orientador: Marcelo Rosado Fantappié
Referências Bibliográficas: f. 125 – 148.
1.
Schistosoma mansoni. 2. Acetilação de Histona. 3.Receptores nucleares.
4. Regulação Gênica. 5. Co-ativadores 6. HMGB1 I. Fantappié, Marcelo
Rosado (Orient.). II. Universidade Federal do Rio de Janeiro, Instituto de
Bioquímica Médica, Programa de Pós-graduação em Química Biológica. III.
Título
III
O presente trabalho foi realizado no Laboratório de Bioquímica do Schistosoma mansoni,
Instituto de Bioquímica Médica, Centro de Ciências da Saúde, Universidade Federal do Rio
de Janeiro, UFRJ, sob orientação do Professor Marcelo Rosado Fantappié, na vigência de
auxílios concedidos pelo Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq-PROFIX) No. 540002/01-1, UNDP/World bank/World health Organization/TDR e
SONDA-FUJB.
IV
FOLHA DE APROVAÇÃO
Renata de Moraes Maciel dos Santos
Estudos funcionais de duas histona acetiltransferases de
Schistosoma mansoni:
SmGCN5 e SmCBP1
Orientador: Marcelo Rosado Fantappié
Tese de Doutorado submetida ao Programa de Pós-graduação em Química Biológica, Instituto
de Bioquímica Médica, da Universidade Federal do Rio de Janeiro - UFRJ, como parte dos
requisitos necessários à obtenção do título de Doutora em Química Biológica
.
Aprovada em de 2008, por:
_______________________________
Prof. Marcelo Rosado Fantappié.
Prof. Adjunto do Instituto de Bioquímica Médica – CCS/UFRJ (Orientador)
_______________________________
Prof. João Paulo de Biaso Viola
Pesquisador Associado, Div. Biologia Celular, INCA
_______________________________
Prof
a
. Glória Regina Franco
Prof
a
. Associada I do Depto. de Bioquímica e Imunologia, ICB/UFMG;
_______________________________
Profª. Adriana Silva Hemerly
Profª. Adjunta III do Instituto de Bioquímica Médica, CCS/UFRJ;
_______________________________
Profª. Ana Lucia Giannini
Profª. Adjunto I do Instituto de Biologia, CCS/UFRJ (Suplente externo)
________________________________
Prof. Claudio Akio Masuda
Prof. Adjunto I do Instituto de Bioquímica Médica, CCS/UFRJ (Revisor e suplente)
V
“Porque a loucura de Deus é mais sábia do que os homens; e a fraqueza de
Deus é mais forte do que os homens”.
“Mas Deus escolheu as coisas loucas deste mundo para confundir as sábias;
e Deus escolheu as coisas fracas deste mundo para confundir as fortes”.
1ª Carta aos Coríntios, 1: 25 e 27
VI
AGRADECIMENTOS
Ao meu Senhor e Salvador Jesus Cristo, porque Dele, por Ele e para Ele são todas as coisas.
Ao meu amado Alex pelo apoio, paciência e amor dedicados a mim, sempre.
A minha linda Gabriela, cujo sorriso “careca” acaba com qualquer estresse e faz diminuir o
cansaço.
Aos meus amados pais Claudio e Rita por todo o apoio, incentivo, entusiasmo, amor e grande
ajuda especialmente nesses últimos oito meses.
A minha querida e amada irmã, pelo incentivo de sempre, torcida e amor.
Ao Professor Marcelo Fantappié pela confiança no meu trabalho, incentivo constante,
sugestões e pela amizade.
Ao Professor Franklin Rumjanek pela oportunidade de fazer parte da sua equipe e pela
amizade.
Aos queridos amigos do laboratório, Paula, Nivea, Francisco, Gilson e Pedro pelas sugestões,
esclarecimentos de dúvidas e pelos momentos de descontração essenciais.
A Isabel Caetano por toda ajuda em discussões de protocolo, reagentes “compartilhados” e
amizade preciosa conquistada ao longo dos anos.
Ao prestativo e responsável Vitor Coutinho por toda a ajuda prestada na bancada e
experimentos em colaboração, pelo carinho e valiosa amizade.
A querida Ana Lucia pela alegria, amizade e ajuda sempre que solicitada.
Aos colaboradores Denis Dutra e Rodrigo Madeiro.
A Marta Freire pela ajuda essencial em todo o trabalho e pela amizade.
VII
RESUMO
Autora:
Renata de Moraes Maciel dos Santos
Orientador: Marcelo Rosado Fantappié
Título: Estudos funcionais de duas histona acetiltransferases de Schistosoma mansoni:
SmGCN5 e SmCBP1
Resumo da Tese de Doutorado submetida ao Programa de Pós-graduação em Química
Biológica, Instituto de Bioquímica Médica, da Universidade Federal do Rio de Janeiro-UFRJ,
como parte dos requisitos necessários à obtenção do título de Doutor em Química Biológica
.
Atividades relacionadas ao DNA como transcrição, replicação e reparo, estão associadas com
alterações na estrutura da cromatina e nucleossomos. Essas mudanças estruturais são em parte
mediadas pela acetilação reversível da região amino terminal das histonas. Os co-ativadores
transcricionais CBP/p300 e PCAF/GCN5 estão presentes em um complexo multifuncional e
funcionam em conjunto com vários fatores transcricionais. HMGB1 é uma proteína não-
histona de ligação ao DNA que funciona como um co-fator estrutural crítico para a regulação
transcricional apropriada em células somáticas. Ela promove um dobramento no DNA e
facilita a ligação de diversos complexos protéicos de regulação ao DNA. Está bem
estabelecido que os co-ativadores são levados ao promotor de genes alvo através da interação
com fatores de ligação ao DNA específicos, e atuam como acetiltransferases que acetilam
histonas e fatores de transcrição. Foram clonadas duas acetiltransferases de
S. mansoni:
SmCBP1 e SmGCN5. Os domínios catalíticos de ambas SmCBP1 e SmGCN5 foram
suficientes para promover a acetilação específica das histonas H3 e H2A. O resíduo de lisina
14 da histona H3 foi identificado como o sítio específico de acetilação tanto para
SmCBP1
como para
SmGCN5. É descrito que a acetilação da lisina 14 na histona H3 está diretamente
relacionada com a ativação transcricional, portanto, sugerimos que ambas as acetiltransferases
do esquistossomo desempenham um papel na ativação gênica. Essa sugestão é reforçada pelos
os dados obtidos por microscopia eletrônica, onde se identificou a proteína
SmGCN5 no
núcleo das células do esquistossomo, especificamente em regiões de eucromatina, estrutura da
cromatina com atividade transcricional.
SmGCN5 também é capaz de acetilar proteínas não-
histona, como os receptors nucleares
SmRXR1 e SmNR1, e o co-ativador SmNCoA-62.
Através de ensaios
in vitro de “pull down”, foram mapeados os domínios de interação dos co-
ativadores de RNs de
S. mansoni, SmGCN5 e SmCBP1, com SmRXR1 e SmNR1. As histona
acetiltransferases de
S. mansoni também foram testadas para a sua habilidade de acetilação in
vitro
da SmHMGB1 e sua forma truncada sem a cauda ácida C-terminal (SmHMGB1 ΔCA).
Tanto a proteína inteira
SmHMGB1, como o seu domino box B (mas não o domíno box A)
foram substratos para
SmGCN5 e SmCBP1. A remoção da cauda ácida C-terminal resultou
em um aumento de acetilaçãoda
SmHMGB1. As proteínas SmHMGB1 ou SmHMGB1 ΔCA
não apresentaram diferença na atividade de superenovelamento de DNA após serem
acetiladas por
SmGCN5 ou SmCBP1. No entanto, a proteína SmHMGB1 foi transportada do
núcleo para o citoplasma, após o tratamento com butirato de sódio. Esses dados reunidos
sugerem que a acetilação da
SmHMGB1 desempenha um papel no transporte subcelular da
proteína, mas não tem influência na sua atividade de superenovelamento do DNA.
Palavras-chave:
Schistosoma mansoni, acetilação de histona, regulação gênica, receptores
nucleares, co-ativadores, HMGB1.
VIII
ABSTRACT
Author: Renata de Moraes Maciel dos Santos
Advisor: Marcelo Rosado Fantappié
Title: Functional studies of two histone acetyltransferases from Schistosoma mansoni:
SmGCN5 and SmCBP1
Abstract
da Tese de Doutorado submetida ao Programa de Pós-graduação em Química
Biológica, Instituto de Bioquímica Médica, da Universidade Federal do Rio de Janeiro-UFRJ,
como parte dos requisitos necessários à obtenção do título de Doutor em Química Biológica
.
DNA-related activities such as transcription, replication, and repair are associated with
modifications in the structure of chromatin and nucleosomes. These structural changes are in
part mediated by the reversible acetylation of the amino termini of the core histones. The
transcriptional co-activators CBP/p300 and PCAF/GCN5 are present in a multiprotein
complex and function in concert with a variety of transcriptional factors. HMGB1 is a
nonhistone DNA-binding protein that functions as a structural cofactor critical for proper
transcriptional regulation in somatic cells. It promotes DNA bending and facilitates the
binding of several regulatory protein complexes to DNA. It is now well established that co-
activators are brought to the promoter of target genes through the interaction with specific
DNA-binding factors, and act as acetyltransferases that acetylate histones and transcriptional
factors. Two acetyltransferases from schistosome have been cloned:
SmCBP1 and SmGCN5.
The HAT catalytic domain of both
SmCBP1 and SmGCN5 were sufficient to promote specific
acetylation of histones H3 and H2A. The lysine 14 residue of histone H3 has been identified
as the specific site of acetylation for
SmCBP1 and SmGCN5. Since it is known that
acetylation of lysine 14 in Histone H3 is directly related to transcription activation, we
suggest that both schistosome acetyltransferases play a role in gene activation. This
suggestion is reinforced with the data obtained by electron microscopy, where
SmGCN5 was
identified in the nuclei of schistosome cells, specifically in euchromatin regions, which is the
active transcriptional form of the chromatin.
SmGCN5 was also able to acetylate schistosome
non-histone proteins, such as the nuclear receptors
SmRXR1 and SmNR1, and the co-activator
SmNCoA-62. By using in vitro pull-down assays, the interaction domains of S. mansoni NR
co-activators,
SmGCN5 and SmCBP1, with the nuclear receptors SmRXR1 and SmNR1 were
mapped. Both
S. mansoni histone acetyltransferases were also tested for their ability to in
vitro
acetylate SmHMGB1 and its truncated form lacking the C-terminal acidic tail
(
SmHMGB1 ΔCA). We found that full-length SmHMGB1, as well as its HMG-box B (but not
HMG-box A) were substrates for
SmGCN5 and SmCBP1. Removal of the C-terminal acidic
tail resulted in increased acetylation of
SmHMGB1. SmHMGB1 or SmHMGB1 ΔCA revealed
no difference in their DNA supercoiling activities after being acetylated by SmGCN5 or
SmCBP1. However, SmHMGB1 protein was transported from the nucleus to the cytoplasm,
after sodium butyrate treatment. Together, our data suggest that acetylation of
SmHMGB1
plays a role in the subcelular trafficking of the protein, but not in its DNA supercoiling
activity.
Key words:
Schistosoma mansoni, histone acetylation, gene regulation, nuclear receptors, co-
activators, HMGB1.
IX
ÍNDICE DE FIGURAS
Página
Figura 1: Distribuição geográfica da esquistossomose mansônica 21
Figura 2: Distribuição percentual do número de óbitos por esquistossomose
segundo região brasileira, no período de 1980 a 2003 22
Figura 3: Distribuição da esquistossomose segundo o percentual de positividade
em inquéritos coproscópicos. Brasil, 1998 – 2003 23
Figura 4: Formas do ciclo de vida parasita de
S. mansoni 25
Figura 5: O ciclo de vida de
S. mansoni 26
Figura 6: Micrografia eletrônica de varredura de um casal de vermes adultos
de
S. mansoni em cópula 28
Figura 7: Distribuição geográfica dos programas de controle da esquistossomose
em 2007 30
Figura 8: Indivíduo com hepatoesplenomegalia 33
Figura 9: Representação esquemática de um nucleossoma, mostrando o DNA
e o octâmero de histonas 35
Figura 10: Organização estrutural dos Receptores Nucleares 37
Figura 11: Mecanismo de interação entre RNs e co-ativadores 38
Figura 12: Formas de remodelamento de nucleossomas 41
Figura 13: Representação esquemática do complexo co-repressor ligado a
receptores nucleares 43
Figura 14: Modificações pós-traducionais em um nucleossoma 47
Figura 15: Estrutura 3D dos domínios funcionais HAT e bromo de
SmGCN5 50
Figura 16: Representação esquemática do complexo co-ativador ligado a
receptores nucleares 54
Figura 17: Região promotora do gene
p14 (F-10) 59
Figura 18: Representação esquemática da movimentação da HMGB1 do
núcleo para o citoplasma 64
Figura 19: Esquema comparativo dos cDNAs com as estruturas dos genes
de
SmGCN5 e SmCBP1 73
Figura 20: Atividade de histona acetiltransferase de
SmCBP1 75
Figura 21: Determinação da lisina acetilada da histona H3 por
SmCBP1 76
X
Figura 22: Acetilação da SmHMGB1 por duas histona acetiltransferases de
S. mansoni 77
Figura 23: Influência da acetilação por
SmGCN5 HAT na indução do
Superenovelamento de DNA plasmidial pela
SmHMGB1 79
Figura 24: Influência da acetilação por
SmCBP1 HAT na indução do
superenovelamento de DNA plasmidial pela
SmHMGB1 80
Figura 25: Transporte celular de
SmHMGB1 na presença de um inibidor de
histona desacetilases 81
Figura 26: Acetilações e interações entre os receptores nucleares e
co-ativadores de
S. mansoni 124
XI
ÍNDICE DE TABELAS
Tabela 1: Espécies de esquistossomos que infectam o homem 20
Tabela 2: Tamanhos dos introns e exons, sítios convergentes doadores e aceptores
de
splice nos genes SmGCN5 e SmCBP1 74
XII
LISTA DE ABREVIATURAS E SÍMBOLOS
aa amino ácidos
ATP adenosina trifosfato
pb pares de base
CA cauda ácida
CBP “CREB Binding Protein” (proteína de associação a CREB)
cDNA DNA complementar
cols. colaboradores
CREB “cAMP response element binding protein”
C-terminal carboxi-terminal
DBD “DNA Binding Domain” (domínio de ligação ao DNA)
DMEM “Dulbecco’s Modofied Eagle’s Médium”
DNA ácido desoxirribonucléico
DR “Direct Repeat” (repetição direta)
DTT ditiotreitol
EDTA ácido etilenodiaminotetracético
EMSA “Eletrophoretic Mobility Shift Assay” (ensaio de retardamento
da mobilidade eletroforética)
ER “Estrogen Receptor” (receptor de estrogênio)
EST Expressed Sequence Tag (etiqueta de seqüência expressa)
g grama
g gravidade
GCN5 “General Control Non Repressed 5”
GR “Glucocorticoid Receptors” (receptor de glicocorticóide)
o
C graus Celcius
GFP “Green Fluorescent Protein” (proteína de fluorescência verde)
GST glutationa S transferase
h hora
HAT histona acetiltransferase
HCl ácido clorídrico
HDAC histona desacetilase
HIS histidina
HMGB1 “High Mobility Group Box 1”
XIII
HMT histona metiltransferase
HRE “Hormone Response Element” (elemento responsivo a
hormônio)
IPTG “isopropil
- D - thiogalactopiranosídeo”
K lisina
Kb kilobase
KCl cloreto de potássio
KDa kilodaltons
Kg kilograma
L litro
LBD “Ligand Binding Domain” (domínio de ligação com o ligante)
M molar
mg miligrama
mL mililitro
mm milímetro
mM milimolar
Ci microcurie
g micrograma
L microlitro
M micromolar
mRNA RNA mensageiro
NaCl cloreto de sódio
NaOH hidróxido de sódio
NCoA-62 “Nuclear Coactivator-62” (co-ativador nuclear-62)
N-CoR “Nuclear Receptor Corepressor” (co-repressor de receptor
nuclear)
NR1 “Nuclear Receptor 1” (receptor nuclear 1)
N-terminal amino terminal
OMS Organização Mundial de Saúde
PCR “Polymerase Chain Reaction” (reação em cadeia da polimerase)
PBS salina tamponada em fosfato
PCAF p300/CBP-associated factor (fator associado a p300/CBP)
PMSF fluoreto de fenilmetil sulfato
XIV
% porcentagem
PPAR
“Peroxisome Proliferator-Activated Receptor “ (receptor
ativado por proliferador de peroxissomo)
PR “Progesterone Receptor” (receptor de progestrona)
RAR “Retinoic Acid Receptor” (receptor de ácido retinóico)
RN Receptor Nuclear
RNA ácido ribonucléico
RNAPII RNA Polimerase II
RXR “Retinioc X Receptor” (receptor de ácido X retinóico)
SDS duodecil sulfato de sódio
SDS-PAGE eletroforese em gel de poliacrilamida com duodecil sulfato de
sódio
Sm Schistosoma mansoni
SMRT “Silencing Mediator of Retinoid and Thyroid receptors”
(mediador de silenciamento de receptores de ácido retinóico e
hormônio tireoidiano)
3D tridimensional
3
H hidrogênio três (trítio)
TAF
“TATA-binding-protein-Associated Factor” (fator associado a
proteína ligadora de TATA)
TBP “TATA-box Binding Protein” (proteína de ligação ao sítio
TATA)
TE tampão Tris-EDTA
TIF “Transcription Initiation Factor” (fator de iniciação da
transcrição)
Topo I Topoisomerase I
TR “Thyroid hormone Receptor” (receptor de hormônio
tireoidiano)
Tris hidroximetil aminometano
V volts
VDR “Vitamin D Receptor” (receptor de vitamina D)
WHO “World Health Organization” (Organização Mundial de Saúde)
WT “Wild Type” (selvagem)
XV
SUMÁRIO
Página
1 INTRODUÇÃO
18
1.1 A Esquistossomose 18
1.1.1 Aspectos Gerais e História 18
1.1.2 Família Schistossomatidae 19
1.1.3 Epidemiologia 21
1.2 O Schistosoma mansoni 23
1.2.1 O Ciclo de Vida 23
1.2.2 Biologia Sexual 26
1.2.3 Diagnóstico e Tratamento 28
1.2.3.1 Diagnóstico 28
1.2.3.2 Tratamento 29
1.2.4 Patologia 31
1.3 Regulação da Expressão Gênica em Eucariotos 33
1.3.1 Cromatina e Histonas 33
1.3.2 Modificações da Cromatina 35
1.3.3 Receptores Nucleares 36
1.3.4 Remodeladores de Cromatina Dependentes de ATP 40
1.3.5 Co-repressores 41
1.3.6 Co-ativadores 43
1.3.6.1 NcoA-62 45
1.3.6.2 Histona Acetiltransferases (HATs) 46
A) GCN5/p/CAF 47
B) CBP/p300 51
1.4 Dinâmica da Transcrição Via Receptores Nucleares e Seus Co-reguladores 54
1.5 Regulação da Expressão Gênica (Gene p14) por Receptores Nucleares em
S. mansoni 57
1.6 Proteína “High Mobility Group Box 1” (HMGB1) 62
1.6.1 HMGB1 de
Schistosoma mansoni (SmHMGB1) 64
2 OBJETIVOS 66
2.1 Objetivo Geral 66
XVI
2.2 Objetivos Específicos 66
3 MATERIAL E MÉTODOS 67
3.1 Proteínas Utilizadas no Trabalho 67
3.2 Clonagem de SmHMGB1 em Vetor GFP 67
3.3 Análise da Organização Genômica de SmGCN5 e SmCBP1 68
3.4 Ensaios de Acetilação in vitro 68
3.4.1 Acetilação de Histonas por
SmCBP1 68
3.4.2 Identificação dos Resíduos de Lisina Acetilados 69
3.4.3 Acetilação das Construções de
SmHMGB1 69
3.5 Ensaios de Superenovelamento de DNA 70
3.6 Cultura de Células e Transfecção 71
3.7 Expressão e Localização de SmHMGB1-GFP em Células HeLa 71
4 RESULTADOS 73
4.1 Organização Genômica de SmGCN5 e SmCBP1 73
4.2 Acetilação de Histonas pelo Domínio HAT de SmCBP1 74
4.3 Mapeamento do Resíduo de Lisina da Histona H3 Acetilado por SmCBP1 75
4.4 Acetilação in vitro das diferentes construções da SmHMGB1 76
4.5 Influência da Acetilação de SmHMGB1 na Atividade de Superenovelamento
de DNA
78
4.6 Localização Celular de SmHMGB1 80
4.8 Resumo do Artigo 1 82
Artigo 1: “Schistosoma mansoni histone acetyltransferase GCN5: linking histone
acetylation to gene activation” 82
4.9 Resumo do Artigo 2 89
Artigo 2: “Protein acetylation sites mediated by Schistosoma mansoni GCN5” 88
4.10 Resumo do Artigo 3 94
Artigo 3: “Cloning of SmNCoA-62, a novel nuclear receptor co-activator from
Schistosoma mansoni: Assembly of a complex with a SmRXR1/SmNR1
heterodimer,
SmGCN5 and SmCBP1” 94
DISCUSSÃO 111
REFERÊNCIAS BIBLIOGRÁFICAS 125
ANEXO A - Trabalho publicado em periódico de circulação internacional:
“Control of transcription in Schistosoma mansoni: Chromatin remodeling and
other regulatory elements” 150
XVII
ANEXO B - Mapa do vetor pQE80L (QIAGEN) com seqüência da região de clonagem 159
ANEXO C - Mapa do vetor pGEX4T1 (GE HEALTHCARE) com seqüência da
região de clonagem 160
ANEXO D - Mapa do vetor pEGFP-C3 (CLONTECH) com seqüência da
região de clonagem 161
1818
1 INTRODUÇÃO
1.1 A Esquistossomose
1.1.1 Aspectos Gerais e História
A esquistossomose, também conhecida como barriga d’água é a doença crônica
causada pelos parasitos multicelulares platelmintos do gênero
Schistosoma. É a forma mais
grave de parasitose por organismo multicelular. Apesar de apresentar uma taxa de mortalidade
relativamente baixa, milhões de pessoas no mundo sofrem de morbidade severa causada pela
doença.
No Egito o parasito tornou-se conhecido, em 1851, com a descrição do médico alemão
Theodor Bilharz, razão pela qual a doença é conhecida como Bilharziose em alguns países
(BILHARZ, 1852, traduzido por KEAN, 1978). No entanto, Theodor Bilharz não conseguiu
evidenciar a diferença entre as espécies atualmente conhecidas como
S. mansoni e S.
hematobium.
Cinqüenta anos mais tarde, o renomado médico inglês Patrick Manson sugeriu a
existência de duas espécies de
Schistosoma parasitos do homem. E, por fim, Sambom (1907)
propôs que se denominasse a espécie responsável pela esquistossomose intestinal como
Schistosoma mansoni, em homenagem a Manson.
Apesar de somente descobertos os primeiros indícios durante o século XIX, a
esquistossomose é, sem dúvida, uma doença que acomete o homem desde a antiguidade. O
caso mais antigo de esquistossomose humana diagnosticado ocorreu a mais de cinco mil anos
em um adolescente egípcio do período Predinástico, onde o antígeno anódico circulante
(CAA)¹ foi encontrado (MILLER
et al., 1992).
¹CAA (circulating anodic antigen): antígeno proveniente do tubo digestivo do verme adulto, de natureza polissacarídea,
regurgitado pelo parasito, presente na patogênese da glomerulopatia, em indivíduos com esquistossomose.
1919
Ovos calcificados também foram encontrados em duas múmias (1250-1000 A.C) por
Ruffer (RUFFER, 1910). Além disso, foi encontrada uma alta prevalência da doença,
aproximadamente 65%, em múmias (550-350 A.C) na fronteira Egito-Sudão (MILLER
et al.,
1992).
Com o desenvolvimento da agricultura a esquistossomose passou de doença rara a
problema sério. A infecção pelos parasitos ocorria nos momentos de trabalhos de irrigação da
agricultura. As cheias do Nilo sempre foram a fonte da prosperidade do Egito, mas também
traziam os caracóis portadores dos esquistossomos. Muitas múmias egípcias apresentam as
lesões produzidas pela esquistossomose causada pelo
S. hematobium. O hábito dos
agricultores de fazer as plantações e trabalhos de irrigação com os pés descalços metidos na
água parada favorecia a disseminação da doença causada por estes parasitos. Alguns
especialistas acreditam que tanto no Egito como na Mesopotâmia (inicialmente a Suméria), as
duas mais antigas civilizações do mundo, a esquistossomose foi fundamental no surgimento
de estados fortes guerreiros. O povo, cronicamente debilitado pela doença, era facilmente
dominável por uma classe de guerreiros que, uma vez que não praticavam a agricultura
irrigada, não contraíam a doença, mantendo-se vigorosos. Estas condições permitiram talvez a
cobrança de impostos em larga escala com excedentes consideráveis que revertiam para a
nova elite de guerreiros, uma estratificação social devida à doença, que se transformaria nas
civilizações.
1.1.2 Família Schistossomatidae
Os agentes etiológicos da esquistossomose, esquistossomos, são organismos
eucariotos que pertencem ao gênero
Schistosoma, filo Platyhelminthes, superclasse
2020
Trematoda, subclasse Digenea, superfamília Schistossomatoidea e família Schistosomatidae.
Uma característica geral desta família é o acentuado dimorfismo sexual.
Doze gêneros são classificados na família
Schistosomatidae, dos quais cinco infectam
mamíferos e apenas o gênero
Schistosoma está associado à infecção em humanos. O gênero
Schistosoma possui a maior distribuição geográfica, apresenta 20 espécies conhecidas, dentre
as quais, cinco parasitam o homen:
S. haematobium, S. mansoni, S. intercalatum, S. mekongi e
S. japonicum (ROLLINSON & SOUTHGATE, 1987). Dentre essas espécies o Schistosoma
mansoni
é o mais estudado, devido à sua distribuição geográfica mais ampla e a sua maior
patogenicidade.
A classificação das espécies é baseada na morfologia dos ovos, na distribuição
geográfica e no gênero dos hospedeiros intermediários, todos caramujos. A relação entre
espécies, hospedeiro intermediário e distribuição geográfica é apresentada na tabela abaixo
(tabela 1).
Espécie Gênero do Caramujo Distribuição Geográfica
Schistosoma mansoni Biomphalaria África, Oriente Médio, Brasil
Schistosoma haematobium Bulinus África, Oriente Médio
Schistosoma japonicum Oncomelania Ásia (antes no Japão, agora predominantemente
na China)
Schistosoma intercalatum Bulinus África Ocidental
Schistosoma mekongi Neotricula Ásia (somente no entorno do rio Mekong)
Tabela 1: Espécies de esquistossomos que infectam o homem. A tabela apresenta os gêneros de
caramujos correspondentes e a distribuição geográfica.
No Brasil, o único agente causador da esquistossomose é o S. mansoni. Dentre as
espécies de caramujo hospedeiro existentes no Brasil, as três que estão mais bem estudadas
são o
Biomphalaria glabrata, o B. tenegophila e o B. straminea.
2121
1.1.3 Epidemiologia
A esquistossomose é a segunda doença infecciosa em importância para a saúde
pública, perdendo apenas para a malária (CHITSULO
et al., 2000). Há 200 milhões de casos
em todo o mundo e mais de 600 milhões de pessoas estão sob o risco de infecção. Endêmica
em 76 países em territórios da África, Ásia e América Latina (figura 1), estima-se que mais de
200.000 mortes por ano são causadas pela esquistossomose na África subssaariana, onde mais
de 80% das pessoas infectadas do mundo vivem (CHITSULO
et al., 2000, 2004). O
Schistosoma tem várias espécies com interesse clínico, as mais significativas são: o S.
mansoni
, o S. japonicum e o S. hematobium. As mortes estão associadas com as
conseqüências severas da infecção, incluindo câncer de bexiga ou falência renal (
Schistosoma
haematobium
) e fibrose hepática e hipertensão portal (S. mansoni).
Enquanto a doença pode resultar em morte, sua natureza crônica reduz a capacidade
de trabalho dos indivíduos infectados. Em crianças pode causar anemia, nanismo e habilidade
reduzida para o aprendizado.
Figura 1: Distribuição geográfica da esquistossomose mansônica.
Retirado de: http://www.path.cam.ac.uk/~schisto/Background/Distribution.html#anchor1572739.
Acesso em Janeiro de 2008.
2222
No Brasil a esquistossomose, causada pelo
S.mansoni, veio provavelmente trazido da
costa ocidental da África para a região nordeste do país com o tráfico de escravos e a
inadequada exploração dos recursos hídricos. Outras regiões das Américas que também têm
parasitos trazidos pelos escravos são as Guianas, a Venezuela e as Caraíbas.
No período de 1980 a 2003 foram registrados 14.463 óbitos por esquistossomose no
Brasil (figura 2) (FERREIRA & SILVA, 2007). Hoje a estimativa de prevalência da
esquistossomose é de dez milhões de indivíduos infectados, com 60 a 80 % morando na
região nordeste. Atualmente, a transmissão da doença se dá, principalmente, na faixa que
abrange do Maranhão ao Espírito Santo, além de Minas Gerais. No Sudeste, surgiram focos
isolados no Rio de Janeiro e em São Paulo. O norte do Paraná, no Sul do país, também se
tornou uma área endêmica. Outros três focos da doença foram descritos, recentemente, em
mais dois estados sulinos: dois em Santa Catarina e um no Rio Grande do Sul (NEVES,
2005).
Sendo assim, torna-se fundamental o conhecimento das áreas de prevalência do
território nacional (figura 3), para que se possam aplicar medidas de controle, como o
direcionamento de investimentos e treinamento e contratação de pessoal técnico (médicos e
agentes de saúde).
Figura 2: Distribuição percentual do número de óbitos por esquistossomose segundo região
brasileira, no período de 1980 a 2003.
(Ferreira & Silva, 2007).
2323
Figura 3: Distribuição da esquistossomose segundo o percentual de positividade em inquéritos
coproscópicos. Brasil, 1998 – 2003.
Retirado de www.ufpe.br/gpit/schisto-pe/mapa-brasil.jpg.
Acesso em Janeiro de 2008.
1.2 O Schistosoma mansoni
Por ser o agente etiológico da esquistossomose no Brasil e o membro mais estudado
do gênero
Schistosoma, o S. mansoni foi escolhido como nosso modelo de estudo.
1.2.1 O Ciclo de vida
A infecção por S. mansoni ocorre quando as formas larvais do parasito, conhecidas
como cercárias (figura 4 B), são liberadas por caramujos aquáticos do gênero
Biomphalaria
(hospedeiro intermediário) (figura 4 A) e penetram ativamente a pele do hospedeiro humano
durante o contato com a água contaminada. No hospedeiro intermediário, o
S. mansoni se
desenvolve de miracídio à cercária. Cerca de três horas após infecção no hospedeiro definitivo
2424
as cercárias atravessam o epitélio e transformam-se em esquistossômulos (figura 4 C) após
perder a cauda e seu revestimento de células ciliadas. Depois de dois dias na pele os
esquistossômulos penetram os vasos sangüíneos ou linfáticos, migram para os pulmões, via
artéria pulmonar, e finalmente são transportados para a circulação porta-hepática. Durante a
migração até o fígado se desenvolvem em vermes adultos, quando ocorre a maturação sexual
e o pareamento de vermes machos e fêmea (figura 4 D). Do fígado a maioria dos vermes
migra para as veias do intestino, onde residem se alimentando de hemácias e se reproduzem
durante toda a vida culminando com a ovoposição extensiva da fêmea. (WILSON, 1987;
NEVES, 2005). Uma fêmea adulta deposita em média 300 ovos por dia. Os ovos (figura 4 E)
do parasito são depositados em vários órgãos, como o intestino, baço e fígado. A presença de
ovos nos órgãos causa reações granulomatosas (figura 4 G), caracterizando as manifestações
clínicas. Os ovos que atravessam a mucosa intestinal são liberados pelas fezes e na água se
desenvolvem em miracídios (figura 4 F), os quais infectam os caramujos, reiniciando o ciclo
(figura 5). Os miracídios são larvas ciliadas que nadam ativamente e penetram nos caramujos.
Essas larvas eclodem dos ovos sob condições especiais como a baixa osmolaridade da água
doce, temperatura em torno de 28°C e incidência de luz.
Uma vez que a doença evoluiu para o estágio de granuloma o dano é irreversível.
Podem-se matar os parasitos do hospedeiro, mas não reparar os danos causados no corpo.
2525
Figura 4: Formas do ciclo de vida do parasito de S. mansoni. (A) hospedeiro intermediário do
gênero
Biomphalaria. (B) micrografia eletrônica da forma larvar – cercária. (C) esquistossômulos. (D)
vermes macho (seta branca) e fêmea (seta amarela) pareados. (E) ovo de
S. mansoni, pode-se observar
um miracídio ainda dentro do ovo. (F) micrografia de varredura de miracídio (acima) recém-saído do
ovo (abaixo). (G) granuloma - observa-se o ovo, no centro da foto, rodeado por fibroblastos e
mastócitos, em meio ao tecido hepático. Imagens acessadas em Janeiro de 2007 e retiradas de:
(A) e (C) http://www.york.ac.uk/res/schisto/background.htm;
(B) http://home.austarnet.com.au/wormman/paraimg/smanscer.jpg;
(D) www.usuhs.mil/mic/Davies/SJD_fig1.jpg;
(E) http://www.path.cam.ac.uk/~schisto/SchistoLife/S.mansoni.egg.html;
(F) http://www.path.cam.ac.uk/~schisto/SchistoLife/Miracidium.html;
(G) http://www.path.cam.ac.uk/~schisto/Background/Granuloma.html.
A
B
C
D
E
F
G
2626
Figura 5: O ciclo de vida de S. mansoni.
Retirado de http://www.copasa.com.br/cgi/cgilua.exe/sys/start.htm?sid=101 Acesso em junho
de 2008.
1.2.2 Biologia Sexual
Diferentemente de outros trematódeos, o S. mansoni é uma espécie dióica cujo sexo é
determinado desde o zigoto pela combinação do par de cromossomos sexuais Z e W
(SHORT, 1983). As fêmeas possuem o par cromossômico heterogamético ZW e os machos
contêm o par cromossômico homogamético ZZ. O genoma de
S. mansoni, cujo tamanho é de
aproximadamente 270 Mb (SIMPSON
et al., 1982), é composto de 7 pares de cromossomos
autossômicos e um par sexual. O zigoto, dentro do ovo, se desenvolve em miracídio. Uma vez
dentro do caramujo, ocorre a reprodução assexuada. Portanto, um único miracídio produz
uma população clonal de milhares de cercárias, todas do mesmo sexo.
Os vermes machos adultos de
Schistosoma mansoni são maiores (5-11 mm de
comprimento e aproximadamente 1 mm de diâmetro) que as fêmeas (8-14 mm de
comprimento e menos de 0,2 mm de diâmetro) e possuem uma fenda longitudinal
2727
denominada canal ginecóforo (figura 6), onde a fêmea se aloja durante o acasalamento
(PESSÔA & MARTINS, 1982). Durante a cópula o esperma é derramado no canal
ginecóforo, espalhando-se pelas suas paredes e penetrando o orifício vaginal da fêmea
(PESSÔA & MARTINS, 1982). Esta apresenta um único ovário que se situa na metade
anterior do corpo, um pequeno útero encurtado devido ao posicionamento do ovário e
glândulas vitelínicas que em indivíduos maduros chega a ocupar quase toda a extensão do
corpo (ERASMUS, 1973). Estudos do desenvolvimento e maturação da fêmea mostraram
que a presença do macho é necessária para o completo crescimento e maturação da fêmea. A
expressão de genes em células vitelínicas (células que produzem os nutrientes e proteínas
precursoras do ovo) é dependente de estímulos do macho (GREVELDING
et al., 1997).
Vermes fêmeas obtidas a partir de infecções unisexuais são atrofiadas e sexualmente imaturas.
A vitelária não está desenvolvida e a glândula de Mehli, que envolve o local onde os ovos são
formados, não está completamente desenvolvida. O controle sexual exercido pelo macho deve
ser mediado por estímulos químicos como hormônios, nutrientes e mensageiros (POPIEL,
1986; LO VERDE & CHEN, 1991; KUNZ, 2001; RUMJANEK, 1989). O estímulo para a
maturação e diferenciação sexual da fêmea é independente de transferência de esperma e
fertilização e não é espécie-específico (POPIEL, 1986; LO VERDE & CHEN, 1991; KUNZ,
2001). Além da iniciação da maturação da fêmea, o macho também é necessário para a
manutenção da maturidade e fecundidade dela. Quando fêmeas maduras são separadas do
macho ocorre regressão morfológica da maturação e elas param de produzir ovos, mas se o
macho entra novamente em contato com as fêmeas ocorre a recuperação da maturidade e
produção de ovos (BOBEK
et al., 1986).
2828
Figura 6: Micrografia eletrônica de varredura de um casal de vermes adultos de S. mansoni em
cópula. Observe a fêmea alojada no canal ginecóforo do macho.
Retirado de
www.icb.ufmg.br/~lgb/smansoni. Acesso em Janeiro de 2008.
1.2.3 Diagnóstico e Tratamento
1.2.3.1 Diagnóstico
O diagnóstico laboratorial da esquistossomose mansônica é relativamente fácil e
rápido. É realizado através da constatação da presença de ovos do
S. mansoni nas fezes do
paciente. O método mais utilizado é o exame parasitológico das fezes. A eclosão de
miracídios, as reações sorológicas, a biópsia retal e a biópsia hepática são métodos auxiliares
e pouco utilizados. A OMS recomenda o método Kato-Katz (contagem do número de ovos
presentes nas fezes), por ser o exame parasitológico das fezes mais sensível, rápido e de fácil
execução, além de ser o mais preciso qualitativa e quantitativamente (REY, 1992). Esse
método é utilizado atualmente nos continentes africano, asiático e nas Américas.
2929
1.2.3.2 Tratamento
O tratamento com medicamentos sempre foi limitado devido à dificuldade de se
encontrar drogas com alta especificidade e tolerabilidade. Hoje, o tratamento pode ser feito
com medicamentos disponíveis no mercado brasileiro, como o oxamniquine (única dose de 15
mg/Kg) ou o praziquantel (três doses de 60 mg/Kg). O mecanismo de ação do oxamniquine
ainda não é conhecido. No que se refere ao praziquantel, supõe-se que ele aja em canais
iônicos existentes nas células da superfície (tegumento) do parasito, gerando um descontrole
no fluxo de íons e assim levando a morte e eliminação do verme. Ambos os medicamentos
são bem tolerados e de baixa toxicidade e a eficácia do tratamento gira em torno de 80% dos
casos em adultos e 70% em crianças de até 15 anos (NEVES, 2005; TOM
et al., 2005).
Atualmente, prefere-se o praziquantel por apresentar menos efeitos colaterais e o menor custo,
já que o medicamento vem sendo fabricado no Brasil por Farmanguinhos/Fundação Oswaldo
Cruz. Entretanto, estudos epidemiológicos recentes demonstraram focos de parasitos
resistentes ao praziquantel no Senegal, continente Africano (NEVES, 2005). Tal fato gera
discussões quanto à eficácia do medicamento e chama a atenção para a necessidade de se
desenvolver tratamentos alternativos.
A medicina possui instrumentos suficientes para tratar os doentes e, portanto, é capaz
de fazer o controle da morbidade. No entanto, o controle da transmissão vai além da
capacidade dos médicos e cientistas, necessitando de ações governamentais como o
saneamento básico, instalação de água e esgoto nas casas, mudanças no meio ambiente,
educação sanitária, combate aos caramujos e diagnóstico precoce dos infectados. Na figura 7,
observa-se como estão as regiões afetadas no que diz respeito às medidas de controle da
doença. Tais medidas são fundamentais não só para o controle de esquistossomose, como para
diversas doenças como salmonelose, hepatites, giardíase e amebíase entre outras.
3030
O tratamento cirúrgico é reservado para as complicações, como o hiperesplenismo
(esplenomegalia maciça) com manifestações clínicas, onde é indicado a esplenectomia, e no
casos de sangramentos maciços por varizes esofágicas, quando é feita a desvascularização
esofagogástrica com esplenectomia (remoção cirúrgica do baço) e anastomose esplenorrenal
distal.
Figura 7: Distribuição geográfica dos programas de controle da esquistossomose em 2007.
Retirado de: http://www.schisto.org/Schistosomiasis/global_distribution.htm. Acesso em: Janeiro de
2008.
Hoje há uma grande preocupação quanto à resistência do parasito ao tratamento com o
praziquantel. Além disso, o tratamento em áreas endêmicas é eficiente para o controle da
morbidade, mas não reduz a prevalência da doença devido a constantes reinfecções. Portanto,
estratégias para o desenvolvimento de vacinas representam um componente essencial para o
futuro controle da esquistossomose como um adicional a quimioterapia de massa. Estudos que
3131
vêm proporcionando um melhor entendimento da resposta imune à infecção pelo parasito,
tanto em modelos animais como em humanos, sugerem que o desenvolvimento de uma vacina
é possível (MCMANUS & LOUKAS, 2008).
Nas últimas duas décadas, os estudos com antígenos que possam conferir imunidade
protetora à infecção experimental pelo
Schistosoma mansoni tiveram grande impulso,
especialmente devido ao avanço dos conhecimentos nos campos da biologia molecular e da
imunologia. Estes estudos têm conferido importantes contribuições, no entanto, até o
momento, a proteção conferida tem girado em torno de 50% de diminuição do número de
vermes e, com alguns antígenos, também do número de ovos (KATZ, 1999). Portanto, apesar
dos estudos para o desenvolvimento de vacina venham experimentando mais falhas do que
sucessos, resultados encorajadores nos últimos anos usando antígenos recombinantes
definidos derivados do
Schistosoma mansoni, têm sido obtidos (OLIVEIRA et al., 2008). As
muitas perguntas ainda não respondidas indicam a necessidade de novas pesquisas a serem
realizadas em animais de pequeno e grande porte, antes que estes antígenos candidatos a
vacina possam ser utilizados em ensaios clínicos (KATZ, 1999).
Além de ser um excelente modelo de estudo de regulação gênica, a busca por um
melhor entendimento dos mecanismos moleculares envolvidos no controle da transcrição do
parasito pode levar a abordagens de desenvolvimento de drogas anti-helmínticas. Essas
drogas podem ser um grande avanço para o tratamento e erradicação da doença.
1.2.4 Patologia
A infecção esquistossomótica inicia-se com a invasão das cercárias, através da pele,
nas partes do corpo expostas ao contato com águas contaminadas, acompanhadas às vezes de
dermatite pruriginosa. O período de incubação é variável, podendo atingir 4 a 8 semanas.
3232
Na fase aguda os esquistossômulos são levados ao pulmão e, posteriormente, ao
sistema porta hepático, onde se dividem provocando a ativação do sistema imunitário,
causando febre, mal estar, cefaléias (dores de cabeça), astenia (fraqueza), dor abdominal,
diarréia sangüinolenta, dispnéia (falta de ar), hemoptise (tosse com sangue), artralgias,
linfonodomegalia e esplenomegalia, um conjunto de sintomas conhecido por síndrome de
Katayama. Nas análises sanguíneas há eosinofilia (aumento dos eosinófilos, células do
sistema imunitário anti-parasitos). A produção de anticorpo pode levar à formação de
complexos que causam danos nos rins. Estes sintomas podem ceder espontaneamente ou
podem nem sequer surgir, mas a doença silenciosa continua.
Os sintomas crônicos são quase todos devidos à produção de ovos imunogênicos. Os
ovos que não são eliminados através das fezes são carreados para o leito portal intra-hepático
e depositados nos tecidos (intestino, fígado ou outros órgãos) onde secretam antígenos
solúveis que atravessam a casca do ovo e causam a resposta granulomatosa característica da
doença. Durante esse processo inflamatório ocorre uma rápida exsudação de eosinófilos,
neutrófilos, histiócitos, e a formação de um aglomerado celular composto principalmente por
linfócitos e macrófagos (que podem se fundir e formar as chamadas células gigantes) ao redor
dos ovos, podendo ocorrer fibrose tecidual ao redor do sítio inflamatório. Na fase crônica da
doença, além da hepatoesplenomegalia (figura 8), o acúmulo progressivo de fibroses pode
causar lesões vasculares por obstrução, hipertensão do sistema porta e ascite (líquido no
peritônio), razão pela qual a doença é conhecida como “barriga d’água”. Em alguns casos,
normalmente associados à desnutrição ou imunodeficiência, a doença causa a morte do
hospedeiro devido a processos hemorrágicos em varizes gastro-esofágicas, originadas em
decorrência da hipertensão portal. Acredita-se que as formas adultas não são atacadas porque
usam moléculas “self” do próprio hospedeiro para se camuflar.
3333
Dependendo da intensidade da infecção e da resistência orgânica da pessoa infectada,
em algumas delas podem passar despercebidos os efeitos dos pequenos danos internos.
Noutras mais fortemente infectadas haverá pelo menos uma queda no seu rendimento físico
(AWAD EL KARIM
et al., 1981, citado por FEACHEM et al., 1983), sendo que em crianças,
inclusive, perda de crescimento. Dentre os fatores que modulam a severidade da doença,
estão: a carga parasitária, a idade, o estado nutricional e, principalmente, o sistema
imunológico do hospedeiro.
Figura 8: Indivíduo com hepatoesplenomegalia.
Retirado de www.dpi.inpe.br/geoschisto/img/gifAnimado.gif Acesso em março de 2008.
1.3 Regulação da Expressão Gênica em Eucariotos
1.3.1 Cromatina e Histonas
O genoma dos eucariotos, ao contrário dos procariotos, está empacotado em estrutura
de cromatina, onde ocorrem os processos nucleares fundamentais de transcrição, replicação e
reparo do DNA. Há dois níveis principais de empacotamento da cromatina, a
3434
heterocromatina, mais densamente empacotada, e a eucromatina, menos densamente
empacotada.
A cromatina é composta de repetidos elementos estruturais simples conhecidos como
nucleossomas. Estes são um complexo nucleoprotéico composto por duas moléculas de cada
uma das quatro histonas centrais: H2A, H2B, H3 e H4. As oito histonas estão organizadas
como um tetrâmero central de composição (H4-H3)-(H3’-H4’) que é flanqueado em cada lado
por um dímero de (H2A-H2B). A composição final dessa estrutura é (H2A-H2B)-(H4-H3)-
(H3’-H4’)-(H2A’-H2B’), rodeado por 147 pares de nucleotídeos perfazendo 1.65 volta
(COLLINGWOOD
et al., 1999; WOOD et al., 2005) (figura 9). Além dos pares de histona
citados há a participação de uma molécula de histona ligadora H1, cuja principal função
imagina-se ser estabilizar a compactação dos nucleossomos. A estrutura da cromatina cria
barreiras para cada passo da transcrição em eucariotos, e para modificar essa estrutura e tornar
o DNA acessível aos fatores envolvidos na transcrição, são necessários complexos
multiprotéicos distintos.
Os processos celulares que envolvem o DNA podem ser regulados por alterações no
seu empacotamento. A ativação da transcrição requer que o DNA esteja acessível tanto aos
fatores de transcrição, que reconhecem seqüências específicas de nucleotídeos, como à RNA
Polimerase II. É necessária também a desnaturação e reformação da dupla hélice ao longo da
transcrição (NARLIKAR
et al., 2002). Portanto, a repressão das atividades na molécula de
DNA pode ocorrer pela criação de uma estrutura de cromatina estável e inacessível, e a
ativação pode ser alcançada pela criação de estrutura de cromatina acessível. De uma forma
geral,
in vivo, a estrutura dos nucleossomas pode ser regulada por três principais mecanismos:
modificações pós-traducionais nas porções amino-terminais das histonas, alterações na
composição do octâmero de histonas, e pelo reposicionamento do octâmero de histonas ao
longo do DNA nucleossomal (SAHA
et al., 2006).
3535
Figura 9: Representação esquemática de um nucleossoma, mostrando o DNA e o octâmero de
histonas.
Retirado de www.biochem.umd.edu/ Acesso em março de 2008.
1.3.2 Modificações da Cromatina
Apesar de o empacotamento e oclusão do DNA serem atributos funcionais dos
nucleossomas, estes são também reconhecidos como participantes dinâmicos em todos os
processos cromossomiais, incluindo transcrição, replicação, reparo de DNA, construção do
centrômero e manutenção do telômero (KOMBERG & LORCH, 1999). Os nucleossomas são
estáveis e possuem pouca mobilidade, sua propriedade dinâmica se deve a ação de complexos
modificadores e remodeladores de cromatina. Complexos modificadores adicionam ou
removem modificações covalentes em resíduos específicos nas histonas (como acetilação,
metilação, ubiquitinação), modificações que são então reconhecidas pelos reguladores
transcricionais e outros fatores (JENUWEIN & ALLIS, 2001; STRAHL & ALLIS, 2000). Os
complexos modificadores atuam juntamente com complexos remodeladores de cromatina, os
quais, reestruturam, mobilizam e removem os nucleossomas para regular o acesso ao DNA
(OWEN-HUGHES, 2003).
3636
1.3.3 Receptores Nucleares
Os receptores nucleares (RNs) são um exemplo claro de como as modificações
reversíveis da estrutura da cromatina contribuem para o controle da expressão gênica. Os RNs
constituem uma grande superfamília de fatores transcricionais ligadores de DNA. São
proteínas que atuam ao nível da cromatina alterando a expressão de genes responsivos a
hormônios. Em muitos casos a atividade dos receptores é modulada pela ligação de ligantes
hormonais (esteróides, retinóides, hormônios tireoidianos, prostanóides, farnesóides e
vitamina D
3
), funcionando como reguladores essenciais em inúmeros processos fisiológicos
como crescimento, desenvolvimento, metabolismo, homeostase, metamorfose e reprodução
(MANGELSDORF
et al., 1995; GRONEMEYER & LAUDET, 1995). Os RNs ligam-se a
elementos “enhancer” ou promotores do gene alvo, levando à ativação transcricional. Essas
proteínas são o melhor exemplo de controle transcricional através do recrutamento de grandes
complexos protéicos que modificam os componentes cromossomiais e estabilizam ou
desestabilizam reversivelmente a cromatina. Esses complexos multiprotéicos são constituídos
por proteínas co-reguladoras
(co-ativadores ou co-repressores) da transcrição. O recrutamento
de co-ativadores que interagem com os receptores nucleares e afetam a transcrição por eles,
através da desestabilização da cromatina (McKENNA
et al., 1998), é dependente de ligante.
Em contraste, o recrutamento de co-repressores, na ausência de ligantes ou na presença de
antagonistas hormonais estabiliza a cromatina através da ação das histona desacetilases.
A maioria dos RN possui uma organização funcional e estrutural com seis regiões A-F
(figura 10). A região N-terminal A/B varia bastante em seqüência e tamanho. Contém um
domínio de transativação (AF-1), o qual funciona de forma independente de ligante. Há ainda
a região central C, a mais conservada, com o um domínio de ligação ao DNA (DBD) com
duas alfa-hélices e dois dedos de zinco tipo II envolvidos na especificidade de
3737
reconhecimento das regiões responsivas a hormônios (HRE – “hormone response element”),
presentes no promotor do gene. Os HREs são geralmente constituídos pelo hexanucleotídeo
AGGTCA e podem estar arranjadas como uma seqüência única ou repetida duas vezes
(“direct repeats” ou DRs), com espaçamentos que podem variar de 1 a 5 nucleotideos (DR1 –
DR5). Os diferentes DRs especificam a ligação dos diferentes RNs. Os RNs podem se ligar ao
DNA na forma de monômeros, no caso de seqüências únicas, ou dímeros (homodímeros ou
heterodímeros), no caso das DRs.
Figura 10: Organização estrutural dos Receptores Nucleares. AF1 é o domínio de transativação
independente de ligante. DBD é domínio de interação com o DNA. LBD é domínio de ligação
com o ligante. AF2 é o domínio de transativação dependente de ligante, onde se ligam as
proteínas co-reguladoras (co-ativadores e co-repressores). LXXLL: motivo de interação dos
co-ativadores de receptores nucleares. Na região C-terminal encontra-se o domínio de
dimerização.
A região C-terminal E contém o domínio de ligação com o ligante (LBD), bastante
conservada entre os receptores. Ainda nessa região há a função de transativação dependente
de ligante (AF-2). O domínio AF-2 dos RNs é constituído de resíduos de aminoácidos
carregados e hidrofóbicos, capazes de acomodar o motivo de interação com receptores
nucleares, denominado LXXLL (onde L é leucina e X pode ser qualquer aminoácido),
presente na maioria dos co-ativadores (figura 11). O domínio AF-2 é composto de três
α-
3838
hélices, sendo as hélices 3 e 12 criticas para a interação. A hélice 12 é altamente móvel e
mediante a interação do ligante, ela assume uma conformação capaz de expor a sua superfície
e permitindo o reconhecimento de co-ativadores primários (figura 11). Alternativamente, na
ausência do ligante, a hélice 12 volta a assumir uma conformação capaz de ligar proteínas co-
repressoras (SAVKUR & BURRIS, 2004).
Figura 11: Mecanismo de interação entre RNs e co-ativadores. A interação entre RNs e co-
ativadores é mediada pelo domínio AF-2 presente nos receptores e o(s) motivo(s) LXXLL contido nos
co-ativadores. (A) LBD sem a presença do ligante. (B) LBD na presença do ligante (LBP) e o
reposicionamento da hélice 12. (C) A hélice 12 está indicada em vermelho, o peptídeo co-ativador em
verde e o motivo de interação com RNs LXXLL em amarelo. O reconhecimento do motivo LXXLL
pelos RNs é feito via interações hidrofóbicas e pontes de hidrogênio entre resíduos de aminoácidos
carregados, denominado de “grampo carregado”. Esse “grampo carregado” é composto por resíduos
carregados, uma lisina na hélice 3 (K362, em alguns casos um resíduo de arginina é observado, em
outros RNs) e um ácido glutâmico (E542) na hélice 12, presentes nos RNs, e que formam pontes de
hidrogênio com as cadeias laterais dos aminoácidos do motivo LXXLL presente nos co-ativadores.
Retirado de http://www.cmbi.ru.nl/edu/bioinf4/fri-Prac/nr.shtml.
Através do alinhamento dos domínios C, D e E dos receptores nucleares, seis
subfamílias foram definidas (LAUDET, 1997). Uma grande subfamília (I) envolve os
receptores de hormônios tireoidianos (TRs), receptores de ácido retinóico (RARs), receptores
ativados pelo proliferador do peroxissomo (PPARs), receptores de vitamina D (VDRs),
3939
receptores de ecdisona (EcRs) e vários receptores órfãos como RORs. A outra subfamília (II)
contém, dentre outros (COUP, HNF4, receptores órfãos testiculares: TR2 e TR4), os que
ligam o ácido 9-
cis retinóico (RXRs). Estes últimos são de grande importância na sinalização
por receptores nucleares, pois são parceiros de diferentes receptores que se ligam no DNA
como heterodímeros (MANGELSDORF
et al., 1995; MANGELSDORF & EVANS, 1995;
GLASS, 1994). Há ainda a subfamília dos receptores de hormônios esteróides (III), por
exemplo, o receptor de estrogênio – ER e o receptor de glicocorticóides – GR. As demais
subfamílias compreendem os receptores órfãos, sendo elas: NGFI-B (subfamília IV); FTZ-
1/SF-1 (V) e GCNF1 (VI) (LAUDET, 1997).
Diversas doenças humanas, como câncer de mama e da próstata, doenças metabólicas,
como diabetes e obesidade, estão relacionadas à ação biológica de RNs. A estratégia utilizada
para bloquear a ação dos RNs tem sido o desenvolvimento de antagonistas ou anti-hormônios.
Esses compostos visam competir com os ligantes pelos seus sítios de ligação, causando um
bloqueio físico ou gerando uma mudança conformacional no domínio AF-2, capaz de induzir
a interação de co-repressores.
Conforme mencionado anteriormente, o empacotamento do DNA genômico em
nucleossomas (DNA + histonas) restringe o acesso da maquinaria transcricional e dos RNs
aos promotores dos genes regulados por hormônios, portanto reduzindo a transcrição desses
genes (URNOV & WOLFFE, 2001a; ROBYR
et al., 2000; WOLFFE & KURUMIZAKA,
1998). Nesse contexto, a estrutura da cromatina nas regiões promotoras e a modulação dessa
estrutura têm sido mostradas como os aspectos chave na regulação da expressão gênica
(BERGER, 2007; LI B. et al., 2007). Para a regulação da transcrição dos genes mediados por
receptores nucleares há a ação em conjunto de três tipos de co-fatores (co-reguladores) que
agem em nível da cromatina: os remodeladores de cromatina dependentes de ATP; os co-
repressores e os co-ativadores (ROBYR
et al., 2000; KRAUS & KADONAGA, 1998;
4040
URNOV & WOLFFE, 2001b). Os complexos co-ativadores e co-repressores contém enzimas
modificadoras de histonas (acetilases, desacetilases, metiltransferases, quinases e ubiquitina
ligases) que modificam covalentemente resíduos específicos de lisinas, argininas ou serinas na
cauda N-terminal das histonas (ROBYR
et al., 2000; STRAHL & ALLIS, 2000; RICE &
ALLIS, 2001). As atividades enzimáticas variadas mencionadas acima são recrutadas para os
promotores responsivos a hormônios via interações diretas ou indiretas com os RNs e
subseqüente modificação dos substratos de cromatina para a regulação da transcrição
realizada pela RNA polimerase II.
1.3.4 Remodeladores de Cromatina Dependentes de ATP
Os complexos de remodeladores contêm subunidades com atividade de
remodelamento da cromatina dependente de ATP. Essas proteínas estão divididas em cinco
famílias: a família SWI/SNF em leveduras (CAIRNS
et al., 1996; LAURENT et al., 1993;
POLLARD & PETERSON, 1998); ISWI-like (NURF, RSF, CHRAC, ACF) em
Drosophila
(KINGSTON & NARLIKAR, 1999; TAMKUN et al., 1992); NURD/Mi-2/CHD; INO80 e
SWR1 (SAHA
et al., 2006). Todas as famílias compartilham um mesmo domínio catalítico
em suas respectivas ATPases que é similar àquele presente em DNA translocases. Esses
complexos usam a energia armazenada na molécula de ATP para deslocar o DNA do
octâmero de histonas (MEERSSEMAN
et al., 1992), e mover ou alterar estruturalmente os
nucleossomas, permitindo maior acesso da maquinaria transcricional ao promotor de um
gene, facilitando a ativação da transcrição (WOLFFE, 1997; ROBYR
et al., 2000; URNOV &
WOLFFE, 2001a, 2001b; KINGSTONE & NARLIKAR, 1999). Há pelo menos quatro
maneiras de modificação da estrutura dos nucleossomas pelos remodeladores (CAIRNS,
2007) (figura 12): (1) o octâmero de histonas é deslizado ou movido para uma nova posição,
4141
expondo o DNA; (2) o octâmero é completamente removido do DNA para sua exposição; (3)
remoção dos dímeros H2A-H2B, deixando apenas o tetrâmero central H3-H4, o que expõe o
DNA e desestabiliza o nucleossoma; e (4) substituição dos dímeros de histona, por exemplo: a
troca dos dímeros H2A-H2B por dímeros contendo H2B e a H2A variante: H2A.Z.
Figura 12: Formas de remodelamento de nucleossomas. Os remodeladores promovem o acesso ao
DNA através do deslizamento, remoção do nucleossoma ou dímeros de histona e substituição de
dímeros H2A-H2B. Atv significa um ativador com um sítio de ligação no nucleossoma. Adaptado de
Cairns, 2007.
1.3.5 Co-repressores
Os co-repressores reprimem a expressão gênica, através da interação com os RNs na
ausência de ligantes (como em RAR e TR) ou na presença de antagonistas (por exemplo, em
receptores ER e PR) (GLASS & ROSENFELD, 2000; LAVINSKY
et al., 1998;
COLLINGWOOD
et al., 1999).
Os primeiros co-repressores identificados para receptores nucleares foram SMRT
(“silencing mediator of retinoid and thyroid hormone receptors”) e N-CoR (“nuclear hormone
receptor-corepressor”) (ZAMIR
et al., 1996; SANDE & PRIVALSKY, 1996; HÖRLEIN et
4242
al., 1995; CHEN & EVANS, 1995), pertencentes à maior família. Depois foram identificadas
as proteínas TIF1 (“transcription intermediary factor-1”) (LE DOUARIAN
et al., 1995, 1996;
VOM BAUR
et al., 1996). Ambas as classes de co-repressores recrutam histona desacetilases
(HDACs) (TORCHIA
et al., 1998; ARANDA & PASCUAL, 2001; CHEN & LI, 1998;
JONES & SHI, 2003; COLLINGWOOD
et al., 1999; URNOV et al., 2001) que vão
modificar covalentemente os nucleossomas. Há três grandes classes de HDACs: Classe I
(HDACs 1, 2, 3 e 8), Classe II (HDACS 4, 5, 6 e 7) e Classe III (proteínas da família Sir2
dependentes de NAD
+
) (YANG et al., 2002; BERTOS et al., 2001; MOAZED, 2001). N-CoR
e SMRT são componentes de um complexo contendo SIN3 (proteína que interage com
diversos RNs) e histona desacetilases (HEINZEL
et al., 1997; NAGY et al., 1997). Estudos
com inibidores de HDACs e bloqueio com anticorpo mostraram que componentes do
complexo NCoR/mSin3/HDAC são necessários para a repressão mediada por RNs na
ausência de ligantes (figura 13). Este fato corrobora a idéia de que a hipoacetilação das
histonas está correlacionada com a repressão gênica (COLLIGWOOD
et al., 1999; WOLFFE,
2000; URNOV
et al., 2001; HU & LAZAR, 2000). As conseqüências do recrutamento e
concentração local das desacetilases são a estabilização da estrutura da cromatina e repressão
da transcrição (COLLIGWOOD
et al., 1999).
4343
Figura 13: Representação esquemática do complexo co-repressor ligado a receptores nucleares.
O complexo SMRT/N-CoR, ligado aos receptores na ausência do ligante, recruta componentes
adicionais ao complexo, como HDACs, mSin3 e outros co-repressores ainda não conhecidos (não
ilustrado para simplificação). A habilidade das HDACs de remover grupos de acetil das histonas,
promovendo a repressão transcricional, está indicada pela seta.
1.3.6 Co-ativadores
Na época da clonagem do primeiro co-ativador de receptor nuclear, SRC-1 (ONATE,
1995), e os co-repressores NCoR e SMRT (HÖRLEIN
et al., 1995; CHEN & EVANS, 1995),
era previsto que existissem de cinco a dez co-ativadores e alguns co-repressores na célula. No
entanto, aproximadamente 300 co-reguladores (co-ativadores e co-repressores) já foram
descritos na literatura, confirmando seus papéis na regulação da transcrição
(http://www.NURSA.org; LONARD & O’MALLEY, 2007). Os co-ativadores são moléculas
recrutadas diretamente pelos RNs e aumentam a expressão gênica mediada por esses
receptores (LONARD & O’MALLEY, 2007). O recrutamento dos co-ativadores é
normalmente, mas nem sempre, dependente de ligante. Essas proteínas podem ser divididas
em dois grupos: co-ativadores primários e co-ativadores secundários (STALLCUP
et al.,
2003). Os co-ativadores secundários pertencem ao complexo multiprotéico de co-ativação,
contribuindo para o aumento da transcrição mediada por RNs, mas não entram em contato
direto com os receptores (JUNG
et al., 2005). Já os co-ativadores primários são os primeiros a
DESACETILAÇÃO
4444
interagirem com os RNs. Além da função de alteração da estrutura da cromatina e da
interação direta com RNs, os co-ativadores primários são capazes de interagir com membros
da maquinaria basal de transcrição, como por exemplo, a TBP (“TATA-binding protein”) e a
RNA polimerase II, atuando como ponte entre o promotor do gene alvo e o complexo de
transcrição basal.
A interação entre RNs e co-ativadores é uma etapa determinante na expressão do gene
alvo. Essa interação é mediada pelo domínio AF-2 contido nos RNs e o motivo LXXLL
contido nos co-ativadores (SAVKUR & BURRIS, 2004) (figura 10). Este motivo assume uma
conformação de
α-hélice, que se liga a hélice 12 dos RNs. O motivo LXXLL está presente na
maioria dos co-ativadores primários (que podem apresentar um ou vários motivos) e é crucial
na interação entre os RNs e os co-ativadores (SAVKUR & BURRIS, 2004).
Uma vez que o recrutamento de co-ativadores é um processo obrigatório para a
ativação gênica via RNs, não é surpreendente que os estudos das interações entre RNs e co-
ativadores têm recebido uma atenção especial como um potencial alvo terapêutico. Nesse
sentido, os estudos de cristalografia dos domínios AF-2 dos RNs, assim como do domínio
AF-2 complexado com os co-ativadores têm gerado informações cruciais para o
desenvolvimento de novas drogas.
Estudos estruturais r
evelaram que o LBD dos RNs compreende 12 α-hélices
antiparalelas que sofrem um rearranjo significativo mediante a ligação do ligante. Esse
rearranjo cria uma reentrância hidrofóbica na superfície no domínio AF-2, permitindo o
encaixe perfeito do domínio LXXLL do co-ativador (figura 10). Vários estudos mostraram
que receptores truncados, contendo somente o DBD e o LBD (que inclui o AF-2) e ligados ao
DNA, foram capazes de interagir com peptídeos contendo a seqüência LXXLL e ativar a
transcrição de genes alvos repórteres. Nesse sentido, moléculas capazes de competir pelo sitio
de interação entre o domínio AF-2 do RN e o motivo LXXLL do co-ativador inativaram a
4545
transcrição dos genes repórteres. Um exemplo clássico da importância de drogas que
bloqueiam a ação de RNs via o motivo LXXLL é o Tamoxifen, uma droga eficaz utilizada no
combate ao câncer de mama. O Tamoxifen se liga especificamente no domínio AF-2 do
receptor de estrogênio alfa, inibindo a interação do co-ativador GRIP1 (WIDAKOWICH
et
al.
, 2007).
1.3.6.1 NCoA-62
O NCoA-62 foi identificado como um co-ativador de RNs por interagir com o receptor
da vitamina D (VDR). Esse co-ativador apresenta propriedades características de um co-
ativador de RN, como interação específica com os RNs e co-ativadores primários, como SRC
e p300/CBP. Diferentemente de outros co-ativadores primários, o NCoA-62 não apresenta
atividade catalítica e dessa forma, não está classificado como um remodelador de cromatina.
Alternativamente, esse co-ativador, além de mediar as interações entre os RNs e a maquinaria
basal de transcrição, tem também envolvimento no processamento do RNA mensageiro
(“mRNA splicing”). Nesse sentido, o NCoA-62 se associa com componentes da maquinaria
de processamento do mRNA (“spliceosome”), atuando no processo de maturação do
transcrito.
O NCoA-62 apresenta dois domínios funcionais. Um domínio de interação com os
RNs, denominados SNW e um domínio de transativação, TAD. A proteína humana é capaz
de interagir com os co-ativadores SRC e p300/CBP, fazendo parte do complexo de co-
ativadores primários de RNs.
4646
1.3.6.2 Histona Acetiltransferases (HATs)
A região N-terminal das histonas nucleossomais pode ser modificada por acetilação,
fosforilação, ubiquitinação, sumoilação e metilação (BRADBURY, 1992) (figura 14). Essas
modificações covalentes afetam a carga e função das histonas, alterando a estrutura da
cromatina e expressão gênica. Estudos vêm demonstrando o papel das modificações pós-
traducionais na ativação transcricional, mas a acetilação ainda é o mecanismo mais bem
compreendido.
Os co-ativadores histona acetiltransferase (HAT) foram identificados inicialmente
através de experimentos que mostravam a sua interação com o domínio LBD de vários RNs
na presença de ligante, e em estudos subseqüentes sua atividade de histona acetiltransferase
foi revelada (SPENCER
et al., 1997). O grupo mais bem caracterizado dos co-ativadores
HAT é a família p160. Três membros dessa família foram isolados incluindo SRC-1/NCoA-1,
TIF2/GRIP1/NCoA-2 e ACTR/RAC3/AIB1/TRAM-1/p/CIP (SPENCER
et al., 1997; CHEN
et al., 1997). As histonas acetiltransferases incluem ainda a família MYST (proteínas Esa1,
MOF, Tip60 e Sas3, por exemplo – BORROW
et al., 1996; NEUWALD & LANDSMAN,
1997); as proteínas p300/CBP e a superfamília GNAT (NEUWALD & LANDSMAN, 1997;
STERNER & BERGER, 2000). A superfamília GNAT inclui as HATs Hat1, Elp3 e Hpa2,
PCAF (p300/CBP associated factor) e seu ortólogo Gcn5.
As HATs são as subunidades catalíticas dos complexos multiprotéicos que acetilam
resíduos específicos de lisina na região N-terminal das histonas presentes na cromatina. Essas
enzimas transferem um grupo acetil da acetil-coenzima A (Acetil-CoA) para o grupo
-amino
das cadeias laterais de lisinas contidas na região N-terminal das histonas (LOIDL, 1994). No
octâmero de histonas, a região N-terminal destaca-se dos domínios globulares, e no contexto
dos nucleossomas acredita-se que liga ao DNA através de interação de cargas (cauda
4747
positivamente carregada das histonas com o DNA negativamente carregado). Essas proteínas
também medeiam as interações entre nucleossomas (FLETCHER & HANSEN, 1995).
Figura 14: Modificações pós-traducionais em um nucleossoma. Modificações de acetilação,
metilação, ubiquitinação, sumoilação e fosforilação nas regiões N-terminais das histonas pertencentes
ao octâmero do núcleo do cormossoma. Adaptado de http://chemistry.gsu.edu/faculty/Zheng/
Os itens seguintes descrevem com mais detalhes as duas histona acetiltransferases
utilizadas como alvos de estudo no presente trabalho.
A) GCN5/PCAF
Desde a descoberta da acetilação de histonas (ALLFREY et al., 1964), esta
modificação pós-traducional tem sido correlacionada com processos de transcrição.
A primeira HAT nuclear com atividade acetiltransferase em histonas livres foi
identificada no ciliado
Tetrahymena thermophila (BROWNELL, 1996). Mais tarde mostrou-
se que ela possuía homologia com a proteína Gcn5 (general control norrepressed-5) de
levedura (yGcn5), anteriormente identificada como um co-ativador transcricional envolvido
acetilação
metilação
ubiquitinação
sumoilação
fosforilação
cauda H2A
cauda H2B
cauda H2A
cauda H4
cauda H4
cauda H3
cauda H3
cauda H2B
4848
na interação entre alguns ativadores e complexos transcricionais (BERGER
et al., 1992).
Homólogos de Gcn5 tem sido clonados em diversos organismos - como humanos (CANDAU,
et al., 1996), camundongo (XU, 1998), Schizosaccharomyces pombe, Drosophila
melanogaster
(SMITH et al., 1998), Arabidopsis thaliana, Toxoplasma gondii (HETTMANN
& SOLDATI, 1999) e mais recentemente em
Schistosoma mansoni (de MORAES MACIEL,
et al., 2004) - sugerindo que sua função é altamente conservada entre os eucariotos.
A proteína GCN5 de levedura (yGCN5) faz parte de pelo menos dois complexos
multiprotéicos de co-ativadores como os complexos SAGA (Spt-Ada-GCN5
acetyltransferases) e ADA (GRANT
et al., 1997, 1998). Estudos genéticos e bioquímicos
revelaram pelo menos duas proteínas de interação, Ada 2 e Ada3, que formam um complexo
com GCN5 (HORIUCHI
et al., 1995; MARCUS et al., 1994). A ligação de Ada2 nos
domínios de ativação de ativadores transcricionais VP16 e Gcn4
in vitro sugere um
mecanismo onde ocorre o recrutamento de Gcn5 pelo promotor. No entanto, o papel biológico
específico do complexo ADA ainda não está claro. O complexo SAGA exerce atividade
transcricional
in vitro utilizando moldes de cromatina, e depende da atividade HAT de GCN5
(BROWNELL & ALLIS, 1996).
As proteínas PCAF/GCN5 possuem dois domínios funcionais altamente conservados
entre seus homólogos, o domínio catalítico HAT e o domínio bromo, de interação proteína-
proteína.
O domínio HAT é responsável pela acetilação de histonas no nucleossomo. Sua
estrutura já foi determinada para alguns representantes da família GNAT, com ou sem os
substratos presentes (DUTNALL
et al., 1998; LIN et al., 1999; ROJAS et al., 1999;
TRIEVEL
et al., 1999; CLEMENTS et al., 1999; ANGUS-HILL et al., 1999). Este domínio
possui uma região N-terminal e outra C-terminal, separados por uma região de depressão
hidrofóbica. Em
Tetrahymena demonstrou-se que nesta região hidrofóbica se ligam a cauda
4949
da histona H3 e a Acetil-CoA. No sítio ativo, o resíduo de ácido glutâmico 122 (E-173 em
yGCN5) cataliza a transferência do grupamento acetil da Acetil-CoA para a cadeia lateral da
lisina da histona H3 (ROJAS
et al., 1999). O resíduo E-173 em yGCN5 é conservado entre os
homólogos de GCN5/PCAF e demonstrou ser o resíduo crítico para a função catalítica de
HAT (TRIEVEL
et al., 1999; WANG et al., 1998). Os homólogos humanos (hsPCAF e
hsGCN5) da proteína GCN5 de levedura foram identificados como tendo atividade HAT
in
vitro
(CANDAU et al., 1996; YANG et al., 1996). Além disso, o seu domínio HAT pode ser
substituído pelo domínio HAT de levedura
in vivo, indicando a conservação evolucionária da
função HAT (WANG, 1998).
O domínio bromo foi primeiramente identificado na proteína brahma de
Drosophila
(TAMKUN et al., 1992; HAYNES et al., 1992). Este domínio compreende uma região bem
conservada encontrada tanto em PCAF como GCN5 (HAYNES
et al., 1992). Sua função
exata ainda não é muito clara, mas parece estar envolvido em interação proteína-proteína
(JEANMOUGIN
et al., 1997; WINSTON & ALLIS, 1999). Dados estruturais e funcionais
sugerem que o domínio bromo tem envolvimento na atividade HAT de GCN5, contribuindo
para a alta especificidade na acetilação de histonas (BROWNELL & ALLIS, 1996;
DHALLUIN
et al., 1999), além de ser indispensável para a função de GCN5 em leveduras
(GEOGARKOPOULOS
et al., 1995). A deleção do domínio bromo em yGCN5 causa
defeitos no crescimento celular e na transcrição
in vivo de certos genes (MARCUS et al.,
1994; GEORGAKOPOULOS
et al., 1995) e, reduz a acetilação de nucleossomas in vitro, no
contexto do complexo SAGA (STERNER
et al., 1999). O domínio bromo de GCN5 também
estabiliza a interação do complexo SAGA com o promotor (SYNTICHAKI
et al., 2000). Este
domínio também demonstrou ser um domínio de ligação a lisinas acetiladas (ZENG &
ZHOU, 2002; DHALLUIN
et al., 1999; OWEN et al., 2000; HUDSON et al., 2000;
JACOBSON
et al., 2000). Dados estruturais mostraram que o sítio de ligação a lisina
5050
acetilada encontra-se em uma região hidrofóbica entre os “loops” ZA e BC formados entre as
estruturas em alfa-hélice 1 e 2, e 3 e 4, respectivamente (ZENG & ZHOU, 2002). Esses dados
reunidos sugerem um possível papel do domínio bromo de histona acetiltransferases na
contribuição de interação de substrato, estabilização dos sítios de interação nos promotores
(BROWNELL & ALLIS, 1996) ou manutenção da interação de proteínas de natureza
regulatória (BARLEV
et al., 1995; WINSTON & ALLIS, 1999). Em SmGCN5 observamos
que as estruturas dos domínios funcionais da proteína (bromo e HAT) são bastante
conservadas (figura 15) (de MORAES MACIEL - dissertação de mestrado, 2004).
Figura 15: Estrutura 3D dos domínios funcionais HAT e bromo de SmGCN5. A: Estrutura 3D do
domínio HAT. Note o resíduo de ácido glutâmico (E109 – correspondente ao resíduo E173 de
yGCN5) entre as folhas beta 3 e 4. B: Estrutura 3D do domínio bromo, mostrando as quatro alfa-
hélice, os "loops" ZA e BC e a cavidade hidrofóbica formada entre eles. As estruturas estão coloridas
de acordo com a sucessão de estrutura secundária.
Em GCN5 e PCAF de humanos (hsGCN5-L e hsPCAF, respectivamente) foi
demonstrado que uma região N-terminal adicional (presente também em GCN5 e PCAF de
camundongo, mas não em yGCN5 e na forma menor de hsGCN5-S) tem grande importância
no reconhecimento de substratos de nucleossomas. As proteínas hsGCN5-L e hsPCAF são
A
B
5151
capazes de acetilar tanto histonas livres como os nucleossomas, enquanto yGCN5 e hsGCN5-
S só acetilam histonas livres (XU
et al., 1998).
Assim como os co-ativadores SCR-1/p160 e CBP/p300, GCN5/PCAF também
possuem um motivo de interação com os receptores nucleares. Conforme já descrito no item
1.3.6, este motivo é denominado LXXLL (HEERY
et al., 1997, 2001; McINERNEY et al.,
1998; SAVKUR & BURRIS, 2004). Os motivos LXXLL podem ser agrupados em quatro
classes diferentes, de acordo com os resíduos flanqueadores (SAVKUR & BURRIS, 2004). A
quantidade e o tipo de motivo presente em cada co-ativador podem conferir a especificidade
na interação com os receptores nucleares (HEERY
et al., 2001; SAVKUR & BURRIS, 2004;
McINERNEY
et al., 1998).
B) CBP/p300
CBP (CREB Binding Protein) foi originalmente identificado em sua associação com
CREB em resposta a fosforilação mediada por AMP cíclico (KWOK
et al., 1994), e a
proteína p300, altamente relacionada, foi isolada a partir de sua interação com a proteína viral
E1A (ECKNER
et al., 1994). Tanto CBP como p300 são fosfoproteínas nucleares contendo
aproximadamente 2400 aminoácidos e massa molecular em torno de 300 kDa. Essas proteínas
estão envolvidas em processos biológicos fundamentais, como crescimento, proliferação,
apoptose e desenvolvimento celular.
CBP/p300 são co-ativadores de diversos fatores transcricionais, incluindo os
receptores nucleares de classes I e II (membros da subfamília III e subfamília I,
respectivamente) (SHIBATA
et al., 1997). Esses co-ativadores não se ligam diretamente ao
DNA, mas são recrutados ao promotor através da interação com os fatores transcricionais
seqüência-específico (YANG
et al., 1996), ou por acetilação de diversos substratos.
5252
CBP/p300 interagem com os fatores transcricionais basais como TATA-biding protein (TBP)
e TFIIB e/ou é capaz de formar um complexo com a RNA polimerase II (KWOK
et al.,
1994). Foi demonstrado que CBP/p300 interagem com uma grande variedade de fatores
transcricionais, como AP-1, myoD, Jun, Fos, NF-
B, STATs e outras proteínas, além de
servirem como co-ativadores desses fatores potencializando sua atividade transcricional
(SHIKAMA
et al., 1998). Por interagirem simultaneamente com a maquinaria basal de
transcrição e com um ou mais fatores de transcrição, CBP e p300 funcionam como pontes
físicas ou estruturais e, portanto estabilizam o complexo transcricional. Outro aspecto
importante da função de co-ativador dessas proteínas é sua habilidade de acetilação de
histonas nucleossomais próximas ao promotor, resultando em acessibilidade aumentada ao
DNA para outros reguladores essenciais (OGRYZKO
et al., 1996; BANNISTER &
KOUZARIDES, 1996; KUNDU
et al., 2000). A proteína CBP foi o primeiro co-ativador com
a atividade HAT demonstrada (OGRYZKO
et al., 1996). Estudos in vitro, experimentos de
co-imunopreciptação, e ensaios de duplo híbrido em leveduras e mamíferos também
demonstraram a interação de diferentes receptores nucleares com CBP. Essa interação é
dependente de ligante e AF-2 dependente, e CBP/p300 parecem funcionar como co-ativadores
essenciais para os receptores (CHAKRAVARTI
et al., 1996; KAMEI et al., 1996). Esta
conclusão foi feita a partir de observações de potencialização da ativação transcricional
dependente de ligante por diferentes RNs mediante uma super-expressão de CBP/p300 e,
mais importante, através da micro injeção de anticorpos anti-CBP que bloqueiam a ativação
dependente de ligante por GR, RAR e RXR. Adicionalmente, a transcrição dependente de
ácido retinóico é marcadamente diminuída em fibroblastos “knock-out” para p300 em
camundongos (YAO
et al., 1998), suportando a idéia de que CBP/p300 são componentes
essencias para regulação da transcrição hormonal
in vivo. A interação entre CBP e os
receptores ocorre através da região N-terminal desse co-ativador, local onde encontramos o
5353
primeiro motivo de interação LXXLL (KAMEI
et al., 1996). CBP/p300 possui muitos outros
domínios funcionais, incluindo o domínio de interação com CREB (KIX) onde outros fatores
transcricionais também se ligam, e as regiões de dedos de zinco (C/H1 – onde encontramos o
segundo LXXLL, C/H2 e C/H3) que se ligam em muitos outros fatores. O terceiro motivo
LXXLL de interação com RNs se encontra na região C-terminal da proteína. A histona
acetiltransferase PCAF também se associa com CBP através da região C/H3. Um domínio
bromo também está presente entre o domínio KIX e o segundo dedo de zinco. Há ainda um
domínio de atividade histona acetiltransferase (HAT) que se encontra entre o domínio bromo
e o terceiro dedo de zinco (OGRYZKO
et al., 1996; BANNISTER & KOUZARIDES, 1996).
A remoção ou mutação do domínio HAT resulta em perda de função para muitos fatores de
transcrição, indicando a importância desta atividade. Diferentes regiões de CBP estão
envolvidas na interação com receptores nucleares e co-ativadores, por exemplo, CBP/p300
não apenas se ligam a RNs, mas se associam com a família de co-ativadores p160, formando
possivelmente um complexo ternário (KAMEI
et al., 1996; TORCHIA et al., 1997; VOEGEL
et al., 1998) (figura 16).
Homólogos de CBP/p300 são encontrados em muitos organismos, que incluem
moscas, vermes e plantas (ARANY
et al., 1994; BORDOLI et al., 2001; YUAN &
GIORDANO, 2002). Alterações genéticas de proteínas ortólogas em
C. elegans e D.
melanogaster
mostraram que esses co-ativadores desempenham um papel central no controle
de passos importantes do desenvolvimento durante a embriogênese em ambos os organismos.
Como mencionado anteriormente, p300 e CBP são proteínas homólogas e ambas
interagem com pCAF/GCN5 (YANG
et al., 1996), com os co-ativadores de receptores
nucleares como o SRC e ACTR (SPENCER
et al., 1997; CHEN et al., 1997), com fatores de
transcrição como o CREB (KWOK
et al., 1994; CHAN & LA THANGUE, 2001) e com os
próprios receptores nucleares (KAMEI
et al., 1996; CHAKRAVARTI et al., 1996).
5454
Figura 16: Representação esquemática do complexo co-ativador ligado a receptores nucleares.
Os receptores ligados ao elemento responsivo a hormônio (HRE), na presença do ligante, recrutam os
co-ativadores. Um complexo com os co-ativadores p160, CBP/p300, CARM1, e PRMT1 ligados aos
receptores nucleares via motivo LXXLL, acetilam ou metilam as histonas nucleossomais, permitindo o
acesso da maquinaria basal de transcrição e da RNA polimerase II ao DNA, e conseqüentemente a
transcrição do gene. O complexo remodelador de cromatina dependente de ATP-Swi/Snf também está
representado na figura.
1.4 Dinâmica da Transcrição Via Receptores Nucleares e Seus Co-reguladores
Décadas de estudos revelaram que a ativação e repressão gênica requerem um enorme
número de fatores que incluem várias combinações de co-ativadores e co-repressores, fatores
de transcrição, fatores gerais de transcrição (FGT) e a maquinaria basal de transcrição da
RNA polimerase II (RNAPII) (KINYAMU & ARCHER, 2004; PERISSI & ROSENFELD,
2005). A complexidade da regulação gênica é aumentada pelo fato de que os fatores
transcricionais devem regular a expressão a partir de um genoma que está compactado na
forma de cromatina (BERGER, 2007; LI B
et al., 2007). Esta complexidade também é
agravada pela rápida expansão do número de co-ativadores/co-repressores identificados e a
imensidão de atividades enzimáticas referentes à cromatina (LONARD & O’MALLEY, 2006;
ROSENFELD
et al., 2006).
5555
Após a sinalização por hormônio, o receptor nuclear se liga a elementos regulatórios
presentes na cromatina e inicia o recrutamento de vários complexos multiprotéicos para
seqüências no promotor do gene. Estes complexos levam ao recrutamento de fatores gerais de
transcrição e iniciam a transcrição.
A ativação da transcrição mediada por RNs é dependente do recrutamento de co-
ativadores pelo receptor ao promotor para a modulação da arquitetura da cromatina. Esses co-
ativadores incluem a família de proteínas p160/SRC que interagem diretamente com os RNs
através dos motivos de interação com RNs (LXXLL) (HEERY
et al., 1997; PERISSI &
ROSENFELD, 2005). As proteínas p160/SRC promovem uma arquitetura para o adicional
recrutamento de co-ativadores primários incluindo as histona acetiltransferases (HATs), como
p300/CBP e histona metiltransferases (HMTs), por exemplo, CARM1 e PRMT1 (figura 16).
Essas enzimas são recrutadas para a modificação covalente das histonas, permitindo
mudanças na arquitetura da cromatina e sinalizando para o recrutamento de proteínas co-
reguladoras adicionais (BERGER, 2007; KINYAMU & ARCHER, 2004; KOUZARIDES,
2007; PERISSI & ROSENFELD, 2005; STALLCUP
et al., 2003). Adicionalmente às
atividades de modificação enzimática covalente, complexos de remodelamento de cromatina
ATP-dependentes, como o SWI/SNF, são recrutados ao promotor e trabalham juntamente
com as enzimas de modificação de histonas para alterar a dinâmica dos nucleossomas na
região promotora, permitindo o acesso de co-ativadores adicionais, complexos mediadores,
FGTs e a maquinaria RNAPII (AOYAGI
et al., 2005; BELAKAVADI & FONDELL, 2006;
TROTTER & ARCHER, 2007).
Muitas proteínas de modificação da cromatina têm sido mostradas como modificadores
de proteínas não-histonas. Entre os seus alvos encontram-se os já descritos receptores
nucleares, e vários outros co-ativadores como SRC3 (AIB1) e CBP/p300, onde as alterações
de modificações pós-traducionais desempenham um papel nas atividades de regulação desses
5656
fatores (BLACK
et al., 2006; FAUS & HAENDLER, 2006; LI & SHANG, 2007; POPOV et
al.
, 2007; ROSENFELD et al., 2006).
Modelos tradicionais sugerem que as interações de receptores-DNA/cromatina sejam
associações estáveis que são ditadas primeiramente pela disponibilidade do ligante. Isto é, na
presença do ligante, os receptores estão associados de forma estável com seus sítios de
interação e esta associação estável conduz por sua vez ao recrutamento por etapas dos fatores
da transcrição e das atividades de modificação/remodelamento da cromatina. Uma
interpretação razoável destes dados indicaria que os receptores estão associados de forma
estável nas suas seqüências alvos através de ciclos múltiplos da iniciação da transcrição. Esta
idéia dos eventos nucleares onde as proteínas estão ligadas estaticamente aos elementos
reguladores por períodos de tempo prolongados tem sido desafiada recentemente através do
uso de proteínas marcadas com fluorescência e das técnicas de “photobleaching” (FRAP), que
permitem o monitorado em tempo real do movimento das proteínas. Tem-se tornado muito
claro que a maioria das proteínas são altamente móveis, e existem em um equilíbrio rápido e
dinâmico com alvos múltiplos dentro do compartimento nuclear (HAGER, 1999; MISTELI,
2001; PHAIR & MISTELI, 2000). A mobilidade rápida parece ser uma característica comum
a proteínas nucleares, independentemente de sua classificação funcional. As proteínas
envolvidas na ativação transcricional, modificação da cromatina, reparo do DNA, “splicing” e
processamento de RNA, todas exibem um comportamento dinâmico (PHAIR & MISTELI,
2000, CARRERO
et al., 2003). A mobilidade alterada de qualquer proteína pode ser
relacionada com interações adicionais com outras proteínas para a formação de complexos. A
mobilidade de uma proteína também pode ser dependente de processos que influenciem seu
estado de modificação, como fosforilação e acetilação, ou a localização subcelular.
Finalmente, uma análise cinética detalhada da ocupação dos co-ativadores/co-
repressores nos promotores revelou um processo altamente dinâmico de mudança entre os co-
5757
fatores (METIVIER
et al., 2006; PERISSI & ROSENFELD, 2005; ROCHETTE-EGLY,
2005; ROSENFELD
et al., 2006). Os estudos recentes também revelaram que a ação desses
co-ativadores ocorre em uma ordem de recrutamento específica para várias combinações de
co-ativadores que regulam a magnitude e a cinética da expressão gênica. Essas modificações
dinâmicas na cromatina acompanham a expressão gênica (METIVIER
et al., 2006). A ligação
do domínio bromo de algumas proteínas em lisinas de histonas acetiladas, a ligação em lisinas
de histonas metiladas pelos domínios chromo, dedos PHD e WD-40 presentes em algumas
proteínas, têm sido identificadas como marcas de modificações que influenciam na arquitetura
da cromatina e a ligação de co-fatores adicionais (KOUZARIDES, 2007; MELLOR, 2006;
WYSOCKA
et al., 2006). A natureza dinâmica e combinatória do recrutamento de co-
ativadores/co-repressores é altamente específica em níveis de promotor, célula e tecido,
levando a várias respostas gênicas e celulares desencadeadas pelo mesmo sinal biológico
como visto com hormônios (LARSEN
et al., 2003).
Além do tempo de recrutamento de co-ativadores, a regulação das modificações pós-
traducionais que modulam as atividades desses fatores e como isso pode influenciar a cinética
de recrutamento de fatores e liberação do promotor, devem ser levados em consideração e
adicionados ao já complexo panorama da ativação gênica.
1.5 Regulação da Expressão Gênica (Gene p14) por Receptores Nucleares em S.
mansoni
A necessidade da presença do esquistossomo macho para a maturação sexual da fêmea
já foi descrito a bastante tempo (SAGAWA
et al., 1928; SEVERINGHAUS, 1928). Na
infecção humana, o acasalamento do verme macho com a fêmea é necessário para a contínua
fertilização e produção de ovos (POPIEL & BASCH, 1984; ERASMUS, 1973; MICHAELS,
5858
1969; SHAW, 1977). Apesar de não sintetizar esteróis
de novo (MEYER et al., 1970), o S.
mansoni
é capaz de converter várias moléculas de esterol incorporadas em metabólitos
relacionados, produzindo sinais similares a hormônios (BRIGGS, 1972). Também foi
demonstrado que inibidores de esteróis afetam a ovoposição
in vivo (BRIGGS, 1972). A
hipótese de que uma secreção hormonal-similar do macho seja responsável pela vitelogênese
em fêmeas tem sido suportada pela observação de indução parcial desse processo em presença
de extratos orgânicos de macho (SHAW, 1977). Vários genes de esquistossomo têm sido
identificados como sendo expressos apenas nas fêmeas maduras (MICHEL
et al., 2003;
HOFFMANN
et al., 2002; GREVELDING et al., 1997; SCHUSSLER et al., 1997; ROCHE
et al., 1996; CHEN et al., 1992; MOSER et al., 1992; LO VERDE & CHEN, 1991; BOBEK
et al., 1986), a maioria deles envolvidos de alguma forma na produção de ovos.
Estudos de regulação gênica, desenvolvidos em outros modelos, têm levado à
identificação de seqüências regulatórias em diferentes regiões promotoras de DNA. Além
disso, diversas proteínas vêm sendo caracterizadas como fatores transcricionais, mostrando-se
capazes de interagir com ácidos nucléicos de maneira à regular processos de transcrição e
replicação gênica (MANIATIS
et al., 1987; MITCHELL & TJIAN, 1989).
Elementos de regulação conservados já foram descritos em alguns genes de
Schistosoma mansoni (LOVERDE & CHEN, 1991), além da presença de seqüências similares
a HRE no gene
p14 (F-10) do parasito (RUMJANEK, 1989). O gene p14 tem sido modelo de
estudo da expressão gênica específica em fêmeas. Ele codifica para uma proteína precursora
da casca do ovo expresso apenas em células vitelínicas de fêmeas maduras em resposta ao
estímulo do macho (BOBEK
et al., 1986; SIMPSON et al., 1987; KOSTER et al., 1988;
CHEN
et al., 1992). Nesse sentido, o gene p14 é considerado um alvo em potencial, e o
entendimento dos mecanismos de sua regulação pode levar a estratégias que permitam intervir
na ativação de sua transcrição. A região promotora do gene
p14 (figura 17) apresenta diversas
5959
putativas seqüências reguladoras, o que sugere que esse gene tenha mecanismos de regulação
complexos. Uma das seqüências descritas, responsiva a fatores de transcrição do grupo dos
receptores nucleares hormonais, consiste de duas repetições diretas, 5’-AACTATCA-3’ (DR5
- direct repeat 5), espaçadas por cinco nucleotídeos (FREEBERN
et al., 1999) (figura 15).
Figura 17: Região promotora do gene p14 (F-10). Os nucleotídeos em vermelho correspondem ao
elemento HRE-DR17, onde se ligam o heterodímero
SmNR1/SmRXR1. Os nucleotídeos destacados
em azul são o elemento DR5 onde se ligam os receptores nucleares
SmRXR1 e SmRXR2. O códon de
inicialização ATG, os “boxes” CAAAT e TATA estão destacados em negrito.
Apesar de evidências mostrarem a influência de hormônios em funções do
esquistossomo, não se sabe exatamente quais receptores nucleares e proteínas regulatórias
estão envolvidas em tais funções. Até a presente data foram identificados 21 RNs (WU
et al.,
2006) em
S. mansoni, incluindo, dentre outros, SmRXR1 e SmRXR2 (FREEBERN, 1999),
SmFTZ-F1 (DE MENDONÇA et al., 2000; LU et al., 2006), receptores de hormônio
tireoidiano (WU
et al., 2006) e SmNR1, similar a RAR, PPAR e EcR, (WU et al., 2007).
Estudos de transcrição utilizando gene repórter em sistema de único-híbrido em
leveduras demonstraram que os receptores nucleares
SmRXR1 e SmRXR2 se ligam na
seqüência regulatória do gene
p14 (5’-AACTATCA-3’) e induzem a expressão do gene
repórter (FREEBERN
et al., 1999; FANTAPPIÉ et al., 2001). No entanto, também por
ensaios de único-híbrido, foram observadas ligações inespecíficas em outras seqüências
regulatórias encontradas no promotor do gene (FREEBERN
et al., 1999). Ainda nesse
contexto, ensaios de retardamento da mobilidade eletroforética (EMSA – “Eletrophoretic
Mobility Shift Assay”) demonstraram que esses receptores nucleares de
S. mansoni se ligam
- 450
CCCACTAGTGTCTCGTCTGACTAGAATGGATTGAGGTCATTGCAACATCGTCTATGAGGTGAACAAGT
TAAATTTAACCTGTTTAGTTATAACTTGTATGTCCAGAGCAAACATCACTTGTCAGTGTTATCAAAAG
AGTTTCGTCTCCATTCAATGAAGACTTAATCAACAGTTTCGATGAACCACATGCTAACGAATTCTACG
GTAGAATCAAAAGAATTAACTGACATTTTTAACTATCACGCTCAACTATCATTAACGATTACACAAAA
GACAGTTCGACAGTAGAGTGCACAAGCGTAATATGTATTTAATAATGATGCACTTAGTGAGGCACAAC
TCTT
CAAATCTATAATCAAAAATATATAAATGATAAATCACACTAGTCTACACATCATCACACCCAGT
ACAACAACACCAACAATTTGAAAA
ATG
6060
fracamente a essa seqüência como monômeros (FREEBERN
et al., 1999; FANTAPPIÉ et al.,
2001). Entretanto, uma forte sugestão de que essas proteínas estão envolvidas na regulação da
transcrição do gene
p14 é a demonstração, por ensaios de hibridização in situ, da sua larga
distribuição em células vitelínicas. Esses receptores possuem a seqüência de dimerização
presente na região AF-2 dos receptores nucleares, no entanto,
SmRXR1 e SmRXR2 não são
capazes de formar dímeros entre si (FANTAPPIÉ
et al., 2001).
Recentemente foi demonstrado
in vivo por sistema de duplo híbrido e in vitro em
ensaios de “pull down”, que o receptor nuclear
SmNR1 interage com SmRXR1 (WU et al.,
2007), formando o heterodímero SmNR1/
SmRXR1. Esse heterodímero é capaz de ligar-se
fortemente a elementos de DNA que formam repetições diretas separadas por 0-5
nucleotídeos (DR1-DR5) e uma repetição palíndrome (Pal0), conforme demonstrado em
experimentos de EMSA (WU
et al., 2007). Recentemente uma nova seqüência regulatória
responsiva a receptores nucleares presente na região promotora do gene
p14 foi identificada
(FANTAPPIE
et al., 2008b). Esta seqüência contem o motivo hexamérico canônico de DNA,
5’-PuGGTCA, composto por uma repetição direta com um espaçamento atípico de 17
nucleotídeos (DR17). Os receptores nucleares de
S. mansoni SmNR1 e SmRXR1 ligam-se
especificamente ao elemento
p14 (F-10)-DR17 como heterodímero. Mutações na seqüência
TCA impediram completamente a ligação do heterodímero
SmNR1/SmRXR1 (FANTAPPIE
et al., 2008b). Esses dados sugerem que a expressão do gene p14 (F-10) é regulada através de
vias sinalizadas por receptores nucleares.
A regulação transcricional mediada por receptores nucleares acontece através da
interação com proteínas co-reguladoras (BELAKAVADI & FONDELL, 2006), que atuam no
remodelamento da cromatina e modificação das histonas (STRAHL & ALLIS, 2000;
BERGER, 2002). A modificação pós-traducional de proteínas histona e não-histona,
incluindo RNs, integra a sinalização de vias que regulam diversos processos biológicos.
6161
Alguns estudos vêm mostrando a participação de proteínas regulatórias na regulação da
transcrição por receptores nucleares de
S. mansoni. Por exemplo, foi demonstrado que o
heterodímero
SmNR1/SmRXR1 ativa a transcrição em um gene repórter regulado por DR2
(direct repeat 2) em células de mamífero (WU
et al., 2007). Essa transativação sugere que
SmNR1/SmRXR1 pode interagir com co-ativadores da transcrição de mamíferos, e que os co-
ativadores de
S. mansoni devem possuir um mecanismo similar na regulação por esse
heterodímero.
Recentemente algumas proteínas reguladoras de RNs foram isoladas e caracterizadas
em
S. mansoni. Proteínas co-ativadoras com atividade histona acetiltransferase (HAT) -
SmGCN5 (de MORAES MACIEL et al., 2004) e SmCBP1 e SmCBP2 (BERTIN et al., 2006),
o co-ativador arginina metiltransferase
SmPRMT1 (MANSURE et al., 2005), um co-repressor
SmFIP-1 (OGER et al., 2006), a ubiquitina ligase SmSINA (FANTAPPIÉ et al., 2005), e mais
recentemente o co-ativador
SmNCoA-62 (FANTAPPIÉ et al., 2008a). O papel no
remodelamento da cromatina pelos co-ativadores de
S. mansoni tem sido bastante estudado.
Por exemplo, Mansure e colaboradores (2005) demonstraram que
SmPRMT1 é capaz de
metilar a histona H4. As histona acetiltransferas de
S. mansoni, SmGCN5 e SmCBP1 acetilam
histonas livres
in vitro, a primeira acetila as histonas H3 e H2A (de MORAES MACIEL et
al.
, 2004), enquanto a última acetila as quatro histonas que compõem o octâmero, com
preferência pela histona H4 (BERTIN
et al., 2005). Vários estudos têm mostrado uma
associação direta entre a acetilação de histonas e a ativação transcricional (KUO
et al., 1996;
VERDONE
et al., 2005). Além da função enzimática de modificação pós-traducional de
histonas, foi demonstrado que essas proteínas podem interagir com os RNs de esquistossomo
e estão de alguma maneira, envolvidas na regulação transcricional mediada por esses
receptores. Por exemplo,
SmCBP1 interage com o receptor SmFTZ-F1 e promove atividade
transcricional em células de mamíferos (BERTIN
et al., 2006). Em contrapartida o co-
6262
repressor
SmFIP-1 interage com SmFTZ-F1 e inibe a transcrição de forma dose-dependente a
partir do promotor de
SmFTZ-F1 (OGER et al., 2006). SmPRMT1 interage com SRC-1
humana, que por sua vez interage com
SmRXR1, formando um complexo ternário como
conseqüência de um recrutamento seqüencial, possivelmente disparado pela ligação inicial
dos receptores nucleares (MANSURE
et al., 2005).
O estudo dos RNs e suas proteínas regulatórias nos permitirá compreender como essas
proteínas regulam as vias de sinalização no esquistossomo e a relação molecular com seu
hospedeiro. No presente trabalho discutiremos o papel das HATs
SmGCN5 e SmCBP1 na
acetilação de proteínas nucleares (histonas e não-histonas) e o seu provável envolvimento na
regulação transcricional em
S. mansoni
1.6 Proteína “High Mobility Group Box1” (HMGB1)
A proteína “High-mobility group box 1” (HMGB1) é uma das mais abundantes
proteínas nucleares não-histona presente em organismos eucariotos. É uma proteína de baixo
peso molecular (menos de 30kDa) e susceptível à modificações pós-traducionais. As HMGBs
são freqüentemente denominadas como proteínas de “arquitetura”, pois são capazes de
modificar, distorcer ou dobrar a estrutura do DNA livre ou complexado com fatores de
transcrição e/ou histonas (AGRESTI & BIANCHI, 2003). Nesse contexto, têm sido descritas
como proteínas que desempenha múltiplas funções na transcrição, replicação, reparo de DNA,
recombinação gênica e diferenciação celular (BUSTIN, 1996; 2001; THOMAS &
TRAVERS, 2001).
Estruturalmente a HMGB1 humana possui 215 resíduos de aminoácidos organizados
em dois domínios de ligação ao DNA (chamados box A e box B), e uma cauda terminal rica
em resíduos ácidos na porção C-terminal (ULLOA & MESSMER, 2006). É uma proteína
6363
expressa em quase todos os tipos celulares e em diversos organismos (ZIMMERMANN
et al.,
2004). No núcleo, a HMGB1 se liga ao DNA sem especificidade de seqüência, induzindo
dobras na estrutura da dupla hélice de 90° ou mais (BIANCHI, 2004). Essas alterações no
DNA possibilitam o recrutamento e a interação física entre o DNA e vários fatores de
transcrição, incluindo o p53, NF-
κB, RAG1/2 e receptores de hormônios esteróides
(BIANCHI, 2004). Uma vez sintetizada, a HMGB1 está sujeita a diversas modificações pós-
traducionais, como acetilação, fosforilação, metilação, ADP-ribosilação e glicosilação. A
acetilação dos Boxes é funcionalmente importante e influencia na capacidade de ligação ao
DNA, na interação com histonas, e na translocação do núcleo para o citoplasma, além de
prevenir a reentrada da proteína no núcleo (BONALDI
et al., 2003).
Apesar de seu conhecido papel nuclear, a HMGB1 tem sido detectada em diferentes
tecidos de mamíferos tanto no núcleo quanto no citoplasma. Ensaios de imunohistoquímica e
fracionamento celular detectaram altos níveis de HMGB1 no baço, testículo e timo (tanto no
citoplasma quanto no núcleo). Portanto, além de seu papel canônico na manutenção da
estrutura da cromatina, a HMGB1 tem sido descrita como um potente mediador inflamatório
(WANG
et al., 1999). A HMGB1 pode ser secretada no espaço extracelular, atuando como
sinal de perigo e/ou mediador inflamatório, por macrófagos ativos e células dendríticas
maduras por um processo ativo dependente da acetilação da molécula no núcleo (BONALDI
et al., 2003) (figura 18). Alternativamente, a HMGB1 pode ser liberada passivamente por
células necrosadas, representando um sinal de dano no tecido (SCAFFIDI
et al., 2002).
6464
Figura 18: Representação esquemática da movimentação da HMGB1 do núcleo para o
citoplasma.
Após ser acetilada no núcleo a HMGB1 é exportada para o citoplasma da célula, e
secretada para o meio extracelular a partir de vesículas lisossomais modificadas, em células ativadas
por citocinas pró-inflamatórias. Adaptado de Bonaldi, 2003.
1.6.1 HMGB1 de Schistosoma mansoni (SmHMGB1)
Recentemente, foi descrita a proteína HMGB1 de parasitos humanos como
S.
mansoni
, S. japonicum e S. haematobium (GNANAZEKAR et al., 2006; de OLIVEIRA et al.,
2007). A análise da seqüência indica cerca de 40% de similaridade com a proteína HMGB1
de mamíferos e roedores. A HMGB1 de
S.mansoni (SmHMGB1) também possui os domínios
box A e box B, e apresenta somente 7 resíduos de aminoácidos na cauda ácida. Análises de
expressão da
SmHMGB1 mostraram que ela está presente em todos os estágios de vida do
parasito (GNANASEKAR
et al., 2006), inclusive nos ovos de Schsitosoma mansoni,os quais
produzem quantidades abundantes de
SmHMGB1, além de serem capazes de secretar a
proteína. Através das técnicas de “Southern blot” e seqüenciamento de DNA foi possível
identificar uma única cópia do gene da
SmHMGB1 composto por 3 éxons e 2 introns. Além
disso, as propriedades de ligação ao DNA também são bastante similares com a proteína de
mamíferos, onde ela se liga preferencialmente ao DNA superenovelado em relação ao linear,
induz o superenovelamento do DNA na presença de Topoisomerase 1 e a dobra (“bending”)
Núcleo
Citoplasma
Estado ativado
Exportação
Exportação
Secreção
Importação
vesicular
sinalização
Meio
Extracelular
Importação
Estado basal
6565
do DNA. Entretanto, observou-se que o box A sozinho não é capaz de dobrar o DNA e que a
SmHMGB1 possui alta capacidade de dobrar e superenovelar o DNA diferentemente da
proteína humana. (de OLIVEIRA
et al., 2007).
Assim como a HMGB1 de humanos é capaz de induzir a produção de níveis
significativos de citocinas pró-inflamatórias,
SmHMGB1 também desempenha tal papel.
Gananasekar e cols. (2006) mostraram que
SmHMGB1 induz a produção de citocinas pró-
inflamatórias, tais como TNF
, MIP-1, IL-1R, IL-2R and IL-6, em macrófagos
peritoneais de camundongos
. Também como a proteína humana, o papel pró-inflamatório de
SmHMGB1 é desempenhado pelo domínio box B da proteína (GNANASEKAR et al., 2006).
Ainda no mesmo trabalho, os autores mostraram que anticorpos anti-
SmHMGB1 bloqueiam a
secreção de TNF
-induzido por SmHMGB1 por macrófagos de camundongos. Esses dados
sugerem fortemente um papel da
SmHMGB1 em processos inflamatórios.
6666
2 OBJETIVOS
2.1 Objetivo Geral
Clonar e caracterizar funcionalmente proteínas do tipo histona acetiltransferases de
Schistosoma mansoni. Investigar os mecanismos moleculares envolvidos na ativação
transcricional em esquistossomo mediada por receptores nucleares e co-ativadores com
atividade HAT do parasito.
2.2 Objetivos Específicos
Clonagem do co-ativador Gcn5 (histona acetiltransferase) de Schistosoma mansoni.
Caracterização funcional das proteínas codificadas pelos genes SmGcn5 e SmCBP1.
Localização celular de SmGcn5 em vermes adultos de Schistosoma mansoni.
Verificação da interação entre os co-ativadores SmGCN5 e SmCBP1 e os receptores
nucleares
SmRXR1 e SmNR1.
Mapeamento dos domínios ou regiões de interação entre os co-ativadores SmGCN5 e
SmCBP1 e os receptores nucleares SmRXR1 e SmNR1.
Verificação das proteínas nucleares histonas e não-histonas (receptores nucleares e
SmHMGB1) como substratos para a acetilação pelas HATs de Schistosoma mansoni.
Verificação da influência da acetilação da proteína SmHMGB1 na sua função de
superenovelamento de DNA.
Verificação do efeito da acetilação na localização subcelular de SmHMGB1.
6767
3 MATERIAL E MÉTODOS
3.1 Proteínas Utilizadas no Trabalho
As proteínas utilizadas no trabalho (SmHMGB1, SmGCN5 e SmCBP1) tiveram seus
respectivos genes isolados pelo nosso grupo (de OLIVEIRA
et al., 2007; de MORAES
MACIEL
et al., 2004; BERTIN et al., 2006 respectivamente).
As construções utilizadas foram:
SmGCN5 HAT-pGEX4T1; SmCBP1 HAT-
pGEX4T1,
SmGCN5 HAT-pET28a e SmCBP1 HAT-pQE80L; SmHMGB1-pQE80L;
SmHMGB1 CA - pQE80L (sem a cauda ácida); SmHMGB1 box A - pQE80L e SmHMGB1
box B - pQE80L. A expressão e purificação de
SmGCN5 HAT-pGEX4T1 e SmCBP1 HAT -
pGEX4T1 foram realizadas de acordo com o descrito anteriormente (de MORAES MACIEL
et al., 2004). A expressão e purificação das construções de SmHMGB1-pQE80L, SmGCN5
HAT-pET28a e
SmCBP1 HAT-pQE80L foram realizadas de acordo com o manual
ProBond
TM
Purification System, Invitrogen.
3.2 Clonagem de SmHMGB1 em Vetor pEGFP
A construção contendo SmHMGB1 fusionada a GFP (GFP-SmHMGB1) foi realizada
utilizando-se o oligonucleotídeo senso (5’-
AAGCTTATGGCTGAAGACAAGGGTAAG-3’)
(sítio para a enzima de restrição
HindIII está destacado em negrito e o códon de iniciação está
sublinhado) e o oligonucleotídeo antisenso (5’-
GGATCCCTAATCGTCAGACTCTGAAATC-3’) (sítio para a enzima de restrição BamHI
destacado em negrito e o códon de término está sublinhado) em reação de PCR. O produto de
amplificação foi clonado no vetor pCR
®
2.1-TOPO
®
através do sistema TOPO TA Cloning
®
6868
(Invitrogen) conforme o protocolo do fabricante. O DNA plasmidial, purificado utilizando-se
Wizard
®
Plus SV Minipreps DNA Purification System (Promega), foi digerido com as
enzimas de restrição
HindIII e BamHI (Promega) e o inserto liberado foi subclonado no vetor
pEGFP-C3 (Clontech), previamente digerido com as mesmas enzimas de restrição. A
subclonagem foi feita através de reação de ligação utilizando-se a enzima T4 DNA Ligase
(Invitrogen) conforme o protocolo do fabricante.
3.3 Análise da Organização Genômica de SmGCN5 e SmCBP1
As buscas de contigs para montagem dos genes completos de SmGCN5 e SmCBP1
foram feitas com as seqüências dos respectivos cDNAs. Os bancos de dados genômicos do
Schistosoma mansoni usados foram Wellcome Trust Sanger Institute
(http://www.sanger.ac.uk/projects/S_mansoni/) e TIGR
Schistosoma mansoni Genome
Project (http://www.tigr.org/tdb/e2k1/sma1).
3.4 Ensaios de Acetilação in vitro
3.4.1 Acetilação de Histonas por SmCBP1
As reações de acetilação foram realizadas de acordo com YAO e cols. (2001),
conforme descrito em de MORAES MACIEL e cols.(2004). Para o ensaio de acetilação das
histonas H3 e H2A pela proteína
SmCBP1 foi utilizada a construção, como proteína de fusão,
SmCBP1 HAT-pQE80L. As reações de acetilação incluíram 0,25 Ci de
3
H Acetil CoA
(Amersham Biosciences), 5
g das histonas H3 ou H2A como substratos, tampão de reação
(50 mM KCl; 50 mM Tris-HCl, pH 8,0; 1 mM DTT; 0,1 mM EDTA; 5% glicerol; 1 mM
6969
PMSF) e 1
g da proteína de fusão de SmCBP1 HAT-pQE80L. As reações foram feitas em
volume final de 30
L a 30
o
C. Após uma hora de incubação as reações foram paradas com
tampão de SDS-PAGE 1x e as amostras fracionadas em gel de poliacrilamida desnaturante
(SDS-PAGE). O gel foi corado com Comassie Brilliant Blue R-250, descorado com 10%
ácido acético e 45% metanol e incubado com 1M salicilato de sódio, pH 6,0 (adicionando-se
NaOH) por uma hora. O gel foi seco e exposto ao filme de autoradiografia MXG/PLUS
(Kodak), por 16h a -70
o
C.
3.4.2 Identificação dos Resíduos de Lisina Acetilados
Peptídeos baseados na região N-terminal das histonas H3 de mamíferos (figura 21 A)
foram desenhados substituindo-se os resíduos de lisina 9, 14 ou 18 por resíduos de alanina, e
denominados H3/WT (selvagem), H3/K9A, H3/K14A e H3/K18A. A região N-terminal da
histona H4 também foi produzida, mas sem nenhuma mutação. Tanto os peptídeos H3 como
H4 foram submetidos a ensaios de acetilação realizados nas mesmas condições descritas no
subitem 3.4.1. Os peptídeos acetilados foram submetidos à eletroforese em SDS-PAGE,
fluorografia e revelados conforme descrito anteriormente.
3.4.3 Acetilação das construções de SmHMGB1
Nos ensaios de acetilação foram utilizadas como substratos as proteínas de fusão:
SmHMGB1, SmHMGB1 ΔCA, SmHMGB1 box A, SmHMGB1 box B e GST como controle
de proteína irrelevante; todas com massa equivalente a 5
μg. Os ensaios de acetilação foram
realizados utilizando-se 1
g das proteínas recombinantes SmGCN5 HAT-pET28a ou
7070
SmCBP1 HAT-pQE80L. As reações de acetilação foram realizadas de acordo com o descrito
no item 3.4.1.
3.5 Ensaios de Superenovelamento de DNA
O plasmídeo pTZ19R (Fermentas) na sua forma superenovelada foi relaxado pela
Topoisomerase I (Topo I) de trigo (Promega) em tampão de reação (50 mM NaCl; 50 mM
Tris, pH 7,5; 1 mM EDTA; glicerol a 20% e 1 mM DTT). A reação contendo 0,6
g do
plasmídeo e 1 U de Topo I foi realizada a 37 °C por 90 min. Ao DNA relaxado foram
adicionadas as formas acetiladas e não acetiladas das proteínas de fusão
SmHMGB1 e
SmHMGB1 CA, mais 1 U de Topo I, 20 mM DTT, 20% glicerol e mais tampão de reação. A
mistura foi colocada a 37 °C por mais 60 min e a reação inibida com a adição de 460
L de
uma solução contendo 1% SDS e 1 M NaCl. Após a desnaturação do complexo, o DNA foi
extraído com 700
L de clorofórmio/álcool isoamílico (24:1) e precipitado por 1 min em
nitrogênio líquido com 2,5 volumes de etanol na presença de 0,02% poliacrilamida linear.
Após a precipitação as amostras foram centrifugadas por 30 min a 16000 x g a 4 °C. O DNA
precipitado foi lavado em 1 mL de etanol 70% e centrifugado como descrito acima. Após
secar em temperatura ambiente o DNA foi ressuspendido em 25
L de 1 X TE (10 mM Tris,
pH 7,5 e 1 mM EDTA) e fracionado em gel de agarose 1% em 1 X TBE a 3 V/cm por 18
horas. O gel foi corado com 0,5
g/mL de brometo de etídeo por 1h, descorado em água por
1h e fotografado através de filtro vermelho em transiluminador de luz ultravioleta (254 nm)
no sistema ImaGo (L&B Systems).
Para as reações de acetilação foram utilizadas as enzimas
SmGCN5 HAT-GST e
SmCBP1 HAT-GST, ligadas na resina de Glutationa por 16h, a 4 °C, sob agitação. Após a
ligação as resinas foram lavadas três vezes em PBS 1x, e então se seguiram as reações. As
7171
proteínas de fusão (
SmHMGB1 e SmHMGB1 ΔCA) adicionadas às enzimas ligadas nas
resinas foram acetiladas como descrito no subitem 3.4.3. As construções não acetiladas
sofreram as mesmas condições da reação de acetilação excluindo-se a adição do ³H Acetil-
CoA. Apenas o sobrenadante da reação foi retirado e a proteína presente foi dosada por
Bradford. Após a dosagem quantidades equivalentes de massa das proteínas foram utilizadas
nas reações de superenovelamento.
3.6 Cultura de Células e Transfecção
Foram cultivadas 2 x 10
5
células HeLa por poço em meio de cultura DMEM
(Dulbecco’s modified Eagle’s medium) suplementado com soro fetal bovino 10%. No dia
seguinte diluiu-se 1
g do DNA (plasmídeo GFP-SmHMGB1 ou pEGFP-C3) em 50 L de
meio sem soro. À mistura foram adicionados 4
L de PEI (polyethylenimine – Polysciences)
1 mg/mL e misturados vigorosamente. Após 10 min. em temperatura ambiente, a mistura
contendo o DNA foi adicionada ao poço contendo as células. Vinte e quatro horas após a
transfecção as células foram submetidas ao tratamento com 10 mM butirato de sódio (inibidor
de desacetilases) por 30h. O controle foi realizado com as células contendo GFP-
SmHMGB1
ou apenas GFP sem o tratamento com butirato de sódio.
3.7 Expressão e Localização de GFP-SmHMGB1 em Células HeLa
As células expressando GFP-SmHMGB1 ou apenas GFP, tanto as tratadas quanto os
controles, foram fixadas em paraformaldeído 4%, por 10 min a temperatura ambiente. Após a
fixação as células foram lavadas em PBS 1x e permeabilizadas em triton X-100 0,1% por 5
min. O núcleo foi corado com DAPI por 5 min. e as células montadas em lâmina para análise
7272
em microscópio de fluorescência. As imagens foram obtidas em microscópio invertido Zeiss
axiovert com 40X de aumento, fotografadas com câmera Hammamatsu. A sobreposição de
imagens DAPI (imagem em azul) e fluorescência GFP (imagem em verde) foi feita no
programa Imagej.
7373
4 RESULTADOS
4.1 Organização Genômica de
SmCBP1 e SmGCN5
As seqüências completas dos cDNA de SmCBP1 e de SmGCN5 usadas para busca nos
bancos de dados têm 6282 e 2700 pares de base (pb) e codificam para as proteína de 2093 e
899 aminoácidos, respectivamente. O gene
SmCBP1 possui 8 exons (figura 19 A), enquanto o
gene
SmGCN5 contém 13 exons (figura 19 B). Os genes SmGCN5 e SmCBP1 apresentam
uma região 5’ UTR de 102 e 124 pb e 3’ UTR com 217 e 840 pb, respectivamente. O sinal
putativo de poliadenilação “AATAAA” de
SmGCN5 localiza-se a 11 pb acima da cauda poli-
A. Em
SmCBP1 esse sinal não pode ser identificado. Os sítios doadores e aceptores de
“splice” dos exons de
SmGCN5 e SmCBP1 estão de acordo com o consenso estabelecido: GT
na extremidade 5’ do intron e AG na extremidade 3’ (tabela 2).
Figura 19: Esquema comparativo dos cDNAs com as estruturas dos genes de SmCBP1 e
SmGCN5. Representação esquemática dos domínios funcionais dos co-ativadores SmCBP1 (A) e
SmGCN5 (B) e suas organizações de intron/exon. Os exons estão indicados por “boxes”, com seus
respectivos números de pares de base. Os domínios funcionais estão indicados com seus respectivos
nomes imediatamente abaixo da representação esquemática.
A
B
7474
Tabela 2: Tamanhos dos introns e exons, sítios convergentes doadores e aceptores de splice nos
genes
SmCBP1 e SmGCN5.
4.2 Acetilação de Histonas pelo Domínio HAT de SmCBP1
As proteínas da família CBP possuem atividade de histona acetiltransferase e são
capazes de acetilar as quatro histonas do centro do nucleossoma, em experimentos
in vitro
(BANNISTER & KOUZARIDES, 1996). A atividade HAT de SmCBP1 já foi demonstrada
utilizando como substrato uma mistura contendo as quatro histonas (BERTIN
et al., 2006).
Nesse trabalho,
SmCBP1 mostrou ter preferência por acetilar a histona H4 presente na
mistura. No presente trabalho nós confirmamos a atividade HAT de
SmCBP1 utilizando as
histonas livres H3 e H2A, separadamente (figura 20). A partir da confirmação da atividade
catalítica da referida enzima pudemos prosseguir com os ensaios subseqüentes de
mapeamento da acetilação da lisina alvo presente na histona H3, e acetilação de outras
proteínas não-histona, como a
SmHMGB1.
7575
1 2
Figura 20: Atividade de histona acetiltransferase de SmCBP1. O painel superior mostra a auto-
radiografia das reações de acetilação: as setas indicam as histonas H3 e H2A acetiladas pelo domínio
HAT de
SmCBP1. Os asteríscos indicam a auto-acetilação de SmCBP1 HAT. O poço 1 contém a
histona H3 acetilada por
SmCBP1 HAT. O poço 2 contém a histona H2A acetilada por SmCBP1 HAT.
O painel inferior mostra o gel de poliacrilamida das reações de acetilação: as setas indicam as posições
das histonas H3 e H2A.
4.3 Mapeamento do Resíduo de Lisina da Histona H3 Acetilado por SmCBP1
A função enzimática de histona acetiltransferase ocorre através da acetilação de um ou
mais resíduos de lisina presentes na cauda N-terminal das histonas (LOIDL, 1994). Dentro do
octâmero de histonas essas regiões estão expostas no contexto do domínio globular do
nucleossoma. Portanto, acredita-se que as histonas se ligam ao DNA através de interação de
cargas (FLETCHER & HANSEN, 1995
; LUGER et al., 1997). Para identificar qual resíduo de
lisina presente na cauda da histona H3 é capaz de ser acetilado pela
SmCBP1 ensaios de
acetilação foram realizados. Para tal, utilizamos peptídeos baseados na região N-terminal da
histona H3, substituindo-se individualmente cada lisina por resíduos de alanina, e como
controle positivo o peptídeo baseado na região N-terminal da histona H4 com todas as lisinas
presentes (figura 21 A). Observando-se a auto-radiografia (figura 21 B) pode-se verificar forte
7676
marcação correspondente a acetilação apenas para os peptídeos H3/WT, H3/K9A e H3/K18A,
enquanto o peptídeo H3/K14A não foi acetilado pelo domínio HAT de
SmCBP1 (figura 21
B). Conclui-se, portanto, que o resíduo de lisina 14 da histona H3 é o sítio para acetilação de
SmCBP1 HAT. Esses dados nos mostram a especificidade da reação de acetilação pelo
domínio catalítico de
SmCBP1. Mostramos ainda que apenas a região N-terminal da histona
H4 é o suficiente para a acetilação pelo domínio HAT de
SmCBP1.
Figura 21: Determinação da lisina acetilada da histona H3 por SmCBP1. (A) Peptídeos da região
N-terminal da histona H3 tiveram seus resíduos de lisina substituídos por alaninas nas posições 9, 14
ou 18. O peptídeo da histona H4 foi mantido intacto. (B) Painel superior: auto-radiografia mostrando
que não houve acetilação do peptídeo H3/K14A por
SmCBP1, concluindo-se que a lisina 14 da região
N-terminal da histona H3 é o sítio de acetilação pela
SmCBP1 HAT. SmCBP1 HAT também é capaz
de acetilar a região N-terminal da histona H4. Painel inferior: gel de poliacrilamida das reações de
acetilaçãos.
4.4 Acetilação in vitro das Diferentes Construções da SmHMGB1
De acordo com os trabalhos publicados recentemente (BONALDI et al., 2003), a hiper-
acetilação da HMGB1 de mamíferos é um processo bastante importante na sua relocalização
do núcleo para o citoplasma e posterior saída da célula, onde irá atuar como mediador pró-
A
B
7777
inflamatório. No presente trabalho mostramos que a proteína
SmHMGB1 inteira é substrato
para a acetilação tanto por
SmGCN5 quanto por SmCBP1 (figura 22 A e B, poço 1,
respectivamente). Quando retiramos a cauda ácida da proteína a intensidade de acetilação
parece ser maior para ambas as HATs (figura 22 A e B, poço 2), sendo que para
SmGCN5
esse efeito é maior. Utilizando apenas os boxes de
SmHMGB1 nós pudemos verificar que a
acetilação ocorre especificamente no box B (figura 22 A e B, poço 4).
SmHMGB1 e o box B
dessa proteína de
S. mansoni são potentes indutores de secreção de TNF por macrófagos,
enquanto o box A não é capaz de induzir essa secreção (GNANAZEKAR
et al., 2006).
Possivelmente a acetilação específica no box B de
SmHMGB1 seja um mecanismo de
modificação pós-traducional envolvido no papel inflamatório observado por Gnanazekar e
cols. (2006).
Figura 22: Acetilação da SmHMGB1 por duas histona acetiltransferases de S. mansoni. (A)
Acetilação por
SmGCN5 HAT 1-4: Acetilação das construções de SmHMGB1. 5: Acetilação da
proteína GST como controle de proteína irrelevante. (B) Acetilação por
SmCBP1 HAT 1-4: Acetilação
das construções de
SmHMGB1. 5: Acetilação da proteína GST como controle de proteína irrelevante.
(A e B) Painéis superiores: géis do ensaio de acetilação corados com Coomassie blue. Painéis
inferiores: auto-radiografia das reações de acetilação. (C) Representação esquemática dos domínios da
proteína
SmHMGB1, indicando o box A, box B e a cauda ácida (CA). Os asteriscos correspondem a
autoacetilação de SmCBP1 HAT.
*
*
*
*
*
*
*
*
7878
4.5 Influência da Acetilação de SmHMGB1 na Atividade de Superenovelamento de
DNA
Várias evidências demonstram que a transcrição deve ser regulada através da acetilação
de proteínas não-histona (KOUZARIDES, 2000). Os estudos mostram que essa modificação
pós-traducional resulta em diferentes efeitos na ligação ao DNA (GU & ROEDER, 1997
;
HERRERA et al., 1999; MARTINEZ-BALBAS et al., 2000; MARZIO et al., 2000; BOYES
et al., 1998). Estudos com HMGB1 fisiologicamente acetilada (células crescidas na presença
de butirato) mostraram uma monoacetilação da lisina 2, na região N-terminal da proteína. O
resultado dessa monoacetilação foi um aumento na afinidade de ligação da proteína a
estruturas de DNA distorcidas (UGRINOVA
et al., 2001). No entanto, a capacidade de
induzir modificações na ligação ao DNA pela HMGB1 acetilada depende da localização da
lisina modificada na molécula (KOUZARIDES, 2000).
No presente trabalho investigamos de que maneira a acetilação da
SmHMGB1 pelas
HATs
SmGCN5 e SmCBP1 pode influenciar sua atividade de superenovelamento de DNA.
Para tal, usamos tanto a proteína inteira quanto a proteína sem a cauda ácida, acetiladas ou
não acetiladas pelas duas HATs de
S. mansoni (figuras 23 A e 24 A) em ensaios de
superenovelamento de DNA. Esses ensaios mostraram que ambas as proteínas são capazes de
promover o superenovelamento do DNA relaxado, independentemente da modificação pós-
traducional sofrida (figura 23 B e 24 B). Portanto, a acetilação, por ambas as histona
acetiltransferses de S
. mansoni, da proteína SmHMGB1 não altera sua atividade de
superenovelamento de DNA plasmidial relaxado.
7979
Figura 23: Influência da acetilação por SmGCN5 HAT na indução do superenovelamento de
DNA plasmidial pela
SmHMGB1. (A) Ensaio de acetilação de SmHMGB1 inteira (I) e SmHMGB1
sem a cauda ácida (
CA). (B) Superenovelamento de DNA plasmidial relaxado induzido pelas
construções de
SmHMGB1 acetiladas e não acetiladas. 1: controle positivo do DNA superenovelado.
2: controle negativo do DNA superenovelado relaxado na presença da topoisomerase. 3-5:
SmHMGB1 inteira acetilada (SmHMGB1 Ac.). 6-8: SmHMGB1 inteira não acetilada (SmHMGB1). 9-
11
: SmHMGB1 sem a cauda ácida acetilada (SmHMGB1 CA Ac.). 12-14: SmHMGB1 sem a cauda
ácida
não acetilada (SmHMGB1 CA). R - DNA plasmidial relaxado. SE - DNA plasmidial
superenovelado. Todos os experimento foram feitos em triplicata e repetidos por pelo menos 3 vezes.
8080
Figura 24: Influência da acetilação por SmCBP1 HAT na indução do superenovelamento de
DNA plasmidial pela
SmHMGB1. Para descrição da figura vide legenda da figura 23.
4.6 Localização Celular de SmHMGB1
Estudos vêm mostrando que a modificação pós-traducional de acetilação é capaz de
promover o transporte da proteína
SmHMGB1 do núcleo para o citoplasma, e a subseqüente
saída da célula para atuação como uma citocina (BONALDI
et al., 2003). Através de
microscopia de fluorescência mostramos que células HeLa transfectadas com GFP-
SmHMGB1 apresentam essa proteína exclusivamente no núcleo (figura 25 A). Após
tratamento dessas células com butirato de sódio, um inibidor de histona desacetilases, a
proteína foi encontrada tanto no núcleo como no citoplasma (figura 25 B). Esses dados
sugerem que a acetilação da
SmHMGB1 participa na mobilidade da proteína na célula e
possivelmente na atuação da mesma como citocina pró-inflamatória. O controle realizado
8181
com células transfectadas apenas com o vetor pEGFP mostra a presença dessa proteína tanto
no citoplasma quanto no núcleo em ambos os tratamentos (figura 25 C e D). Essa observação
se deve ao fato de que a proteína GFP tem livre trânsito dentro da célula.
Figura 25: Transporte celular de SmHMGB1 na presença de um inibidor de histona
desacetilases.
Células HeLa transfectadas com GFP-SmHMGB1 ou apenas GFP e incubadas na
presença ou ausência de butirato de sódio 10mM por 30 h. (A) Células transfectadas com GFP-
SmHMGB1, sem o tratamento com butirato de sódio, apresentam a proteína SmHMGB1
exclusivamente no núcleo. (B) Células transfectadas com
SmHMGB1 tratadas com butirato de sódio
apresentam a proteína
SmHMGB1 tanto no núcleo quanto no citoplasma. (C e D) Controles de células
transfectadas com o vetor pEGFP, não tratadas ou tratadas com butirato de sódio, respectivamente. A
proteína GFP encontra-se tanto no núcleo como no citoplasma em ambos os painéis.
82
4.8 Resumo do Trabalho 1: “Schistosoma mansoni histone acetyltransferase GCN5:
linking histone acetylation to gene activation”
Renata de Moraes Maciel
, Denis Luis da Silva Dutra, Franklin David Rumjanek, Luiz
Juliano, Maria Aparecida Juliano, Marcelo Rosado Fantappié
Atividades relacionadas ao DNA como transcrição, replicação e reparo, estão
associadas com alterações na estrutura da cromatina e nucleossomos. A descoberta e
caracterização da maquinaria modificadora de cromatina sugeriu que ela influencia
drasticamente a atividade transcricional em outros sistemas e é possível que seja importante
em parasitas helmintos também. Essas mudanças estruturais são em parte mediadas pela
acetilação reversível da região amino terminal das histonas. Vários estudos têm demonstrado
uma correlação direta entre a ativação transcricional da cromatina e o estado de acetilação das
histonas. No presente trabalho foi clonado um cDNA que codifica para a histona
acetiltransferase de
Schistosoma mansoni (SmGcn5). O gene do esquistossomo tem uma
seqüência aberta de leitura de 2697 nucleotídeos, traduzindo em uma proteína de 899
aminoácidos. A proteína GCN5 do esquistossomo (
SmGCN5) contém alta similaridade com
outras proteínas GCN5-relacionadas tanto no domínio HAT (93,4% de similaridade) como o
bromo (96,7% de identidade). Surpreendentemente, flanqueando o domínio HAT, foram
encontradas duas seqüências novas não descritas em outras proteínas GCN5-relacionadas. A
região flanqueadora N-terminal contém uma seqüência adicional de 71 aminoácidos (aa 310–
381), enquanto na região C-terminal uma seqüência adicional de 66 aminoácidos (aa 677–
743) foi encontrada. Mostrou-se, por "Northern blot", que
SmGcn5 é constitutivamente
expresso em vermes maduros e imaturos, tanto macho como fêmea. Foram expressos
separadamente, como proteínas de fusão de
SmGCN5, os domínios HAT (aa 436-652) e
bromo (aa 787-898), uma região N-terminal (aa 1-148) e outra região N-terminal contendo o
motivo de interação (LXXLL) com receptores nucleares (aa 161-287). Mostrou-se por ensaios
83
de acetilação in vitro que o domínio HAT de SmGCN5 e apenas ele é suficiente para
promover a acetilação específica das histonas H3 e H2A. Por espectrometria de massa
demonstrou-se ainda, utilizando peptídeos sintéticos baseados na região N-terminal da histona
H3, que H3 é acetilada em um único resíduo de aminoácido.
A ligação estabelecida entre
SmGCN5 e a acetilação de histonas fornece um exemplo
claro da relação entre a expressão gênica e a estrutura da cromatina. Nossos achados também
levantam a hipótese de um envolvimento de
SmGCN5 na regulação de genes alvo através da
ação de receptores nucleares do esquistossomo.
Molecular & Biochemical Parasitology 133 (2004) 131–135
Short communication
Schistosoma mansoni histone acetyltransferase GCN5:
linking histone acetylation to gene activation
ଝ
Renata de Moraes Maciel
a
, Denis Luis da Silva Dutra
a
, Franklin David Rumjanek
a
,
Luiz Juliano
b
, Maria Aparecida Juliano
b
, Marcelo Rosado Fantappié
a,∗
a
Departamento de Bioqu´ımica Médica, ICB/CCS, Universidade Federal do Rio de Janeiro, Ilha do Fundão, Rio de Janeiro 21941-590, Brazil
b
Departamento de Biof´ısica, Escola Paulista de Medicina, Universidade Federal de São Paulo, Rua Trˆes de Maio, 100, São Paulo 04044-020, Brazil
Received 16 July 2003; accepted 10 September 2003
Keywords: Schistosoma mansoni; Histone acetylation; Gene regulation; Nuclear receptors
Unlike prokaryotes, the genomes of eukaryote are pack-
aged into the chromatin structure. Biochemical and genetic
studies have demonstrated in vitro and in vivo that transcrip-
tional initiation is inhibited on chromatin templates, since
nucleosomes limit the access of sequence-specific activa-
tors, co-activators, and polymerase II basic transcriptional
machinery to the DNA templates. Thus, relaxation of the
tight association between DNA and histones at the nucleo-
somal level through chromatin remodeling is a prerequisite
for gene expression [1,2].
It is now clear that chromatin remodeling and gene ex-
pression require the recruitment of histone acetyltransferases
(HATs). These enzymes are capable of acetylating specific
lysinesresidues at the N-terminal tailsof core histones. It fol-
lows that remodeling is also dependent on histone deacety-
lases [3,4].
A major advance in understanding the connection be-
tween histone acetylation and gene transcription came with
the cloning of the first transcription-associated HAT from
Tetrahymena [5]. This gene shares significant homology
with the Saccharomyces cerevisiae adapter GCN5 (for gen-
eral control nonrepressed), a well studied yeast protein orig-
inally defined by genetic analysis as being required for full
activity of a subset of transcriptional activators [6,7]. GCN5
acetylates in vitro specific lysines yielding a pattern as-
sociated with transcriptionally active chromatin [8]. More-
over, the HAT activity of GCN5 is required for activation of
GCN5-responsive genes in vivo [9,10]. Together, these stud-
ଝ
Note: Nucleotide sequence data reported in this paper is available in
the GeneBank
TM
, under the accession number AY337317.
∗
Corresponding author. Tel.: +55-21-2562-6759;
fax: +55-21-2270-8647.
E-mail address: [email protected] (M.R. Fantappi
´
e).
ies strengthened the role of histone acetylation in enhanced
gene transcription [11].
Human homologues of GCN5 have been cloned and
were shown to have HAT activity [10,12]. One homolog
(hGCN5-S, a spliced variant) displayed the same structural
organization as the Tetrahymena thermophila [5] and S.
cerevisiae [9] proteins. Two other homologues (hPCAF
and hGCN5-L), although highly similar to hGCN5-S, con-
tain an unique N-terminal extension required for binding
CREB-binding protein (CBP) [13] and the related p300
[14]. CBP/p300 are transcriptional co-activators that in-
teract with a large number of developmentally important
transcription factors [15]. CBP/p300 were also shown to
have intrinsic HAT activity [16].
PCAF and CBP are also found in a complex with a third
familyof HATs, the hormone receptor co-activators SRC and
ACTR [17,18]. In addition, PCAF has been shown to play a
central role in nuclear receptor function [19]. In this context,
it has been shown that hGCN5 physically interacted with the
nuclear receptor steroidogenic factor-1 (SF-1) and also that
hGCN5-acetylated SF-1 in vitro [20]. Moreover, acetylation
by hGCN5 enhanced SF-1 mediated transactivation [20].
In an attempt to identify Schistosoma mansoni fac-
tors involved in chromatin remodeling we searched the S.
mansoni-expressed sequence tag (EST) database (TIGR).
In this work we cloned and characterized the HAT activity
of the S. mansoni GCN5 protein homolog.
The schistosome EST database search revealed the
presence of a cDNA of 517 bp (GeneBank accession
number AW017225) exhibiting significant homology to
p300/CBP-associated factor (PCAF). A S. mansoni adult
worm-cDNA ␭-Zap II library was screened using the pu-
tative schistosome PCAF probe. We isolated a clone that
shared high homology to Drosophila GCN5 [21]. The S.
0166-6851/$ – see front matter © 2003 Elsevier B.V. All rights reserved.
doi:10.1016/j.molbiopara.2003.09.005
132 R. de Moraes Maciel et al./ Molecular & Biochemical Parasitology 133 (2004) 131–135
Fig. 1. Amino acid sequence alignment of Schistosoma mansoni GCN5 with other GCN5-related proteins. Accession numbers: ggGCN5: BAB59137;
DmGCN5: AAC39102.1; hsGCN5: NP
066564.1; hsPCAF: S71788; mmPCAF: NP 064389.1; SmGCN5: AY337317; yGCN5: X68628. Alignments were
performed using Clustaw algorithm. Identical amino acid residues occupying the same position are shaded in black. The two most conserved domains,
the HAT domain and the bromodomain are boxed in red and blue, respectively. The LXXLL motif is highlighted in a blue box (SmGCN5, amino acids
249–253). Note the two extra stretches of amino acids present only in SmGCN5 sequence (N-terminus: amino acids 310–381; C-terminus: amino acids
677–743).
R. de Moraes Maciel et al./ Molecular & Biochemical Parasitology 133 (2004) 131–135 133
mansoni GCN5 (SmGCN5) encoded a deduced translated
open reading frame of 899 amino acids (Fig. 1). Sequence
comparison analysis of the predicted SmGCN5 with various
GCN5-related proteins showed two regions of close similar-
ity, the HAT domain and the bromodomain, shown in Fig. 1.
The catalytic domain of histone acetyltransferases cat-
alyzes the transfer of an acetyl moiety from acetyl-CoA to
the ε-amino group of lysine residues in the N-terminal re-
gion of histones [22]. The bromodomain is found in nu-
merous co-activators, although its functional role is still
speculative. Nevertheless, the bromodomain seems to par-
ticipate in the catalysis process itself and consequently, in
protein–protein interactions directly relevanttothe transcrip-
tion [23].
Amino acid sequence comparison between SmGCN5 and
six GCN5-related proteins (Fig. 1) revealed the most signif-
icant homology in the HAT domain. This corresponded to
approximately 93.4% (34% identity). The homology in the
bromodomain was slightly higher (96.7 and 36.1% identity).
Nevertheless, the residues previously noted to be conserved
between yeast GCN5 and other transcriptional factors [24]
were also conserved in SmGCN5 (Fig. 1).
Surprisingly, the N-terminal region of SmGCN5 contained
an additional sequence of 71 amino acids (aa 310–381) not
found in other GCN5-related proteins (Fig. 1). This was also
the case of an additional 66 amino acids (aa 677–743) found
in the C-terminus of the protein, which is only present in
the schistosome GCN5.
A significant finding regarding schistosome GCN5 was
the presence of a LXXLL motif (aa 249–253). The LXXLL
motif (where L is a leucine and X is any amino acid), is asig-
nature sequence found in all nuclear receptor co-activators
and is necessary and sufficient to mediate association of
co-activators to ligand-bound receptors [25]. The fact that S.
mansoni GCN5 protein contained such a motif was highly
significant, considering the recent cloning and characteriza-
tion of three members of the nuclear receptor super-family in
S. mansoni [26–29]. By considering that nuclear receptors in
S. mansoni may be involved in female-specific gene regula-
tion [26,27], the identification of the SmGCN5 co-regulator
is of obvious importance.
The calculated molecular mass of SmGCN5 was
103.7kDa. Northern blot analysis revealed a single message
of ∼2.7kb (Fig. 2), consistent with an open reading frame
of 2.697bp (Fig. 1). The message was detected in both, ma-
ture and immature male and female worms, indicating that
in the adult stages, SmGCN5 is constitutively expressed.
By assuming that GCN5 proteins may act remodeling the
chromatin, it can be predicted that the schistosome GCN5
protein is widely distributed throughout development. In-
deed, it has been shown that Drosophila and maize GCN5
proteins are ubiquitously expressed in all developmental
stages [30,31].
The yeast GCN5 (yGCN5) HAT exhibits a strong pref-
erence for acetylation of lysine 14 of histone H3 in vitro.
In vivo, yGCN5 has been reported to acetylate lysine 9 as
Fig. 2. Northern blot analysis of SmGCN5. Five micrograms of total RNA
from adult mature and immature male and female worms were separated
on a 1% agarose–formaldehyde gel, transferred to a nylon membrane
and probed with a random primed
32
P-labeled SmGCN5 cDNA probe
(517bp). A 2.7kb transcript was detected in all stages (top panel). The
blot was reprobed for the GAPDH message as a constitutive-gene control
(bottom panel).
well. Besides, yGCN5 acetylates lysine 18 of histone H3,
residues 8 and 16 of histone H4, and lysine residues in the
N-terminus of histone H2B, albeit to a much lesser degree
than lysine 14 of histone H3 [22].
The remarkably high degree of similarity between
S. mansoni GCN5 and yGCN5 (Fig. 1) suggests that
SmGCN5 contains HAT activity. To test this hypothesis,
we cloned and expressed the HAT catalytic domain alone
(as a thioredoxine/his-tag fusion) for in vitro acetylation
assays (Fig. 3A). As a control, the acetylation reactions
also included constructs containing part of the N-terminus
(GST-fusion) and the bromodomain (thioredoxine/his-tag
fusion) of SmGCN5 (Fig. 3A). As expected, and in agree-
ment with other GCN5 family members [8], only the
construct containing the HAT domain of SmGCN5 acety-
lated histone H3 (Sigma). Curiously, the HAT domain of
SmGCN5 was also able to acetylate histone H2A (Sigma)
(Fig. 3A). To our knowledge, this is the first demonstration
that a GCN5 homologue acetylates histone H2A. Con-
textually, it will be important to determine whether the
two additional and exclusive regions (aa 310–381 and aa
677–743) of SmGCN5 play a role on the specificity for
histone substrates.
SmGCN5 did not show any acetylation activity when an
irrelevant peptide, containing three lysines, was used as a
substrate (data not shown). It is worth mentioning that the
catalytic HAT domain alone of SmGCN5 contained all the
sequences required for full HAT activity. More importantly,
the HAT domain revealed specificity for histone H3 and
H2A in vitro (Fig. 3A). We also showed that histone H4 was
poorly acetylated by SmGCN5 (data not shown).
In order to gain further understanding into the mechanism
of SmGCN5, we carried out acetylation reactions using a 20
amino acid-synthetic peptide whose sequence was derived
from the amino terminus of histone H3. The analysis was
carried out by mass spectrometry.
The spectra in Fig. 3B showed that SmGCN5 HAT domain
was able to acetylate the histone H3 peptide. Moreover, the
mass spectra revealed a single peak of acetylation, indicating
that histone H3 was monoacetylated by SmGCN5 (Fig. 3C,
bottom panel).
134 R. de Moraes Maciel et al./ Molecular & Biochemical Parasitology 133 (2004) 131–135
Fig. 3. HAT activity of SmGCN5. In vitro acetylation reactions were carried out using Histone H3 and Histone H2A (Sigma) as substrates. Reactions con-
taining the substrates and 1␮g of purified GST-SmGCN5-N-terminal domain (aa 1–148), his-tag-SmGCN5 HAT domain (aa 439–652) and his-tag-SmGCN5
bromodomain (aa 787–899) were incubated at 30
◦
C for 1h with 0.25 ␮Ci of [
3
H] acetyl coenzyme A ([
3
H] acetyl-CoA) (Amersham Biosciences) in 30␮l
of acetylation buffer (50 mM Tris–HCl; pH 8.0), 5% glycerol, 0.1mM EDTA, 50mM KCl, 1 mM DTT, and 0.1 mM PMSF. Proteins were fractionated
by SDS–PAGE, fixed by Coomassie blue staining and subjected to fluorography with 1M salycilic acid for 1 h. The dry gel was exposed to X-ray film.
For subsequent mass spectrometry analysis, 0.5pmol of histone H3-amino terminal related peptide (ARTKQTARKSTGGKAPRKCL) was acetylated in
acetylation buffer for 1h with [
3
H] acetyl coenzyme A, and analyzed in a mass spectrometer MALDI-TOF Voyager DE-PRO (Applied Biosystems). (A)
Top panel: autoradiography of the acetylation reactions: the arrow indicates acetylated histone H3 and histone H2A by SmGCN5 HAT domain. Fusion
proteins alone (GST (pGEX-4T1; Amersham Biosciences) and thioredoxine-his-tag (pET 32a+; Novagen)) were used in acetylation reactions as negative
controls. (A) Bottom panel: Coomassie blue stained gel from the acetylation assay. The arrows indicate the positions of histone H3 and histone H2A. (B
and C) Determination of the number of acetylated lysines by mass spectrometry. Two populations of the peptide were seen in the mass spectra (2158
m/z, representing the original peptide, and 2055 m/z,representing a truncated form of the peptide). The peaks marked by asterisks represent the truncated
form of the peptide, lacking the cysteine residue at position 19 of the peptide). Both populations were acetylated by SmGCN5 HAT (panel C), as shown
by the higher molecular mass of the peptides, which included the 41 Da corresponding to the acetyl group (arrows, indicate monoacetylation).
The importance of chromatin remodeling in the control of
gene expression in S. mansoni has not yet been investigated.
In the past few years, the role of chromatin has emerged at
the forefront of transcription research [31]. Discovery and
characterization of the chromatin modifying machinery sug-
gested that it drastically influenced transcriptional activity in
other systems and it is likely to be important in helminthes
parasites as well.
The link we have established between SmGCN5 and his-
tone acetylation provides a clear illustration of the relation-
R. de Moraes Maciel et al./ Molecular & Biochemical Parasitology 133 (2004) 131–135 135
ship between gene expression and chromatin structure. Our
findings also raised the possibility that SmGCN5 might be
involved in the regulation of target genes through the action
of schistosome nuclear receptors.
Acknowledgements
This research received financial support from Con-
selho Nacional de Desenvolvimento Cientifico e Tecno-
logico, CNPq-PROFIX No. 540002/01-1 and UNDP/World
bank/World Health Organization/TDR. R.M.M. was sup-
ported by a fellowship from CNPq. M.R.F. is a recipient of
CNPq/PROFIX fellowship. We are in debt with Dr. Paulo
Bisch, Coordinator of Rede Prote
ˆ
omica do Rio de Janeiro,
for help with the mass spectrometer. We wish to thank Dr.
Phil LoVerde (University at Buffalo) for providing schisto-
some PCAF EST clone. The technical assistance of Maria
Marta Freire is also acknowledged.
References
[1] Komberg RD, Lorch Y. Twenty-five years of the nucleosome, fun-
damental particle of the eukaryote chromosome. Cell 1999;98:
285–94.
[2] Narlikar GJ, Fan H, Kingston E. Cooperation between complexes
that regulate chromatin structure and transcription. Cell 2002;108:
475–87.
[3] Roth SY, Denu JM, Allis CD. Histone acetyl transferases. Ann Rev
Biochem 2001;70:81–120.
[4] Khochbin S, Verdel A, Lemercier C, Seigneurin-Berny D. Functional
significance of histone deacetylase diversity. Curr Opin Genet Dev
2001;11:162–6.
[5] Brownell JE, Zhou J, Ranalli T, Kobayashi R, Edmondson DG,
Roth SY, et al. Tetrahymena histone acetyltransferase A: a homolog
to yeast Gcn5p linking histone acetylation to gene activation. Cell
1996;84:843–51.
[6] Guarente L. Transcriptional coactivators in yeast and beyond. Trends
Biochem 1995;20:517–21.
[7] Georgakopoulos T, Thireos G. Two distinct yeast transcriptional
activators require the function of the GCN5 protein to promote
normal levels of transcription. EMBO J 1992;11:4145–52.
[8] Kuo MH, Brownell JE, Sobel RE, Ranalli TA, Cook RG, Edmondson
DG, et al. Transcription-linked acetylation by Gcn5 of histones H3
and H4 at specific lysines. Nature 1996;383:269–72.
[9] Kuo MH, Zhou J, Jambeck P, Churchill ME, Allis CD. Histone acetyl
transferases activity of yeast Gcn5p is required for the activation of
target genes in vivo. Genes Dev 1998;12:627–39.
[10] Candau R, Moore PA, Wang L, Barlev N, Ying CY, Rosen CA, et al.
Identification of human proteins functionally conserved with the yeast
putative adaptors ADA2 and GCN5. Mol Cell Biol 1996;16:593–602.
[11] Kadam S, Emerson BM. Mechanism of chromatin assembly and
transcription. Curr Opin Cell Biol 2002;14:262–8.
[12] Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y. A
p300/CBP-associated factor that competes with the adenoviral onco-
protein E1A. Nature 1996;382:319–24.
[13] Harlow E, Whyte P, Franza Jr R, Schley C. Association of adenovirus
early-region 1A proteins with cellular polypeptides. Mol Cell Biol
1986;6:1579–89.
[14] Eckner R, Ewen ME, Newsome D, Gerdes M, DeCaprio JA,
Lawrence JB, et al. Genes Dev 1994;8:869–84.
[15] Chan HM, LaThangue NB. P300/CBP proteins: HATs for transcrip-
tional bridges and scaffolds. J Cell Sci 2001;114:2363–73.
[16] Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y.
The transcriptional coactivators p300 and CBP are histone acetyl-
transferases. Cell 1996;87:953–9.
[17] Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA,
et al. Steroid receptor coactivator-1 is a histone acetyltransferase.
Nature 1997;389:194–208.
[18] Chen H, Lin RJ, Schiltz RL, Chakrayarti D, Nash A, Nagy L, et al.
Nuclear receptor coactivator ACTR is a novel histone acetyltrans-
ferase and forms a multimeric activation complex with P/CAF and
CBP/p300. Cell 1997;90:569–80.
[19] Blanco JCG, Minucci S, Lu J, Yang XJ, Walker KK, Chen H, et al.
Genes Dev 1998;12:1638–51.
[20] Jacob AL, Lund J, Martinez P, Hedin L. Acetylation of steroidogenic
factor 1 protein regulates its transcriptional activity and recruits the
coactivator GCN5. J Biol Chem 2001;276:37659–64.
[21] Smith ER, Belote JM, Schiltz RL, Yang XJ, Moore PA, Berger
SL, et al. Cloning of Drosophila GCN5 conserved features among
metazoan GCN5 family members. Nucl Acids Res 1998;26:2948–54.
[22] Tanner KG, Langer MR, Youngioo K, Denus JM. Kinetic mechanism
of the histone acetyltransferase GCN5 from yeast. J Biol Chem
2001;275:22048–55.
[23] Marmorstein R, Berger SL. Structure and function of bromodomains
in chromatin-regulating complexes. Gene 2001;272:1–9.
[24] Hettman C, Soldati D. Cloning and analysis of a Toxoplasma gondii
histone acetyltransferase: a novel chromatin remodeling factor in
Apicomplexan parasites. Nucl Acids Res 1999;27:4344–52.
[25] Aranda A, Pascual A. Nuclear hormone receptors and gene expres-
sion. Physiol Reviews 2001;81:1269–304.
[26] Freebern WJ, Osman A, Niles EG, Christen L, LoVerde PT. Identifi-
cation of a cDNA enconding a retinoid X receptor homologue from
Schistosoma mansoni: evidence for a role in female-specific gene
expression. J Biol Chem 1999;274:4577–85.
[27] Fantappié MR, Freebern WJ, Osman A, LaDuca J, Niles EG, LoVerde
PT. Evaluation of Schistosoma mansoni retinoid X receptor (Sm-
RXR1 and SmRXR2) activity and tissue distribution. Mol Biochem
Parasitol 2001;5:87–99.
[28] De Mendonca RL, Escriva H, Bouton D, Zelus D, Vanacker JM,
Bonnelye E, et al. Structural and functional divergence of a nuclear
receptor of the RXR family from the trematode parasite Schistosoma
mansoni. Eur J Biochem 2000;267:3208–19.
[29] De Mendonca RL, Bouton D, Bertin B, Escriva H, Noel C, Vanacker
JM, et al. A functionally conserved member of the FTZ-F1 nu-
clear receptor family from Schistosoma mansoni. Eur J Biochem
2002;269:5700–11.
[30] Bhat RA, Riehi M, Santandrea G, Velasco R, Slocombe S, Donn G,
et al. Alteration of GCN5 levels in maize reveals dynamic responses
to manipulating histone acetylation. Plant J 2003;33:455–69.
[31] Gregory PD, Horz W. Life with nucleosomes: chromatin remodeling
in gene regulation. Curr Opin Cell Biol 1998;10:339–45.
89
4.9 Resumo do Trabalho 2: “Protein acetylation sites mediated by Schistosoma mansoni
GCN5”
Renata de Moraes Maciel
, Rodrigo Furtado Madeiro da Costa, Francisco Meirelles Bastos
de Oliveira, Franklin David Rumjanek, Marcelo Rosado Fantappié
O co-ativador transcricional GCN5, uma histona acetiltransferase (HAT), faz parte de
grandes complexos multiméricos que são necessários para o remodelamento da cromatina e
ativação da transcrição. Tal como em outros eucariotos, o DNA do parasito
Schistosoma
mansoni
é organizado em nucleossomos e o genoma codifica para componentes de complexos
de remodeladores da cromatina. Usando uma série de peptídeos sintéticos baseados na região
N-terminal da histona H3 e SDS-PAGE foi possível mostrar que o resíduo de lisina 14 da
histona H3 é acetilado pelo domínio HAT da proteína recombinante
SmGCN5-HAT. SmGCN5
também foi capaz de acetilar proteínas não-histonas do esquistossomo, tais como o receptor
nuclear
SmRXR1 e o co-ativador SmNCoA-62. Através da microscopia eletrônica foi revelada
a presença de proteínas
SmGCN5 no núcleo de células vitelínicas de fêmeas sexualmente
maduras. Dentro do núcleo,
SmGCN5 foi encontrada em grânulos de intercromatina (IGCs),
que são estruturas de ativação transcricional. Os dados reunidos reforçam nossa hipótese de
que
SmGCN5 está envolvida na ativação da transcrição, e possivelmente, na ativação da
transcrição do gene
p14.
Protein acetylation sites mediated by Schistosoma mansoni GCN5
Renata de Moraes Maciel, Rodrigo Furtado Madeiro da Costa, Francisco Meirelles Bastos de Oliveira,
Franklin David Rumjanek, Marcelo Rosado Fantappié
*
Instituto de Bioquímica Médica, Programa de Biologia Molecular e Biotecnologia, Universidade Federal do Rio de Janeiro, CCS, Ilha do Fundão, Rio de Janeiro 21941-590, Brazil
article info
Article history:
Received 27 February 2008
Available online 17 March 2008
Keywords:
Schistosoma mansoni
SmGCN5
Histone acetyltransferase
Transcription activation
abstract
The transcriptional co-activator GCN5, a histone acetyltransferase (HAT), is part of large multimeric com-
plexes that are required for chromatin remodeling and transcription activation. As in other eukaryotes,
the DNA from the parasite Schistosome mansoni is organized into nucleosomes and the genome encodes
components of chromatin-remodeling complexes. Using a series of synthetic peptides we determined
that Lys-14 of histone H3 was acetylated by the recombinant SmGCN5-HAT domain. SmGCN5 was also
able to acetylate schistosome non-histone proteins, such as the nuclear receptors SmRXR1 and SmNR1,
and the co-activator SmNCoA-62. Electron microscopy revealed the presence of SmGCN5 protein in the
nuclei of vitelline cells. Within the nucleus, SmGCN5 was found to be located in interchromatin granule
clusters (IGCs), which are transcriptionally active structures. The data suggest that SmGCN5 is involved in
transcription activation.
Ó 2008 Elsevier Inc. All rights reserved.
Gene expression in eukaryotes involves the participation of
nucleosomes and the packaging of DNA into higher order chroma-
tin structures [1]. A compact chromatin represents a physical bar-
rier to transcription factors hindering their access to DNA.
Biochemical mechanisms that circumvent this problem must then
be invoked.
Post-translational modifications of nucleosomal histones have
been associated to transcription activation or repression events in
the chromatin [2,3]. One of the most extensively studied modifica-
tions is the acetylation of the highly conserved N-terminal histone
tails. The basic repeating unit of chromatin is the nucleosome
consisting of 146 bp of DNA wrapped around a histone octamer
containing two copies of each histones H2A, H2B, H3, and H4. The
steady-state acetylation level of histone proteins is accomplished
by action of histone acetyltransferases (HATs) and histone deacety-
lases (HDACs) [4]. The modifications carried out by the different HATs
take place on the e-amino group of lysine (K) residues using acetyl
coenzyme A as a coenzyme. Acetylation affects higher-order folding
of chromatin fibers, loosening of the contacts between the DNA
and the histones and/or non-histone proteins [5]. Thus, HATs are
thought to increase the loosening of chromatin, which in turn may
increase the accessibility of factors that promote transcription [5].
Several studies have provided a direct molecular link between
histone acetylation and transcriptional activation [6,7]. In these re-
ports, it has been shown that several previously identified co-acti-
vators/adaptors of transcription possess intrinsic HAT activity.
Interestingly, many of these chromatin-modifying activities have
been found within large multiprotein complexes. Importantly,
these HAT-activity containing complexes can also function as sim-
ple acetyl transferases and catalyse the acetylation of non-histone
substrates leading to changes in their activity or stability [8,9].
The yeast adaptor GCN5 (General Control Nonderepressible-5)
histone acetyltransferase from Saccharomyces cerevisiae was the
first transcription factor identified as a bona fide HAT [6]. The yeast
GCN5 has been characterized as the HAT subunit of at least two
large macromolecular complexes, SAGA (Spt-Ada-GCN5 acetyl-
transferase) and ADA [10]. The specific biological role of ADA is
not clear. However, SAGA has been shown to stimulate transcrip-
tion in a subset of yeast genes and requires HAT activity of the
GCN5 subunit [10]. Both SAGA and ADA acetylate histone H3 and
H2B on nucleosome targets [10]. Studies using recombinant
GCN5 indicated that it displays a non-random specificity for acet-
ylation of lysines, predominantly acetylating H3 at lysine 14 [10].
In vivo, acetylation of H3 can occur at lysines 9, 14, 18, and 23. In
this regard, acetylation of lysine 9 of H3 is associated with histone
deposition, whereas acetylation of lysine 14 is associated with
transcription [11].
We have previously cloned the GCN5 from the human parasite
Schistosoma mansoni (SmGCN5) [12]. We have shown that SmGCN5
was able to mono-acetylate histones H3 and H2A [12]. Moreover,
we have recently demonstrated the involvement of SmGCN5 with
the nuclear receptor signaling pathway in S. mansoni [13]. In this
context, we have shown that SmGCN5 physically interacted with
schistosome nuclear receptors SmRXR1 and SmNR1, as well as
with the schistosome co-activators SmNCoA-62 and SmCBP-1 [13].
0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2008.03.022
* Corresponding author. Fax: +55 21 2562 6754.
E-mail address: [email protected] (M.R. Fantappié).
Biochemical and Biophysical Research Communications 370 (2008) 53–56
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications
journal homepage: www.elsevier.com/locate/ybbrc
In the present study, we provided evidence that may link
SmGCN5 to transcription regulation in S. mansoni.
Materials and methods
Histone acetyltransferase (HAT) assay. Expression and purification of the
SmGCN5/HAT enzyme were carried out as previously described [12]. HAT assays
were performed using the following substrates: recombinant GST (glutathione- S-
transferase), GST-SmNCoA-62, MBP (maltose binding protein), MBP-SmRXR1, and
MBP-SmNR1, all bound to the beads; commercial histone H3 (H4380-SIGMA) and
histone H3 and H4 N-terminal synthetic peptides (kindly synthesized by Dr. Luis
Juliano Neto, Escola Paulista de Medicina, São Paulo, Brazil). Acetylation reactions
were carried out with 0.5 lg of recombinant GST-SmGCN5/HAT and 0.25 lCi
[
3
H]acetyl-CoA (GE HealthCare) in reaction buffer containing 50 mM Tris, pH 8.0,
5% glycerol, 0.1 mM EDTA, 50 mM KCl, 1 mM DTT, 1 mM PMSF, at 30 °C in a total
volume of 30 ll. The samples with the bead-bound proteins were washed three
times with PBS and resuspended in SDS sample buffer. The histone H3 samples
and the peptides were directly resuspended in SDS sample buffer. Gels were stained
with Coomassie Blue, destained, then soaked with Amplify (GE HealthCare) for
30 min and vacuum dried. The gels were exposed to Hyperfilm (GE HealthCare)
and left at À80 °C for 1–7 days.
Transmission electron microscopy and immunolabeling. Adult worms of S. mansoni
were obtained by perfusion of Swiss mice and immersed in fixative solution con-
taining 0.7% glutaraldehyde (v/v), 0.1% picric acid, 0.1% sucrose, 2% paraformalde-
hyde and 5 mM CaCl
2
in 0.1 M cacodylate buffer (pH 7.2), dehydrated in ethanol
and embedded in Unicryl resin (Ted Pella, Redding, CA). Ultrathin sections were
quenched in NH
4
Cl for 30 min and incubated in the presence of polyclonal
anti-SmGCN5 antibody (1:100), raised against the bromo-domain of the enzyme.
Controls consisted of pre-immune serum used in the same concentration as the im-
mune serum. After several washes in PBS with 1% albumin, sections were incubated
in the presence of 10 nM gold labeled goat anti-rabbit IgG (BB International, UK),
washed and observed in a ZEISS 900 transmission electron microscope.
Results
Acetylation of histone H3–K14 by SmGCN5
The histone H3 N-terminus contains four lysine residues that
are acetylation sites for lysine–histone acetyltransferases. We have
previously shown that H3 is acetylated by SmGCN5 [12]. In order
to identify which of the lysine residues in H3 are acetylated by
SmGCN5, we used synthetic peptides as substrates. One was based
on the wild type sequence of the mammalian H3 N-terminus and
the three remaining peptides carried each a substitution in one
of the lysine residues (Fig. 1A). Acetylation assays showed that
SmGCN5 specifically acetylated lysine 14 of histone H3 (Fig. 1B).
Moreover, we showed that histone H4 was not a substrate for
SmGCN5 (Fig. 1B, lane 5).
In vitro acetylation of SmRXR1, SmNR1 and SmNCoA-62 by
SmGCN5. The acetylation of lysine groups in transcription factors
modulates their activities, both in vivo and in vitro [14]. We then
investigated whether SmGCN5 could acetylate recombinant
SmRXR1 and SmNR1 in vitro. The results in Fig. 2 showed that
SmGCN5 was able to acetylate full length SmRXR1 (Fig. 2, lane
4), but not full length SmNR1 protein (Fig. 2, lane 5). The observa-
tion that SmNCoA-62 contains a large number of lysine residues
throughout the polypeptide chain, prompted us to test the ability
of SmGCN5 to acetylate this protein. As shown in Fig. 2, lane 2,
SmGCN5 acetylated SmNCoA-62. Note that the fusion moieties
GST and MBP were not acetylated by SmGCN5 (Fig. 2, lanes 1
and 3). The asterisks in SmRXR1 and SmNR1 indicate the full
length proteins; the arrows indicate proteolysis of the full length
proteins.
SmGCN5 is localized within interchromatin granule clusters of
euchromatin
There is increasing evidence showing that gene activity is non-
randomly organized within the cell nucleus [15,16]. Of particular
interest, a spatial and functional relationship between intranuclear
structures, termed interchromatin granule clusters (IGCs), and spe-
cific transcribed loci has been reported [17]. By using transmission
electron microscopy and immunolabelling, we were able to local-
ize SmGCN5 within the nucleus and nucleolus of S. mansoni adult
parasites (Fig. 3, panel B, arrows). Importantly, SmGCN5 was
mainly concentrated within IGCs (Fig. 3, panel B, arrows). In addi-
tion, SmGCN5 labeling was found in condensed chromatin (Fig. 3,
panel B). When the pre-immune serum was used, no labeling
was observed (Fig. 3, panel A). It is worth mentioning that in the
nucleus, SmGCN5 was observed mainly in the mature stage (S4)
of the vitelline cells of female worm sections. The S4 stage of the
vitelline cells could be detected by the presence of vitelline drop-
lets (Fig. 3, panel A). However, SmGCN5 was also found in other tis-
sues of female parasites (data not shown).
Discussion
The SAGA and ADA complexes are essential actors of transcrip-
tional gene regulation in eukaryotes. Their structure and composi-
tion have been conserved throughout evolution, from yeast to
human, and they exert their function through the catalytic activity
of an HAT component. Vertebrate GCN5 have been involved in
many biological processes, including the response to steroid/reti-
noid hormones, cell proliferation and cell differentiation. However,
in other organisms, such as the parasite S. mansoni, how the func-
tion of GCN5 is integrated in the control of development has still to
be defined.
The pathology of Schistosomiasis develops through the deposi-
tion of eggs in the liver and spleen of infected individuals [18].
Around three hundred eggs are laid everyday by a single sexually
mature female worm that is paired to a male.
The p14 gene from S. mansoni encodes a major eggshell precur-
sor that is expressed only in sexually mature female worms upon
Fig. 1. Lysine 14 of histone H3 is specifically acetylated by SmGCN5. (A) N-terminal
peptide of histone H3 (wild-type) and its respective mutated peptides (lysines, in
blue, were substituted with alanines, in red). The positions of lysines are marked.
Histone H4 N-terminal peptide (wild-type) was used as a control. (B) SmGCN5-
mediated in vitro acetylation assays were carried out using equal amounts of each
peptide (monitored by Coomassie Blue staining). The target acetylated residue was
identified by autoradiography. (For interpretation of color mentioned in this figure
the reader is referred to the web version of the article.)
54 R. de Moraes Maciel et al. / Biochemical and Biophysical Research Communications 370 (2008) 53–56
mating with male worms [18]. Due to the importance of the p14
gene in eggshell development, we (and others) have concentrated
our efforts to understand the molecular mechanisms of how the
p14 gene is regulated. Cumulative data indicate that the p14 gene
is regulated by nuclear receptors [18–20]. Since it is now well
established that GCN5 proteins act as a co-activator in nuclear
receptor signaling pathways, we envision that SmGCN5 might be
playing a role in the regulation of the p14 gene expression. In this
respect, we recently showed that, in vitro, SmGCN5 was assembled
within a high molecular weight complex containing the target
DNA, the SmRXR1/SmNR1 heterodimer and the coactivators SmN-
CoA-62 and SmCBP-1 [13].
In the present work, we report data that support with our
hypothesis that SmGCN5 plays a role in transcription activation,
and possibly, in transcription activation of the p14 gene.
It has been demonstrated that GCN5-dependent complex ADA
preferentially acetylates Lys 14 on synthetic H3 peptide substrates
and on nucleosomal H3 [1]. Importantly, acetylation of H3 Lys 14
has been linked to transcription activation in both yeast and verte-
brate cells [10]. In this respect, we clearly showed that S. mansoni
GCN5 specifically acetylated lysine 14 of a histone H3 peptide
(Fig. 1). Thus, SmGCN5 may affect the cellular transcription profile
of this parasite by modifying its higher-order chromatin structure.
The suggestion that SmGCN5 may indeed be involved in tran-
scription activation (possibly of the p14 gene) was also based on
our results obtained with the electron microscopy. Using antibod-
ies against SmGCN5, we demonstrated the presence of this enzyme
in the nuclei of vitelline cells of sexually mature female worms
(Fig. 3). SmGCN5 was almost exclusively concentrated in inter-
chromatin granule clusters (IGCs). IGC constituents include, but
are not limited, to small nuclear ribonucleoprotein particles
(snRNP), splicing factors, and the hyperphosphorylated form of
the large subunit of RNA polymerase II [21], and thus, are consid-
ered an active transcriptional compartment [22].
It has been shown that histone acetyltransferases, besides his-
tones, also possess a factor acetyltransferase activity, in that they
acetylate non-histone substrates, such as specific and general tran-
scription factors or chromatin-related proteins [8]. Transcription
factor acetylation can modify protein–DNA and protein–protein
interactions [8]. We have recently demonstrated that the DNA
binding domain of SmRXR1 and SmNR1 were acetylated by
SmGCN5 [13]. Curiously, when we mapped the acetylation sites
of both receptors by using synthetic peptides based on putative
acetylation sites, we observed acetylation in two peptides from
SmNR1 sequence. However, no acetylation was seen with the
peptides from SmRXR1 [13]. To try to clarify these discrepancies,
we used full length SmRXR1 and SmNR1 proteins as substrates
of SmGCN5 (Fig. 2). Our results showed that full length SmRXR1
Fig. 2. Acetylation of SmRXR1, SmNR1 and SmNCoA-62 by SmGCN5. Equal amou-
nts of MBP-SmRXR1, MBP-SmNR1 and GST-SmNCoA-62 incubated with recombi-
nant GST-SmGCN5-HAT domain in the presence of [
3
H]acetyl coenzyme A. The
acetylated SmRXR1 and SmNCoA-62 full length proteins were detected by fluo-
rography (lanes 2 and 4). SmNR1 was not acetylated by SmGCN5 (lane 5). No ac-
etylation was observed in GST or MBP alone. The asterisks indicate the full length
proteins and the arrows indicate proteolysis of the full length proteins.
Fig. 3. Electron microscopy and immunolabelling of SmGCN5. Polyclonal antibody was raised against the bromo domain of SmGCN5 to identify the enzyme in S. mansoni
ultrathin section. (A) Parasite sections were reacted with pre-immune serum. (B) Parasite sections were reacted with SmGCN5 specific antibody. Intense labeling of SmGCN5
was observed in interchromatin granules (arrows). NM, nuclear membrane; VD, vitelline droplet; N, nucleus; CC, condensed chromatin; Nc, nucleolus and IG, interchromatin
granules.
R. de Moraes Maciel et al. / Biochemical and Biophysical Research Communications 370 (2008) 53–56
55
protein was highly acetylated by SmGCN5. Alternatively, full
length SmNR1 protein was not acetylated by SmGCN5. One expla-
nation for the lack of acetylation of SmRXR1 [13] is that the syn-
thetic peptide is not conducive to acetylation by SmGCN5. In the
same context, the lack of acetylation of SmNR1 could be due to
the steric hydrance posed by the MBP moiety in SmNR1.
In summary, the data presented here provide insights into the
role that SmGCN5 may play in transcription regulation in the par-
asite S. mansoni.
Acknowledgments
We thank Dr. Phil LoVerde and Dr. Wenjie Wu for providing the
MBP-SmRXR1 and MBP-SmNR1 clones. This research received
grants to MRF, from Conselho Nacional de Desenvolvimento Cientí-
fico e Tecnológico, CNPq-Universal 2007 and Fundacßão de Amparo
à Pesquisa do Estado do Rio de Janeiro, FAPERJ. We wish to thank
Coordenacßão de Aperfeicßoamento de Pessoal de Nível Superior,
CAPES for providing the fellowship to R.M.M.
References
[1] J.F. Couture, R.C. Trievel, Histone-modifying enzymes: encrypting an enigmatic
epigenetic code, Curr. Opin. Struct. Biol. 16 (2006) 753–760.
[2] A. Eberharter, P.B. Becker, Histone acetylation: a switch between repressive
and permissive chromatin. Second in review series on chromatin dynamics,
EMBO Rep. 3 (2002) 224–229.
[3] Z. Nagy, L. Tora, Distinct GCN5/PCAF-containing complexes function as co-
activators and are involved in transcription factor and global histone
acetylation, Oncogene 26 (2007) 5341–5357.
[4] G.J. Narlikar, H.Y. Fan, R.E. Kingston, Cooperation between complexes that
regulate chromatin structure and transcription, Cell 108 (2002) 475–487.
[5] M. Shogren-Knaak, H. Ishii, J.M. Sun, M.J. Pazin, J.R. Davie, C.L. Peterson, Histone
H4–K16 acetylation controls chromatin structure and protein interactions,
Science 311 (2006) 844–847.
[6] M.H. Kuo, J.E. Brownell, R.E. Sobel, T.A. Ranalli, R.G. Cook, D.G. Edmondson, S.Y.
Roth, C.D. Allis, Transcription-linked acetylation by Gcn5p of histones H3 and
H4 at specific lysines, Nature 383 (1996) 269–272.
[7] L. Verdone, M. Caserta, E. Di Mauro, Role of histone acetylation in the control of
gene expression, Biochem. Cell. Biol. 83 (2005) 344–353.
[8] D.E. Sterner, S.L. Berger, Acetylation of histones and transcription-related
factors, Microbiol. Mol. Biol. Rev. 64 (2000) 435–459.
[9] X.J. Yang, Lysine acetylation and the bromodomain: a new partnership for
signaling, Bioessays 26 (2004) 1076–1087.
[10] P.A. Grant, L. Duggan, J. Cote, S.M. Roberts, J.E. Brownell, R. Candau, R. Ohba, T.
Owen-Hughes, C.D. Allis, F. Winston, S.L. Berger, J.L. Workman, Yeast Gcn5
functions in two multisubunit complexes to acetylate nucleosomal histones:
characterization of an Ada complex and the SAGA (Spt/Ada) complex, Genes
Dev. 11 (1997) 1640–1650.
[11] S.Y. Roth, C.D. Allis, Histone acetylation and chromatin assembly: a single
escort, multiple dances?, Cell 87 (1996) 5–8.
[12] R. de Moraes Maciel, D.L. de Silva Dutra, F.D. Rumjanek, L. Juliano, M.A. Juliano,
M.R. Fantappie, Schistosoma mansoni histone acetyltransferase GCN5: linking
histone acetylation to gene activation, Mol. Biochem. Parasitol. 133 (2004)
131–135.
[13] M.R. Fantappié, F.M.B. de Oliveira, R. de Moraes Maciel, F.D. Rumjanek, W. Wu,
and P.T. LoVerde, Cloning of SmNCoA-62, a novel nuclear receptor co-activator
from Schistosoma mansoni: assembly of a complex with a SmRXR1/SmNR1
heterodimer, SmGCN5 and SmCBP1. Int. J. Parasitol., in press.
[14] R. Amat, G. Solanes, M. Giralt, F. Villarroya, SIRT1 is involved in glucocorticoid-
mediated control of uncoupling protein-3 gene transcription, J. Biol. Chem. 282
(2007) 34066–34076.
[15] C.M. Clemson, J.A. McNeil, H.F. Willard, J.B. Lawrence, XIST RNA paints the
inactive X chromosome at interphase: evidence for a novel RNA involved in
nuclear/chromosome structure, J. Cell Biol. 132 (1996) 259–275.
[16] A.I. Lamond, W.C. Earnshaw, Structure and function in the nucleus, Science
280 (1998) 547–553.
[17] S. Huang, D.L. Spector, Nascent pre-mRNA transcripts are associated with
nuclear regions enriched in splicing factors, Genes Dev. 5 (1991)
2288–2302.
[18] W.J. Freebern, A. Osman, E.G. Niles, L. Christen, P.T. LoVerde, Identification of a
cDNA encoding a retinoid X receptor homologue from Schistosoma mansoni.
Evidence for a role in female-specific gene expression, J. Biol. Chem. 274
(1999) 4577–4585.
[19] M.R. Fantappie, W.J. Freebern, A. Osman, J. LaDuca, E.G. Niles, P.T. LoVerde,
Evaluation of Schistosoma mansoni retinoid X receptor (SmRXR1 and SmRXR2)
activity and tissue distribution, Mol. Biochem. Parasitol. 115 (2001) 87–99.
[20] M.R. Fantappie, A. Osman, C. Ericsson, E.G. Niles, P.T. LoVerde, Cloning of
Schistosoma mansoni Seven in Absentia (SmSINA)(+) homologue cDNA, a gene
involved in ubiquitination of SmRXR1 and SmRXR2, Mol. Biochem. Parasitol.
131 (2003) 45–54.
[21] D.B. Bregman, L. Du, S. van der Zee, S.L. Warren, Transcription-dependent
redistribution of the large subunit of RNA polymerase II to discrete nuclear
domains, J. Cell Biol. 129 (1995) 287–298.
[22] P. Sacco-Bubulya, D.L. Spector, Disassembly of interchromatin granule clusters
alters the coordination of transcription and pre-mRNA splicing, J. Cell Biol. 156
(2002) 425–436.
56 R. de Moraes Maciel et al. / Biochemical and Biophysical Research Communications 370 (2008) 53–56
94
4.10 Resumo do Trabalho 3: “Cloning of SmNCoA-62, a novel nuclear receptor co-
activator from
Schistosoma mansoni: Assembly of a complex with a SmRXR1/SmNR1
heterodimer, SmGCN5 and SmCBP1”
Marcelo Rosado Fantappié, Francisco Meirelles Bastos de Oliveira, Renata de Moraes
Maciel
, Franklin David Rumjanek, Wenjie Wua, Philip T. Loverde
Recentemente foi mostrado que os receptores nucleares (RN) de
Schistosoma mansoni
Sm
RXR1 e SmNR1, formam um heterodímero e se ligam em elementos de DNA responsivos
a hormônios. O recrutamento de proteínas co-reguladoras pelos receptores nucleares (RNs) é
necessário para as suas atividades transcricional e biológicas. Neste trabalho foi clonado um
novo co-ativador de RN de
S. mansoni, SmNCoA-62. SmNCoA-62 é altamente similar ao co-
ativador do receptor humano de vitamina D, o co-ativador NCoA62/SKIP. Através da
utilização de ensaios
in vitro de “pull-down”, os domínios de interação dos co-ativadores de
RNs de
S. mansoni, SmNCoA-62, SmGCN5 e SmCBP1 com SmRXR1 e SmNR1, bem como
os domínios que medeiam as interações entre os próprios co-ativadores foram mapeados. O
co-ativador
SmGCN5 interage com ambos os receptores nucleares através do domínio HAT,
contendo um motivo de interação com RNs, e o domínio bromo de interação proteína-
proteína. Por análise de mutagênese, foi demonstrado que os motivos LXXLL 2 e 3 de
SmCBP1, mas não o motivo LXXLL 1, foram essenciais para mediar as interações entre
SmCBP1 e os domínios EF de SmRXR1 e SmNR1. As histona acetiltransferases SmGCN5 e
SmCBP1 acetilam especificamente os domínios C/D (de ligação ao DNA) de SmRXR1 e
SmNR1. SmGCN5 e SmCBP1 também acetilam SmNCoA-62, mas com diferenças
significativas em suas atividades de acetilação. Usando análise de retardamento de mobilidade
eletroforética (“gel shift”), demonstrou-se,
in vitro, a reunião dos co-ativadores com o
heterodímero
SmRXR1/SmNR1 ligado ao DNA. Os motivos LXXLL 2 e 3 do SmCBP1
parecem desempenhar um papel crucial na interação dos co-ativadores com o heterodímero
95
SmRXR1/SmNR1 ligado ao DNA.
A regulação da expressão gênica mediada por RNs envolve interações dinâmicas e
coordenadas com complexos de histona acetiltransferases e histona desacetilases, que são
componentes dos complexos de co-ativadores ou co-repressores de receptores nucleares. No
entanto, embora os RNs de vertebrados pareçam recrutar um intrincado conjunto de
fatores/complexos, ainda não está claro se os RNs do esquistossomo requerem muitos,
limitados ou diferentes fatores/complexos para atingirem plena atividade dos promotores
alvos. Avanços na compreensão dos mecanismos moleculares que se baseiam na função dos
RNs do parasito
S. mansoni certamente contribuirão para a descoberta de drogas anti-
helmínticas.
Cloning of SmNCoA-62, a novel nuclear receptor co-activator
from Schistosoma mansoni: Assembly of a complex
with a SmRXR1/SmNR1 heterodimer, SmGCN5 and SmCBP1
q
Marcelo Rosado Fantappie
´
a,b,
*
,1
, Francisco Meirelles Bastos de Oliveira
a,b,1
,
Renata de Moraes Maciel
b
, Franklin David Rumjanek
b
, Wenjie Wu
a
, Philip T. LoVerde
a,2
a
Southwest Foundation for Biomedical Research, Department of Virology and Immunology, P.O. Box 78245-0594, San Antonio, TX, USA
b
Instituto de Bioquı
´
mica Me
´
dica, Programa de Biologia Molecular e Biotecnologia, Universidade Federal do Rio de Janeiro, CCS, Ilha do Funda
˜
o,
Rio de Janeiro, 21941-590, Brazil
Received 15 December 2007; received in revised form 7 February 2008; accepted 10 February 2008
Abstract
The Schistosoma mansoni nuclear receptors (NR) SmRXR1 and SmNR1 have recently been shown to form a heterodimer and to bind
to canonic hormone response DNA elements. Recruitment of co-regulatory proteins to NRs is required for their transcriptional and bio-
logical activities. Here, we cloned a novel S. mansoni NR co-activator, SmNCoA-62. SmNCoA-62 is highly homologous to the human
Vitamin D receptor co-activator NCoA62/SKIP. SmNCoA-62 contains the SNW nuclear receptor interaction domain and a putative C-
terminus transactivation domain. By using in vitro pull-down assays, we fully mapped the interaction domains of S. mansoni NR co-
activators, SmNCoA-62, SmGCN5 and SmCBP1 with SmRXR1 and SmNR1, as well as the domains that mediate interactions amongst
the co-activators themselves. By mutagenesis analysis, we showed that SmCBP1 LxxLL motif 2 and LxxLL motif 3, but not LxxLL motif
1, were essential to mediate the interactions of SmCBP1 with the EF domains of SmRXR1 and SmNR1. Histone acetyltransferases
SmGCN5 and SmCBP1 specifically acetylated the C/D domains of SmRXR1 and SmNR1. In addition, two acetylation sites of SmNR1
were identified. SmGCN5 and SmCBP1 also acetylated SmNCoA-62 but with significant differences in their acetylation activities. Using
gel shift analysis, we were able to demonstrate, in vitro, the assembly of the co-activators on the SmRXR1/SmNR1 heterodimer bound
to DNA. LxxLL motifs 2 and 3 of SmCBP1 seemed to play a crucial role for the assembly of the co-activators to the DNA-bound
SmRXR1/SmNR1 heterodimer.
Ó 2008 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Keywords: Schistosoma mansoni; Nuclear receptor; Co-activator; Gene regulation
1. Introd uction
Schistosoma mansoni is a multicellular parasite, with
separate sexes and a complex life cycle that includes two
different hosts and two free-living stages. Hence, regulation
of transcription of sex and stage-specific genes in S. man-
soni must depend on fine-tuned molecular mechanisms
and thus, investigation of the control of transcription in
this parasite may suggest strategies for the development
of anthelmintic drugs.
The nuclear receptor (NR) superfamily encodes struc-
turally related proteins including receptors for steroid
0020-7519/$34.00 Ó 2008 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.ijpara.2008.02.003
q
Note: The nucleotide sequence reported in this paper is available in the
GenBank under the Accession No. EF529813.
*
Corresponding author. Address: Instituto de Bioquı
´
mica Me
´
dica,
Programa de Biologia Molecular e Biotecnologia, Universidade Federal
do Rio de Janeiro, CCS, Ilha do Funda
˜
o, Rio de Janeiro, 21941-590,
Brazil. Tel.: +55 21 2562 6759; fax: +55 21 2562 6754.
E-mail address: [email protected] (M.R. Fantappie
´
).
1
These authors contributed equally to this work.
2
Present address: Department of Biochemistry and Department of
Pathology, The University of Texas Health Science Center at San
Antonio, 7703 Floyd Curl, Dr. San Antonio, TX 78229-3900, USA.
www.elsevier.com/locate/ijpara
Available online at www.sciencedirect.com
International Journal for Parasitology 38 (2008) 1133–1147
and thyroid hormones, retinoic acid, vitamins and other
proteins for which no ligands have been found (orphan
receptors). Nuclear receptors generally function as
ligand-activated transcription factors. Amongst the fun c-
tional domains of NRs, the DNA binding domain
(DBD) directs the receptor towards specific DNA
sequences as monomers, homodimers or heterodimers
and the ligand binding domain (LBD), interacts with
transcriptional coregulators (co-activators or co-repres-
sors), resulting in ligand-regulated a nd ligand-indepen-
dent effects on gene transcription (McKenn a et al.,
1999; Fu et al., 2004).
So far, as many as 21 NRs have been identified in S.
mansoni (Freebern et al., 1999; de Mendonca et al., 2000;
Lu et al., 2006b; Wu et al., 2006, 2007b) and several of
their cDNAs have been cloned and charact erised (Fan-
tappie et al., 2001; De Mendonca et al., 2002; Bertin
et al., 2006; Hu et al., 2006a, 2006b, 2006c; Lu et al.,
2006a, 2006b; Wu et al., 2007a). In this regard,
SmRXR1 and SmRXR2 were shown to be present in
the vitelline cells of adult schistosomes and thus sug-
gested to be involved in the transcription of the
female-specific gene p14 (Fantappie et al., 2001). More-
over, SmFtz-F1 and SmRXR1/SmNR1 heterodimer dis-
played transcriptional activation properties, as shown
by mammalian gene reporter assays (De Mendonca
et al., 2002).
Activation of target genes by hormone NRs requires
chromatin remodelling and histone modifications such as
acetylation, methylation, phosphorylation and ubiquityna-
tion (Strahl and Allis, 2000; Berger, 2002). Distinct histone
modifications, which act sequentially or in combination,
dictate dynamic transitions between transcriptionally
active or transcriptionally silent chromatin states (Strahl
and Allis, 2000; Berger, 2002 ). Post-translational modifica-
tions of histone proteins as well as non-histone proteins,
including NRs, integrate signalling pathways mediating
diverse biological processes.
NR co-regulators convey both intrinsic enzymatic
activities and recruit enzymes to molecular interactions
to modulate gene expression in response to hormonal
signals (Khan and Nawaz, 2003). A large number of
co-activators/adaptors of NRs have been identified,
including the primary co-activator Steroid Receptor
Coactivator-1 (SRC-1) (Onate et al., 1995; Kamei
et al., 1996) and CBP/p300 (Goodman and Smolik,
2000). Multiple lines of evidence have shown that SRC-
1 plays an integral role in NR signalling events, binding
to NRs in a ligand and AF2-dependent manner, both in
solution and on a DNA template (Brown et al., 2003).
The NR interaction domains (NRIDs) of all SRC pro-
teins contain three NR boxes, with a consensus amino
acid sequence LxxLL (where L is leucine and x can be
any amino acid). Most primary NR co-activators contain
the signature LxxLL motif which is necessary and suffi-
cient to permit interaction between a receptor and its
co-activator (Plevin et al., 2005).
The CBP/p300 co-activators are highly conserved pro-
teins that possess protein acetyltransferase activity and
can acetylate histone and non-histone proteins. CBP/p300
interacts directly with SRC-1 and over expression of
SRC-1 and CBP/p300 act synergistically to enhance tran-
scription (Brown et al., 2003). In addition to CBP/p300,
another NR co-activator, General Control Nonrepressed-
5 (GCN5) has been shown to be recruited to SRC-3/p/
CIP (Brown et al., 2003 ).
The GCN5 histone acetyltransfer ase (HAT) has been
extensively shown to act as a NR co-activator and is the
best characterised member of the GCN5/p/CAF HAT
family. Transient transfection assays in mammalian cells
indicated that GCN5 cooperates with p/CIP/SRC-3 as a
co-activator of RARa-dependent transcription (Brown
et al., 2003). Down-regulation of GCN5 using small inter-
fering RNA (siRNA) indicated that the RARb promoter
activity is dependent on GCN5 (Brown et al., 2003). Fur-
thermore, the Steroidogenic Factor 1 (SF-1) orphan recep-
tor was shown to recruit GCN5, and acetylation of SF-1 by
GCN5 stimulated its transcriptional activity (Jacob et al.,
2001).
In addition to SRCs, CBP/p300 and GCN5, the nuclear
co-activator-62 kDa (NCoA62) is a co-activator protein
that was isolated as a Vitamin D receptor (VDR)-inter act-
ing protein in yeast two-hybrid screen (Baudino et al.,
1998). NCoA62 was independently isolated as a protein
that interacts with v-Ski oncoprotein, and it was termed
Ski-interacting protein or SKIP (Dahl et al., 1998).
NCoA62/SKIP exhibited properties consistent with a NR
co-activator in that it interacted directly with VDRs and
other NRs, and it enhanced 1, 25-(OH)
2
D
3
, retinoic acid,
oestrogen and glucocorticoid-activated transcription.
There are, however, differences between NCoA62/SKIP
and SRCs. For example, NCoA/SKIP lacks LxxLL type
motifs and it interacts with VDRs in an AF2-indepe ndent
manner (Baudino et al., 1998 ). NCoA62/SKIP also inter-
acts preferentially with the VDR–RXR heterodimer com-
pared with a VDR monomer or VDR homodimer
(Zhang et al., 2001).
The fact that S. mansoni encodes a variety of NRs, and
that transcription regulation by NRs is totally dependent
on the activity of co-regulatory proteins prompted us
(and others) to identify co-activators and co-repressors in
this parasite.
In the present study, we identified a S. mansoni homo-
logue of the NCoA62-SKIP, that we named SmNCoA-
62. We extended the characterisation of the enzymatic
activities of SmGCN5 and SmCBP1. We used a
SmRXR1/SmNR1 heterodimer as a model to study the
mechanisms of interaction of SmGCN5, SmCBP1 and
SmNCoA-62 and to understand the role of NR co-acti-
vators in the biology of the parasite. The data presented
here consistently showed that, notwithstanding its own
remarkable peculiarities, the NR signalling pathway in
S. mansoni is similar to that found in other eukaryotic
species.
1134 M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147
2. Materials and methods
2.1. Cloning of SmNCoA-62 cDNA
In an attempt to identify new NR coregulators in S.
mansoni, the schistosome expressed sequence tage (EST)
databases were searched. By data mining the S. mansoni
EST genome database from FAPESP http://ver-
jo18.iq.usp.br/schisto/ for co-activators, one sequence
(SmAE 706554. 1) of 393 bp was retrieved. After comparing
this sequence against the NCBI database (http://
www.ncbi.nlm.nih.gov/), it was shown to be highly homol-
ogous to the Homo sapie ns SKI-interacting protei n; NR co-
activator 62 kDa. Reverse transcriptase (RT)-PCR on
adult worm pair cDNA was carried out to amplify a
393 bp amplicon. This PCR product was further used as
a probe to screen a S. mansoni adult worm pair k-ZapII
cDNA expression library. Isolated clones were excised
in vivo and convert ed to pBlueScript SK+ phagemids.
One of these clones was found to contai n the entire coding
sequence of the S. mansoni NCoA62/SKIP homologue.
The S. mansoni protein was termed SmNCoA-62.
2.2. Plasmid constructs
All plasmids used in this study, including the full-length
cDNAs, as well as their truncated and mutat ed forms, were
generated by using GateWay cloning technology (Invitro-
gen). All primers were synthesised by Integrated DNA
Technologies (IDT) and Pfu DNA polymerase (Stratagene)
was used to generate the desired blunt end PCR amplico ns.
The PCR products were cloned into pEN TR
TM
/SD/D-
TOPO (Invitrogen) and sequenced. The cDNAs were then
transferred to destination vectors that were modified in our
laboratory by insertion of the GateWay cassettes. All Gate-
Way clonings were performed following the manufacture’s
manual. The following plasmid constructs were generated:
SmNR1 full-length, SmNR1/AB, SmNR1/CD, SmNR1/
EF in pMAL2C (New England BioLabs) for expression
of Maltose Binding Protein (MBP)-fusion proteins;
SmRXR1 full-length, SmRXR1/AB, SmRXR1/CD,
SmRXR1/EF in pMAL2C; SmNR1 full-length, SmNR1/
AB, SmNR1/CD, SmNR1/EF in pCITE 4a (Novagen)
for in vitro transcription/translation; SmRXR1 full-length,
SmRXR1/AB, SmRXR1/CD, SmRXR1/EF in pCITE-4a;
SmGCN5 full-length, SmGCN5D (mutations at both
LxxLL motifs; for details, see Section 2.4); SmGCN5/
LxxLL 1, SmGC N5/LxxLL 2, SmGCN5/HAT, SmGCN5/
Bromo in pCITE-4a; SmGCN5 HAT in pGEX-4T1 for
expression of GST-fusion proteins; SmNCoA-62 full-
length, SmNCoA-62/NH
2
, SmNCoA-62/SNW, SmN-
CoA-62/TAD in pCITE-4a and in pGEX-4T1. SmCBP1/
HAT in pQE-80L (Quiagen), for expression of histagged
protein; SmCBP1/LxxLL 1; SmCBP1/LxxLL 2;
SmCBP1/LxxLL 3; SmCBP1/LxxLL 1D, SmCBP1/LxxLL
2D, SmCBP1/LxxLL 3D (for details, see Section 2.4)in
pCITE-4a; SmCBP1 full-length in fusion with GST was a
kind gift from Dr. Ray Pierce (Pasteur Institute, Lille).
2.3. Sequences analysis and genomic organization
Protein sequences of NCoA62/SKIP homologues were
aligned using the Align X tool of NTI Advance 10 software
(Invitrogen) and edited with the GeneDoc Alignment edi-
tor, v.2.6.002.
Schistosoma mansoni genomic DNA databases from The
Wellcome Trust Sanger Institute (http://www.san-
ger.ac.uk/) and The Institute for Genomic Research
(http://www.tigr.org/), were searched using SmNCoA-62
cDNA sequence to identify contigs that contained the
entire gene.
2.4. Site-directed mutagenesis
Mutations of the LxxLL motifs of SmGCN5
(SmGCN5D) and SmCBP1 wer e carried out with the Gene-
Tailor
TM
Site-Directed Mutagenesis System (Invitrogen),
following the manufacturer’s instructions. Primers used
for mutations of SmGC N5 LxxLL motifs were as follows:
LxxLL 1 mut 5
0
–5
0
TACAACCTTTAACACGACTGGCA
GCCGCGGCTGAAGATAATATT 3
0
; LxxLL 2 mut 3
0
–5
0
CAGTCGTGTTAAAGGTTGTATTAAATGTATCTTT
GCATCCAG 3
0
; LxxLL 2 mut 5
0
–5
0
CACAAACATAT
ATTTGGCTTGCAGCCGCGGCTAATGTATTTGCT 3
0
;
LxxLL 2 mut 3
0
–5
0
AAGCCAAATATATGTTTGTGG
AGGTTGATTAGGATTTAAACT3
0
; Primers used for
mutations of SmCBP1 LxxLL motifs were as follows:
LxxLL 1 mut 5
0
–5
0
GCCAGCCAGCCTGATATGCTCG-
CAGCCGCGGCTTCCAGAAATGTA 3
0
; LxxlLL 1 mut
3
0
–5
0
GAGCATATCAGGCTGGCTGGCAGGAGTGC
TGCAATGAGCATG 3
0
; LxxLL 2 mut 5
0
–5
0
CAACTC
ATCCAGCAGCAGTTGGCAGCCGCGGCTCATGCT
GCGCGT 3
0
; LxxLL 2 mut 3
0
–5
0
CAACTGCTGCTGGA
TGAGTTGACGTTTTTCCGGATCTGTTGC 3
0
; LxxLL
3 mut 5
0
–5
0
TGTTTGCTCTGTCAACAGCTGGCAGCC
GCGGCTTGGCACCATGCT 3
0
; LxxLL 3 mut 3
0
–5
0
CAGCTGTTGACAGAGCAAACAACTGTTTGTCGCT
TTCTTGGT 3
0
.
SmGCN5D corresponds to the full-length cDNA
mutated at both LxxLL motifs as follows: SmGCN5-
LxxLL 1,
250
LCNLL
254
to
250
LAAAA
254
; SmGCN5-
LxxLL 2,
490
LLELL
494
to
490
LAAAA
494
; Mutation of
SmCBP1 LxxLL motifs were as follows: SmCBP1–LxxLL
1,
125
LETLL
129
to
125
LAAAA
129
; SmCBP1–LxxLL 2,
211
LILLL
215
to
211
LAAAA
215
; SmC BP1–LXXLL 3,
1451
LLSLL
1455
to
1451
LAAAA
1455
.
2.5. Phylogenetic analysis
The phylogenetic tree was constructed using the
deduced amino acid sequences from the SNW domain of
the NCoA-62 proteins aligned with CLUSTALW (http://
www.cf.ac.uk/biosi/research.biosoft/downloads/clustalw.
M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147 1135
html). Phylogenetic analysis of the data set was carried
out using the maximum likelihood method under the
Jones-Taylor-Thornton substitution model (Jaber et al.,
2006), with a gamma distribution of rates between sites
(eight categories, parameter alpha, estimated by the pro-
gram) using PHYLM v2.4.4 (Guindon and Gascuel,
2003). Support values for the trees were obtained by
bootstrapping 100 replicates. The same data set was also
tested by Bayesian inference (Huelsenbeck and Ronquist,
2001) and neighbor-joining distance methods (Saitou and
Nei, 1987). For Bayesian inference, the data set was ana-
lysed under the Jones-Taylor-Thornton substitution
model with a gamma distribution of rates between sites
using MRBAYES v3.1.1 (Saitou and Nei, 1987). The
trees were started randomly; four simultaneous Markov
chains were run for three mil lion generations. The trees
were sampled every 100 generations. Bayesian posterior
probabilities were calculated using Markov chain Monte
Carlo (MCMC) sampling approach implemented in
MRBAYES v3.1.1, with burn-in value setting at 7500
generations. For neighbor-joining distance analysis, the
data set was analysed under the Jones-Taylor-Thornton
substitution model with a gamma distribution of rates
between sites (eight categories, parameter alpha,
estimated using PHYLUM) using PHYLIP package
v.3.62 (http://evolution.genetics.washington.edu/phylip.
html). Support values for the trees were obtained by
bootstrapping a 1000 replicates with SEQBOOT imple-
mented in the PHYLIP package v3.62.
2.6. In vitro protein interactions by pull-down assays
Full-length GST-SmCBP1 was expressed as previously
described (Bertin et al., 2006). Equivalent amounts of
GST or MBP and GST or MBP-fusion proteins bound
to glutathione-S-Sepharose or Amylose beads were used
in pull-down assays. Proteins were translated in vitro with
[
35
S]-methionine (GE HealthCare), using either the Quic k
Coupled Transcription/Translation T7 System (Promega)
or the Single Tube Pro tein System 3, T7 (Novagen). Five
microlitres of the [
35
S]-labeled proteins were incubated
with the corresponding protein-bound-beads in a final
volume of 350 ll of binding buffer (50 mM Tris; pH 7.5,
100 mM NaCl, 10% glycerol, 0.15% NP-40) and incu-
bated overnight at 4 °C under rotation. Protein-bound-
beads were collected by centrifugation, washed five times
with bind ing buffer, resuspended in SDS-sample buffer
and boiled for 5 min prior to loading on a 10% denatur-
ing polyacrylamide gel. Gels were stained with Coomassie
blue, destained, vacuum-dried and exposed to Phospho-
Imager screens. The dried gels were scanned with a Storm
840 (Amersham Biosciences). Percentage values of precip-
itated reactive radiolab eled proteins were measured with
the Quantity One 1-D Analysis Software Version 4.6.5
(Bio-Rad). In all pull-down assays, percentage values that
were equal to or below 0.5 were considered residual
in vitro interactions.
2.7. Histone acetyltransferase (HAT) assay
Expression and purification of the SmGCN5/HAT
enzyme was carried out as previously described (de Oliveira
et al., 2004). Expression and purification of the histagged-
SmCBP1/HAT enzyme was done by following the Pro-
Bond
TM
Purification System manual (Invitrogen).
HAT assays were performed using the following sub-
strates: schistosome recombi nant proteins bound to the
beads, commercial histone H3 (H4380-SIGMA), SmRXR1
and SmNR1 synthetic peptides (GenScript Corporation,
USA). The sequence of the irrelevant control peptide was
based on the sequence of S. mansoni glutathione peroxi-
dase. Acetylation reactions were carried out with 0.5 lg
of recombinant GST-SmGCN5/HAT and 0.25 lCi [
3
H]-
acetyl-CoA (GE HealthCare) in reaction buffer containing
50 mM Tris; pH 8.0, 5% glycerol, 0.1 mM EDTA, 50 mM
KCl, 1 mM DTT and 1 mM phenylmethylsulphonyl fluo-
ride (PMSF), at 30 °C in a total volume of 30 ll. The sam-
ples with the bead-bound proteins were washed three times
with 1 Â PBS and resuspended in SDS-sample buffer. The
histone H3 samples and the peptides were directly resus-
pended in sample buffer. Gels were stained with Coomassie
blue, destained then soaked with Amplify (GE HealthCare)
for 30 min and vacuum dried. The gels were exposed to
Hyperfilms (GE HealthCare) and left at À80 °C for 1–7
days.
2.8. Electrophorectic mobi lity shift assay (EMSA)
For all electrophoretic mobility shift assays (EMSA), the
DNA probe used represents a canonical direct repeat 2
(DR2) (Wu et al., 2007a). Complementary oligonu cleotides
(5
0
CCGTAAGGTCACAAGGTCACTCG 3
0
) were
annealed, followed by [
32
P]-end labelling with T4 polynucle-
otide kinase. Proteins were translated in vitro in the presence
of cold methionine. SmRXR1 and SmNR1 were translated
in vitro concomitantly. The co-activators were individually
translated in vitro. Three to five microliters of the in vitro
translated proteins or 0.2 lg of MBP-SmRXR1 and MBP-
SmNR1 fusi on proteins were incubated with 50,000 counts
per minute (CPM) of the probe in 1Â binding buffer (20%
glycerol, 1 mM MgCl
2
, 0.5 mM EDTA, 0.5 mM DTT,
50 mM NaCl, 10 mM Tris, pH 7.5 and 1 lg poly (dI–dC),
on ice for 30 min in a 30 ll reaction volume. After incuba-
tion, reaction mixtures were loaded on a 4% (v/v) native
polyacrylamide gel and separated in 1Â Tris base-boric
acid-EDTA (TBE) buffer at 4 °C. Gels were vacuum dried
prior scanning with a PhosphoImager.
3. Result s
3.1. SmNCoA-62: identification and sequence analysis of the
cDNA and description of genomic organi zation
By mining the S. mansoni EST database from FAPESP,
we identified a sequence of 393 bp that showed high homol-
1136 M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147
ogy to the nuclear co-activator NCoA62/SKIP (SmAE
706554.1) from Homo sapiens and to Drosophila BX42, a
nuclear protein that is involved in ecdysone-stimulated
gene expression (Wieland et al., 1992). The entire open
reading frame (ORF) of SmNCoA-62 has 1620 bp and
encodes a protein of 540 amino acids (Fig. 1A), with a pre-
dicted molecular mass of 61.6 kDa. Sequence comparisons
in Fig. 1A demonstrated that SmNCoA-62 shows the high-
est similarity within the SNW-NR interacting domain
(amino acids 168–349 in SmNCoA-62). Curiously, the sec-
ond domain that showed high similarity was the N-termi-
nal domain. However, the N-terminus of human
NCoA62/SKIP was shown to be dispensable for VDR
interactions as well as for transactivation activities (Baudi-
no et al., 1998). The maximum transactivation activity of
human NCoA62/SKIP was mapped between amino acids
437–487 (Baudino et al., 1998). In this respect, sequence
comparison between SmNCoA-62 and human NCoA62/
SKIP transactivation domains (TAD s) showed a high
degree of similarity within this amino acid stretch (see
Fig. 1A for comparison). It has been reported that human
NCoA62/SKIP is highly phosphorylated at two serine res-
idues (MacDonald et al., 2001). How ever, these authors
did not provide experimental evidence for these phospho-
rylations and did not comment on the type of kinase
involved in this phosphorylation. Since SmNCoA- 62 con-
tains a putative Cdc2 kinase-phosphorylation site (identi-
fied by the ScanSite Motif Scanner, http://
scansite.mit.edu/motifscan_seq.phtml) within the SNW
domain (
227
PPLMHSPARKVT
238
), and because phos-
phorylation is well known to play important biological
roles, we tested whether the schistosome co-activator
would be phosphorylated by a commercial Cdc2 kinase
(Promega). Despite the presence of a potential phosphory-
lation site, no phopshorylation was observed in SmNC oA-
62 (data not shown).
In order to determine whether SmNCoA-62 was devel-
opmentally expressed, a semi-quantitative RT-PCR was
carried out. We showed that SmNCoA-62 has similar
expression levels throughout schistosome stages (data not
shown).
Phylogenetic analysis of the SNW domain of NCoA
proteins showed that metazoan NC oAs clustered as a
group, as did plant NCoA and fungi NCoAs. In the
metazoan group, SKIP/NCoA formed clusters within the
vertebrates, echinoderm, arthropod, nematodes and platy-
helminths, respectively. SmNCoA-62 clustered with ces-
tode SKIP which suggests that these two genes are
orthologues (Fig. 1B).
Use of the full-length SmNCoA-62 cDNA sequence as a
query to search the S. mansoni genomic databases resulted
in the assembly of several contigs to construct the genomic
gene of SmNCoA-62 (Fig. 1C). The 3517 bp SmNCoA-62
gene consists of five exons. The SmNCoA-62 gene contains
a 145 bp 5
0
-untranslated region (UTR), a 179 bp 3
0
-UTR
and a putative ‘‘AATTAAA” polyadelynation signal
located 16 bp upstream of the poly-A tail. The splice donor
and acceptor sites of SmNCoA-62 exons conformed to the
established consensus GT at the 5
0
-end of the intron and
AG at the 3
0
-end (Supplementary Table S2). Fig. 2 shows
the full-l ength and the constructs of the three NR co-acti-
vators from S. mansoni that were used in this study.
3.2. In vitro acetylation of SmRXR1, SmNR1 and
SmNCoA-62 by SmGCN5 and SmCBP1
The acetylation of lysine groups in transcription factors
modulates their activities, both in vivo and in vitro (Jacob
et al., 2001). We assessed whether SmGCN5 and SmCBP1
could acetylate recombi nant SmRXR1 and SmNR1
in vitro. We showed that both recombinant enzymes were
able to specifically acetylate the C/D domains of SmRXR1
and SmNR1 (asterisks), but not the AB or EF domains
(Fig. 3A).
Due to the fact that SmNCoA-62 contains a large num-
ber of lysine residues throughout the polypeptide chain, we
tested the ability of SmGCN5 and SmCBP1 to acetylate
this protein. As shown in Fig. 3B, SmGCN5 and SmCBP1
were able to acetylate SmNCoA-62. It is worth mentioning
that although the three domains of SmNCoA-62 contain
almost the same number of lysine residues (NH
2
domain
has 14 lysines; SNW domain has 16 lysines; TAD domain
has 17 lysines), the acetylation pattern of each domain
was different (Fig. 3B). By comparing Fig. 3B, left panel
with right panel, it is clear that SmGCN5 acetylated SmN-
CoA-62 more efficiently than SmCBP1. In this respect, the
TAD domain was highly acetylated by SmGCN5, followed
by the SNW domain and the NH
2
domain. Importantly,
SmCBP1 also displayed specificity towards acetylation of
the TAD domain of SmNCoA-62. In contrast, the NH
2
and SNW domains of SmNCoA-62 were poorly acetylated
by SmC BP1. In this context, it is important to point out
that the enzymatic activities of SmGCN5 and SmCBP1
were similar, when monitored by the acetylation levels of
histone H3 (Fig. 3B, lanes 6 and 12). In these experiments,
we were also able to demonstrate that SmGCN5 and
SmCBP1 were auto-acetylated (Fig. 3B, lanes 5 and 11).
3.3. Mapping the acetylation sites of SmRXR1 and SmNR1
The candidate acetylation motif KxKK/RxKK of the
NR members such as TR, RAR, PPAR, LXR, FXR,
VDR, GR, PR, HNF4, and SF1 are phylogenetically con-
served amongst different species including vertebrates,
arthropods and nematodes (Wang et al., 2001). By search-
ing the amino acid sequences of SmRXR1 and SmNR1, we
were able to identify two putative acetylation sites in each
receptor. Curiously, one of the putative sites was located
within the AB domain of SmNR1 (SmN R1 GenBank
Accession No. AY395037; amino acids
203
RCKK
206
).
However, in Fig. 3A, we clearly demonstrated that the
AB domains of both SmRXR1 and SmNR1 were not the
substrates for acetylation by SmGCN5 and SmCBP1. Nev-
ertheless, this putative acetylation site was tested for acety-
M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147 1137
Fig. 1. Amino acid comparison amongst NCoA-62 proteins and gene structure of SmNCoA-62. (A) The deduced amino acid sequence of SmNCoA-62 was
aligned with four related proteins using the Align X tool of the NTI Advance 10 software (Invitrogen). Regions of sequence identity are shaded. The SNW
domain is shown inside a box. The accession numbers of human NCoA-62/SKIP, chicken, frog and zebra fish are AAC31697, XP_421294, NP_001017145,
NP_001002864, respectively. (B) Phylogenetic analysis of SmNCoA-62. The phylogenetic tree was constructed using the maximum likelihood method under
the Jones-Taylor-Thornton substitution model with a gamma distribution of rates between sites (eight categories, parameter alpha). Support values for the
trees were obtained by bootstrapping, 100 replicates. The GenBank accession numbers of the analysed sequences are provided in Supplementary Table S1. (C)
Schematic representation of the functional domains of SmNCoA-62 co-activator and its intron/exon organization. The exons are indicated by boxes. The
numbers and sizes of the exons and introns, as well as the exon donor and acceptor sequences are provided in Supplementary Table S2.
1138 M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147
lation by SmGCN5 and SmCBP1. The other three putative
sites were located within the C/D domains of SmRXR1
and SmNR1 (SmRXR1 GenBank Accession No.
AF094759; amino acids
343
KGMKK
347
and amino acids
370
KSEKK
374
; SmNR1, amino acids
353
RQGKK
357
). Syn-
thetic peptides bearing the acetylation motifs of SmRXR1
and SmNR1, as well as an irrelevant peptide ( Fig. 4A),
were tested as substrates for SmGCN5 and SmCBP1. As
seen in Fig. 4B, lanes 3 and 4, SmGCN5 and SmCBP1 were
able to acetylate both peptides from SmNR1 protein. How-
ever, no acetylation of SmRXR1 peptides was observed
(Fig. 4B, lanes 1 and 2). Similarly, no acetylation was
observed with the irrelevant peptide (lane 5). Histone H3
used as a positive control was highly acetylated by both
enzymes (lane 6).
3.4. In vitro interactions of S. mansoni nuclear recept ors and
co-activators
To evaluate the level of interactions between schisto-
some NRs and co-activators as well as the interactions
amongst the co-activators, and in order to map the
Fig. 1 (continued)
Fig. 2. Schematic representation of the full-length cDNA sequences, gene
constructs of the domains/motifs and the mutant forms of SmNR1,
SmRXR1, SmGCN5, SmNCoA-62 and SmCBP1. The location of each
fragment is shown by the amino acid numbers. The locations of the
LxxLL mutations in SmGCN5 and SmCBP1 are indicated by grey boxes.
M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147 1139
domains that mediate these interactions, we used in vitro
GST or MBP pull-down assays. The degree of interaction
was expressed as the percentage value of the precipitated
radiolabeled proteins compared with the input material.
Several constructs of SmGCN5 were generated for this
study (see Fig. 2). The N-terminus of SmGCN5 contains
a putative LxxLL motif (SmGCN5 LxxLL 1), localised
between amino acids
250
LCNLL
254
. The histone acetyl-
transferase (HAT) domain of SmGCN5 contains a second
putative LxxLL motif (SmGCN5 LxxLL 2), between
amino acids
490
LLELL
494
. Fig. 5A shows that wild-type
full-length SmGCN5 interacted with SmRXR1 and
SmNR1 (panel SmGCN5). When both LxxLL motifs of
SmGCN5 were mutated (SmG CN5D), a reduction of
approximately 50% in binding was observed (panel
SmGCN5D). When we used the construct containing the
first LxxLL motif (SmGCN5 LxxLL 1, see Fig. 2 for
details), a weak interaction was observed (panel
SmGCN5–LxxLL 1). Alternatively, when we used the con-
struct containing the second LxxLL motif (SmGCN5
LxxLL 2), interactions were observed with SmRXR1 and
SmNR1 (panel SmGCN5–LxxLL 2). The values obtained
for these interactions were similar to the values found with
SmGCN5D. The HAT domain of SmGCN5 (which
includes the second LxxLL motif, see Fig. 2) showed levels
of interactions comparable to the levels achieved with
SmGCN5 wild-type (panel SmGCN5–HAT), indica ting
that besides the LxxLL 2 motif, other sequences within
the HAT domain mediate interactions with SmRXR1
and SmNR1. The bromo-domain was also shown to inter-
act with both receptors (panel SmGCN5–BROMO).
Fig. 5B shows the domains of SmNR1 that were involved
in the interactions wi th SmNCoA-62 and SmGCN5. Simi-
lar results were obtained with SmRXR1 (data not shown).
Recently, it has been shown that SmRXR1 and SmNR1
heterodimerize through their EF domains (Wu et al.,
2007a). Indeed, we show here that this interaction is very
stable in solution (Fig. 5B, panel SmRxR1). Besides the
EF domain, we showed that the C/D domains of SmNR1
were also involved in the interaction with SmRXR1. We
believe that this interaction was mediated by the hinge
region D, which is contained in this gene construction.
SmNCoA-62 was found to have a high affinity for the
AB domain of SmNR1, followed by the EF domain
(Fig. 5B, panel SmNCoA-62). An interaction of SmN-
CoA-62 with the C/D domains of SmNR1 was also
observed (panel SmNCoA-62). The co-activator SmGCN5
was able to interact, at comparable levels, with all three
domains of SmNR1 (panel SmGCN5).
The results in Fig. 5C indicate that the SNW and TAD
domains of SmNCoA-62 are important for interactions
with SmRXR1 and SmNR1. The N-terminal domain of
SmNCoA-62 did not bind to the receptors (panel SmN-
CoA-62 NH2). Predictably, the SNW-nuclear receptor
interaction domain interacted strongly with SmRXR1
and SmNR1 (panel SmNCoA-62 SNW). Surprisingly, the
TAD domain of SmNCoA-62 was also able to efficiently
mediate the interactions with both schistosome NRs (panel
SmNCoA-62 TAD).
In vitro interactions of full-length SmCBP1 with
SmRXR1, SmNR1, SmGCn5 and SmNCoA-62 were also
investigated. As shown in Fig. 5D, panels SmRxR1 and
SmNR1, SmCBP1 interacted with SmRXR1 and SmNR1.
We investigated further the ability of SmCBP1 to interact
with SmGCN5 and SmNCoA-62. Fig. 5D shows that
Fig. 3. Mapping SmGCN5 and SmCBP1-mediated acetylation domains
of SmRXR1, SmNR1 and SmNCoA-62. (A) The C/D domains of
SmRXR1 and SmNR1 were acetylated by SmGCN5 and SmCBP1
in vitro. Equal amounts of the maltose binding protein (MBP)-fusion
proteins were incubated with GST-SmGCN5-HAT domain or histagged-
SmCBP1-HAT domain in the presence of [
3
H]-acetyl coenzyme A. The
acetylated C/D domains of SmRXR1 and SmNR1 (asterisks) were
detected by fluorography. (B) Domains of SmNCoA-62 fused to GST
were used in acetylation assays (as above). The faint acetylated band seen
in lane 1 is believed to be originated from SmGCN5 autoacetylation.
Histone H3 (SIGMA) was used as a positive control substrate.
Fig. 4. Identification of acetylation sites in SmRXR1 and SmNR1. (A)
Potential acetylation sites of SmRXR1 and SmNR1 (peptides 1–4).
Irrelevant control peptide containing putative acetylation site (lane 5). The
faint band seen in lane 5, upper panel is considered background. (B)
Peptides were used as direct substrates for GST-SmGCN5-HAT or
histagged-SmCBP1-HAT in the presence of [
3
H]-acetyl coenzyme A.
Histone H3 (SIGMA) was used as a positive control substrate.
1140 M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147
SmCBP1 bound to SmGCN5. On the other hand, SmCBP1
was not able to interac t with either wild-type SmNCoA-62
or its individual domains (Fig. 5D, panels SmNCoA-62,
SmNCoA-62 NH2, panel SmNCoA-62 SNW and panel
SmNCoA-62 TAD). When we tested the ab ility of
SmGCN5 to interact with SmNCoA-62, all three domains
of SmNCoA-62 were fou nd to bind to SmGCN5 with high
affinity ( Fig. 5E).
3.5. SmCBP1–LxxLL 2 and LxxLL 3 mediate the
interactions with the EF domains of SmRXR1 and SmNR1
It is well established that the interactions between NRs
and co-activators can be mediated by the NR boxes Lxx LL
present in the co-activators. The well-studied human CBP/
p300 (hCBP/p300) co-activator has three LxxLL motifs
(Goodman and Smolik, 2000). Like its mammalian coun-
terpart, SmCBP1 also contains three LxxLL motifs (Bertin
et al., 2006 ). We translated peptides in vitro (with an aver-
age of 98 amino acids, see Fig. 2 for details), each contain-
ing the individual LxxLL motifs from SmCBP1. The
mutant forms of these peptides were also translated
in vitro (see Section 2 for details). Fig. 6A shows that the
peptides containing the wild-type LxxLL 2 and LxxLL 3
of SmCBP1 efficiently bound to full-length SmRXR1 and
SmNR1 (panels SmCBP1–Lxx LL 2 and SmCBP1–LxxLL
3, respectively). The interaction of SmCBP1 LxxLL 1
wild-type peptide was less efficient (panel SmCBP1–LxxLL
1). Next, we evaluated whether these interactions were
exclusively dependent on the LxxLL moti fs of SmCBP1.
For these experiments, we expressed the EF domain of
SmRXR1 and SmNR1. As seen in Fig. 6B, and in accor-
dance with the result obtained in Fig. 6A, the SmCBP1
wild-type LxxLL 1 peptide showed weak interactions with
the EF domain of the receptors (panel SmCBP1–LxxLL 1).
When the mutated form of SmCBP1 LxxLL 1 peptide was
tested, comparable levels of interactions were obtained
(compare Fig. 6B and C, panel SmCBP1–LxxLL 1). Even
though 0.3% and 0.5% differences between LxxLL 1
mutant and wild-type are seen, we believe that this does
not reflect interactions involving the NR boxes. Consi stent
with the results found in Fig. 6A, the wild-type peptides
LxxLL 2 and LxLL3 of SmCBP1 bound efficiently to the
EF domains of SmRXR1 and SmNR1 (Fig. 6B, panels
SmCBP1–LxxLL 2 and SmCBP1– 3). However, when
mutated forms of SmCBP1 LxxLL 2 or LxxLL 3 peptides
were tested, no interactions were observed (Fig. 6C, panels
SmCBP1–LxxLL 2 and SmCBP1–LxxLL 3). These results
Fig. 5. In vitro interactions of schistosome nuclear receptors and co-activators. (A–C) Equal amounts of various maltose binding protein (MBP)-fusion
proteins of SmRXR1 or SmNR1 were incubated with various in vitro [
35
S]-translated constructs of SmGCN5 and SmNCoA-62. (D) In vitro [
35
S]-
translated SmRXR1, SmNR1 or SmNCoA-62 were incubated with full-length GST-fused SmCBP1; (E) in vitro [
35
S]-translated full-length SmGCN5 was
incubated with the three domains of SmNCoA-62 fused with GST. A portion of in vitro translated protein was loaded directly in the gel (10% input).
Percentage values of precipitated reactive radiolabeled proteins were calculated by subtracting the values of the control fusion proteins (GST or MBP).
M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147 1141
strongly suggested that both LxxLL 2 and LxxLL 3 motifs
of SmCBP1 were necessary and sufficient for the interac-
tions with SmRXR1 and SmNR1.
3.6. SmRXR1/SmNR1 heterodimer and co-activators
SmNCoA-62, SmGCN5 and SmCBP1 are assembled in the
presence of DNA
We have describ ed the in vitro interactions of SmRXR1
and SmNR1 (individually) with SmNCoA-62, SmGCN5
and SmCBP1 in solution. However, in the cell, the assem -
bly of NRs and co-activators occurs on a DNA molecule.
In order to partially mimic this scenario, we used EMSA
analysis to investigate the inter actions of SmRXR1/
SmNR1 heterodimer with SmNCoA-62, SmGCN5 and
the pep tides containing the LxxLL motifs of SmCBP1, in
the presence of a DR2 oligonucleotide. All proteins used
in these assays were translated in vitro an d free of tags.
The interaction of the SmRXR1/SmNR1 heterodimer to
DR2 was confirmed by the formation of a shifted band
(Fig. 7, lane 2). Importantly and consistently, the individual
addition of SmNCoA-62, SmGCN5 or SmCBP1-LxxLL 3
resulted in a higher affinity binding of the receptor heterodi-
mer to the target DNA, as monitored by the intensity of the
bands (Fig. 7, lanes 3–5). Incubation of the SmRXR1/
SmNR1 heterodimer with SmNCoA-62 and SmGCN5 also
resulted in the formation of a tighter NR-DNA complex (lane
6). Curiously, no super shift was observed upon addition of
the individual co-activators (lanes 3–5). In order to test
whether we could reconstitute the in vitro assembly of the
schistosome NR-co-activator complex, we incubated the
DR2 oligonucleotide in the presence of the SmRXR1/
SmNR1 heterodimer, SmNCoA-62, SmGCN5 and each
SmCBP1–LxxLL constructs (wild-type or mutants, incu-
bated individually). In agreement with the pull-down results
obtained in Fig. 6, our EMSA analysis showed that the
LxxLL 1 motif of SmCBP1 did not take part in the NR-co-
activator complex (Fig. 7, lane 7). This result was corrobo-
rated by the lack of interaction with the SmCBP1 LxxLL 1
mutant peptide (lane 8). On the other hand, the addition of
either LxxLL 2 or LxxLL 3 motifs of SmCBP1 resulted in
the formation of a stable NR-co-activator complex (Fig. 7,
lanes 9 and 11), monitored by the shifted bands and by the
high molecular weight complexes that were retained in the
wells of the gel. The addition of either mutant SmCBP1
LxxLL 2 or LxxLL 3 did not result in the formation of com-
plexes (Fig. 7, lanes 10 and 12). These results clearly showed
that SmCBP1 LxxLL 2 and LxxLL 3 motifs are essential, not
only for mediating the interactions with the NRs, but notably
they were also required to trigger the formation of the whole
complex, in vitro. To prove that the formation of the complex
was dependent on the presence of the NR heterodimer, we
tested the three co-activators in the presence of DNA, but
in the absence of the SmRXR1/SmNR1 heterodimer, and
as shown in lane 13, no shifted bands were observed.
To confirm the results obtained with the in vitro trans-
lated proteins, we also carried out EMSA analysis using
recombinant SmRXR1 and SmNR1 fused with MBP.
Addition of the three in vitro translated schistosome co-
activators resulted in the formation of a high molecular
weight complex that was partially retained at the top of
the gel (data not shown).
4. Discuss ion
Precise spatial and temporal patterns of gene expression
are crucial for normal development of the different stages
of S. mansoni. Orchestrating these patterns requires the
coordination of numerous regulatory events and mecha-
nisms that mediate both repression and activation of spe-
cific target genes at specific times and places during the
development of the parasite.
NRs carry out their many different transcriptional func-
tions through the recruitment of a myriad of pos itive and
negative regulatory proteins, referred to as co-activators
or corepressors, respectively. NR coregulators can be clas-
sified into two main groups according to their mode of
action. The first group contains factors that covalently
modify histones (acetylation, methylation, phosphoryla-
tion and ubiquitylation), a process that follows a precise
and combinatorial code. The second group includes ATP-
dependent chromatin remodeling factors. However, this
Fig. 6. Role of nuclear receptor (NR) LxxLL-boxes for SmCBP1 and SmRXR1/SmNR1 interactions. (A) In vitro [
35
S]-translated SmCBP1 LxxLL
peptides were incubated with full-length Maltose Binding Protein (MBP)-SmRXR1 and MBP-SmNR1. (B and C) In vitro [
35
S]-translated wild-type or
mutated forms of SmCBP1 LxxLL peptides were incubated with MBP-recombinant EF domains of SmRXR1 and SmNR1.
1142 M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147
broad division is not fully inclusive as there are numerous
cofactors that do not have any known direct effects on
chromatin structure or modification, but instead function
in the assem bly, the recruitment or the release of co-regula-
tory complexes. This is probably the case of the schisto-
some co-activator SmNC oA-62, identifie d in this study.
SmNCoA-62 is a newly characterised NR co-activator
in S. mansoni. SmNCoA-62 is highly homologous to the
human NCoA62/SKIP protein in the SNW and TAD
domains, as well as in the N-terminus of the protein, which
has, to date, no known function. For example, it has been
shown that the N-terminus of human NCoA62/SKIP was
not involved in NR binding or transactivation activities
(Baudino et al., 1998). Similarly, our studies showed that
the SmNCoA-62 N-terminus did not interact with
SmRXR1 or SmNR1, whereas the SNW domain of SmN-
CoA-62 was found to efficiently interact with both
receptors.
The TAD domain of human NCoA62/SKIP has been
reported to mediate transactivation activities (Baudino
et al., 1998). However, these authors also reported a small
stretch of 24 amino acids within the TAD domain of
NCoA62/SKIP that mediated interactions with the Vita-
min D receptor (Baudino et al., 1998). We also showed in
our studies that the SmNCoA-62-TAD domain interacted
with SmRXR1 and SmNR1. We suggest that this interac-
tion may be mediated by the same conserved stretch of
amino acids present in the schistosome protein. Although
we have not tested the transactivation ability of the SmN-
CoA-62-TAD domain, we specu late that it plays a role in
transcription activity, based on the fact that maximum
transactivation activity of the NCoA62/SKIP was mapped
within a region that is highly conserved between NCoA62/
SKIP and SmNCoA-62.
Lysine acetylation has been shown to occur in many
protein targets (Yang, 2004). This modification is reversible
in vivo, with its specificity and level being largely co ntrolled
by signal-dependent association of substr ates with
acetyltransferases and deacetylases. Like other covalent
modifications, lysine acetylation exerts its effects through
‘‘loss-of-function” and ‘‘gain-of-function” mechanisms.
The presence of 47 lysine residues evenly distributed in
the polypeptide chain of SmNCoA-62 is noteworthy. Inter-
estingly, these residues are almost equally distributed along
the functional domains of the protei n. We showed that
despite this even lysine distribution, the acetylation levels
of the domains, by both schistosome acetyltransferases
SmGCN5 and SmCBP1 were clearly different . For exam-
ple, the TAD domain of SmNCoA-62 was highly acety-
lated by GCN5, as well as the SNW domain. In this
regard, it has been demonstrated that acetylation can reg-
ulate protein interactions and transactivation activities
(Levy et al., 2004; Thompson et al., 2004). In contrast to
SmGCN5, SmNCoA-62 was poorly acetylated by
SmCBP1.
Unlike classical enzyme substrates, most known N
e
-
acetylated proteins stably associate with their respective
acetyltransferases. The stable association brings these pro-
teins to the physical proximity of their respective acetyl-
transferase, thereby increasing local substrate
concentration and determining acetylation specificity. In
fact, our acetylation data is in complete agreement with
Fig. 7. Nuclear receptor (NR) heterodimer-co-activator assembly on DNA by gel mobility shift assay. [
32
P]-DR2 was incubated with 5 ll of in vitro
unlabeled-translated SmRXR1/SmNR1 (both translated in the same tube), followed by the addition of each of the in vitro unlabeled-translated co-
activators SmGCN5, SmNCoA-62 and SmCBP1, individually (lanes 3–5) or in combination (lane 6–12). Lane 1, no protein added. The DNA/SmRXR1/
SmNR1 interaction is indicated by a solid arrow. The DNA/SmRXR1 interaction is shown by a dash. Enhancement of binding is seen in lanes 2–5. DNA/
NR/co-activator complex is indicated by a bracket. NS: non-specific binding from the reticulocyte lysate. A schematic model of interactions and the
respective legends are provided on the left. The AF2 conformational change induced by SmCBP1 peptides, suggested by us, is depicted in the scheme.
M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147 1143
our protein–protein interaction results. In this regard,
SmGCN5 strongly interacted with SmNCoA-62-SNW
and TAD domains, whilst SmCBP1 showed no measurable
interactions with SmNCoA-62 in vitro.
Regulation of NR gene express ion involves dynamic and
coordinated interactions with histone acetyltransferases
and histone deacetylase complexes, which are components
of the NR co-activator or corepressor complexes. NR
members, such as AR and ERa, are direct substrates of his-
tone acetyltransferases in vitro and in vivo (Muth et al.,
2001; Vo et al., 2001; Choi et al., 2003; Levy et al., 2004;
Thompson et al., 2004). We showed that SmGCN5 and
SmCBP1 were both able to specifically acetylate the C/D
domains (DBD and hinge) of SmRXR1 and SmNR1.
These results are of special interest since acetylation of
the DBD of SF-1 by CBP/p300 and GCN5, increased its
DNA binding (Chen et al., 2005), and transactivation
activities (Jacob et al., 2001), respectively.
The diversity of N
e
-acetylated proteins raises the ques-
tion of whether there are consensus acetylation sites. Com-
monly, acetylation sites are lysine-rich and sequence
alignment of these sites has revealed three consensus
motifs, GKXXP (Jenuwein and Allis, 2001), KxKK and
RxKK (Kim et al., 2006 ). Two acetylation sites that follow
these consensus motifs, KGFFK and KQQKK of the NR
SF-1 (Jacob et al., 2001; Chen et al., 2005) and one acety-
lation site of the AR, KLKK (Kim et al., 2006) have been
mapped. Alternatively, the acetylation site of the ERa,
KHKRQ, does not follow these consensus sequences
(Kim et al., 2006).
We were able to identify two putative acetylation motifs
in each of the schistosome recept ors. Both motifs of
SmRXR1 (KGMKK and KSEKK) are present within
the DBD. In the case of SmNR1, one motif is present in
the DBD (RKRR or GKKR), and the second moti f
(RCKK) is present in the AB domain. SmGCN5 and
SmCBP1 efficiently acetylated peptides containing both
motifs of SmNR1 (including the motif present in the AB
domain). Curiously, we did not observe acetylation of the
MBP-fusion construct SmNR1-AB by SmGCN5 or
SmCBP1. One reasonable explanation for the lack of acet-
ylation of the MBP-SmNR 1-AB domain could be the steric
hindrance posed by the MBP moiety. Unlike SmNR1, we
did not observe acetylation when SmRXR1 peptides were
tested. In this case, it is reasonable to assume that, similar
to ERa, acetylation of SmRXR1 may take place in any of
the lysine residues present throughout the DBD. Another
plausible explanation is that the c onformation of SmRXR1
synthetic peptides is not conducive to acetylation by
SmGCN5 or SmCBP1. Future studies using mass spec-
trometry will be conducted to specifically identify the acet-
ylated lysines of SmRXR1 and SmNR1 (and of SmNCoA-
62).
Although several classes of recognition interfaces
between NRs and co-activators are likely to exist, a highly
conserved ‘‘signature sequence”, designated the NR box,
has been demonstrated to mediate co-activator-NR inter-
actions for a large number of these proteins. The NR box
is comprised of a short a-helical Lxx LL motif. Although
this motif is necessary to mediate the binding of these pro-
teins to the liganded NRs, amino acid residues flanking the
core moti f are important in the recognition of NRs.
Two S. mansoni co-activators, SmGCN5 and SmCBP1,
contain the typical LxxLL motifs and we evaluated the role
of these motifs in NR interactions. We were able to identify
the second LxxLL motif of SmGCN5 (present within the
HAT domain) as the signature responsible for mediating
the interactions with SmRXR1 and SmNR1. The fact that
the first LxxLL motif of SmGCN5 did not play a role in the
interactions with the NRs emphasises the importance of
the flanking amino acid residues. Mutations in both LxxLL
motifs (that includes LxxLL 2) of SmGCN5 did not com-
pletely abolish interactions with NRs, indicating that
besides the LxxLL 2 motif, other sequences in the HAT
domain and the bromo domain mediated the interactions
between SmGCN5 and the NRs. Indeed, it is known that
bromo domains bind in vitro to the amino-terminal tails
of histones (Matangkasombut and Buratowski, 2003) and
acetylation of lysine residues on these tails improves bind-
ing (Matangkasombut et al., 2000).
Not only were the different domains of SmGCN5
involved in the interactions with SmRXR1 and SmNR1,
but the three functional domains of SmNR1 (and SmRXR1,
data not sho wn) also participated in these interactions.
These results suggested that in vivo, SmGCN5 probably
forms a stable trimeric complex with a SmRXR1/SmNR1
heterodimer and can serve as the main platform for the
sequential recruitment of other co-activators.
Besides SmGCN5 (and SmNCoA-62), SmCBP1 effi-
ciently bound to SmRXR1 and SmNR1. Like its mamma-
lian counterpart, SmCBP1 has three LxxLL motifs (Bertin
et al., 2006 ). SmCBP1 LxxLL 2 and LxxLL 3 are localised
within the conserved zinc finger motifs CH1 and CH3 (cys-
teine–histidine rich domains), respectively.
The LxxLL 1 motif of hCB P/p300 has been shown to
strongly mediate the interaction with NR LBDs (Chakrav-
arti et al., 1996; Heery et al., 2001), but the other two
motifs were shown to interact weakly with NR LBDs
(Chakravarti et al., 1996; Heery et al., 2001).
In terms of positions and flanking sequences, the NR
boxes (LxxLLs) from SmCBP1 and human CBP/p300
show differences in the LxxLL 1 and LxxLL 3 motifs, but
conservation in the LxxLL 2 motif. Thus, we considered
whether these alterations might affect the mode of interac-
tion of SmCBP1 with the LBDs of SmRXR1 and SmNR1.
We demonstrated that the LxxLL 1 of SmCBP1 was not
involved in the binding to the LBDs of the schistosome
receptors, wher eas both LxxLL 2 and LxxLL 3 of SmCBP1
were essential and sufficient for binding to the LBDs of
SmRXR1 and SmNR1.
An important feature of the LxxLL 2 and LxxLL 3
motifs of SmCBP1 is the presence of Glutamine (Gln) res-
idues at position-1 of each NR box. It has been shown that
Gln at position-1 of the hCBP/p300 LxxLL 1 motif is
1144 M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147
involved in the interface between PPARc-LBDs and the
bound NR box (Klein et al., 2005).
The LxxLL 3 motif of SmC BP1 is located at the third
zinc finger motif CH3 of the protein. Recently, it has been
shown that the ERa antagonist ICI, which blocks ERa
transcription activity, increased ERa-CBP/p300 interac-
tions to levels higher than those observed for E2 (Jaber
et al., 2006). Interestingly, the interactions induced by
ICI were mediated by the CH3 domain of hCBP/p300,
which does not encompass any LxxLL motifs (Jaber
et al., 2006). Using an elegant approach, these authors
showed by nuclear magnetic resonance and mutagenesis
analysis that the CH3 domain of hCBP/p300 was com-
posed of four a-helices encompassing three histidine–cys-
teine rich regions, capable of forming loops surrounding
the zinc atoms, and that mutations of amino acids impor-
tant for the coordinate binding of each zinc atom, blocked
interactions between ERa and hCBP/p300 (Jaber et al.,
2006). This finding was especially important because the
LxxLL 3 motif of SmCBP1 is located centrally within the
zinc fingers of the CH3 domain.
Despite the presence of Gln residues at position-1 of
LxxLL 2 and LxxLL 3 of SmCBP1 and the presence of
the same four a-helices in the SmCBP1 CH3 domain,
mutations in the LxxLL 2 and LxxLL 3 motifs completely
abolished interactions with the LBDs of SmRXR1 and
SmNR1. These results clearly demonstrate that the mode
of interaction between SmCBP1 and NRs differ from that
characterised for the mammalian CBP/p300.
Our data on protein–protein interactions provide com-
pelling evidence that SmRXR1 and SmNR1 interacted spe-
cifically with GC N5, SmNCoA-62 and SmCBP1 in
solution. To gain further insight into the function of schis-
tosome NR-co-activator interactions, gel shift assays were
carried out wi th the SmRXR1/SmNR1 heterodimer on a
DR2 DNA element.
Incubation of a SmRXR1/SmNR1 heterodimer with the
DR2 probe produced band retardation, and coincubation
with either SmNCoA-62, SmGCN5 or both, increased
intensity of the retarded bands, indicating that SmNCoA-
62 and SmGCN5 enhanced heterodimer-DNA complex
formation. However, a supershifted ternary complex was
not observed. Failure to observe a supershift ternary com-
plex is not unprecedented because sim ilar observations
have been reported previously for other transcription fac-
tors (including NR co-activators) in gel shift assays
(Romine et al., 1998; Itoh et al., 2000; Lee et al., 2005).
It is possible that the stoichiometry of the SmRXR1/
SmNR1 heterodimer bound to DNA changes upon co-acti-
vator binding without changing the mobility of the
retarded complex. Yet another possibility is that a co-acti-
vator-SmRXR1/SmNR1 complex bound to DNA cannot
withstand the EMSA conditions. Alternatively, the co-acti-
vators may increase the affinity of SmRXR1/SmNR1 to
DNA by inducing a conformational change in the hetero-
dimer, and the binding of SmGCN5 or SmNCoA-62 to
SmRXR1/SmNR1 may be mutually exclusive with the
binding of SmRXR1/SmNR1 to DNA . It is this possibility
that we most favour to explain why the addition of
SmGCN5 or SmNCoA-62 enhanced SmRXR1/SmNR1
binding without changing the mobility of the complex.
Although the individual addition of co-activators to the
SmRXR1/SmNR1-DNA complex did not generate a
supershift, simultaneous addition of all three co-activators,
SmGCN5, SmNCoA-62 and SmCBP1 (in the form of
LxxLL 2 or LxxLL 3 peptides) gave rise to a high molecu-
lar weigh complex. Since the addition of SmGCN5 and
SmNCoA-62 together did not generate a supershift, it
became clear that the presence of the LxxLL motifs of
SmCBP1 was critical for assembly of the entire complex.
We suggest that the formation of this molecular complex
was achieved by way of a major structural change in the
AF2 domains of the heterodimer, conditioned by the bind-
ing of the SmCBP1-LxxLL motif peptides. It has recently
been reported that co-activator LxxLL motif binding can
induce conformational changes in AF2 and impac t ligand
binding kinetics (He et al., 2002, 2004).
LxxLL-peptides of SmCBP1, rather than their full-
length form, were chosen to be assayed in this study based
on previous studies where the use of peptide binding agreed
well with the binding data of a full-length cofactor ( Faroo-
qui et al., 2003; Pogenberg et al., 2005). For example, the
full-length cofactor recruitment of SRC3, FHL2, SRC1
and RIP140 (Farooqui et al., 2003; Tzameli et al., 2003;
Klein et al., 2005; Pogenberg et al., 2005) is reflected by
the recruitme nt of peptides derived from these co-act iva-
tors. These studies also ranked the co-activator LxxLL
peptides as those that could bind avidly to the LBD in
the absence of an agonist, peptides that could bind only
in the presence of a ligand, and peptides that did not bind
at all.
NRs require a number of distinct classes of factors and/
or complexes for their functions in gene regulation. From
the most current views on the molecular mechanisms of
gene regulation by DNA-binding transcription factors, it
appears that a number of complexes and factors associate
with a given transcription factor in a sequential and highly
regulated mann er. However, whilst verte brate NRs appear
to recruit an intricate number of factors/complexes, trig-
gered by the arrival of the p160 co-activators to the NR-
bound DNA, it is still unclear whether schistosome NR
molecules require many, limited or different factors/com-
plexes to achieve a full activity of the target promoters.
Advances in the understanding of molecular mechanisms
that underlie NR function in the parasite S. mansoni will
certainly contribute to drug discovery.
Acknowledgments
This work was supported by NIH Grant D43TW006580
to P.T.L. and grants from Conselho Naci onal de Desen-
volvimento Cientı
´
fico e Tecnolo
´
gico (CNPq) and Fun-
dacßa
˜
o de Amparo a Pesquisa do Estado do Rio de
Janeiro (FAPERJ) to M.R.F. FMBO received a PDEE fel-
M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147 1145
lowship from Coordenacßa
˜
o de Aperfeicßoamento de Pessoal
de Nı
´
vel Superior (CAPES – Bolsa PDEE N
o
BEX0518/
05-0, Brazil). We are indebted to Dr. Raymond Pierce (Pas-
teur Institute, Lille) for providing the full-length GST-
SmCBP1 clone.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at doi:10.1016/j.ijpara.
2008.02.003.
References
Baudino, T.A., Kraichely, D.M., Jefcoat Jr., S.C., Winchester, S.K.,
Partridge, N.C., MacDonald, P.N., 1998. Isolation and characteriza-
tion of a novel co-activator protein, NCoA-62, involved in vitamin D-
mediated transcription. J. Biol. Chem. 273, 16434–16441.
Berger, S.L., 2002. Histone modifications in transcriptional regulation.
Curr. Opin. Genet. Dev. 12, 142–148.
Bertin, B., Oger, F., Cornette, J., Caby, S., Noel, C., Capron, M.,
Fantappie, M.R., Rumjanek, F.D., Pierce, R.J., 2006. Schistosoma
mansoni CBP/p300 has a conserved domain structure and interacts
functionally with the nuclear receptor SmFtz-F1. Mol. Biochem.
Parasitol. 146, 180–191.
Brown, K., Chen, Y., Underhill, T.M., Mymryk, J.S., Torchia, J., 2003.
The co-activator p/CIP/SRC-3 facilitates retinoic acid receptor
signaling via recruitment of GCN5. J. Biol. Chem. 278, 39402–39412.
Chakravarti, D., LaMorte, V.J., Nelson, M.C., Nakajima, T., Schulman,
I.G., Juguilon, H., Montminy, M., Evans, R.M., 1996. Role of CBP/
P300 in nuclear receptor signalling. Nature 383, 99–103.
Chen, W.Y., Juan, L.J., Chung, B.C., 2005. SF-1 (nuclear receptor 5A1)
activity is activated by cyclic AMP via p300-mediated recruitment to
active foci, acetylation, and increased DNA binding. Mol. Cell Biol.
25, 10442–10453.
Choi, C.H., Hiromura, M., Usheva, A., 2003. Transcription factor IIB
acetylates itself to regulate transcription. Nature 424, 965–969.
Dahl, R., Wani, B., Hayman, M.J., 1998. The Ski oncoprotein interacts
with SKIP, the human homolog of Drosophila Bx42. Oncogene 16,
1579–1586.
de Mendonca, R.L., Escriva, H., Bouton, D., Zelus, D., Vanacker, J.M.,
Bonnelye, E., Cornette, J., Pierce, R.J., Laudet, V., 2000. Structural
and functional divergence of a nuclear receptor of the RXR family
from the trematode parasite Schistosoma mansoni. Eur. J. Biochem.
267, 3208–3219.
De Mendonca, R.L., Bouton, D., Bertin, B., Escriva, H., Noel, C.,
Vanacker, J.M., Cornette, J., Laudet, V., Pierce, R.J., 2002. A
functionally conserved member of the FTZ-F1 nuclear receptor family
from Schistosoma mansoni. Eur. J. Biochem. 269, 5700–5711.
de Oliveira, F.M., da Silva, I.C., Rumjanek, F.D., Valadao, A.F., Franco,
G.R., Mesquita, R.D., da Silva-Neto, M.A., Fantappie, M.R., 2004.
Functional properties of Schistosoma mansoni single-stranded DNA-
binding protein SmPUR-alpha. Description of the interaction between
SmPUR-alpha and SMYB1. Mol. Biochem. Parasitol. 135, 21–30.
Fantappie, M.R., Freebern, W.J., Osman, A., LaDuca, J., Niles, E.G.,
LoVerde, P.T., 2001. Evaluation of Schistosoma mansoni reti-
noid  receptor (SmRXR1 and SmRXR2) activity and tissue distri-
bution. Mol. Biochem. Parasitol. 115, 87–99.
Farooqui, M., Franco, P.J., Thompson, J., Kagechika, H., Chandraratna,
R.A., Banaszak, L., Wei, L.N., 2003. Effects of retinoid ligands on
RIP140: molecular interaction with retinoid receptors and biological
activity. Biochemistry 42, 971–979.
Freebern, W.J., Niles, E.G., LoVerde, P.T., 1999. RXR-2, a member
of the retinoid  receptor family in Schistosoma mansoni. Gene 233,
33–38.
Fu, M., Wang, C., Zhang, X., Pestell, R.G., 2004. Acetylation of nuclear
receptors in cellular growth and apoptosis. Biochem. Pharmacol. 68,
1199–1208.
Goodman, R.H., Smolik, S., 2000. CBP/p300 in cell growth, transforma-
tion, and development. Genes Dev. 14, 1553–1577.
Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to
estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–
704.
He, B., Minges, J.T., Lee, L.W., Wilson, E.M., 2002. The FXXLF motif
mediates androgen receptor-specific interactions with coregulators. J.
Biol. Chem. 277, 10226–10235.
He, B., Gampe Jr., R.T., Kole, A.J., Hnat, A.T., Stanley, T.B., An, G.,
Stewart, E.L., Kalman, R.I., Minges, J.T., Wilson, E.M., 2004.
Structural basis for androgen receptor interdomain and co-activator
interactions suggests a transition in nuclear receptor activation
function dominance. Mol. Cell 16, 425–438.
Heery, D.M., Hoare, S., Hussain, S., Parker, M.G., Sheppard, H., 2001.
Core LXXLL motif sequences in CREB-binding protein, SRC1, and
RIP140 define affinity and selectivity for steroid and retinoid receptors.
J. Biol. Chem. 276, 6695–6702.
Hu, R., Niles, E.G., LoVerde, P.T., 2006a. DNA binding and transac-
tivation properties of the Schistosoma mansoni constitutive androstane
receptor homologue. Mol. Biochem. Parasitol. 150, 174–185.
Hu, R., Wu, W., Niles, E.G., LoVerde, P.T., 2006b. SmTR2/4, a
Schistosoma mansoni homologue of TR2/TR4 orphan nuclear recep-
tor. Int. J. Parasitol. 36, 1113–1122.
Hu, R., Wu, W., Niles, E.G., Loverde, P.T., 2006c. Isolation and
characterization of Schistosoma mansoni constitutive androstane
receptor. Mol. Biochem. Parasitol. 148, 31–43.
Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of
phylogenetic trees. Bioinformatics 17, 754–755.
Itoh, S., Ericsson, J., Nishikawa, J., Heldin, C.H., ten Dijke, P., 2000. The
transcriptional co-activator P/CAF potentiates TGF-beta/Smad sig-
naling. Nucleic Acids Res. 28, 4291–4298.
Jaber, B.M., Gao, T., Huang, L., Karmakar, S., Smith, C.L., 2006. The
pure estrogen receptor antagonist ICI 182,780 promotes a novel
interaction of estrogen receptor-alpha with the 3
0
,5
0
-cyclic adenosine
monophosphate response element-binding protein-binding protein/
p300 co-activators. Mol. Endocrinol. 20, 2695–2710.
Jacob, A.L., Lund, J., Martinez, P., Hedin, L., 2001. Acetylation of
steroidogenic factor 1 protein regulates its transcriptional activity and
recruits the co-activator GCN5. J. Biol. Chem. 276, 37659–37664.
Jenuwein, T., Allis, C.D., 2001. Translating the histone code. Science 293,
1074–1080.
Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin,
S.C., Heyman, R.A., Rose, D.W., Glass, C.K., Rosenfeld, M.G., 1996.
A CBP integrator complex mediates transcriptional activation and AP-
1 inhibition by nuclear receptors. Cell 85, 403–414.
Khan, O.Y., Nawaz, Z., 2003. Nuclear hormone receptor co-regulators.
Curr. Opin. Drug Discov. Devel. 6, 692–701.
Kim, M.Y., Woo, E.M., Chong, Y.T., Homenko, D.R., Kraus, W.L.,
2006. Acetylation of estrogen receptor alpha by p300 at lysines 266 and
268 enhances the deoxyribonucleic acid binding and transactivation
activities of the receptor. Mol. Endocrinol. 20, 1479–1493.
Klein, F.A., Atkinson, R.A., Potier, N., Moras, D., Cavarelli, J., 2005.
Biochemical and NMR mapping of the interface between CREB-
binding protein and ligand binding domains of nuclear receptor:
beyond the LXXLL motif. J. Biol. Chem. 280, 5682–5692.
Lee, J.E., Kim, K., Sacchettini, J.C., Smith, C.V., Safe, S., 2005. DRIP150
coactivation of estrogen receptor alpha in ZR-75 breast cancer cells is
independent of LXXLL motifs. J. Biol. Chem. 280, 8819–8830.
Levy, L., Wei, Y., Labalette, C., Wu, Y., Renard, C.A., Buendia, M.A.,
Neuveut, C., 2004. Acetylation of beta-catenin by p300 regulates beta-
catenin-Tcf4 interaction. Mol. Cell Biol. 24, 3404–3414.
Lu, C., Niles, E.G., LoVerde, P.T., 2006a. Characterization of the DNA-
binding properties and the transactivation activity of Schistosoma
mansoni nuclear receptor fushi tarazu-factor 1alpha (SmFTZ-
F1alpha). Mol. Biochem. Parasitol. 150, 72–82.
1146 M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147
Lu, C., Wu, W., Niles, E.G., LoVerde, P.T., 2006b. Identification and
characterization of a novel fushi tarazu factor 1 (FTZ-F1) nuclear
receptor in Schistosoma mansoni. Mol. Biochem. Parasitol. 150, 25–36.
MacDonald, P.N., Baudino, T.A., Tokumaru, H., Dowd, D.R., Zhang,
C., 2001. Vitamin D receptor and nuclear receptor co-activators:
crucial interactions in vitamin D-mediated transcription. Steroids 66,
171–176.
Matangkasombut, O., Buratowski, R.M., Swilling, N.W., Buratowski, S.,
2000. Bromodomain factor 1 corresponds to a missing piece of yeast
TFIID. Genes Dev. 14, 951–962.
Matangkasombut, O., Buratowski, S., 2003. Different sensitivities of
bromodomain factors 1 and 2 to histone H4 acetylation. Mol. Cell 11,
353–363.
McKenna, N.J., Xu, J., Nawaz, Z., Tsai, S.Y., Tsai, M.J., O’Malley, B.W.,
1999. Nuclear receptor co-activators: multiple enzymes, multiple
complexes, multiple functions. J. Steroid Biochem. Mol. Biol. 69, 3–12.
Muth, V., Nadaud, S., Grummt, I., Voit, R., 2001. Acetylation of
TAF(I)68, a subunit of TIF-IB/SL1, activates RNA polymerase I
transcription. EMBO J. 20, 1353–1362.
Onate, S.A., Tsai, S.Y., Tsai, M.J., O’Malley, B.W., 1995. Sequence and
characterization of a co-activator for the steroid hormone receptor
superfamily. Science 270, 1354–1357.
Plevin, M.J., Mills, M.M., Ikura, M., 2005. The LxxLL motif: a
multifunctional binding sequence in transcriptional regulation. Trends
Biochem. Sci. 30, 66–69.
Pogenberg, V., Guichou, J.F., Vivat-Hannah, V., Kammerer, S., Perez, E.,
Germain, P., de Lera, A.R., Gronemeyer, H., Royer, C.A., Bourguet,
W., 2005. Characterization of the interaction between retinoic acid
receptor/retinoid  receptor (RAR/RXR) heterodimers and transcrip-
tional co-activators through structural and fluorescence anisotropy
studies. J. Biol. Chem. 280, 1625–1633.
Romine, L.E., Wood, J.R., Lamia, L.A., Prendergast, P., Edwards, D.P.,
Nardulli, A.M., 1998. The high mobility group protein 1 enhances
binding of the estrogen receptor DNA binding domain to the estrogen
response element. Mol. Endocrinol. 12, 664–674.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Strahl, B.D., Allis, C.D., 2000. The language of covalent histone
modifications. Nature 403, 41–45.
Thompson, P.R., Wang, D., Wang, L., Fulco, M., Pediconi, N., Zhang,
D., An, W., Ge, Q., Roeder, R.G., Wong, J., Levrero, M., Sartorelli,
V., Cotter, R.J., Cole, P.A., 2004. Regulation of the p300 HAT
domain via a novel activation loop. Nat. Struct. Mol. Biol. 11, 308–
315.
Tzameli, I., Chua, S.S., Cheskis, B., Moore, D.D., 2003. Complex effects
of rexinoids on ligand dependent activation or inhibition of the
xenobiotic receptor, CAR. Nucl. Recept. 1 (2).
Vo, N., Fjeld, C., Goodman, R.H., 2001. Acetylation of nuclear hormone
receptor-interacting protein RIP140 regulates binding of the transcrip-
tional corepressor CtBP. Mol. Cell Biol. 21, 6181–6188.
Wang, C., Fu, M., Angeletti, R.H., Siconolfi-Baez, L., Reutens, A.T.,
Albanese, C., Lisanti, M.P., Katzenellenbogen, B.S., Kato, S., Hopp,
T., Fuqua, S.A., Lopez, G.N., Kushner, P.J., Pestell, R.G., 2001.
Direct acetylation of the estrogen receptor alpha hinge region by p300
regulates transactivation and hormone sensitivity. J. Biol. Chem. 276,
18375–18383.
Wieland, C., Mann, S., von Besser, H., Saumweber, H., 1992. The
Drosophila nuclear protein Bx42, which is found in many puffs on
polytene chromosomes, is highly charged. Chromosoma 101, 517–
525.
Wu, W., Niles, E.G., El-Sayed, N., Berriman, M., LoVerde, P.T.,
2006. Schistosoma mansoni (Platyhelminthes, Trematoda) nuclear
receptors: sixteen new members and a novel subfamily. Gene 366,
303–315.
Wu, W., Niles, E.G., Hirai, H., LoVerde, P.T., 2007a. Identification
and characterization of a nuclear receptor subfamily I member in
the Platyhelminth Schistosoma mansoni (SmNR1). FEBS J. 274,
390–405.
Wu, W., Niles, E.G., Hirai, H., LoVerde, P.T., 2007b. Evolution of a
novel subfamily of nuclear receptors with members that each contain
two DNA binding domains. BMC Evol. Biol. 7, 27.
Yang, X.J., 2004. Lysine acetylation and the bromodomain: a new
partnership for signaling. Bioessays 26, 1076–1087.
Zhang, C., Baudino, T.A., Dowd, D.R., Tokumaru, H., Wang, W.,
MacDonald, P.N., 2001. Ternary complexes and cooperative interplay
between NCoA-62/Ski-interacting protein and steroid receptor co-
activators in vitamin D receptor-mediated transcription. J. Biol. Chem.
276, 40614–40620.
M.R. Fantappie
´
et al. / International Journal for Parasitology 38 (2008) 1133–1147 1147
111
DISCUSSÃO
A complexidade morfológica e comportamental dos organismos não são garantidas
pelo seu número de genes, mas podem ser devido a regulações de expressão gênica mais
complexas. O
Schistosoma mansoni é um parasito eucarioto multicelular com ciclo de vida
extremamente complexo, passando por estágios de vida bastante diferentes morfológica e
fisiologicamente. A adaptação a diferentes ambientes, maturação do estágio larvar para as
formas adultas, diferenciação sexual e ovogênese do
S. mansoni, tornam esse parasito um
excelente modelo de estudo para a investigação dos mecanismos de regulação da expressão
gênica. O estágio de produção de ovos durante a infecção pelo parasito é a causa da patogenia
em milhares de pessoas em todo mundo e o responsável pela disseminação da doença.
Portanto, o estudo do desenvolvimento sexual da fêmea e da ovogênese pode ser de grande
importância para o controle da esquistossomose (LO VERDE & CHEN, 1991; FANTAPPIÉ
et al., 2001). A regulação da transcrição de genes sexo-estágio específicos deve estar ligada a
mecanismos moleculares muito bem orquestrados, que dependem da coordenação de
inúmeros eventos de repressão e ativação de genes alvo em momentos e lugares específicos,
durante o desenvolvimento do parasito. Vários genes de esquistossomo têm sido identificados
como sendo expressos apenas nas fêmeas maduras (MICHEL
et al., 2003; HOFFMANN et
al.
, 2002; GREVELDING et al., 1997; SCHUSSLER et al., 1997; ROCHE et al., 1996;
MOSER
et al., 1992; LO VERDE & CHEN, 1991; BOBEK et al., 1986), a maioria deles
envolvidos de alguma forma na produção de ovos. Nesse sentido, o gene
p14 de S. mansoni,
que codifica para uma proteína precursora da casca do ovo, tem sido modelo de estudo da
expressão gênica específica em fêmeas.
112
SmGCN5 e SmCBP1: Duas Histona Acetiltransferases de Schistosoma Mansoni e Seu
Papel no Remodelamento da Cromatina.
O empacotamento do DNA em forma de cromatina reprime a transcrição por impedir
a ligação de fatores transcricionais e da maquinaria basal de transcrição aos sítios de DNA
(OWEN-HUGHES & WORKMAN, 1994; PARANJAPE
et al., 1994) e por bloquear a
elongação transcricional (ORPHANIDES
et al., 1998). A observação no aumento da
afinidade dos fatores transcricionais ao DNA tem sido atribuída a acetilação das histonas
nucleossomais (JUAN
et al., 1994; VETTESE-DADEY et al., 1996). Uma longa história de
estudos mostrou uma forte relação entre a presença de resíduos de lisina acetilados na região
N-terminal das histonas e a atividade transcricional dos genes correspondentes (LOIDL, 1994;
TURNER & O' NEILL, 1995).
Dentre os co-ativadores com potente atividade HAT estão as proteínas p300/CBP e
PCAF/GCN5. Ambas as proteínas são capazes de acetilar tanto histonas como proteínas não-
histona, incluindo os receptores nucleares, e, portanto regulando a atividade dessas proteínas
(CHEN
et al., 1997). Nesse contexto, foram clonados cDNAs que codificam para duas histona
acetiltransferases em
Schistosoma mansoni: SmCBP1 (figura 19 B) e SmGCN5 (figura 19 A;
de MORAES MACIEL
et al., 2004 – figura 1). Tanto SmCBP1 (figura 19 B) como SmGCN5
(figura 19 A; de MORAES MACIEL
et al., 2004 – figura 1) apresentam os domínios
conservados característicos das proteínas relacionadas, respectivamente. A proteína
SmGCN5
possui alta similaridade tanto em seqüência (de MORAES MACIEL
et al., 2004 - figura 1),
como em estrutura 3D dos domínios funcionais HAT e bromo (figura 15). A comparação dos
amino ácidos de
SmGCN5 com outras seis proteínas GCN5 relacionadas (de MORAES
MACIEL
et al., 2004 - figura 1) revela similaridade de 93,4% (34% de identidade) no
domínio catalítico HAT. O domínio bromo apresentou uma maior conservação entre os
113
resíduos de amino ácidos (96,7% similaridade e 36,1% de identidade). Surpreendentemente,
flanqueando o domínio HAT, encontramos duas seqüências novas não descritas em outras
proteínas GCN5-relacionadas. A região flanqueadora N-terminal contém uma seqüência
adicional de 71 aminoácidos (aa 310–381), enquanto na região C-terminal uma seqüência
adicional de 66 aminoácidos (aa 677–743) foi encontrada (de MORAES MACIEL
et al., 2004
- figura 1).
SmCBP1 apresenta todos os principais domínios típicos das proteínas da família
CBP/p300, compreendendo o domínio KIX e outros motivos envolvidos na ligação de
ativadores transcricionais, os domínios bromo e HAT (figura 19 B). Ambos os co-ativadores
possuem o motivo de interação com receptores nucleares (LXXLL) (de MORAES MACIEL
et al., 2004 – figura 1; BERTIN et al., 2006). O primeiro motivo de interação com RNs
presente em
SmGCN5 foi encontrado na região N-terminal dessa proteína (de MORAES
MACIEL
et al., 2004 – figura 1). No entanto, o segundo motivo de interação foi encontrado
no domínio catalítico HAT (FANTAPPIÉ
et al., 2008a – figura 5 A), e segundo o nosso
conhecimento, essa é a primeira vez que esse motivo é descrito em proteínas do tipo GCN5. O
domínio catalítico HAT de ambas as proteínas é capaz de transferir o grupo acetil da Acetil-
Coenzima A para histonas (de MORAES MACIEL
et al., 2004 – figura 3; de MORAES
MACIEL
et al., 2008 – figura 1; figuras 20 e 21), o que sugere que essas proteínas possuem a
atividade catalítica HAT. Mais especificamente, as histonas H3 e H2A são acetiladas tanto
por
SmGCN5 (de MORAES MACIEL et al., 2004 – figura 3A) como por SmCBP1 (figura
20). O substrato de acetilação descrito para proteínas GCN5 homólogas são as histonas H3 e
H2B (TANNER
et al., 2000), no entanto é a primeira vez que se demonstra a acetilação de
histona H2A pelo domínio HAT de uma proteína GCN5.
Estudos iniciais utilizando GCN5 recombinante mostraram que a acetilação é não
específica para os resíduos de lisina, predominantemente acetilando a lisina 14 da histona H3
114
(GRANT et al., 1997). A acetilação in vivo pode ocorrer nos resíduos de lisina 9, 14, 18 e 23,
e a acetilação da lisina 14 tem sido associada com a ativação da transcrição e expressão
gênica (ROTH & ALLIS, 1996). Uma melhor caracterização dos padrões de acetilação das
duas histona acetiltransferases de
S. mansoni revelou que a região N-terminal da histona H3 é
acetilada em um único resíduo pela enzima
SmGCN5 (de MORAES MACIEL et al., 2004 –
figura 3 C), especificamente na lisina 14 da histona H3, tanto para
SmGCN5 (de MORAES
MACIEL
et al., 2008 – figura 1) como para SmCBP1 (figura 22). Portanto, assumimos que
ambas as histonas acetiltransferases desempenham um papel na ativação transcricional em
S.
mansoni
.
In vivo yGcn5 também acetila as lisinas 9 e 18 da histona H3, lisinas 8 e 16 da histona
H4 e alguns resíduos de lisina da histona H2B, sendo em um grau bem menor do que a
acetilação da lisina 14 da histona H3 (TANNER
et al., 2000). A enzima SmGCN5 não é
capaz de acetilar o peptídeo da região N-terminal da histona H4 (de MORAES MACIEL
et
al.
, 2008 – figura 1), o que torna claro que, apesar da alta similaridade entre ela e suas
ortólogas, a proteína do
S. mansoni possui diferenças no reconhecimento de substratos.
Ainda referente a
SmGCN5, a idéia da sua participação efetiva na ativação
transcricional no parasito é reforçada pelos dados que mostram essa proteína expressa no
núcleo, mais especificamente em estruturas de grânulos de intercromatina (de MORAES
MACIEL
et al., 2008 – figura 3). Essas estruturas são descritas como regiões de alta atividade
transcricional, com vários fatores de elongação transcricional chaves, complexos de
remodelamento de cromatina e essencialmente todos os fatores necessários para o “splicing”
de RNA mensageiro presentes (LAMOND & SPECTOR, 2003; SAITOH
et al., 2004).
A proteína CBP/p300 é uma histona acetiltransferase que possui sítios de interação
com as proteínas PCAF/GCN5, outros co-ativadores de receptores nucleares, e os próprios
receptores (STERNER & BERGER, 2000). Esse é um exemplo de um complexo de regulação
115
transcricional que contem várias proteínas com atividade acetiltransferase. CBP/p300 e
GCN5/PCAF geralmente atuam sinergisticamente na ativação transcricional. Em alguns
casos, a presença de GCN5 aumenta em até 30 % os níveis de acetilação de histonas (LEE,
2002). CBP/p300 e PCAF/GCN5 existem em um complexo multiprotéico
in vivo e funcionam
como co-ativadores para uma variedade de fatores transcricionais (JANKNECHT &
HUNTER, 1996; NAKATANI, 2001). Assim como descrito para as proteínas de outros
organismos, os co-ativadores
SmGCN5 e SmCBP1 são capazes de interagir entre si
(FANTAPPIÉ
et al., 2008a – figura 5 D), indicando uma possível participação em conjunto
dessas proteínas em um complexo protéico de regulação gênica no
S. mansoni.
SmGCN5 e SmCBP1 Atuam Como Co-Ativadores de Receptores Nucleares
Normalmente os co-ativadores desempenham um ou mais papéis na atividade
transcricional dos receptores nucleares: (1) funcionam como pontes para o recrutamento de
co-fatores para os receptores nucleares ligados ao DNA (por exemplo, proteínas SRC
recrutam p300/CBP para o DNA ligado aos receptores, revisado em LEO & CHEN, 2000);
(2) acetilam histonas nucleossomais e vários fatores de transcrição dos promotores de genes
alvos regulados por hormônio (por exemplo, p300/CBP e PCAF/GCN5, os quais têm potente
atividade de acetilação de histonas nucleossomais e de fatores transcricionais, revisado em
McKENNA
et al., 1999); e (3) funcionam como pontes entre os receptores ligados ao DNA e
a maquinaria basal de transcrição. As interações entre os receptores nucleares, complexos de
remodeladores de cromatina e co-ativadores nos promotores ativados por hormônios levam ao
estímulo da transcrição gênica, integrando a sinalização de vias que regulam diversos
processos biológicos.
116
Estudos mostrando a ativação da transcrição de um gene repórter pelo heterodímero
SmNR1/SmRXR1, em células de mamíferos, sugerem a participação dos co-ativadores de
mamíferos na regulação da transcrição realizada por esses receptores nucleares (WU
et al.,
2007). Esses foram os primeiros indícios de que os co-ativadores de receptores nucleares de
S.
mansoni
poderiam atuar com um mecanismo similar na regulação da transcrição gênica
regulada por esse heterodímero no parasito.
A participação dos co-ativadores na transcrição de genes alvos regulados pelos
receptores nucleares foi evidenciada em experimentos de interação
in vitro (“pull down”)
entre os co-ativadores (
SmGCN5 e SmCBP1) e os receptores nucleares. Os resultados
mostram que tanto
SmGCN5 como SmCBP1 interagem com os receptores SmRXR1 e SmNR1
(FANTAPPIÉ
et al., 2008a – figura 5 A e 5 D).
O motivo de interação com receptores nucleares (LXXLL), representado duas vezes
em
SmGCN5 (de MORAES MACIEL et al., 2004 – figura 1), é encontrado na maioria dos
co-ativadores de receptores nucleares. A presença desse motivo é obrigatória para mediar a
associação dos co-ativadores com os receptores ligados ao ligante (ARANDA & PASCUAL,
2001). Além disso, esse motivo está envolvido na interação entre as proteínas do complexo
multiprotéico envolvido na ativação transcricional. Mapeando as regiões de
SmGCN5 que
ligam nas proteínas
SmRXR1 e SmNR1, verificamos que o domínio HAT, contendo o motivo
(LLELL), apresenta forte interação com os receptores (FANTAPPIÉ
et al., 2008a – figura 5
A). Não obstante a necessidade do motivo propriamente dito, os aminoácidos que o
flanqueiam são importantes para o reconhecimento e ligação dos co-ativadores nos receptores
nucleares (HEERY
et al., 2001; SAVKUR & BURRIS, 2004; McINERNEY et al., 1998).
Nesse sentido, mostramos ainda, que apenas o polipeptídeo contendo o motivo LLELL, mas
não o polipeptídeo contendo o motivo LCNLL (presente na região N-terminal) é capaz de
117
interagir com os receptores (FANTAPPIÉ et al., 2008a – figura 5 A), provando a importância
dos aminoácidos flanqueadores.
Outra região de interação entre
SmGCN5 e os receptores é o domínio bromo
(FANTAPPIÉ
et al., 2008a – figura 5 A). Esse domínio é encontrado em grande parte dos co-
ativadores, embora seu papel funcional ainda seja especulativo. Entretanto o domínio bromo
parece participar do processo catalítico e conseqüentemente, nas interações proteína-proteína
(MARMORSTEIN & BERGER, 2001). Ele é capaz de reconhecer e ligar resíduos de lisina
acetilados (DHALLUIN
et al., 1999), servindo como mecanismo importante na regulação das
interações proteína-proteína em vários processos celulares incluindo o remodelamento da
cromatina e a ativação transcricional (DYSON
et al., 2001; WINSTON & ALLIS, 1999;
SYNTICHAKI
et al., 2000; STRAHL & ALLIS, 2000).
Já foi demonstrado que CBP/p300 aumenta a transativação transcricional pelos
receptores nucleares RXR, RAR e TR (CHAKRAVARTI
et al., 1996). No contexto do S.
mansoni
, os ensaios de interação com SmCBP1 mostraram que este co-ativador interage com
os receptores
SmRXR1 e SmNR1 através dos motivos LXXLL 2 e LXXLL 3 presentes na
região N-terminal e no domínio HAT, respectivamente (FANTAPPIÉ
et al., 2008a – figura 6
A). Esses dados sugerem que ambos os motivos de interação com os receptores nucleares são
necessários e suficientes para a interação de
SmCBP1 com SmRXR1 e SmNR1.
A proteína
SmNCoA-62, identificada recentemente, é um co-ativador importante que
interage com os receptores
SmRXR1 e SmNR1 (FANTAPPIÉ et al., 2008a). Ela não participa
da interação com o co-ativador
SmCBP1, no entanto se liga fortemente a SmGCN5
(FANTAPPIÉ
et al., 2008 A – figura 5 E), além de ser acetilada por essa enzima (de
MORAES MACIEL
et al., 2008 – figura 2).
Foi mostrado que a adição individual ou em conjunto dos co-ativadores (
SmGCN5,
SmCBP1 e SmNCoA-62) ao complexo do heterodímero SmNR1/SmRXR1 ligado ao DNA
118
aumenta essa ligação (FANTAPPIÉ et al., 2008a). Esses dados reúnem os co-ativadores e
receptores nucleares de
S. mansoni em um mesmo complexo protéico de interação com DNA.
Provável Envolvimento das HATs de S. mansoni na Regulação do Gene p14 Mediada
pelos Receptores Nucleares do Parasito
Como relatado anteriormente, estudos feitos com seqüências regulatórias presentes na
região promotora do gene
p14 de S. mansoni mostraram que tanto SmRXR1 e SmRXR2
(como monômeros), como o heterodímero
SmRXR1/SmNR1 reconhecem e se ligam nas
seqüências de DNA (HRE-DR5 e HRE-DR17, respectivamente) (FREEBERN
et al., 1999;
FANTAPPIÉ
et al., 2001; FANTAPPIE et al., 2008b). Esses dados indicam a participação
desses receptores na regulação da transcrição do gene
p14. Propomos que essa regulação seja
realizada através da atividade HAT das histona acetilatransferases isoladas no presente
trabalho, e das interações entre os RNs e esses co-ativadores. Os dados de acetilação dos
próprios receptores nucleares
SmRXR1 e SmNR1 (FANTAPPIÉ et al., 2008a – figura 3 A; de
MORAES MACIEL
et al., 2008 – figura 2), além do possível papel de remodelamento da
cromatina, através da acetilação de histonas pelos co-ativadores
SmCBP1 e SmGCN5,
evidenciam o proposto acima.
Experimentos de hibridização
in situ com os receptores SmRXR1 e SmRXR2
mostraram que esses genes são transcritos nas células vitelínicas, e através de
imunolocalização observou-se que as proteínas codificadas por esses genes também estão
presentes nas células da vitelária (FANTAPPIÉ
et al., 2001). Esses resultados corroboram a
idéia da participação efetiva de receptores nucleares de
S. mansoni na regulação da
transcrição do gene
p14. Através da microscopia eletrônica foi revelada a presença da
proteína
SmGCN5 no núcleo de células vitelínicas de vermes fêmeas sexualmente maduras
119
(de MORAES MACIEL et al., 2008 – figura 3). Esses dados nos sugerem que tanto os
receptores quanto os co-ativadores estão envolvidos, como um complexo multiprotéico, na
regulação do gene
p14, imprescindível na produção dos ovos de esquistossomo.
Os dados que evidenciam a participação efetiva dos co-ativadores na via de
sinalização dos receptores nucleares em
S. mansoni, onde os dois grupos de proteínas estão
presentes em um mesmo complexo multiprotéico de interação com DNA, foram obtidos em
experimentos com seqüências alvo de DNA que não seguiam o motivo consenso hexamérico
para receptores nucleares (HRE-DR5 - figura 17) (FREEBERN
et al., 1999), ou seqüências
alvo de DNA sintéticos que imitam elementos hexaméricos típicos de vertebrados (5’-
PuGGTCA: HRE-DR1-DR5) (WU
et al., 2007; FANTAPPIÉ et al., 2008a). Nesse contexto,
o estudo da regulação transcricional mediada por receptores nucleares, e os co-ativadores de
S. mansoni, utilizando o novo elemento hexamérico (p14-DR17) identificado recentemente no
promotor do gene
p14 (figura 17) (FANTAPPIÉ et al., 2008b) pode elucidar os mecanismos
moleculares envolvidos na ativação transcricional desse gene de
Schistosoma mansoni.
Programas para erradicação da esquistossomose atualmente baseiam-se no uso de
quimioterápicos como o praziquantel. No entanto, já foram registradas ocorrências de falhas
nos tratamentos utilizando esse medicamento, no Egito (ISMAIL
et al., 1996, 1999) e Senegal
(GRYSEELS
et al., 1994; STELMA et al., 1995). Essas falhas no tratamento podem ser
relacionadas a uma provável resistência ao praziquantel, visto que ele é ineficiente em formas
imaturas do verme e após 3-4 semanas da infecção com o parasito (CIOLI & PICA-
MATTOCCIA, 2003). Além disso, essas ocorrências foram observadas em regiões
endêmicas, com alta reincidência de infecção. Essa provável resistência a drogas gera uma
discussão a respeito da eficácia desse tipo de tratamento. O estudo de vacinas é uma outra
abordagem para a tentativa de erradicação da doença, no entanto ainda é muito inconclusivo e
incerto. Visto que a disseminação da doença e a patologia são causadas pelo ovo produzido
120
pela fêmea, o entendimento dos mecanismos de regulação da transcrição no parasito e uma
melhor compreensão do controle da maturação sexual da fêmea e produção dos ovos em
níveis moleculares podem levar ao desenvolvimento de drogas anti-helmínticas eficazes para
a erradicação da doença. Drogas desenhadas para bloquear alguma etapa no processo de
transcrição dos genes envolvidos na maturação sexual da fêmea e produção de ovos podem
ser uma boa abordagem de desenvolvimento. Nesse sentido, vale ressaltar a presença de duas
seqüências adicionais na proteína
SmGCN5, ausentes em outras proteínas GCN5-relacionadas
(de MORAES MACIEL
et al., 2004 – figura 1). Essas regiões exclusivas do co-ativador de S.
mansoni
são alvos em potencial para o desenho de inibidores específicos. Nesse contexto, é
importante mencionar que as drogas sintéticas desenvolvidas contra doenças que envolvem
vias de sinalização de receptores nucleares são direcionadas contra os co-ativadores (HALL &
MCDONNELL, 2005).
Papel da Acetilação na Localização Subcelular de SmHMGB1 e Provável Atuação como
uma Citocina Pró-inflamatória.
Além da função de remodelamento de cromatina (acetilação de histonas) e atividade
na regulação gênica mediada por receptores nucleares demonstradas neste trabalho,
investigamos o papel das acetilações nas funções exercidas pela proteína não-histona
SmHMGB1.
HMGB1 é uma proteína nuclear não-histona que se liga ao DNA de forma transiente,
estabiliza a formação de nucleossomas e regula a transcrição (DUMITRIU
et al., 2005). Esta
proteína foi primeiramente identificada no começo dos anos 70 através da sua alta mobilidade
eletroforética em gel (GOODWIN
et al., 1973). O papel das modificações pós-traducionais da
HMGB1, principalmente fosforilação e acetilação, e sua influência nas propriedades da
121
proteína tem sido alvo de estudos. Ensaios com proteínas fosforiladas em insetos e vegetais
superiores mostraram que essa modificação é essencial para especificidade de dobramento e
ligação ao DNA. Ao contrário da fosforilação, a acetilação da HMGB1 tem sido estudada em
vertebrados. Proteínas monoacetiladas
in vivo isoladas de células tratadas com butirato
resultaram em um efeito grave no comportamento da HMGB1: um aumento significativo na
sua afinidade de ligação em estruturas de DNA distorcidas foi observado (UGRINOVA
et al.,
2001) junto com uma perda na habilidade de dobrar o DNA (UGRINOVA
et al., 2007).
Portanto, a fosforilação e acetilação de HMGB1 parecem modular suas propriedades
nucleares de mudança da arquitetura do DNA, o que facilita o acesso de complexos de
nucleoproteínas. Nesse sentido, mostramos que
SmHMGB1 e SmHMGB1 CA são capazes
de superenovelar uma molécula de DNA plasmidial, no entanto, a acetilação não tem efeito
nessa função nuclear da proteína (figura 23 B e 24 B). As modificações na atividade de
ligação e dobramento do DNA (“bending”) por proteínas HMGB1 acetiladas foram
observadas em proteínas acetiladas nos resíduos de lisina 2 e 11, presentes no domínio box A
(ASSENBERG
et al., 2008). A proteína SmHMGB1 não possui lisinas correspondentes aos
resíduos 2 e 11 observados na proteína humana. Além disso, a proteína de
S. mansoni é
acetilada especificamente em um ou mais resíduos de lisina no box B, tanto por
SmCBP1
como por
SmGCN5 (figura 22 A e 22 B, respectivamente). A combinação dessas duas
informações pode explicar a ausência de modificação na atividade de superenovelamento do
DNA observada. Apesar dos experimentos de superenovelamento de DNA plasmidial por
proteínas
SmHMGB1 acetiladas terem sido realizados em triplicata e repetidos pelo menos
três vezes, com enzima e Acetil CoA em excesso, não pudemos quantificar os níveis de
acetilação, portanto não podemos afirmar que toda a população de
SmHMGB1 presente na
reação sofreu a modificação pós-traducional. Sendo assim, a hipótese de que a acetilação
tenha alguma influência na atividade de superenovelamento do DNA por
SmHMGB1 não
122
pode ser totalmente descartada. Para se excluir definitivamente a influência da acetilação no
papel nuclear da
SmHMGB1, é necessário ainda investigar as funções de dobramento do
DNA e reconhecimento de estruturas de DNA cruciforme (“four way junction”).
Alguns estudos de mapeamento e estrutura da HMGB1 humana mostram que a cauda
ácida faz contato com a superfície de ligação ao DNA de ambos os boxes da proteína, e que o
domínio box B é escondido por esta cauda (KNAPP
et al., 2004; WATSON et al., 2007;
ASSENBERG
et al., 2008). Apesar da SmHMGB1 possuir apenas 7 resíduos de aminoácido
na região da cauda ácida, acreditamos que a estrutura terciária assume uma conformação onde
esses resíduos sejam capazes de mediar interações iônicas com o box B, tornando o acesso a
esse domínio dificultado. Os dados que mostram um maior nível de acetilação da proteína
sem a cauda ácida, por ambas as histona acetiltransferases de
S. mansoni (figura 22 A e B),
nos sugerem, portanto, que algum tipo de impedimento estérico possa estar sendo mediado
por essa porção C-terminal da
SmHMGB1.
Além de seu papel canônico na manutenção da estrutura da cromatina, recentes
evidências demonstram um papel importante para a HMGB1 extracelular como uma potente
citocina que medeia as respostas a infecção, injúria e inflamação (WANG
et al., 1999).
A HMGB1 está envolvida na patogenicidade de várias doenças inflamatórias,
incluindo sepse bacteriana, artrite, anorexia, tumor metastático e malária, por causa da sua
habilidade de induzir a produção de TNF
por macrófagos. Níveis aumentados de TNF
estão associados com a patologia induzida por ovos em esquistossomose humana. De modo
semelhante, IL-13 desempenha um papel importante na progressão da esquistossomose e
patologia do fígado. Gananasekar e cols. (2006) mostraram que os ovos de
Schsitosoma
mansoni
produzem quantidades abundantes de SmHMGB1, e esta é uma potente indutora de
TNF
e IL-13 em macrófagos do hospedeiro.
123
O papel de HMGB1 como uma proteína pró-inflamatória é possível porque ela é
ativamente secretada por células imune após serem acetiladas por proteínas acetiltransferases,
como p300/CBP e PCAF (um ortólogo de GCN5 em humanos), por exemplo (BONALDI
et
al.
, 2003; PASHEVA et al., 2004). Em S. mansoni já foi demonstrado um possível papel de
mediador pró-inflamatório da proteína
SmHMGB1 (GANANASEKAR et al., 2006), e que o
domínio box B está associado com essa atividade pró-inflamatória. A observação da
acetilação da
SmHMGB1, pelas histona acetiltransferases SmCBP1 e SmGCN5,
especificamente no domínio box B (figura 22 A e B) reforçam essa idéia. Outra forte
evidência da participação de
SmHMGB1 como uma citocina foi obtida a partir dos dados que
mostram a translocação de GFP-
SmHMGB1 do núcleo para o citoplasma em células tratadas
com um inibidor de histonas desacetilases (figura 25).
Considerando que a patologia da esquistossomose se caracteriza por um processo
inflamatório que culmina com a formação de um granuloma hepático, é possível imaginar um
papel importante da HMGB1 do hospedeiro (e a HMGB1 do próprio
S. mansoni, com a
secreção de
SmHMGB1 pelos ovos retidos no fígado), mediando esse processo inflamatório.
Para resumir e facilitar o entendimento dos resultados, um diagrama contendo todas as
proteínas, suas interações e acetilações descritas no presente trabalho foi adicionado (figura
26).
124
Figura 26: Acetilações e interações entre os receptores nucleares e co-ativadores de S. mansoni.
O diagrama mostra o remodelamento da cromatina através da acetilação das histonas pelas HATs
SmCBP1 e SmGCN5. O complexo protéico contendo os co-ativadores e o heterodímero dos receptores
nucleares
SmRXR1 e SmNR1, ligados ao elemento responsivo a hormônio (HRE), mostra as
interações entre essas proteínas e as acetilações sofridas por elas. Sugerimos ainda que esse complexo
seja formado com o heterodímero ligado ao HRE- DR-17 do
S. mansoni. Destaca-se também a
acetilação do fator transcricional
SmHMGB1 pelas HATs do parasito e sua posterior translocação do
núcleo para o citoplasma, de onde possivelmente saia para o meio extracelular para atuar como
mediador pró-inflamatório.
125
REFERÊNCIAS BILBLIOGRÁFICAS
Agresti A & Bianchi ME. HMG proteins and gene expression. Curr. Opin. Genet. Dev.
13: 170-178 (2003).
Allfrey VG, Faulkner RM, Mirsky AE. Acetylation and methylation of histones and
their possible role in the regulation of RNA synthesis.
Proc Natl Acad Sci USA 51:
786–794 (1964).
Angus-Hill ML, Dutnall RN, Tafrov ST, Sternglanz R, Ramakrishnan V. Crystal
structure of the histone acetyltransferase Hpa2: A tetrameric member of the Gcn5-
related N-acetyltransferase superfamily.
J Mol Biol. 294: 1311-25 (1999).
Aoyagi S, Trotter KW, Archer TK. ATP-dependent chromatin remodeling complexes
and their role in nuclear receptor-dependent transcription in vivo.
Vitam Horm. 70:
281-307 (2005).
Aranda A & Pascual A. Nuclear hormone receptors and gene expression.
Physiol
Reviews
81: 1269-304 (2001).
Arany Z, Sellers WR, Livingston DM, Eckner R. E1A-associated p300 and CREB-
associated CBP belong to a conserved family of coactivators.
Cell. 77(6): 799-800
(1994).
Assenberg R, Webb M, Connolly E, Stott K, Watson M, Hobbs J, Thomas JO. A critical
role in structure-specific DNA binding for the acetylatable lysine residues in
HMGB1.
Biochem J. 411(3): 553-61 (2008).
Awad El Karim MA, Collins KJ, Sukkar MY, Omer AH, Amin MA, Doré C. An
assessment of anti-schistosomal treatment on physical work capacity.
J Trop Med
Hyg
. 84 (2): 67-72 (1981).
Bannister AJ & Kouzarides T. The CBP co-activator is a histone acetyltransferase.
Nature 384(6610): 641-3 (1996).
Barlev NA, Candau R, Wang L, Darpino P, Silverman N, Berger SL. Characterization
of physical interactions of the putative transcriptional adaptor, ADA2, with acidic
activation domains and TATA-bindingprotein.
J Biol Chem. 270: 19337-44 (1995).
126
Belakavadi M, Fondell JD. Role of the mediator complex in nuclear hormone receptor
signaling. Rev Physiol
Biochem Pharmacol. 156: 23-43 (2006).
Berger SL, Piña B, Silverman N, Marcus GA, Agapite J, Regier JL, Triezenberg SJ,
Guarente L. Genetic isolation of ADA2: a potential transcriptional adaptor required
for function of certain acidic activation domains.
Cell. 70(2): 251-65 (1992).
Berger SL. Histone modifications in transcriptional regulation.
Curr Opin Genet Dev.
12(2): 142-8 (2002).
Berger SL. The complex language of chromatin regulation during transcription.
Nature.
447 (7143): 407-12 (2007).
Bertin B, Oger F, Cornette J, Caby S, Noel C, Capron M, Fantappie MR, Rumjanek FD,
Pierce RJ. Schistosoma mansoni CBP/p300 has a conserved domain structure and
interacts functionally with the nuclear receptor SmFtz-F1.
Mol Biochem Parasitol.
146(2): 180-91 (2006).
Bertos NR, Wang AH, Yang XJ. Class II histone deacetylases: structure, function, and
regulation.
Biochem Cell Biol 79: 243-52 (2001).
Bianchi M. Significant (re)location: how to use chromatin and/or abundant proteins as
messages of life and death.
Trends Cell Biol. 14(6): 287-93 (2004).
Billarhz T. Ein Beitrag zur Helminthographis Humana.
Zeitscrift fϋr Wissenschaftliche
Zoologie.
146 (2): 53-76 (1852). Tradução para o inglês por Kean B.
Black JC, Choi JE, Lombardo SR, Carey M. A mechanism for coordinating chromatin
modification and preinitiation complex assembly.
Mol Cell. 23(6): 809-18 (2006).
Bobek L, Rekosh DM, van Keulen H, LoVerde PT. Characterization of a female-
specific cDNA derived from developmentally regulated mRNA in the human blood
fluke
Schistosoma mansoni. Proc Natl Acad Sci USA 83: 5544-5548 (1986).
Bonaldi T, Talamo F, Scaffidi P, Ferrera D, Porto A, Bachi A, Rubartelli A, Agresti A,
Bianchi ME. Monocytic cells hyperacetylate chromatin protein HMGB1 to redirect
it towards secretion.
EMBO J. 22: 5551-5560 (2003).
127
Bordoli L, Netsch M, Lüthi U, Lutz W, Eckner R. Plant orthologs of p300/CBP:
conservation of a core domain in metazoan p300/CBP acetyltransferase-related
proteins.
Nucleic Acids Res. 29(3): 589-97 (2001).
Borrow J, Stanton VP Jr, Andresen JM, Becher R, Behm FG, Chaganti RS, Civin CI,
Disteche C, Dubé I, Frischauf AM, Horsman D, Mitelman F, Volinia S, Watmore
AE, Housman DE. The translocation t (8;16) (p11;p13) of acute myeloid leukaemia
fuses a putative acetyltransferase to the CREB-binding protein.
Nat Genet 14: 33-41
(1996).
Boyes J, Byfield P, Nakatani Y, Ogryzko V. Regulation of activity of the transcription
factor GATA-1 by acetylation.
Nature. 396(6711): 594-8 (1998).
Bradbury EM. Revesible hisatone modifications and the chromosome cell cycle.
Bioessays 14: 9-16 (1992).
Briggs MH.Metabolism of steroid hormones by schistosomes.
Biochim Biophys Acta.
280(3): 481-5 (1972).
Brownell JE.
Tetrahymena histone acetyltransferase A: a transcriptional coactivator
linking gene expression to histone acetylation.
Cell 84: 843-51 (1996).
Brownell JE & Allis CD. Special HATs for special occasions: linking histone
acetylation to chromatin assembly and gene activation.
Curr Opin Genet Dev. 6:
176-84 (1996).
Bustin M. Regulation of DNA-dependent activities by the functional motifs of the high-
mobility-group chromosomal proteins.
Mol Cell Biol. (8): 5237-46 (1999).
Bustin M. Revised nomenclature for high mobility group (HMG) chromosomal
proteins.
Trends Biochem. Sci. 26(3):152-153 (2001).
Candau R, Moore PA, Wang L, Barlev N, Ying CY, Rosen CA, Berger SL.
Identification of human proteins functionally conserved with the yeast putative
adaptors ADA2 and GCN5.
Mol. Cell Biol. 16: 593-602 (1996).
Cairns BR, Levinson RS, Yamamoto KR, Kornberg RD. Essential role of Swp73p in
the function of yeast Swi/Snf complex.
Gens Dev. 10: 2131-44 (1996).
128
Cairns BR. Chromatin remodeling: insights and intrigue from single-molecule studies.
Nature Structural & Molecular Biology 14 (11): 989-96 (2007).
Carrero G, McDonald D, Crawford E, de Vries G, Hendzel MJ. Using FRAP and
mathematical modeling to determine the in vivo kinetics of nuclear proteins.
Methods 29: 14– 28 (2003).
Chan HM & La Thangue NB. p300/CBP proteins: HATs for transcriptional bridges and
scaffolds.
J Cell Sci. 114: 2363-73 (2001).
Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Juguilon H,
Montminy M, Evans RM. Role of CBP/P300 in nuclear receptor signalling.
Nature
383: 99-103 (1996).
Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani
Y, Evans RM. Nuclear receptor coactivator ACTR is a novel histone
acetyltransferase and forms a multimeric activation complex with PCAF and
CBP/p300.
Cell 90: 569-80 (1997).
Chen JD & Evans RM. A transcriptional co-repressor that interacts with nuclear
hormone receptors.
Nature 377: 454–57 (1995).
Chen JD & Li H. Coactivation and corepression in transcriptional regulation by
steroid/nuclear hormone receptors.
Crit. Rev. Eukaryot. Gene Expr. 8: 169–90
(1998).
Chen LL, Rekosh DM, LoVerde PT.
Schistosoma mansoni p48 eggshell protein gene:
characterization, developmentally regulated expression and comparison to the p14
eggshell protein gene.
Mol Biochem Parasitol 52: 39-52 (1992).
Chitsulo L, Engels D, Montresor A, Savioli L.
The global status of schistosomiasis and
its control.
Acta Trop. 77: 41–51 (2000).
Chitsulo L, Loverde P, Engels D. Schistosomiasis.
Nat. Ver. Microbiol. 2(1) : 12-13
(2004).
Cioli D & Pica-Mattoccia L. Praziquantel.
Parasitol Res. 90: 3-9. (2003).
129
Clements A, Rojas JR, Trievel RC, Wang L, Berger SL, Marmorstein R. Crystal
structure of the histone acetyltransferase domain of the human PCAF transcriptional
regulator bound to coenzyme A.
EMBO J. 18 (13): 3521-32 (1999).
Collingwood TN, Urnov FD, Wolffe AP. Nuclear receptors: coactivators, corepressors
and chromatin remodeling in the control of transcription.
J Mol Endocrinol 23: 255-
75 (1999).
de Mendonça RL, Escriva H, Bouton D, Zelus D, Vanacker JM, Bonnelye E, Cornette J,
Pierce RJ, Laudet V. Structural and functional divergence of a nuclear receptor of
the RXR family from the trematode parasite Schistosoma mansoni. Eur J Biochem.
267(11): 3208-19 (2000).
de Moraes Maciel R. Clonagem e Caracterização Funcional de SmGCN5, uma Histona
Acetil Transferase de Schistosoma mansoni. 2004. 85 f Dissertação (Mestrado em
Química Biológica) - Centro de Ciências da Saúde, Universidade Federal do Rio de
Janeiro, Rio de Janeiro, 2004.
de Moraes Maciel R, de Silva Dutra DL, Rumjanek FD, Juliano L, Juliano MA,
Fantappie MR. Schistosoma mansoni histone acetyltransferase GCN5: linking
histone acetylation to gene activation.
Mol Biochem Parasitol. 133(1): 131-5 (2004).
de Moraes Maciel R, da Costa RF, de Oliveira FM, Rumjanek FD, Fantappié MR.
Protein acetylation sites mediated by Schistosoma mansoni GCN5.
Biochem
Biophys Res Commun.
370(1): 53-6 (2008).
de Oliveira FM, de Abreu da Silva IC, Rumjanek FD, Dias-Neto E, Guimarães PE,
Verjovski-Almeida S, Stros M, Fantappié MR. Cloning the genes and DNA binding
properties of High Mobility Group B1 (HMGB1) proteins from the human blood
flukes Schistosoma mansoni and Schistosoma japonicum.
Gene. 1 (377): 33-45
(2007).
Dhalluin C, Carlson JE, Zeng L, He C, Aggarwal AK, Zhou MM. Structure and ligand
of a histone acetyltransferase bromodomain.
Nature 399: 491-96 (1999).
Dumitriu IE, Baruah P, Manfredi AA, Bianchi ME, Rovere-Querini P HMGB1:
guiding immunity from within. Trends Immunol 26: 381–387 (2005).
Dutnall RN, Tafrov ST, Sternglanz R, Ramakrishnan V. Structure of the histone
acetyltransferase Hat1: a paradigm for the GCN5-related N-acetyltransferase
superfamily.
Cell. 94: 427-38 (1998).
130
Dyson MH, Rose S, Mahadevan LC. Acetyllysine-binding and function of
bromodomain-containing proteins in chromatin.
Front Bio-sci 6: 853-65 (2001).
Eckner R, Ewen ME, Newsome D, Gerdes M, Decaprio JA, Lawrence JB, Livingston
DM. Molecular cloning and functional analysis of the adenovirus E1A-associated
300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor.
Genes Dev 8: 869–884, 1994.
Erasmus DA. A comparative study of the reproductive system of mature, imature and
"unisexual" female
Schistosoma mansoni. Parasitology 67: 165-83 (1973).
Fantappie MR, Freebern WJ, Osman A, LaDuca J, Niles EG, LoVerde PT. Evaluation
of
Schistosoma mansoni retinoic X receptor (SmRXR1 and SmRXR2) activity and
tissue distribution.
Mol Biochem Parasitol 115: 87-99 (2001).
Fantappié MR, Osman A, Ericsson C, Niles EG, LoVerde PT. Cloning of Schistosoma
mansoni Seven in Absentia (SmSINA)(+) homologue cDNA, a gene involved in
ubiquitination of SmRXR1 and SmRXR2.
Mol Biochem Parasitol. 131(1): 45-54
(2003).
Fantappíé MR, de Oliveira FM, Santos RD, Mansure JJ, Furtado DR, da Silva IC,
Rumjanek FD. Control of transcription in Schistosoma mansoni: Chromatin
remodeling and other regulatory elements.
Acta Trop. in press (2007).
Fantappié MR, de Oliveira FM, de Moraes Maciel R, Rumjanek FD, Wu W, Loverde
PT. Cloning of SmNCoA-62, a novel nuclear receptor co-activator from
Schistosoma mansoni: Assembly of a complex with a SmRXR1/SmNR1
heterodimer, SmGCN5 and SmCBP1.
Int J Parasitol. 38(10): 1133-1147 (2008)a.
Fantappié MR, Furtado DR, Rumjanek FD, Loverde PT. A unique nuclear receptor
direct repeat 17 (DR17) is present within the upstream region of Schistosoma
mansoni female-specific p14 gene.
Biochem Biophys Res Commun. 371(4): 689-93
(2008)b.
Faus H, Haendler B. Post-translational modifications of steroid receptors.
Biomed
Pharmacother.
60(9): 520-8 (2006).
Feachem RG, Guy MW, Harrison S, Iwugo KO, Marshall T, Mbere N, Muller R,
Wright AM. Excreta disposal facilities and intestinal parasitism in urban Africa:
preliminary studies in Botswana, Ghana and Zambia.
Trans R Soc Trop Med Hyg.
77 (4): 515-21 (1983).
131
Ferreira ILM & Silva TPT Mortalidade por esquistossomose no Brasil: 1980-2003
Revista de Patologia Tropical 36 (1): 67-74 (2007).
Fletcher TM & Hansen JC. Core histone tail domains mediate oligonucleosome folding
and nucleosaomal DNA organization through distinct molecular mechanisms.
J Biol
Chem
270: 25359-62 (1995).
Freebern WJ, Osman A, Niles EG, Christen L, LoVerde PT. Identification of a cDNA
encoding a retinoid X receptor homologue from
Schistosoma mansoni. Evidence for
a role in female-specific gene expression.
J Biol Chem 274: 4577-85 (1999).
Georgakopoulos T, Gounalaki N, Thireos G. Genetic evidence for the interaction of the
yeast transcriptionla co-activator proteins GCN5 and ADA2.
Mol. Gen. Genet. 246:
723-28 (1995).
Glass CK. Differential recognition of target genes by nuclear receptor monomers,
dimers and heterodimers.
Endocrine Reviews 15: 391-407 (1994).
Glass CK, Rosenfeld MG. The coregulator exchange in transcriptional functions of
nuclear receptors.
Genes Dev. 14(2):121-41 (2000).
Gnanasekar M, Velusamy R, He YX, Ramaswamy K. Cloning and characterization of a
high mobility group box 1 (HMGB1) homologue protein from
Schistosoma
mansoni. Mol. & Biochemical Parasitology
. 145: 137-146 (2006).
Goodwin G H, Sanders C, Johns EW. A new group of chromatin associated proteins
with a high content of acidic and basic amino acids.
Eur. J. Biochem. 38: 14-19
(1973).
Grant PA, Duggan L, Côté J, Roberts SM, Brownell JE, Candau R, Ohba R, Owen-
Hughes T, Allis CD, Winston F, Berger SL, Workman JL. Yeast Gcn5 functions in
two multisubunit complexes to acetylate nucleossomal histones: characterization of
na Ada complex and the SAGA (Spt/Ada) complex.
Genes & Dev. 11: 1640-50
(1997).
Grant PA, Schieltz D, Pray-Grant MG, Steger DJ, Reese JC, Yates JR 3rd, Workman
JL. A subset of TAF(II)s are integral components of the SAGA complex required
for nucleossome acetylation and transcriptional stimulation.
Cell 94: 45-53 (1998).
132
Grevelding CG, Sommer G, Kunz W. Female-specific gene expression in Schistosoma
mansoni
is regulated by pairing. Parasitology 115: 635-40 (1997).
Gronemeyer H & Laudet V. Transcription factors 3: nuclear receptors.
Protein Profile.
2 (11): 1173-308 (1995).
Gryseels B, Stelma FF, Talla I, van Dam GJ, Polman K, Sow S, Diaw M, Sturrock RF,
Doehring-Schwerdtfeger E, Kardorff R, et al. Epidemiology, immunology and
chemotherapy of
Schistosoma mansoni infections in a recently exposed community
in Senegal.
Trop Geogr Med 46: 209–19 (1994).
Gu W & Roeder RG. Activation of p53 sequence-specific DNA binding by acetylation
of the p53 C-terminal domain.
Cell. 90(4):595-606 (1997).
Hager GL. Studying nuclear receptors with GFP fusions.
Methods Enzymol. 302: 73– 84
(1999).
Hall JM, McDonnell DP. Coregulators in nuclear estrogen receptor action: from concept
to therapeutic targeting.
Mol Interv. 5: 343-357 (2005).
Haynes SR, Dollard C, Winston F, Beck S, Trowsdale J, Dawid IB. The bromodomain:
a conserved sequence found in human, Drosophila and yeast proteins.
Nucleic Acids
Res.
20: 2603 (1992.).
Heery DM, Kalkhoven E, Hoare S, Parker MG. A signature motif in transcriptional co-
activators mediates binding to nuclear receptors.
Nature. 387: 733-6 (1997).
Heery DM, Hoare S, Hussain S, Parker MG, Sheppard H. Core LXXLL motif
sequences in CREB-binding protein, SRC1, and RIP140 define affinity and
selectivity for steroid and retinoid receptors.
J Biol Chem. 276: 6695-702 (2001).
Heinzel T, Lavinsky RM, Mullen TM, Söderstrom M, Laherty CD, Torchia J, Yang
WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK,
Rosenfeld MG. A complex containing N-CoR, mSin3 and histone deacetylase
mediates transcriptional repression. Nature. 387(6628): 43-8 (1997).
Herrera JE, Sakaguchi K, Bergel M, Trieschmann L, Nakatani Y, Bustin M. Specific
acetylation of chromosomal protein HMG-17 by PCAF alters its interaction with
nucleosomes.
Mol Cell Biol. 19(5): 3466-73 (1999).
133
Hettmann C, Soldati D. Cloning and analysis of a Toxoplasma gondii histone
acetyltransferase: a novel chromatin remodelling factor in Apicomplexan parasites.
Nucleic Acids Res. 27(22): 4344-52 (1999).
Hoffmann KF, Johnston DA, Dunne DW. Identification of
Schistosoma mansoni
gender-associated gene transcripts by cDNA microarray profiling. Genome Biology
3: 1-12 (2002).
Horiuchi J, Silverman N, Marcus GA, Guarente L. ADA3, a putative transcriptional
adaptor, consists of two separable domains and interacts with ADA2 and GCN5 in a
trimeric complex.
Mol Cell Biol. 15(3): 1203-9 (1995).
Hörlein AJ, Näär AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y,
Söderström M, Glass CK,
et al. Ligand independent repression by the thyroid
hormone receptor mediated by a nuclear receptor co-repressor.
Nature 377: 397–404
(1995).
Hu X & Lazar MA. Transcriponal repression by nuclear hormone receptors.
Trends
Endocrinal Metab
11: 6-10 (2000).
Hudson BP, Martinez-Yamout MA, Dyson HJ, Wright PE. Solution structure and
acetyl-lysine binding activity of the GCN5 bromodomain.
J Mol Biol. 304: 355-70
(2000).
Ismail M, Metwally A, Farghaly A, Bruce J, Tao LF, Bennett JL. Characterisation of
isolates of
Schistosoma mansoni from Egyptian villagers that tolerate high doses of
praziquantel.
Am. J. Trop. Med. Hyg. 55: 214–18 (1996).
Ismail M, Botros S, Metwally A, William S, Farghally A, Tao LF, Day TA, Bennett JL.
Resistance to praziquantel: direct evidence from
Schistosoma mansoni isolated from
Egyptian villagers.
Am. J. Trop. Med. Hyg. 60: 932–35 (1999).
Jacobson RH, Ladurner AG, King DS, Tjian R. Structure and function of a human
TAFII250 double bromodomain module.
Science. 288: 1422-5 (2000).
Janknecht R & Hunter T Transcription. A growing coactivator network.
Nature 383:
22–23 (1996).
Jenuwein T, Allis CD. Translating the histone code.
Science 293(5532): 1074-80
(2001).
134
Jeanmougin F, Wurtz JM, Le Douarin B, Chambon P, Losson R. The bromodomain
revisited.
Trends Biochem Sci. 22: 151-3 (1997).
Jones PL & Shi YB. N-CoR-HDAC corepressor complexes: roles in transcriptional
regulation by nuclear hormone receptors.
Curr. Top. Microbiol. Immunol. 274: 237–
68 (2003).
Juan LJ, Utley RT, Adams CC, Vettese-Dadey M, Workman JL. Differential repression
of transcription factor binding by histone H1 is regulated by the core histone amino
termini.
EMBO J. 13(24):6031-40 (1994).
Jung SY, Malovannaya A, Wei J, O'Malley BW, Qin J. Proteomic analysis of steady-
state nuclear hormone receptor coactivator complexes.
Mol Endocrinol. 19(10):
2451-65 (2005).
Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA,
Rose DW, Glass CK, Rosenfeld MG. A CBP integrator complex mediates
transcriptional activation and AP-1 inhibition by nuclear receptors.
Cell. 85: 403-14
(1996).
Katz N. Dificuldades no desenvolvimento de uma vacina para a esquistossomose
mansoni.
Revista da Sociedade Brasileira de Medicina Tropical 32(6): 705-711
(1999).
Kinyamu HK & Archer TK. Modifying chromatin to permit steroid hormone receptor-
dependent transcription.
Biochim. Biophys. Acta 1677: 30–45 (2004).
Kingstone RE & Narlikar GJ. ATP-dependent remodeling and acetylation as regulators
of chromatin fluidity.
Genes Dev. 13: 2339-52 (1999).
Knapp S, Müller S, Digilio G, Bonaldi T, Bianchi ME, Musco G. The long acidic tail of
high mobility group box 1 (HMGB1) protein forms an extended and flexible
structure that interacts with specific residues within and between the HMG boxes.
Biochemistry 43(38): 11992-7 (2004).
Kornberg RD & Lorch Y. Chromatin-modifying and -remodeling complexes.
Curr Opin Genet Dev. 9: 148-51 (1999).
Köster B, Dargatz H, Schröder J, Hirzmann J, Haarmann C, Symmons P, Kunz W.
Identification and localization of the products of a putative eggshell precursor gene
135
in the vitellarium of Schistosoma mansoni. Mol Biochem Parasitol 31: 183-98
(1988).
Kouzarides T. Acetylation: a regulatory modification to rival phosphorylation?
EMBO
J
. 19(6): 1176-9 (2000).
Kouzarides T. Chromatin modifications and their function.
Cell 128: 693–705 (2007).
Kraus WL & Kadonaga JT. p300 and estrogen receptor cooperatively activate
transcription via differential enhancement of initiation and reinitiation.
Genes Dev.
12: 331-42 (1998).
Kundu TK, Palhan VB, Wang Z, An W, Cole PA, Roeder RG. Activator-dependent
transcription from chromatin in vitro involving targeted histone acetylation by p300.
Mol Cell. 6(3): 551-61 (2000).
Kunz W. Schistosome male-female interaction:Induction of germ cell differentiation.
Trends in Parasitology 17: 227-31 (2001).
Kuo MH, Brownell JE, Sobel RE, Ranalli TA, Cook RG, Edmondson DG, Roth SY,
Allis CD. Transcription-linked acetylation by Gcn5p of histones H3 and H4 at
specific lysines.
Nature 383(6597): 269-72 (1996).
Kwok RP, Lundblad JR, Chrivia JC, Richards JP, Bächinger HP, Brennan RG, Roberts
SG, Green MR, Goodman RH. Nuclear protein CBP is a coactivator for the
transcription factor CREB.
Nature. 370: 223-6 (1994).
Lamond AI & Spector DL. Nuclear speckles: a model for nuclear organelles.
Nat. Rev.
Mol. Cell Biol
. 4: 605–612 (2003).
Larsen PR, Kronenberg HM, Melmed S, Polonsky KS.
Williams Textbook of
Endocrinology. Saunders.
(2003).
Laudet V. Evolution of the nuclear receptor superfamily: early diversification from na
ancestral orphan receptor.
J Mol Endocrinol 19: 207-226 (1997).
Laurent BC, Treich I, Carlson M. The yeast SNF2/SWI2 protein has DNA-stimulated
ATPase activity required for transcriptional activation.
Genes & Dev. 7: 583-591
(1993).
136
Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen TM, Schiff R, Del-Rio AL,
Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld
MG, Rose DW. Diverse signaling pathways modulate nuclear receptor recruitment
of N-CoR and SMRT complexes.
Proc Natl Acad Sci U S A. 95(6): 2920-5 (1998).
Le Douarin B, Zechel C, Garnier JM, Lutz Y, Tora L, Pierrat P, Heery D, Gronemeyer
H, Chambon P, Losson R. The N-terminal part of TIF1, a putative mediator of the
ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in
the oncogenic protein T18.
EMBO J. 14(9): 2020-33 (1995).
Le Douarin B, Nielsen AL, Garnier JM, Ichinose H, Jeanmougin F, Losson R, Chambon
P. A possible involvement of TIF1 alpha and TIF1 beta in the epigenetic control of
transcription by nuclear receptors.
EMBO J. 15(23): 6701-15 (1996).
Lee YH. Synergy among nuclear receptor coactivators: selective requirement for protein
methyltransferase and acetyltransferase activities.
Mol. Cell. Biol. 22: 3621–32
(2002).
Leo C, Chen JD. The SRC family of nuclear receptor coactivators.
Gene. 245(1): 1-11
(2000).
Li B, Carey M, Workman JL. The role of chromatin during transcription.
Cell. 128(4):
707-19 (2007).
Li S, Shang Y. Regulation of SRC family coactivators by post-translational
modifications.
Cell Signal. 19(6): 1101-12 (2007).
Lin Y, Fletcher CM, Zhou J, Allis CD, Wagner G. Solution structure of the catalytic
domain of GCN5 histone acetyltransferase bound to coenzyme A.
Nature. 400
(6739): 86-9 (1999).
Loidl P. Histone acetylation: facts and questions.
Chromosoma 103: 441-49 (1994).
Lonard DM, O'Malley BW. The expanding cosmos of nuclear receptor coactivators.
Cell. 125(3):411-4 (2006).
Lonard DM, O'malley BW. Nuclear receptor coregulators: judges, juries, and
executioners of cellular regulation.
Mol Cell. 27(5): 691-700 (2007).
137
Lo Verde PT & Chen L. Schistosome female reproductive development. Parasitol
Today
7: 303-8 (1991).
Lu C, Wu W, Niles EG, LoVerde PT. Identification and characterization of a novel
fushi tarazu factor 1 (FTZ-F1) nuclear receptor in Schistosoma mansoni.
Mol
Biochem Parasitol
. 150(1): 25-36 (2006).
Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ. Crystal structure of the
nucleosome core particle at 2.8 Å resolution.
Nature 389: 251–260 (1997).
Luger K & Richmond TJ. The histone tail of the nucleosome.
Curr Opin Genet Dev 8:
14-6 (1998).
Mangelsdorf DJ & Evans RM. The RXR heterodimers and orphan receptors.
Cell 83:
841-50 (1995).
Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schütz G, Umesono K, Blumberg
B, Kastner P, Mark M, Chambon P, Evans RM. The nuclear receptor superfamily:
teh second decade.
Cell 83: 835-39 (1995).
Maniatis T, Goodbourn S, Fischer JA. Regulation of inducible and tissue-specific gene
expression.
Science 236: 1237-45 (1987).
Mansure JJ, Furtado DR, de Oliveira FM, Rumjanek FD, Franco GR, Fantappie MR.
Cloning of a protein arginine methyltransferase PRMT1 homologue from
Schistosoma mansoni: evidence for roles in nuclear receptor signaling and RNA
metabolism.
Biochem Biophys Res Commun. 335(4): 1163-72 (2005).
Marcus GA, Silverman N, Berger SL, Horiuchi J, Guarente L. Functional similarity and
physical association between GCN5 and ADA2: putative transcriptional adaptors.
EMBO J. 13: 4807-15 (1994).
Marmorstein R & Berger SL. Structure and function of bromodomains in chromatin-
regulating complexes.
Gene 272: 1-9 (2001).
Martínez-Balbás MA, Bauer UM, Nielsen SJ, Brehm A, Kouzarides T. Regulation of
E2F1 activity by acetylation.
EMBO J. 19(4): 662-71 (2000).
138
Marzio G, Wagener C, Gutierrez MI, Cartwright P, Helin K, Giacca M. E2F family
members are differentially regulated by reversible acetylation.
J Biol Chem.
275(15): 10887-921 (2000).
McInerney EM, Rose DW, Flynn SE, Westin S, Mullen TM, Krones A, Inostroza J,
Torchia J, Nolte RT, Assa-Munt N, Milburn MV, Glass CK, Rosenfeld MG.
Determinants of coactivator LXXLL motif specificity in nuclear receptor
transcriptional activation.
Genes Dev. 12: 3357-68 (1998).
McKenna NJ, Nawaz Z, Tsai SY, Tsai MJ, O'Malley BW. Distinc steady-state nuclear
receptor coregulators.
Proceedings of the National Academy of Sciences of the USA
95: 11697-702 (1998).
McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ, O'Malley BW. Nuclear receptor
coactivators: multiple enzymes, multiple complexes, multiple functions.
J Steroid
Biochem Mol Biol
. 69(1-6):3-12 (1999).
McManus DP & Loukas A. Current Status of Vaccines for Schistosomiasis
Clinical
Microbiology Reviews
21 (1): 225-242 (2008).
Meersseman G, Pennings S, Bradbury EM. Mobile nucleosomes--a general behavior.
EMBO J. 11: 2951-9 (1992).
Mellor J. It takes a PHD to read the histone code.
Cell 126: 22–24 (2006).
Metivier R, Reid G, Gannon F. Transcription in four dimensions: nuclear receptor-
directed initiation of gene expression.
EMBO Rep. 7: 161–167. (2006).
Meyer F, Meyer H, Bueding E. Lipid metabolism in the parasitic and free-living
flatworms, Schistosoma mansoni and Dugesia dorotocephala.
Biochim Biophys
Acta
. 210(2):257-66 (1970).
Michaels RM. Mating of
Schistosoma mansoni "in vitro". Exp Parasitol 25: 58-71
(1969).
Michel A, Knobloch J, Kunz W. P19: a female and tissue specifically expressed gene
in
Schistosoma mansoni, regulated by pairing with the male. Parasitology 127: 519–
24 (2003).
139
Miller RL, Armelagos GJ, Ikram S, De Jonge N, Krijger FW, Deelder AM.
Palaeoepidemiology of Schistosoma infection in mummies.
Br. Med. J., 304: 555-
556 (1992).
Misteli T. Protein dynamics: implications for nuclear architecture and gene expression.
Science 291: 843–847 (2001).
Mitchell PJ & Tjian R. Transcriptional regulation im mammalian cells by sequence-
specific DNA binding proteins.
Science 285: 681-92 (1989).
Moazed D. Enzymatic actitivities of Sir2 and chromatin silencing.
Curr Opin Cell Biol
12: 232-38 (2001).
Moser D, Doenhoff MJ, Klinkert MQ. A stage-specific calcium-binding protein
expressed in eggs of
Schistosoma mansoni Mol Biochem Parasitol 51: 229-238
(1992).
Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans
RM. Nuclear receptor repression mediated by a complex containing SMRT,
mSin3A, and histone deacetylase.
Cell. 89(3): 373-80 (1997).
Nakatani Y. Histone acetylases—versatile players.
Genes Cells 6: 79–86 (2001).
Narlikar GJ, Fan HY, Kingston RE. Cooperation between complexes that regulate
chromatin structure and transcription.
Cell 108: 475-87 (2002).
Neuwald AF & Landsman D. GCN5-realted histone N-acetyltransferases belong to a
diverse superfamily that includes the yeast SPT10 protein.
Trends Biochem 22: 154-
5 (1997).
Neves PD. Parasitologia Humana. Editora Atheneu, 11ª edição, p.193-222 (2005).
Oger F, Bertin B, Caby S, Dalia-Cornette J, Adams M, Vicogne J, Capron M, Pierce RJ.
Molecular cloning and characterization of Schistosoma mansoni Ftz-F1 interacting
protein-1 (SmFIP-1), a novel corepressor of the nuclear receptor SmFtz-F1.
Mol
Biochem Parasitol
. 148(1): 10-23 (2006).
Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y. The transcriptional
coactivators p300 and CBP are histone acetyltransferases.
Cell. 87(5): 953-9 (1996).
140
Oliveira SC, Fonseca CT, Cardoso FC, Farias LP, Leite LCC. Recent advances in
vaccine research against schistosomiasis in Brazil
Acta Tropica in press (2008)
Oñate SA, Tsai SY, Tsai MJ, O'Malley BW. Sequence and characterization of a
coactivator for the steroid hormone receptor superfamily.
Science. 270(5240): 1354-
7 (1995).
Orphanides G, LeRoy G, Chang CH, Luse DS, Reinberg D. FACT, a factor that
facilitates transcript elongation through nucleosomes.
Cell. 92(1): 105-16 (1998).
Owen DJ, Ornaghi P, Yang JC, Lowe N, Evans PR, Ballario P, Neuhaus D, Filetici P,
Travers AA. The structural basis for the recognition of acetylated histone H4 by the
bromodomain of histone acetyltransferase gcn5p.
EMBO J. 19: 6141-9 (2000).
Owen-Hughes T & Workman JL. Experimental analysis of chromatin function in
transcription control.
Crit Rev Eukaryot Gene Expr. 4: 403-41 (1994).
Owen-Hughes T. Colworth memorial lecture. Pathways for remodelling chromatin.
Biochem Soc Trans. 31(Pt 5): 893-905 (2003).
Paranjape SM, Kamakaka RT, Kadonaga JT. Role of chromatin structure in the
regulation of transcription by RNA polymerase II.
Annu Rev Biochem.63: 265-97
(1994).
Pasheva E, Sarov M, Bidjekov K, Ugrinova I, Sarg B, Lindner H, Pashev IG. In Vitro
Acetylation of HMGB-1 and -2 Proteins by CBP: the Role of the Acidic Tail.
Biochemistry 43(10): 2935-2940 (2004).
Perissi V & Rosenfeld MG. Controlling nuclear receptors: the circular logic of cofactor
cycles.
Nat. Rev. Mol. Cell. Biol. 6: 542–554 (2005).
Pessôa SB & Martins AV.
Parasitologia Médica Rio de Janeiro. Guanabara Kogan. p.
872 (1982).
Phair RD & Misteli T. High mobility of proteins in the mammalian cell nucleus.
Nature
404: 604–609 (2000).
Pollard KJ & Peterson CL. Chromatin remodeling: a marriage between two families?
BioEssays 20: 771-80 (1998).
141
Popiel I. The reproductive biology of schistosomes. Parasitology Today 2: 10-5 (1986).
Popiel I & Basch PF. Reproductive development of female
Schistosoma mansoni
(Digenea: Schistosomatidae) following bisexual pairing of worms and worm
segments.
J Exp Zool 232: 141-50 (1984).
Popov VM, Wang C, Shirley LA, Rosenberg A, Li S, Nevalainen M, Fu M, Pestell RG.
The functional significance of nuclear receptor acetylation.
Steroids. 72(2): 221-30
(2007).
Rey L. Bases da Parasitologia Médica. 2ª Edição. Editora Guanabara Koogan, capítulo
17, p. 167 (1992).
Rice JC & Allis CD. Histone methylation versus histone acetylation: new insights into
epigenetic regulation.
Curr Opin Cell Biol. 13(3): 263-73 (2001).
Robyr D, Wolffe AP, Wahli W. Nuclear hormone receptor coregulators in action:
diversity for shared tasks.
Mol. Endocrinol. 14: 329-47 (2000).
Roche C, Liu JL, LePresle T, Capron A, Pierce RJ. Tissue localization and stage-
specific expression of the phospholipid hydroperoxide glutathione peroxidase of
Schistosoma mansoni. Molecular and Biochemical Parasitology 75: 187-95 (1996).
Rochette-Egly C. Dynamic combinatorial networks in nuclear receptormediated
transcription.
J. Biol. Chem. 280: 32565–32568 (2005).
Rojas JR, Trievel RC, Zhou J, Mo Y, Li X, Berger SL, Allis CD, Marmorstein R.
Structure of Tetrahymena GCN5 bound to coenzyme A and a histone H3 peptide.
Nature 401(6748): 93-8 (1999).
Rollinson D & Southgate VR. The biology of schistosomes. From gene to latrines. Ed.
by Rollinson D & Simpson AJG.
Academic Press, cap. 1. (1987).
Rosenfeld MG, Lunyak VV, Glass CK. Sensors and signals: a coactivator/
corepressor/epigenetic code for integrating signal-dependent programs of
transcriptional response.
Genes Dev. 20: 1405–1428 (2006).
Roth SY & Allis CD. Histone acetylation and chromatin assembly: a single escort,
multiple dances?
Cell 87: 5–8 (1996).
142
Ruffer MA. Note on the presence of Bilharzia haematobia in Egyptian mummies of the
twentieth dynasty (1250-11 B.C).
Br. Med. J. v. i, n. 16. (1910).
Rumjanek FD. Regulation of gene expression in the
Schistosoma mansoni female. Mem.
Inst. Oswaldo Cruz.
84: 197-8 (1989).
Sagawa E.
et al. Studies concerning the influence of sex on the growth of animal
bodies. First report: Experiments on Schistosoma mansoni.
Trans. Jap. Pathol. Soc.
18: 494-500 (1928).
Saha A, Wittmeyer J, Cairns BR. Mechanisms for nucleosome movement by ATP-
dependent chromatin remodeling complexes.
Results Probl Cell Differ. 41: 127-48
(2006).
Saitoh N, Spahr CS, Paterson SD, Bubulya P, Neuwald A, Spector DL. Proteomic
analysis of interchromatin granule clusters.
Mol. Biol. Cell 15: 3876–3890 (2004).
Sambon LW. New or little known African entozoa.
J. Trop. Med. 10: 117 (1907).
Sande S & Privalsky ML. Identification of TRACs (T3 receptor-associating cofactors),
a family of cofactors that associate with, and modulate the activity of, nuclear
hormone receptors.
Mol. Endocrinol. 10: 813–25 (1996).
Savkur RS & Burris TP. The coactivator LXXLL nuclear receptor recognition motif.
J
Pept Res.
63: 207-12 (2004).
Scaffidi P, Misteli T, Bianchi ME. Release of chromatin protein HMGB1 by necrotic
cells triggers inflammation.
Nature, 418: 191–195 (2002).
Schüssler P, Grevelding CG, Kunz W. Identification of Ras, MAP kinases and a GAP
protein in
Schistosoma mansoni by immunoblotting and their putative involvment in
male-female interaction.
Parasitology 115: 629-34 (1997).
Severinghaus AE. Sex studies on Schistosoma japonicum.
Q. J. Microsc. Sci. 71: 653-
702 (1928).
Shaw JR.
Schistosoma mansoni: pairing "in vitro" and development of females from
single Sex infection.
Exp Parasitol 41: 54-65 (1977).
143
Shibata H, Spencer TE, Oñate SA, Jenster G, Tsai SY, Tsai MJ, O'Malley BW. Role of
co-activators and co-repressors in the mechanism of steroid/thyroid receptor action.
Recent Prog Horm Res.52: 141-64; discussion 164-5 (1997).
Shikama N, Lyon J, La Thangue NB. The p300/CBP family: integrating signals with
transcription factors and chromatin.
Trends Cell Biol 7: 230–236 (1998).
Simpson AJ, Sher A, McCutchan TF. The genome of Schistosoma mansoni: isolation of
DNA, its size, bases and repetitive sequences.
Mol Biochem Parasitol. 6(2): 125-37
(1982).
Simpson AJ, Chaudri M, Knight M, Kelly C, Rumjanek F, Martin S, Smithers SR.
Characterization of the structure and expression of the gene encoding a major
female specific polypeptide of
Schistosoma mansoni. Mol Biochem Parasitol 22:
169-76 (1987).
Smith ER, Belote JM, Schiltz RL, Yang XJ, Moore PA, Berger SL, Nakatani Y, Allis
CD. Cloning of Drosophila GCN5: conserved features among metazoan GCN5
family members.
Nucleic Acids Res. 26(12): 2948-54 (1998).
Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate
SA, Tsai SY, Tsai MJ, O'Malley BW. Steroid receptor coactivator-1 is a histone
acetyltransferse.
Nature 389: 194-8 (1997).
Stallcup MR, Kim JH, Teyssier C, Lee YH, Ma H, Chen D. The roles of protein-protein
interactions and protein methylation in transcriptional activation by nuclear
receptors and their coactivators.
J Steroid Biochem Mol Biol. 85(2-5): 139-45
(2003).
Stelma FF, Talla I, Sow S, Kongs A, Niang M, Polman K, Deelder AM, Gryseels B.
Efficacy and side-effects of praziquantel in an epidemic focus of
Schistosoma
mansoni
. Am J Trop Med Hyg 53: 167–70 (1995).
Sterner DE & Berger SL. Acetylation of histones and transcription-related factors.
Microbiol Mol Biol Rev. 64: 435-59 (2000).
Sterner DE, Grant PA, Roberts SM, Duggan LJ, Belotserkovskaya R, Pacella LA,
Winston F, Workman JL, Berger SL. Functional organization of the yeast SAGA
complex: distinct components involved in structural integrity, nucleosome
acetylation, and TATA-binding protein interaction.
Mol Cell Biol. 19: 86-98 (1999).
144
Strahl BD & Allis CD. The language of covalent histone modifications.Nature 403: 41-
45 (2000).
Syntichaki P, Topalidou I, Thireos G. The Gcn5 bromodomain co-ordinates nucleosome
remodelling.
Nature 404: 414-7 (2000).
Tamkun JW, Deuring R, Scott MP, Kissinger M, Pattatucci AM, Kaufman TC,
Kennison JA. brahma: a regulator of
Drosophila homeotic genes structurally related
to the yeast transcriptional activator SNF2/SWI2.
Cell. 68: 561-72 (1992).
Tanner KG, Langer MR, Denu JM. Kinetic mechanism of the histone acetyltransferase
GCN5 from yeast.
J Biol Chem 275: 22048-55 (2000).
Thomas JO & Travers AA. HMG1 and 2, and related 'architectural' DNA-binding
proteins.
Trends Biochem Sci. 26(3):167-74 (2001). Erratum in: Trends Biochem
Sci
. 26(4): 219 (2001).
Tom GT, De Man JG, Bogers JJ, De Winter BY, Vrolix G, Herman AG, Van Marck
EA, Pelckmans PA. Effect of
Schistosoma mansoni induced granulomatous
inflammation on murine gastrointestinal motility.
Am. J. of physiology. 280: 1030-
1042 (2005).
Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG. The
transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor
function.
Nature 387: 677–684, 1997.
Torchia J, Glass C, Rosenfeld MG. Co-activators and co-repressors in the integration of
transcriptional responses.
Current Opinion in Cell Biology 10: 373-383 (1998).
Trievel RC, Rojas JR, Sterner DE, Venkataramani RN, Wang L, Zhou J, Allis CD,
Berger SL, Marmorstein R. Crystal structure and mechanism of histone acetylation
of the yeast GCN5 transcriptional coactivator.
Proc Natl Acad Sci U S A. 96 (16):
8931-6 (1999).
Trotter KW, Archer TK. Nuclear receptors and chromatin remodeling machinery.
Mol
Cell Endocrinol
. 265-266: 162-7 (2007).
Turner BM. Histone acetylation and control of gene expression.
J. Cell Sci. 99, 13-20
(1991).
145
Turner BM & O'Neill LP. Histone acetylation in chromatin and chromosomes. Semin
Cell Biol
. 6(4):229-36 (1995).
Ugrinova I, Pasheva EA, Armengaud J, Pashev IG. In vivo acetylation of HMG1
protein enhances its binding affinity to distorted DNA structures.
Biochemistry.
40(48): 14655-60 (2001).
Ugrinova I, Mitkova E, Moskalenko C, Pashev I, Pasheva E. DNA bending versus DNA
end joining activity of HMGB1 protein is modulated in vitro by acetylation.
Biochemistry. 46(8): 2111-7 (2007).
Ulloa L & Messmer D. High-mobility group box 1 (HMGB1) protein: friend and foe.
Cytokine Growth Factor. 17(3): 189-201 (2006).
Urnov FD & Wolffe AP. A necessary good: nuclear hormone receptors and their
chromatin templates.
Mol. Endocrinol. 15: 1-16 (2001)a.
Urnov FD & Wolffe AP. Chromatin remodeling and transcriptional activation: the cast
(in order of appearance).
Oncogene 20: 2991-3006 (2001)b.
Urnov FD, Wolffe AP, Guschin D. Molecular mechanisms of corepressor function.
Curr Top Microbiol Immunol 254: 1-33 (2001).
Verdone L, Caserta M, Di Mauro E. Role of histone acetylation in the control of gene
expression.
Biochem Cell Biol. 83(3): 344-53 (2005).
Vettese-Dadey M, Grant PA, Hebbes TR, Crane- Robinson C, Allis CD, Workman JL.
Acetylation of histone H4 plays a primary role in enhancing transcription factor
binding to nucleosomal DNA in vitro.
EMBO J. 15(10): 2508-18 (1996).
Voegel JJ, Heine MJ, Tini M, Vivat V, Chambon P, Gronemeyer H. The coactivator
TIF2 contains three nuclear receptor-binding motifs and mediates transactivation
through CBP binding-dependent and -independent pathways.
EMBO J. 17: 507–
519, 1998.
vom Baur E, Zechel C, Heery D, Heine MJ, Garnier JM, Vivat V, Le Douarin B,
Gronemeyer H, Chambon P, Losson R. Differential ligand-dependent interactions
between the AF-2 activating domain of nuclear receptors and the putative
transcriptional intermediary factors mSUG1 and TIF1.
EMBO J. 15(1): 110-24
(1996).
146
Wang H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A, Yang
H, Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson J,
Andersson U, Molina PE, Abumrad NN, Sama A, Tracey KJ. HMG-1 as a late
mediator of endotoxin lethality in mice.
Science. 285: 248–251 (1999).
Wang L, Liu L, Berger SL. Critical residues for histone acetylation by Gcn5,
functioning in Ada and SAGA complexes, are also required for transcriptional
function in vivo.
Genes Dev. 12 (5): 640-53 (1998).
Watson M, Stott K, Thomas JO. Mapping intramolecular interactions between domains
in HMGB1 using a tail-truncation approach.
J Mol Biol. 374(5): 1286-97 (2007).
WHO Technical Report Series 912: prevention and control of schistosomiasis and
soiltransmitted helminthiasis
WHO, Geneva (2002).
Widakowich C, de Azambuja E, Gil T, Cardoso F, Dinh P, Awada A, Piccart-Gebhart
M. Molecular targeted therapies in breast cancer: where are we now?
Int J Biochem
Cell Biol
. 39(7-8): 1375-87 (2007).
Wilson RA. The biology of schistosomes. From gene to latrines. Ed. By Rollinson D &
Simpson AJG.
Academic Press, cap. 4 (1987).
Winston E & Allis CD. The bromodomain: a chromatin-targeting module?
Nature
Struct Biol
6: 601-4 (1999).
Wolffe AP. Chromatin remodeling regulated by steroid and nuclear receptors.
Cell Res.
7: 127-42 (1997).
Wolffe AP & Kurumizaka H. The nucleosome: a powerful regulator of transcription.
Prog. Nucleic Acid Res. Mol. Biol. 61: 379-422 (1998).
Wolffe, A. P.
et al. Co-repressor complexes and remodelling chromatin for repression.
Biochem Soc Trans. 28: 379-86 (2000).
Wood CM, Nicholson JM, Lambert SJ, Chantalat L, Reynolds CD, Baldwin JP. High-
resolution structure of the native histone octamer.
Acta Crystallogr Sect F Struct
Biol Cryst Commun
. 61(Pt 6): 541-5 (2005).
147
Wu W, Niles EG, El-Sayed N, Berriman M, LoVerde PT. Schistosoma mansoni
(Platyhelminthes, Trematoda) nuclear receptors: sixteen new members and a novel
subfamily.
Gene. 366(2): 303-15 (2006).
Wu W, Niles EG, Hirai H, LoVerde PT. Identification and characterization of a nuclear
receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1).
FEBS J. 274(2): 390-405 (2007).
Wysocka J, Swigut T, Milne TA, Dou Y, Zhang X, Burlingame AL, Roeder RG,
Brivanlou AH, Allis CD. WDR5 associates with histone H3 methylated at K4 and is
essential for H3 K4 methylation and vertebrate development.
Cell. 121(6): 859-72
(2005).
Wysocka J, Swigut T, Xiao H, Milne TA, Kwon SY, Landry J, Kauer M, Tackett AJ,
Chait BT, Badenhorst P, Wu C, Allis CD. A PHD finger of NURF couples histone
H3 lysine 4 trimethylation with chromatin remodelling.
Nature. 442(7098): 86-90
(2006).
Xu W, Edmondson DG, Roth SY. Mammalian GCN5 and P/CAF acetyltransferases
have homologous amino-terminal domains important for recognition of nucleosomal
substrates.
Mol Cell Biol. 18: 5659-69 (1998).
Yang WM, Tsai SC, Wen YD, Fejer G, Seto E. Functional Domains of Histone
Deacetylase-3
J Biol Chem 277: 9447–54 (2002).
Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y. A p300/CBP-
associatede factor that competes with the adenoviral oncoprotein E1A.
Nature 382:
319-24 (1996).
Yao TP, Oh SP, Fuchs M, Zhou ND, Ch’ng Le, Newsome D, Bronson RT, Li E,
Livingston DM, Eckner R. Gene dosage-dependent embryonic development and
proliferation defects in mice lacking the transcriptional integrator p300.
Cell 93:
361–372 (1998).
Yao YL, Yang WM, Seto E. Regulation of transcription factor YY1 by acetylation and
deacetylation.
Mol Cell Biol 21: 5979-91 (2001).
Yuan LW & Giordano A. Acetyltransferase machinery conserved in p300/CBP-family
proteins.
Oncogene.21(14): 2253-60 (2002).
148
Zamir I, Harding HP, Atkins GB, Hörlein A, Glass CK, Rosenfeld MG, Lazar MA A
nuclear hormone receptor corepressor mediates transcriptional silencing by
receptors with distinct repression domains.
Mol. Cell Biol. 16: 458–65 (1996).
Zeng L & Zhou MM. Bromodomain: an acetyl-lysine binding domain.
FEBS Lett. 513:
124-8 (2002).
Zimmermann K, Völkel D, Pable S, Lindner T, Kramberger F, Bahrami S, Scheiflinger
F. Native versus Recombinant High-Mobility Group B1 Proteins: Functional
Activity In Vitro.
Inflammation. 28: 221-229 (2004).
149
ANEXOS
150
ANEXO A – TRABALHO PUBLICADO EM PERIÓDICO DE CIRCULAÇÃO
INTERNACIONAL
MARCELO ROSADO FANTAPPIÉ, FRANCISCO M. BASTOS DE OLIVEIRA, RENATA
DE MORAES MACIEL DOS SANTOS
, JOSÉ JOÃO MANSURE, DANIEL
RODRIGUES FURTADO, ISABEL CAETANO DE ABREU DA SILVA, FRANKLIN
DAVID RUMJANEK. Control of transcription in
Schistosoma mansoni: Chromatin
remodeling and other regulatory elements.
Acta Trop. (2008),
doi:10.1016/j.actatropica.2007.11.006
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
A
vailable online at www.sciencedirect.com
Acta Tropica xxx (2008) xxx–xxx
Control of transcription in Schistosoma mansoni: Chromatin
remodeling and other regulatory elements
Marcelo Rosado Fantapp
´
ı
´
e
a
, Francisco M. Bastos de Oliveira
a
,
Renata de Moraes Maciel dos Santos
a
, Jos
´
eJo
˜
ao Mansure
b
,
Daniel Rodrigues Furtado
a
, Isabel Caetano de Abreu da Silva
a
,
Franklin David Rumjanek
a,∗
a
Instituto de Bioqu´ımica M´edica, Programa de Biologia Molecular e Biotecnologia, Centro de Ciˆencias da Sa´ude,
Universidade Federal do Rio de Janeiro, Ilha do Fund ˜ao, Cidade Universit´aria, CEP 21941-590, Rio de Janeiro, Brazil
b
Universt´e de Montreal, Facult´edeM´edecine, D´epartement de Microbiologie et Immunologie,
Bureau S 655, poste 3143, C.P. 6128, Montr´eal, Qu´ebec H3C 3J7, Canada
Abstract
The platyhelminth parasite Schistosoma mansoni, the causative agent of schistosomiasis, is a dioecious parasite with a complex life cycle that
includes two different hosts and two free-living stages. Yet very little is known about the biochemical details connected to these different transitions.
In the present work, results will be presented showing the most recent results in S. mansoni regarding the characterization of transcription factors
and coactivators that act directly on the transcriptional machinery and those that are involved with chromatin remodeling. It is hoped that the
information gathered here may contribute towards the understanding of crucial events in the parasite life cycle. Likewise, the development of new
drugs that could interfere with oogenesis and sexual maturation may eventually profit from the information contained herein.
© 2007 Elsevier B.V. All rights reserved.
Keywords: Schistosoma mansoni; Chromatin; HMGB1; GCN5; Methylation; Acetylation
1. Introduction
In contrast to genes whose products are constantly in demand,
those associated to development or to biochemical activities that
respond to variable levels of mediators in eukaryotic cells require
regulation. In these situations it is very important to precisely
regulate the time at which genes are transcribed. Apart from
the timing, the amount of RNA produced also has to be consid-
ered. Following transcription, the RNA molecule itself is further
processed through splicing adding yet another level of regula-
tion at the splice sites. However, if one includes translation in
the general process of gene expression, temporal and quantita-
tive aspects of eukaryotic transcription constitute only part of the
regulatory complex. Because transcription and translation occur
in different compartments, spatial issues involving the transport
of mRNA from nucleus to cytoplasm and its attachment to the
∗
Corresponding author. Tel.: +55 21 2560 9625; fax: +55 21 22605579.
E-mail address: [email protected] (F.D. Rumjanek).
ribosomes must be discussed as well. Taken together transcrip-
tion and translation compose a coordinated sequence of events
which start at the cis-acting sequences present on the DNA
molecule (coding for initiation, elongation and termination) and
are followed by post-transcriptional modifications of the RNA
molecule generating mRNA. Each of these intermediary stages
is subject to individual regulatory elements. In eukaryotes con-
trol of expression has evolved to become so intricate that the
interplay mediated by the several regulatory elements leading
alternately to gene activation and suppression can actually pro-
duce different cell types.
Although gene expression is controlled mainly at the level
of transcription, other stages preceding RNA synthesis are
amenable to regulation. For example, before transcription
ensues, chromatin remodeling must take place. This usually
involves the relaxation of the tightly packed DNA–protein com-
plex found in the nucleosomes, which in eukaryotes make up
the basic structural unit of the chromatin. Modulation of sev-
eral nuclear processes is thus linked to covalent modifications
of chromatin. Relaxation of the DNA–protein complex depends
0001-706X/$ – see front matter © 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.actatropica.2007.11.006
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
2 M.R. Fantapp´ı´e et al. / Acta Tropica xxx (2008) xxx–xxx
on the neutralization of charges associated to the amino termini
of histones, the protein core of the nucleosomes. These post-
translational modifications comprise methylation, acetylation,
phosphorylation and ubiquitination of the positively charged
aminoacid residues present in the histone tails. In the case of
lysine acetylation, neutralization of charge occurs so that the
electrostatic attraction between DNA and histones diminishes
and allows DNA to become accessible to the RNA polymerase
complex. In contrast, methylation of lysine residues does not
change its charge and it is possible that lysine methylation influ-
ences chromatin remodeling through some other process. This
will be further discussed later on. Again both, the enzymatic
systems participating in the post-translational modifications and
their cognate genes add on more sites of regulation to this already
multilayered assemblage.
Until quite recently knowledge on the control of transcrip-
tion of the platyhelminth parasite Schistosoma mansoni has been
rather scarce, mainly due to the lack of detailed information on
the biochemistry and physiology of the parasites. Thus, many of
the more fundamental questions on the biochemical processes of
schistosomes are still unanswered, especially those related to the
adaptation of the parasites to different environments, maturation
from larval to adult stages, sexual differentiation and oogenesis.
If on one hand research has been hindered by the lack of data
on the other, the life cycle of S. mansoni by its very complex-
ity becomes an ideal model for investigation on the regulation
of gene expression. Apart from the intrinsic biochemical inter-
est, investigation on the control of transcription in schistosomes
may suggest strategies for the development of drugs that can
specifically counteract those medically important parasites.
Although schistosomes are metazoans displaying different
tissues, rather than concentrating on a particular cell type and
on the regulation associated to a specific physiological response,
the group has been attempting to unravel those general mecha-
nisms of regulation of gene expression that are shared by various
other organisms. With this strategy in mind we aimed at not only
laying the groundwork for a general model of gene regulation
in schistosomes, but also to allow quantification of relevant bio-
chemical parameters during crucial passages along the parasite’s
life cycle.
As alluded before, transcription is mediated and regulated
by protein–DNA interactions. Thus, our research has broadly
approached the subject by employing techniques that generated
information based on the mutual affinity of these polymers. At
this stage it must be mentioned that the search and characteriza-
tion of the different factors described in this work has profited
by the recent publication of the S. mansoni genome (Verjovski-
Almeida et al., 2003) and was greatly aided by the collaborative
effort with Dr. Sergio Verjovski’s group.
1.1. Chromatin remodeling and protein arginine
methyltransferases (PRMTs)
As mentioned earlier, chromatin reorganization necessar-
ily precedes the binding of the RNA transcription complex to
cis-acting elements present in inducible genes. This is manda-
tory because the eukaryotic genomic DNA is highly compacted
in the nucleosomes and access to the DNA by RNA poly-
merase and other regulators is physically restricted. Among the
post-translational modifications that can affect gene expression,
protein methylation catalyzed by a family of enzymes known as
protein arginine methyltransferases (PRMTs) is one of the most
common. Lysine residues are also preferentially methylated, but
by a different class of enzymes termed lysine methyltransferases.
In the context of regulation of transcription, the histones H3
and H4 have been recognized as one of the major substrates
to the histone methyltransferase complex. Lysine methylation
takes place in the histone domain consisting of long aminoacid
tracts which make up the histone tail. The histone tails are free
to establish contact with other proteins that may contribute to
relaxation or compactness of the nucleosomes and thus affect
transcription directly. Both, arginine and lysine residues are
abundantly represented in the histone H3 and H4 tails so that
the two aminoacids are potential substrates to PRMTs and lysine
methyltransferases. With regards to lysine methylation, it should
be emphasized that recent results have shown that histone lysine
methylation can signal either activation or repression depending
on which residues are methylated (Martin and Zhang, 2005; Roh
et al., 2006). Interestingly, the data suggest that lysine methyla-
tion introduces in the histone tail a mark that appears to constitute
a signal for the binding of protein factors that regulate transcrip-
tion. Indeed, trimethylation of lysine residue 4 in histone H3
(H3K4me3) seems to mediate the recruitment of proteins that
are essential for development (Wysocka et al., 2006; Li et al.,
2006; Pe
˜
na et al., 2006). Consistently, it has been proposed that
trimethylation of H3K4 in eukaryotes forms a universal code
that determines the site where transcription of regulated genes
starts (Shi et al., 2006).
Although only partial sequences of S. mansoni exist for
histones H3 and H4 (Verjovski-Almeida et al., 2003), it is con-
ceivable that their primary structures are quite similar to those
already reported in the literature (Requena et al., 2000), histones
being very conserved proteins. Hence, it is reasonable to assume
that at the level of histones, similar regulatory mechanisms apply
for the parasites.
Recently we have been able to clone a protein arginine
methyltransferase from S. mansoni whose sequence classified
it as type 1 (Mansure et al., 2005). PRMT1 is the most preva-
lent PRMT isoform and its main function appears is histone
methylation (Krause et al., 2007). Curiously, SmPRMT1 dis-
played a high degree of homology to the vertebrate enzyme.
Of course this does not exclude the possibility of occurrence
of the other PRMT isoforms. In order to test the specificity
of the schistosome enzyme, SmPRMT1 was expressed and the
function of the recombinant protein tested using synthetic pep-
tides with sequences based on the N-terminal regions of histones
H3 and H4. It was found that SmPRMT1 methylated only the
H4 peptides. The position of the SmPRMT1methylation on the
three nitrogen atoms of the guanidinium side chain of arginine
residues in histone H4 still remains to be determined.
The specificity observed for SmPRMT1 suggested that the
mechanism whereby acetylation of CBP/p300 dependent of
PRMT1 methylation of H3 (Bedford and Richard, 2005) may
be a pathway absent in schistosomes. Nevertheless, it is possible
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
M.R. Fantapp´ı´e et al. / Acta Tropica xxx (2008) xxx–xxx 3
that a S. mansoni PRMT4 orthologue (an isoform that methy-
lates H3) and as yet unidentified in the parasites, could play
this role. Alternatively, acetylation of other relevant transcription
factors present in S. mansoni may resort to an entirely different
mechanism (see discussion ahead). Specificity of SmPRMT1
does not seem to be restricted to the histone family since it
was found that SmPRMT1 was able to methylate RNA bind-
ing proteins SMYB1 and SmSmD3 (Mansure et al., 2005 and
Franco, unpublished results). These results were obtained using
two different approaches. Direct methylation and pull-down
assays (that measure interaction between different molecules).
The results obtained with these two proteins suggested that
SmPRMT1 ability to methylate its substrates is dependent on
the occurrence of the RGG and/or RG/GRG motifs. That RGG
motifs are required was confirmed by control experiments using
target protein constructs devoid of the RGG motifs. These could
not be methylated by SmPRMT1. It is not known, however,
what is the biochemical significance of SMYB1 methylation
by SmPRMT1.
Pull-down assays were also used to study the affinity of
SmPRMT1 to SRC-1 and SmRXR. SRC-1 is a 160 kDa coactiva-
tor that is required for full transcriptional activity of the steroid
receptor superfamily. Retinoid X receptors such as SmRXR1
and SmRXR2 may likewise be involved in the regulation of
gene expression (Fantappi
´
e et al., 2003). These coactivators
were selected as targets because it is known that PRMTs do not
interact directly with nuclear receptors bound to the promoter
region of the regulated genes. The pull-down assays showed that
SmPRMT1 was able to interact with human SRC-1 and in addi-
tion SRC-1 interacted with SmRXR. There was no interaction
between SmPRMT1 and SmRXR1. It is important to mention
that so far no member of the p160 family has been identified
in S. mansoni and thus, the bridge required for the interaction
between SmPRMT1 and SmRXR1 has remained elusive. Nev-
ertheless, our results were compatible with the occurrence of a
ternary complex formed as a consequence of sequential recruit-
ment, presumably triggered by the initial binding of nuclear
receptors.
1.2. Histone acetyl transferases
Histone methylation alone is not sufficient to specify the
interaction of nucleosomes with transcription factors. Thus, the
introductory remarks about methylation of histones are neces-
sarily followed by acetylation (Becker, 2006). As mentioned
before regulators of chromatin structure preceding transcription
respond to structural cues present in the histone tails. Examples
of ligands that recognize these marks are the proteins bearing
domains such as bromo and chromodomains. The bromodomain
represents a broad family of conserved protein modules that pref-
erentially bind acetylated peptides. This leads to the speculation
that the acetylated lysine residues of histone tails could consti-
tute the preferential binding sites of bromodomain-containing
proteins. In this context it has been confirmed that histone H3,
acetylated on lysines K14, K14 and K18, histone H4, acety-
lated on lysines K5 and K8 and histones H2A and H2B are
bromodomain binding targets (de la Cruz et al., 2005). The
chromodomains on the other hand bind to methylated lysines
of histone H3. The bromodomain occurs in nearly all nuclear
histone acetyltransferases (Zeng and Zhou, 2002).
Acetylation of the histone N-terminal tails is found on spe-
cific lysine residues and is catalyzed by acetyl-CoA-dependent
histone acetyl transferases (HATs) (Hansen, 2006; Denu, 2003).
In this model a transcription factor binds to specific DNA
sequences so that the HAT complex is recruited and then acety-
lates the histone tails. Acetylation is a dynamic process that
depends on the interplay between HATs and histone deacetylases
(HDACs). In this context, HAT mediated acetylation cancels the
charge of lysine residues by turning a positively charged amine
into a neutral hydrophobic side chain and thus contributes to
chromatin relaxation and hence correlates with transcriptional
activity. Activation of transcription has been pinpointed to acety-
lation of histone H3 on lysines 9 and 14, in conjunction with
methylation of lysines 4, 36 and 79. In contrast, the deacetyla-
tion catalyzed by HDACs enhances chromatin compactness and,
therefore, correlates with gene silencing. The repression medi-
ated by deacetylation is accompanied by methylation of lysines
9 and 27 which are considered repression marks. However, this
pattern does not seem to constitute a general rule. In a recent
publication (Hansen, 2006) it has been demonstrated that acety-
lation of a single lysine 16 in histone H4 could be associated with
transcriptionally active euchromatic domains. In this instance
H4K16acet was able to change the sedimentation coefficient of
nucleosomal arrays showing that a discrete modification could
profoundly affect their overall conformation.
Even though association between acetylation and gene acti-
vation in S. mansoni has not yet been demonstrated, our own
results on the characterization of a histone acetyltransferase,
SmGCN5, have shown that histone H3 was acetylated (Maciel
et al., 2004). In this work the HAT catalytic domain was
cloned, expressed and functionally tested. The schistosome his-
tone acetyl transferase shared high homology to Drosophila
GCN5 and encoded a 899 aminoacid protein. SmGCN5 dis-
played a HAT domain that exhibited the highest homology
with six other GCN5-related proteins, except for a N-terminal
stretch of 71-aminoacid sequences not found in these proteins.
The C-terminal also contained a 66-aminoacid sequences that
was characteristic of the parasite. Otherwise, SmGCN5 deduced
sequence showed the presence of two LXXLL motifs (the second
LxxLL motif was eventually identified within the HAT domain
of SmGCN5) that have been demonstrated to be essential as a
mediator of the interaction between coregulators and nuclear
receptors.
In order to investigate whether the recombinant SmGCN5 was
able to acetylate proteins a series of synthetic peptides were used
as potential substrates in acetylation assays. The results showed
that only the constructs containing the HAT domain were able to
acetylate the synthetic peptides mimicking the structure of his-
tones H3 and H2A. It was also shown that histone H4 was poorly
acetylated, thus confirming the majority of reports in which
HAT activity is preferentially associated to histone H3 acety-
lation. Furthermore mass spectra of the acetylated histone H3
revealed a single peak of acetylation indicating that histone H3
was monoacetylated by SmGCN5. Acetylation of histone H2A
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
4 M.R. Fantapp´ı´e et al. / Acta Tropica xxx (2008) xxx–xxx
by SmGCN5 was surprising since this histone, although contain-
ing a peptide tail as its counterparts, does not usually take part in
the regulatory mechanism associated to acetylation/methylation.
Although the atypical N-terminal and C-terminal sequences may
be correlated to this heterodox acetylation pattern, the biochem-
ical significance of this result still remains to be investigated.
Finally, confirming its constitutive expression, northern blot
experiments showed that SmGCN5 was equally expressed by
mature and immature males and0 females of S. mansoni.
2. High mobility group proteins
Proteins of the family high mobility group (HMG) proteins
were first characterized as abundant, acid-extractable, nuclear
proteins that behaved atypically in electrophoresis. The high
electrophoretic mobility of these proteins was found to be asso-
ciated to a peculiar primary structure which contains highly
conserved N- and C-terminal regions enriched with basic and
acidic aminoacid residues. Presently, HMG proteins are known
as HMGB which stands for high mobility group box. The family
is made up of three nuclear proteins, all with less than 30 kDa,
HMGB1, HMGB2 and HMGB3. Human HMGB1 proteins are
composed of 215 aminoacids and of two tandem 80 aminoacid
domains, boxes A and B and an acidic tail. On average, mam-
malian HMGB1 proteins from several species have a length of
218 aminoacids. This section will deal mainly with HMGB1
and HMGB2 proteins since these two groups are the better
characterized ones in S. mansoni.
All the HMGB proteins are susceptible to post-translational
modifications such as acetylation, methylation and phosphory-
lation. Because HMGB1 contains many lysine residues, it is
amenable to polyacetylation. The acidic C-terminus contains
many aspartic acid residues. The length of the acidic C-terminal
tail also varies between species (L
¨
angst and Becker, 2004).
Although there are hypothesis for the possible function of the
acidic tail (Travers, 2003), at this moment it is not possible to
ascribe to it a well-defined role in HMGB binding to DNA (see
below).
It is the structured arrangement of the tandem box domains
of the HMGB that confer to this family of proteins its better
known activity, namely DNA binding. The DNA binding func-
tion of HMGB1 can be generalized and this role as a structural
co-factor critical for proper transcriptional regulation in eukary-
otic cells is now recognized (Travers, 2003). The interaction of
HMGB1 proteins with DNA takes place in the minor groove
and is believed to be the result of both, the three-dimensional
compatibility of the tandem domains A and B with the DNA
molecule and charge complementarity. It is worth mentioning
as well that the interaction between HMGB1 and DNA seems to
be sequence independent. HMGB proteins induce sharp or mod-
erate DNA bending, an effect that can be promptly observed
by electrophoresis of the complex protein–DNA (L
¨
angst and
Becker, 2004). The HMGB1 induced alteration of DNA con-
formation is interpreted as being an accessory event in the
regulation of transcription. Thus, DNA bending not only allows
and initiates the recruitment of other transcription factors, but
also, through loop formation, brings together regulatory motifs
present in the DNA molecule that would otherwise be distant in
the primary structure.
Apart from the better-known role of HMGBs as agents
involved in the maintenance of nucleosomes, recent results
have uncovered another biochemical property, independent of
that linked to DNA binding. It is becoming gradually accepted
that HMGB1 may act as cytoquine mediating inflammatory
responses (Yamada and Maruyama, 2007). The physiological
and pathological implications of HMGBs will be discussed later
on in connection with S. mansoni life cycle.
Preliminary studies on the S. mansoni HMGB proteins were
restricted to partial structural analysis of an enriched nuclear
extract of adult worms (Fantappi
´
e and Rumjanek, 1994). In the
same work the binding of HMGB2 to a specific schistosome gene
was also reported. Additional structural and functional informa-
tion on the S. mansoni and Schistosoma japonicum HMGB1
proteins has been recently published (de Oliveira et al., 2006).
The genes for HMGB1 of S. mansoni and S. japonicum were
cloned (SmHMGB and SjHMGB) and sequenced. The deduced
sequences of HMGB1 were found to be relatively smaller (176
aminoacid residues) than those described for other species. The
domains corresponding to boxes A and B displayed the highest
similarity to human HMGB1. In contrast, a striking difference in
the acidic C-tail was found in the parasites HMGB1. Whereas
the human protein contained an unbroken run of 30 glutamic
or aspartic acid residues, the schistosome proteins exhibited
a very short tail with only five acidic aminoacids interrupted
by two serines. Inspection of the available sequence data on
HMGB1 allowed the conclusion that a longer acidic tail might
be a recent evolutionary addition. The biochemical significance
of this difference is still uncertain, but we suggest that the
short acidic C-tail of schistosomes might have a significant
influence on DNA supercoiling (see below). Interestingly, other
HMGB variants were characterized in this work (SmHMGB2
and SmHMGB3) which had different DNA sequences when
compared to SmHMGB1.
Northern blot analysis found no differential expression of
SmHMGB1 when adult male and female parasites were com-
pared. This result is consistent with the fact that HMGB proteins
are constitutively synthesized in eukaryotic cells. Curiously, a
recent publication has reported differential expression of S. man-
soni HMGB1, when stages other than the adult forms were
considered (Gnanasekar et al., 2006). Thus, adults and eggs
displayed the highest expression, whereas cercariae and schisto-
somula expressed very little HMGB1. Presumably in the larval
stages, reduced expression of HMGBs reflects a temporary sit-
uation in which the parasite cells are generally quiescent.
In order to study the DNA binding properties of SmHMGB
and SjHMGB, the clones were expressed in E. coli and the
recombinant proteins and other truncated products tested in
electrophoretic mobility assays, using several conformational
constructs of DNA as targets. SmHMGB1 and
SjHMGB1
were shown to interact preferentially with the cruciform, four-
way junction DNA (4WJ). Likewise, both SmHMGB1 and
SjHMGB1 were able to induce supercoiling in DNA in the
presence of topoisomerase I. The supercoiling induced by
SmHMGB1 and SjHMGB1 was found to be negative in sign.
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
M.R. Fantapp´ı´e et al. / Acta Tropica xxx (2008) xxx–xxx 5
The importance of the acidic C-tail on the ability of HMGB1
to supercoil DNA was more obvious when the experiments
were carried out at high ionic strength. The results showed
that whereas SmHMGB1 could induce supercoiling, this was
suppressed when human full-length HMGB1 was tested. This
difference in supercoiling was not observed when human and
SmHMGB1 proteins lacking the acidic C-tail were assayed. In
short, it is suggested that the relatively long acidic C-tail, present
in human HMGB1 (and in species bearing long acidic C-tails)
may have a suppressive role in DNA supercoiling. That the C-
terminal acidic tail seems to inhibit the DNA-binding activity of
HMGB1to DNA is in agreement with recent reports (Thomas
and Chiang, 2006).
Collectively these results suggest that when compared to
human gene regulatory mechanisms, schistosomes may be more
dependent on HMGB1-induced topological alterations at the
level of nucleosomes. Humans and other species, on the other
hand, might have gradually evolved more complex transcription
machinery which is reflected mainly by an increased number
of transcription factors.
It was mentioned earlier that HMGB proteins have a role
as mediators of inflammation. This activity of HMGBs may
be relevant to schistosomiasis since this pathology is actually
characterized by an intense egg-induced inflammatory process,
affecting specially the liver and spleen of infected individu-
als. Indeed, it was found that SmHMGB1 has pro-inflammatory
properties similar to HMGB1 from other species. It is envisaged
that the HMGB1 proteins are thus transported to the cytoplasm
and secreted as cytokines that end up stimulating the release of
other cytoquines by the host’s macrophages, particularly TNF␣
(Gnanasekar et al., 2006). At any rate the available data of
SmHMGB1 in the infection by S. mansoni is still fragmen-
tary and does not present a clear picture regarding both, its
participation in the host–parasite relationship and its mode of
action. Ongoing experiments in our laboratory address these
questions.
3. CBP/p300 transcription coactivators
Cyclic AMP regulatory element-binding protein (CREB)
recognizes and binds to a cyclic AMP response element, a
motif present in many genes that are activated by cyclic AMP.
CREB-binding protein (CBP) binds to phosphorylated CREB
and activates the transcription of the genes regulated by CREB.
CBP and its related transcription coactivator p300 are global
regulators of transcription. These are highly conserved pro-
teins that can be described as having several roles within the
complex that activates and makes up the transcription machin-
ery. p300 was first identified as an adenovirus E1A-binding
protein and CBP was first identified as a CREB-binding pro-
tein that co-activates the CREB transcription factor. Both p300
and CBP are nuclear phosphoproteins containing approximately
2400 aminoacids and have molecular masses of about 300 kDa.
Several studies have show that a p300-binding protein termed
PCAF contain histone acetylation activity. Besides histones,
CBP and p300 can acetylate other cellular transcription fac-
tors such as p53 and thus modulate its DNA-binding activity.
The enzymatic activity of the two-chromatin modifying pro-
teins is derived from the presence of a HAT domain (see above).
Thus, acetylation of histones by CBP, as well as several other
proteins contributes towards exposing target motifs on the pro-
moter, including the TATA box, to various activating factors.
Independently of the acetylation activity, CBP transcriptional
coactivator proteins play a central role in co-ordinating and inte-
grating multiple signal-dependent events by acting as a bridging
factor between the various ligands and the transcriptional appa-
ratus. Also, besides the bridging role and its intrinsic acetylation
properties, partly as a function of its size, CBP provides a protein
scaffold upon which a complex network of regulatory proteins
can be assembled. It is not surprising, therefore, that the partic-
ipation of CBP is linked to several important cellular processes
such as proliferation, differentiation and apoptosis.
That CBP/p300 is a highly conserved family was confirmed
by sequence analysis of the two S. mansoni isoforms, SmCBP1
and SmCBP2. We originally identified SmCBP1 using a degen-
erate PCR approach and SmCBP2 was isolated after screening
S. mansoni EST libraries using SmCBP1 as a probe (Bertin et
al., 2006). Of the two orthologues, SmCBP2 was found to be less
well conserved with respect to the human CBP/p300. Although
SmCBP1 and SmCBP2 displayed discrete differences in their
primary structure, they were globally more similar to each other
than to CBPs of other species. Nevertheless, it was found that
all the major domains typical of the CBP/p300 protein family
were present in SmCBP1 and SmCBP2, even though the reported
sequence of the latter is still incomplete (Bertin et al., 2006). The
domains comprise the KIX domain and other motifs involved in
binding of transcriptional activators, the bromodomain and the
HAT domain. Besides these domains, the schistosome genes
contained sequences corresponding to NR-boxes that interact
with nuclear receptors.
Because members of the CBP family participate in the acti-
vation of many different genes, they could be considered as
constitutive genes. In order to test this hypothesis, quantitative
expression of SmCBP1 and SmCBP2 was analyzed. Surpris-
ingly there was clear differential expression along the life cycle
of schistosomes. The highest expression for both isoforms was
associated to miracidia, one of the two free-living stages of the
parasite. For the other stages, the pattern of differential expres-
sion of SmCBP1 and SmCBP2 differed from each other, a result
that suggested distinct functions for each isoform. For exam-
ple, after miracidia SmCBP1 of cercariae and schistosomula
exhibited the highest expression, whereas SMCBP2 had approx-
imately the same level of expression for all the stages. Although
the biochemical meaning of the distinct patterns of differen-
tial expression between SmCBP1 and SmCBP2 remains to be
clarified, it was consistent with the different sequences found
for each gene. High expression levels in miracidia were also
found for SmGCN5 ( ), a result that supports the idea that this
stage is characterized by considerable biosynthetic activity as
far as transcription is concerned. Presumably, active transcrip-
tion might reflect intense developmental changes just prior to
snail infection.
Like SmGCN5, a recombinant protein containing the HAT
domain of SmCBP1 was shown to acetylate a crude mixture
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
6 M.R. Fantapp´ı´e et al. / Acta Tropica xxx (2008) xxx–xxx
of calf thymus histones. Although the mixture included histones
H3, H2A, H2B and H4, there was preferential labeling of histone
H4 (Bertin et al., 2006). Similar results were obtained in inde-
pendent experiments, in which comparable acetylating activity
was obtained when histones H2A, H3 and H4 were used as
substrates. The HAT domain of SmCBP could also acetylate
HMGB1 proteins (Maciel, personal communication). Theses
result must be interpreted with caution, however. It is known
that a general feature of HAT recombinant proteins is the indis-
criminate acetylation of free histones and other proteins bearing
lysine residues. In contrast, it has been demonstrated that nucle-
osome acetylation only occurs in the in vivo situation. Thus,
it must be kept in mind that intracellular biochemical acetyla-
tion by HAT proteins could show patterns different from those
obtained in vitro, based on the fact that HAT proteins belonging
to individual families seem to display unique substrate speci-
ficities (Marmorstein, 2001). This, of course, is also valid for
the in vitro results obtained with SmGCN5 (Maciel, 2004). It is
worth mentioning that the secretion of HMGB1 in its role as a
proinflammatory agent depends on acetylation by CBP/p300 or
by p/CAF (Bonaldi et al., 2003). Therefore, it is reasonable to
propose an indirect role for SmCBP1 in the acetylation of SmH-
MGB1, an action that may be important in the pathogenesis of
schistosomiasis.
As mentioned above, CBP/p300 proteins are known as tran-
scription coactivators. The sequence data and enzymatic activity
of the HAT domain obtained for SmCBP1 and SmCBP2 are com-
patible with such identity. However, in order to fit the description
of a coactivator, it is necessary to test whether the ligand domains
of the recombinant protein are able to interact with other tran-
scription factors. This was carried out with a homologue of the
human Ftz-F1 family, since it has been demonstrated that CBP
is able to mediate the transcriptional activity of SF-1 (Bertin
et al., 2006). In this experiment full length SmCBP1 immobi-
lized to Sepharose was shown to bind to
35
S-labelled SmFtz-F1,
albeit with low affinity. Furthermore, cotransfection experiments
with plasmid vectors containing the full length SmCBP1 were
shown to activate the transcription of SmFtz-F1 by two to three-
fold, using luciferase as a reporter vector (Bertin et al., 2006).
These results demonstrated that besides acetylation, SmCBP1
was also able to transactivate a reporter gene and hence can be
functionally classified as a coactivator.
4. LIM domain proteins and LIMPETins
LIM stands for the initials of the first three proteins in which
the domains described below were characterized. LIM domains
are composed of approximately 55 aminoacid residues, eight of
which are usually highly conserved and are interspersed at regu-
lar intervals along the primary structure. These motifs contribute
towards the formation of tandem zinc fingers, which assume the
appearance of loops, hence the name. Apparently these protein
structures are exclusively found in eukaryotes. LIM proteins
are usually associated to regulatory functions and are mainly
involved in protein–protein interactions.
In the majority of cases the conserved aminoacids are cys-
teines and histidines. Typically, a motif present in LIM domains
is: CX
2
CX
16–23
HX
2
CX
2
CX
2
CX
16–21
CX
2
C/H/D, in which X
could be any aminoacid. Proteins bearing the LIM domain may
also contain other domains such as homeodomains, catalytic
domains and other protein binding domains. LIM proteins con-
stitute a family whose members are defined by the secondary
structure made up by the motifs described above and by their
occurrence in a specific tissue. Thus the LIM proteins contain
four LIM domains and a single zinc finger at the NH
2
termi-
nus that corresponds to a half domain. Because of this peculiar
structure the acronym FHL was generated standing for, for four
and a half LIM, domains. Five different FHL proteins have
been described, FHL1–FHL4 and ACT (activator of CREM
in testis). FHL4 and ACT are found in testis, whereas FHL1,
FHL2, and FHL3 occur mainly in contractile tissue such as
muscle.
ACT is a testis-specific coactivator that interacts with a
cyclic AMP response element modulator (CREM), which in
turn belongs to a family of transcription factors that target genes
possessing cyclic AMP response elements (CREs). ACT which
is conserved in mice and men takes part in the male gamete
formation and, therefore, is of great interest in the case of S. man-
soni, a helminth which is characterized by sexual dimorphism.
Although it has not yet been possible to identify a S. mansoni pro-
tein homologous to ACT (see below), nuclear extracts of adult
worm were shown to contain a protein(s) that specifically inter-
acted with sequences bearing the CRE motif in electrophoretic
mobility shift assays (Furtado, umpublished results). Presum-
ably the sequence homology of the ACT-like nuclear factor of
S. mansoni was restricted to the DNA binding motif. Efforts to
characterize the S. mansoni ACT-like coactivator are described
ahead.
Preliminary screening of S. mansoni DNA sequences data
banks TIGR S. mansoni Gene Index using the sequence of
ACT/FHL5 revealed the sequence of a contig of 631 bp with
significant homology to the mouse protein sequence. Primers
based on this sequence allowed the amplification of a product
which was then used as a probe to screen a cDNA library of S.
mansoni constructed from mRNA extracted from adult male and
female worms. A clone was then isolated which upon sequenc-
ing proved not to code for ACT, but to a novel class of protein
bearing both domains, LIM and PET. PET stands for the ini-
tials of three proteins in which the domain was found (Gubb
et al., 1999; Divecha and Charleston, 1995). The PET domain
consists of a conserved sequence of aminoacids found in the
N-terminus of proteins containing LIM domains. Thus the S.
mansoni protein was preliminary classified as SmLIMPETin
(Furtado, umpublished). The suffix in stands for invertebrate,
since the sequence of SmLIMPETin, coding for a protein of 556
aminoacid residues and containing six probable LIM domains
besides a PET domain, displayed the highest similarity and
identity to invertebrate LIMPETins. LIMPETins constitute a
novel family of proteins that due to their peculiar secondary
structures could be tentatively classified as regulatory factors.
Functional assays with SmLIMPETin, however, remain to be
carried out.
In order to summarize the results and to facilitate and integrate
them, a diagram including all the transcription factors and other
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
M.R. Fantapp´ı´e et al. / Acta Tropica xxx (2008) xxx–xxx 7
Fig. 1. Integration of the several activators and co-activators in S. mansoni. The diagram shows that chromatin remodeling is mediated by acetylation of histones
catalysed by SmCBP and SmGCN5. Histone, SmYBOX and SmSmD3 methylation is carried out by SmPRMT1. The diagram highlights the interaction between
SmPRMT1 and hSRC-1. Likewise, SmFTZ-F1 was shown to interact with SmCBP and activate transcription via SFRE/PROMO FF1. In addition, several motifs
present in the primary structure of DNA can become accessible through DNA folding mediated by HMGB1.
regulatory elements of S. mansoni described in the present work
has been added (Fig. 1).
Acknowledgements
This work received financial support from UNDP/World
Bank/World Health Organization/TDR, Conselho Nacional de
Desenvolvimento Cient
´
ıfico e Tecnol
´
ogico, CNPq-PROFIX,
CAPES, FAPERJ and The Brazilian and Czech Republic
Academy of Sciences.
References
Becker, P.B., 2006. A finger on the mark. Nature 442, 31–32.
Bedford, M.T., Richard, S., 2005. Arginine methylation: an emerging regulator
of protein function. Mol. Cell 18, 263–272.
Bertin, B., Oger, F., Cornette, J., Caby, S., No
¨
el, C., Capron, M., Fantappi
´
e,
M.R., Rumjanek, F.D., Pierce, R.J., 2006. Schistosoma mansoni CBP/p300
has conserved domain structure and interacts functionally with the nuclear
receptor SmFtz-F1. Mol. Biochem. Parasitol. 146, 180–191.
Bonaldi, T., Talamo, F., Scaffidi, P., Ferrera, D., Porto, A., Bachi, A., Rubartelli,
A., Agresti, A., Bianchi, M.E., 2003. Monocytic cells hyperacetylate chro-
matin proteins HMGB1 to redirect it towards secretion. EMBO J. 22 (20),
5551–5560.
de la Cruz, X., Lois, S., Sanchez-Molina, S., Martinez-Balb
´
as, M.A., 2005. Do
protein motifs read the histone code? Bioessays 27, 164–175.
Denu, J.M., 2003. Linking chromatin function with metabolic networks: Sir2
family of NAD+-dependent deacetylases. Trends Biochem. Sci. 28 (1),
41–48.
de Oliveira, F.M.B., da Silva, I.C.A., Rumjanek, F.D., Dias-Neto, E., Guimar
˜
aes,
P.E.M., Verjovski-Almeida, S., Stros, M., Fantappi
´
e, M.R., 2006. Cloning
the genes and DNA binding properties of high mobility group B1 (HMGB1)
proteins from the human blood flukes Schistosoma mansoni and Schistosoma
japonicum. Gene 377, 33–45.
Divecha, N., Charleston, B., 1995. Cloning and characterization of two new
cDNAs encoding murine triple LIM domains. Gene 156 (2), 283–286.
Fantappi
´
e, M.R., Rumjanek, F.D., 1994. Characterization of a HMG2-like pro-
tein from Schistosoma mansoni. Parasitology 108, 43–50.
Fantappi
´
e, M.R., Osman, A., Ericsson, C., Niles, E.G., LoVerde, P.T., 2003.
Cloning of Schistosoma mansoni Seven in Absentia (SmSINA)(+) homo-
logue cDNA, a gene involved in ubiquitination of SmRXR1 and SmRXR2.
Mol. Biochem. Parasitol. 131 (1), 45–54.
Gnanasekar, M., Velusamy, R., He, Y.X., Ramaswamy, K., 2006. Cloning and
characterization of a high mobility group box 1 (HMGB1) homologue
protein from Schistosoma mansoni. Mol. Biochem. Parasitol. 145, 137–
146.
Gubb, D., Green, C., Huen, D., Coulson, D., Johnson, G., Tree, D., Collier, S.,
Roote, J., 1999. The balance between isoforms of the Prickle LIM domain
protein is critical for planar polarity in Drosophila imaginal discs. Genes
Dev. 13 (17), 2315–2327.
Hansen, J.C., 2006. Linking genome structure and function through specific
histone acetylation. ACS Chem. Biol. 1 (2), 69–72.
Krause, C.D., Yang, Z.H., Kim, Y.S., Lee, J.H., Cook, J.R., Pestka, S., 2007.
Protein arginine methyltransferase: evolution and assessment of their phar-
macological and therapeutic potential. Pharmacol. Ther. 113, 50–87.
L
¨
angst, G., Becker, P.B., 2004. Nucleosome remodeling: one mechanism, many
phenomena? Biochim. Biophys. Acta 1677 (1–3), 58–63.
Li, H., Llin, S., Wang, W., Duncan, E., Wysocka, J., Allis, C.D., 2006. Molecular
basis for site-specific read-out of histone H3K4me3 by BPTF PHD finger of
NURF. Nature 442, 91–95.
Maciel, R.M., Dutra, D.L.S., Rumjanek, F.D., Neto, L.J., Juliano, M.A., Fan-
tappi
´
e, M.R., 2004. Schistosoma mansoni histone acetyltransferase GCN5:
linking histone acetylation to gene activation. Mol. Biochem. Parasitol. 133,
131–135.
Mansure, J.J., Furtado, D.R., de Oliveira, F.M.B., Rumjanek, F.D., Franco,
G.R., Fantappi
´
e, M.R., 2005. Cloning of a protein arginine methyltrans-
ferase PRMT1 homologue from Schistosoma mansoni: evidence for roles in
nuclear receptor signaling and RNA metabolism. Biochem. Biophys. Res.
Commun. 335 (4), 1163–1172.
Marmorstein, R., 2001. Structure and function of histone acetyltransferases.
Cell. Mol. Life Sci. 58, 693–703.
Martin, C., Zhang, Y., 2005. The diverse functions of histone lysine methylation.
Nat. Rev. Mol. Cell Biol. 6, 838–849.
Pe
˜
na, P., Davrazou, F., Shi, X., Walter, K.L., Verkhusha, V.V., Gozani, O., Zhao,
R., Kutateladze, T.G., 2006. Molecular mechanism of histone H3K4me3
recognition by plant homeodomain of ING2. Nature 442, 100–103.
Please cite this article in press as: Fantapp
´
ı
´
e, M.R., et al., Control of transcription in Schistosoma mansoni: Chromatin remodeling and other
regulatory elements, Acta Trop. (2008), doi:10.1016/j.actatropica.2007.11.006
ARTICLE IN PRESS
+Model
ACTROP-2043; No. of Pages 8
8 M.R. Fantapp´ı´e et al. / Acta Tropica xxx (2008) xxx–xxx
Requena, J.M., Alonso, C., Soto, M., 2000. Evolutionarily conserved proteins
as prominent immunogens during Leishmania infections. Parasitol. Today
16, 246–250.
Roh, T.Y., Cuddapah, S., Cui, K., Zhao, K., 2006. The genomic landscape of
histone modifications in human T cells. Proc. Natl. Acad. Sci. N.Y. 103 (43),
15782–15787.
Shi, X., Hong, T., Walter, K.L., Ewalt, M., Michishita, E., Hung, T., Carney,
D., Pe
˜
na, P., Lan, F., Kaadige, M.R., Lacoste, N., Cayrou, C., Davrazou,
F., Saha, A., Cairns, B.R., Ayer, D.E., Kutateladze, T.G., Shi, Y., Cot
´
e, J.,
Chua, K.F., Gozani, O., 2006. ING2 PHD domain links histone H3 lysine 4
methylation to active gene repression. Nature 442, 96–99.
Thomas, M.C., Chiang, C.M., 2006. The general transcription machinery and
general cofactors. Crit. Rev. Biochem. Mol. Biol. 41 (3), 105–178.
Travers, A.A., 2003. Priming the nucleosome: a role for HMGB proteins? EMBO
Rep. 4 (2), 131–136.
Verjovski-Almeida, S., DeMarco, R., Martins, E.A., Guimaraes, P.E., Ojopi,
E.P., Paquola, A.C., Piazza, J.P., Nishiyama Jr., M.Y., Kitajima, J.P., Adam-
son, R.E., Ashton, P.D., Bonaldo, M.F., Coulson, P.S., Dillon, G.P., Farias,
L.P., Gregorio, S.P., Ho, P.L., Leite, R.A., Malaquias, L.C., Marques, R.C.,
Miyasato, P.A., Nascimento, A.L., Ohlweiler, F.P., Reis, E.M., Ribeiro,
M.A., Sa, R.G., Stukart, G.C., Soares, M.B., Gargioni, C., Kawano, T.,
Rodrigues, V., Madeira, A.M., Wilson, R.A., Menck, C.F., Setubal, J.C.,
Leite, L.C., Dias-Neto, E., 2003. Transcriptome analysis of the acoelo-
mate human parasite Schistosoma mansoni. Nat. Genet. 35 (2), 148–
157.
Wysocka, J., Swigut, T., Xiao, H., Milne, T.A., Kwon, S.Y., Landry, J., Kauer,
M., Tackett, A.J., Chait, B.T., Badenhorst, P., Wu, C., Allis, C.D., 2006.
A PHD finger of NURF couples histone H3 lysine 4 trimethylation with
chromatin remodeling. Nature 442, 86–90.
Yamada, S., Maruyama, I., 2007. HMGB1, a novel inflammatory cytokine. Clin.
Chim. Acta 375, 36–42.
Zeng, L., Zhou, M.M., 2002. Bromodomain: an acetyl-lysine binding domain.
FEBS Lett. 513, 124–128.
159
ANEXO B – MAPA DO VETOR pQE80L (QIAGEN) COM SEQÜÊNCIA DA
REGIÃO DE CLONAGEM
160
ANEXO C – MAPA DO VETOR pGEX4T1 (GE HEALTHCARE) COM SEQÜÊNCIA
DA REGIÃO DE CLONAGEM
161
ANEXO D – MAPA DO VETOR pEGFP-C3 (CLONTECH) COM SEQÜÊNCIA DA
REGIÃO DE CLONAGEM
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo