ads:
André Luiz Sena Guimarães
Estudo da associação entre Estomatite Ulcerativa
Recorrente, Síndrome da Ardência Bucal e
polimorfismos funcionais nos genes SLC6A4,
IL1B,IL6,IL10, TNFA
Tese apresentada ao Curso de Pós-
graduação em Farmacologia Bioquímica e
Molecular do Instituto de Ciências Biológicas
da Universidade Federal de Minas Gerais,
como requisito parcial à obtenção do título de
Doutor em Farmacologia Bioquímica e
Molecular.
Orientador: Prof Dr. Ricardo Santiago Gomez
Universidade Federal de Minas Gerais
Belo Horizonte
Instituto de Ciências Biológicas da UFMG
2006
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
‘’No meio da dificuldade, está a oportunidade’’
Afinal,
"O único lugar aonde o sucesso vem antes do trabalho é no dicionário."
(Albert Einstein)
ads:
AGRADECIMENTOS
Em primeiro lugar agradeço a Deus por inserir em minha vida tantas pessoas
maravilhosas que por toda a minha vida estarão em meu coração.
Aos meus pais, irmãos e sobrinhos pelo amor, carinho, proteção e apoio em
qualquer momento.
Ao meu amor, Karollyne que simplesmente me faz sentir o homem mais feliz do
mundo.
Ao senhor Lodonio pelo carinhoso acolhimento
Ao meu orientador Prof. Dr. Ricardo Santiago Gomez agradeço principalmente a
amizade, mas nunca esquecerei a sua rapidez e eficiência (de sempre) e seu exemplo
cidadão.
Aos que de professores se tornaram grandes amigos: Prof. Dr. Wagner Castro,
Prof. Dr. Rodrigo Albuquerque, Prof. Dr. José Eustáquio da Costa e Profa. Dra. Tarcília
Aparecida.
Aos professores do Curso de Farmacologia Bioquímica e Molecular pelos
conhecimentos passados, pela oportunidade de conhecer e trabalhar com grandes
cientistas.
Aos professores do Departamento de Patologia Prof. Dr.Ricardo Mesquita, Profa.
Dra. Maria Cássia, Profa. Dra. Maria Auxiliadora e Prof. Dr. Wagner Santos pela
receptividade e conhecimentos passados.
Aos Pacientes pela colaboração
Aos meus amigos Hugo, Wilson, Rodrigo, Denis, Maurício e Mauro.
Aos amigos do laboratório de patologia odontológica e biologia molecular
Aos Professores do projeto TMO pela ajuda.
Aos colegas da Neurofarmacologia
Aos alunos da graduação da FO-UFMG pela convivência
Aos Funcionários da FO-UFMG
Às agências de fomento à pesquisa
Guimarães AL 1
RESUMO
Este trabalho teve como objetivo geral investigar uma possível associação entre
cinco polimorfismos genéticos funcionais em duas doenças bucais de etiologias diferentes
em pacientes brasileiros. Para isto, a tese foi dividida em três artigos.
No primeiro, foi avaliada a associação entre os polimorfismos genéticos IL-1B
+3954 (C/T) e 5HTTLPR com a Síndrome da Ardência Bucal (SAB). Para este estudo foi
extraído o DNA de trinta pacientes com SAB e trinta e um controles. Não observamos
diferença estatística entre os grupos quanto à distribuição do polimorfismo 5-HTTLPR
(P=0.60), por outro lado, um aumento significante do genótipo heterozigoto, CT, foi
encontrado nos pacientes com SAB (P=0.005). Concluímos então que há uma associação
entre o genótipo alto produtor de IL-1β e SAB, embora mais estudos são necessários para
identificar o papel desta citocina na etiologia da SAB.
Em seguida, estudamos a associação entre o polimorfismo IL-1B +3954 (C/T) e a
EUR. Sessenta e dois pacientes com EUR e 62 voluntários saudáveis foram genotipados
para o polimorfismo IL-1B +3954. Um aumento significante da presença do genótipo
heterozigoto, CT, foi observado nos pacientes com EUR (p= 0.01). Estes resultados
sugerem que há uma associação entre o genótipo que confere uma produção aumentada
de IL-1β e EUR.
Por último, avaliamos pela primeira vez, através análise multivariada, a associação
de polimorfismos genéticos nos genes IL-B, IL-6, IL-10 e TNFA e EUR. Sessenta e quatro
pacientes com EUR econtroles participaram deste estudo. Concluímos que existe uma
associação entre os genótipos heterozigotos dos genes IL-1 e TNFA (p= 0.03 e p=0.04,
respectivamente) e EUR na população estudada.
SUMÁRIO
RESUMO ......................................................................................................................................................... 1
SUMÁRIO......................................................................................................................................................... 2
1- INTRODUÇÃO........................................................................................................................................... 3
1.1- POLIMORFISMOS GENÉTICOS........................................................................................................ 4
1.2- RESPOSTA IMUNE E CITOCINAS..................................................................................................... 5
1.2.1- Interleucina-1β........................................................................................................................................ 7
1.2.2- Interleucina-6.......................................................................................................................................... 9
1.2.3- Interleucina-10...................................................................................................................................... 11
1.2.4- Fator de Necrose Tumoral-α................................................................................................................. 12
1.3- TRANSMISSÃO SEROTONINÉRGICA............................................................................................ 13
1.3.1- Polimorfismo do Gene Transportador de Serotonina (5-HTTLPR)...................................................... 14
1.4- ESTOMATITE ULCEROSA RECORRENTE (EUR)....................................................................... 15
1.5- SÍNDROME DA ARDÊNCIA BUCAL (SAB).................................................................................... 19
2- ARTIGO I.................................................................................................................................................. 22
3- ARTIGO II ...................................................................................ERRO! INDICADOR NÃO DEFINIDO.
4- ARTIGO III..................................................................................ERRO! INDICADOR NÃO DEFINIDO.
5- CONSIDERAÇÕES FINAIS ......................................................ERRO! INDICADOR NÃO DEFINIDO.
5- REFERÊNCIAS BIBLIOGRÁFICAS.......................................ERRO! INDICADOR NÃO DEFINIDO.
6- ANEXOS.......................................................................................ERRO! INDICADOR NÃO DEFINIDO.
ANEXO I (ASPECTOS ÉTICOS) ..................................................ERRO! INDICADOR NÃO DEFINIDO.
ANEXO II (GENÓTIPOS)..............................................................ERRO! INDICADOR NÃO DEFINIDO.
ANEXO III (SEQUÊNCIAS DOS POLIMORFISMOS GENÉTICO)............ERRO! INDICADOR NÃO
DEFINIDO.
1- INTRODUÇÃO
Introdução 4
1.1- Polimorfismos Genéticos
O conceito tradicional de polimorfismo presente nos livros textos é o de alterações
na carga genética dos indivíduos, ocorrendo em uma freqüência de, no mínimo 1% de
uma determinada população, que resultam em variações dentro de um padrão ainda
considerado biologicamente normal, podendo causar ou não alterações na função da
proteína e fenótipo. Existe uma proposta para se agrupar polimorfismos genéticos e
mutações em um único grupo, porém na literatura encontramos uma grande variedade de
nomenclatura destas variações nas seqüências genéticas (den Dunnen & Antonarakis,
2001).
Um polimorfismo na região promotora poderá alterar a proporção da transcrição de
uma determinada proteína. Já quando localizado na região codificadora ou nos limites
intron/exon, pode produzir proteínas incompletas ou inativas, como resultado de um
splicing incorreto do ácido ribonucléico mensageiro (RNAm). Polimorfismos genéticos
caracterizados por completas deleções gênicas eliminam qualquer atividade funcional da
proteína, enquanto polimorfismos genéticos que são duplicações do gene inteiro podem
resultar em elevados níveis de atividade (Miller e cols., 2001).
As técnicas mais usadas para se detectar a ocorrência de polimorfismos genéticos
envolvem os polimorfismos genéticos de comprimento de fragmentos de restrição
(RFLPs) (Botstein e cols., 1980), e os polimorfismos genéticos de número variável de
repetições em tandem (VNTRs) (Moretti e cols., 2001). Alguns polimorfismos genéticos de
ponto que criam ou destroem sítios de restrição enzima-específicos esta técnica e
denominada de RFLP. Como as enzimas de restrição têm seqüências de reconhecimento
específicas no DNA, as alterações da seqüência do DNA genômico acarretam na criação
ou destruição de sítios de clivagem alterando, desse modo, o tamanho de um ou mais
fragmentos de DNA oriundos da ação da enzima de restrição (Miller e cols, 2001). Os
Introdução 5
polimorfismos genéticos por inserção/deleção que consistem numa série de
comprimentos de fragmentos alélicos, relacionados entre si por um número variável de
seqüências de DNA repetidas em tandem no intervalo entre dois sítios de restrição são os
VNTRs (Moretti e cols, 2001).
Os VNTRs e os RFLPs detectam polimorfismos de forma similar, através da
amplificação da região de interesse pela técnica da reação em cadeia da polimerase
(PCR) e, se necessário, posterior tratamento com enzimas de restrição que reconhecem
sítios específicos e originam fragmentos de DNA com comprimentos variados. Enquanto
os RFLPs revelam polimorfismos genéticos devido à presença ou ausência de um sítio de
restrição, os VNTRs revelam polimorfismos genéticos devido a números diferentes de
repetições situadas entre o sítio de amplificação (Botstein e cols, 1980; Moretti e cols,
2001).
Polimorfismos genéticos funcionais em genes de citocinas e outros mediadores
inflamatórios, que podem confirmar diferenças interindividuais na síntese e secreção
dessas proteínas, têm sido associados a doenças que apresentam componentes
inflamatórios (Parkhill e cols., 2000) ou comportamentais (Brydon e cols., 2005). Portanto,
a investigação e a caracterização dos elementos específicos alterados podem
proporcionar biomarcadores aplicáveis em diagnóstico e prognóstico, estimando o risco
em indivíduos (Kornman e cols., 1997).
1.2- Resposta imune e Citocinas
As células e moléculas responsáveis pela imunidade constituem o chamado
sistema imune e a resposta deste sistema frente a uma agressão é denominada resposta
imune. Esta foi didaticamente dividida em resposta inata e adaptativa. A resposta inata se
dá através dos mediadores inatos tais como toxinas bacterianas, neuropeptídeos,
Introdução 6
peptídeos fibrinolíticos, cininas, fragmentos do sistema complemento, aminas vasoativas,
enzimas lisossomais e citocinas. Em relação à resposta adaptativa, esta pode ser
mediada por células, através das ações de linfócitos T (LT) e citocinas (resposta imune
celular), ou mediada por anticorpos, produtos de linfócitos B (LB) ativados (resposta
imune humoral)(Akira e cols., 2006)
Citocinas são geralmente proteínas ou glicoproteínas de peso molecular
relativamente baixo (8 a 30kD) e, freqüentemente, consistem de uma única cadeia
polipeptídica. Elas regulam processos biológicos importantes, tais como: crescimento e
ativação celulares, inflamação, imunidade, reparo tecidual, fibrose e morfogênese (Van
Wyk, 1992; Hopkins, 2003).
O termo citocinas já esteve baseado nos tipos celulares que as produziam;
portanto, monocinas, linfocinas e interleucinas eram utilizadas para identificarem produtos
de macrófagos, linfócitos e leucócitos, respectivamente. Algumas citocinas são fatores
quimiotáticos para certos tipos celulares e são denominadas quimiocinas; já outras
receberam a nomenclatura de acordo com suas funções biológicas. Com o advento das
técnicas moleculares, tornou-se claro que a mesma proteína pode ser sintetizada por uma
variedade de tipos celulares, incluindo células endoteliais e algumas células epiteliais. Por
isso, o termo genérico citocinas tem sido preferido para designar essa classe de
mediadores (Hopkins, 2003).
Algumas citocinas promovem inflamação e são chamadas de pró-inflamatórias, ao
passo que outras, por suprimirem tal atividade, são chamadas de antiinflamatórias.
Interleucina-4 (IL-4), (IL-10) e interleucina-13 (IL-13) são potentes ativadoras de linfócito
B; entretanto, elas também são importantes agentes antiinflamatórios por possuírem a
habilidade de suprimirem genes das citocinas pró-inflamatórias, como IL-1, TNF, e
quimiocinas (Dinarello, 2000).
Introdução 7
A secreção de citocinas é um evento breve e autolimitado, não existindo como
moléculas pré-formadas, e sim necessitando de ativação transcricional. Uma vez
sintetizadas, elas são rapidamente secretadas (Arai e cols., 1992).
As ações das citocinas se realizam através de ligações de alta afinidade a
receptores específicos, localizados nas membranas das células-alvo (van e cols., 1992).
Diferentes citocinas utilizam vias de sinalização especializadas, tal como a via Janus
Kinases (JAKs) / Sinal Transducers and Activators of Transcription (STATs). A porção
citoplasmática de muitos receptores de citocinas está associada aos membros dos
receptores de tirosina-quinase da família das JAKs. Após a ligação, os JAKs tornam-se
ativados por fosforilação. Uma vez ativados, eles fosforilam resíduos específicos de
tirosina nos receptores de citocinas. Esses resíduos servem como porta para a entrada
dos fatores de transcrição conhecidos como STATs. Proteínas STATs específicas e, até
então, inativas são recrutadas aos receptores das citocinas e, então, fosforiladas. Ao
mesmo tempo em que são liberadas do receptor, as STATs dimerizam-se e são
translocadas para o núcleo. Nesse local, dímeros de STATs se ligam a seqüências
específicas próximas aos promotores dos genes induzidos por citocinas, resultando na
indução de sua produção (Leonard & O'Shea, 1998).
Citocinas possuem efeitos locais e sistêmicos, apresentando padrões de ação
autócrinos, parácrinos e endócrinos (van e cols, 1992).
1.2.1- Interleucina-1β
A IL-1β madura é uma proteína de 17,5KD codificada pelo respectivo gene IL-1B e
que se encontra arranjado em cluster, juntamente com os genes IL-A e IL-1RN, no braço
longo do cromossomo 2 humano em uma região de 430 Kb (Nicklin e cols., 1994). Os
Introdução 8
primeiros estudos sobre a citocina IL-1β apontaram a sua a capacidade de produzir febre
(di Giovine & Duff, 1990). Estes resultados também foram confirmados posteriormente
(ATKINS, 1960; Dinarello, 2000). Além do mais, a IL-1β tem se mostrado não só como
potente pirógeno endógeno, mas também a citocina pró-inflamatória mais potente
podendo então, influenciar a resposta do hospedeiro em inúmeras doenças (Merriman e
cols., 1977).
A IL-1β está envolvida na ativação de células endoteliais e conseqüente aumento
da expressão da molécula de adesão intercelular-1 (ICAM-1) e selectina-E,
proporcionando a migração e recrutamento celular (Figueredo e cols., 1999). Os
aumentos nos níveis destas moléculas de adesão em algumas doenças, como a EUR,
podem estar associados com um polimorfismo genético associado à maior produção de
IL-1β, o que pode favorecer o desenvolvimento das úlceras (Bazrafshani e cols., 2002a;
Guimarães AL e cols., 2006a). Além disso, níveis aumentados de IL-1β têm se mostrado
também no sangue e líquor de pacientes deprimidos (Maes e cols., 1991a; Maes e cols.,
1991b).
Outros estudos também sugerem que essa citocina pode estimular a liberação de
outros mediadores pró-inflamatórios, como a IL-8 e TNF-α (Figueredo e cols, 1999).
As fontes primárias de IL-1β são os monócitos, macrófagos e células dendríticas.
Linfócitos B, células natural killer (NK) e queratinócitos também produzem essa citocina
(Dinarello, 1989).
Recentemente, polimorfismos genéticos dentro dos genes desse cluster foram
descritos e algumas dessas variações genéticas têm sido associadas a diferenças nos
níveis produzidos de IL-1α e IL-1β (Molvig e cols., 1988; Endres e cols., 1989), levando
alguns indivíduos a apresentarem uma resposta inflamatória mais exacerbada que outros,
frente ao mesmo estímulo. Polimorfismos genéticos funcionais no locus –511 e +3954 do
Introdução 9
gene da IL-1β já foram descritos (Pociot e cols., 1992). O polimorfismo funcional mais
estudado é o single nucleotide polymorphism (SNP) que resulta na troca de uma citosina
por uma timina na região codificadora, na posição +3954 do exon 5, destruindo assim, um
sítio de restrição para a enzima de restrição Taq I (Pociot e cols, 1992). Nesse tipo de
polimorfismo, os monócitos de indivíduos homozigotos para o alelo [T] produzem duas
vezes mais IL-1β do que monócitos heterozigotos e quatro vezes mais do que monócitos
dos indivíduos homozigotos para o alelo [C] após a estimulação com lipopolissacarídeo
(LPS) (Pociot e cols, 1992). A resposta inflamatória que é direcionada em grande parte
pela IL-1 é, portanto, geneticamente determinada, com alguns indivíduos tendo uma
resposta mais exacerbada do que outros quando submetidos a um mesmo estímulo (Lang
e cols., 2000). Diversos estudos avaliando a presença do alelo T têm relacionado este
genótipo com inúmeras entidades patológicas, tais como artrite reumatóide, psoríase,
doença periodontal, fibrose pulmonar e lúpus eritematoso (di Giovine & Duff, 1990; Pociot
e cols, 1992; Kornman e cols, 1997; Cox e cols., 1999; Whyte e cols., 2000).
1.2.2- Interleucina-6
A IL-6 é uma glicoproteína com peso molecular variando de 20 a 30 KD,
dependendo do tipo celular de origem que atua nas imunidades inata e adaptativa. O
gene IL-6 se localiza no cromossomo 7. (Sehgal e cols., 1987). A transcrição dessa
citocina é regulada pelos fatores de transcrição fator nuclear IL-6 (NFIL-6), NFκB,
Fos/Jun, CRBP e receptor de glicocorticóide (Terry e cols., 2000)
Essa citocina não é espontaneamente produzida por células normais intactas
(Kupper, 1990), sendo que sua síntese e liberação requerem estímulo inflamatório ou
presença de outras citocinas como por exemplo, IL-1β e TNF-α (Kishimoto, 1989;
Introdução 10
Littlewood e cols., 1991). A IL-6 é produzida por muitos tipos celulares, tais como linfócitos
T e B, células NK, monócitos, macrófagos, adipócitos, mastócitos, células endoteliais e
queratinócitos (Bauer & Herrmann, 1991).
A IL-6 possui várias ações na imunidade inata, onde estimula a síntese de
proteínas de fase aguda por hepatócitos, contribuindo para os efeitos sistêmicos da
inflamação (Crowl e cols., 1991). Ela também inibe a produção de TNF-α e IL-1 por
células sanguíneas mononucleares, através da indução de seus receptores antagonistas
(SCHINDLER, 1952; Tilg e cols., 1994).
Na imunidade adaptativa, essa citocina induz ativação, proliferação e diferenciação
de linfócitos T, com produção de linfócitos T citotóxicos (LTc) e estimula o crescimento e
diferenciação de linfócitos B (SCHINDLER, 1952). A IL-6 tem-se mostrado potente
indutora de fosfolipase A2, intermediária na via final da produção de leucotrienos, PGs, e
fator ativador de plaquetas (Crowl e cols, 1991). Entretanto, dados na literatura vêm
também sugerindo um papel antiinflamatório para a IL-6 (SCHINDLER, 1952; Akira e
cols., 1993; Tilg e cols, 1994; Ramsay e cols., 1994; Balto e cols., 2001). Uma vez que,
essa citocina regula, positivamente, o inibidor tecidual das metaloproteinases-1 (TIMPs-1)
(Sato e cols., 1990; Kopf e cols., 1994). Existem evidências de que proteínas de fase
aguda, reguladas por IL-6, também possuem propriedades antiinflamatórias e
imunossupressoras e atuam como antiproteinases e captadoras de oxigênio (Tilg e cols,
1994; Baumann & Gauldie, 1994; Jordan e cols., 1995; Tilg e cols., 1997).
Polimorfismos genéticos na região promotora do gene IL-6, como o situado na
região -174 (G/C), podem resultar em variações inter-individuais no que diz respeito à
expressão protéica (Ray e cols., 1990). Em um estudo onde se reproduziu in vitro as
variantes alélicas deste polimorfismo, a variante G esta relacionada a uma maior
produção de IL-6 em relação ao alelo C. Além disso, os níveis de expressão de IL-6 da
Introdução 11
variável C não se alteraram após estimulação com LPS ou IL-1 (Fishman e cols., 1998).
Uma explicação sugerida para este fato é a sua localização próxima ao sítio de ligação do
receptor para glicocorticóide, um domínio de regulação negativa do promotor capaz de
suprimir a transcrição do gene da IL-6 (Ray e cols, 1990). A presença do alelo G foi
associada à várias doenças como artrite crônica juvenil precoce sistêmica (Fishman e
cols, 1998), artrite reumatóide (Hirano e cols., 1988), osteoporose (Jilka e cols., 1992; Poli
e cols., 1994) e psoríase (Grossman e cols., 1989). O alelo C mostra associação com
riscos reduzidos para a doença de Alzheimer (Papassotiropoulos e cols., 1999).
1.2.3- Interleucina-10
IL-10 é uma citocina com peso molecular estimado em 18,647 KD (Vieira e cols.,
1991) que se encontra profundamente envolvida na regulação das reações inflamatórias e
respostas imunes. O gene da IL-10 humana está localizado no cromossomo 1q e consiste
de cinco exons separados por quatro introns (Eskdale e cols., 1998).
A IL-10 afeta não somente o sistema imune como muitos processos incluindo
angiogênese e tumorigênese. É uma molécula-chave no que diz respeito à diminuição do
potencial patológico dos processos auto-imunes, através da inibição de muitos eventos da
resposta inflamatória (de Waal e cols., 1992).
Ela apresenta efeitos inibitórios sobre a produção de citocinas pró-inflamatórias
como IL-1α, IL-1β, IL-6, IL-8, IL-12 e TNF-α além de regular negativamente a expressão
de moléculas ativadoras e coestimulatórias sobre monócitos e células dendríticas (Moore
e cols., 1993; D'Andrea e cols., 1993; Macatonia e cols., 1993). A IL-10 possui atividades
de fator de crescimento sobre linfócitos B e mastócitos, e pode tanto inibir quanto
Introdução 12
aumentar as atividades dos linfócitos T, dependendo das condições de ativação e das
subclasses destes linfócitos (Moore e cols, 1993).
IL-10 é produzida por linfócitos T virgem e os de memória, clones pertencentes aos
sub-tipos T helper 1 (Th1) e T helper 2 (Th2), células NK, LB, linhagens de células B
transformadas pelo vírus Epstein-Barr, monócitos, trofoblastos, células epiteliais
bronquiais, e certas células tumorais incluindo melanomas e carcinomas de várias origens
(de Waal e cols, 1992; Moore e cols, 1993).
Vários polimorfismos genéticos têm sido observados nesse gene na região
flanqueadora 5’. Eles incluem duas áreas 6-11 (CA)n em regiões microssatélites, nas
posições -1109 e -3942, assim como três SNP, nas posições -1082 (G/A), -819 (C/T) e -
592 (C/A) (Eskdale e cols, 1998; Hurme e cols., 1998). Tais polimorfismos genéticos têm
sido relacionados à produção aumentada de IL-10 por monócitos e células T e também
por pacientes portadores ou sujeitos a desenvolverem lúpus eritematoso sistêmico
(Mehrian e cols., 1998), doença meningocócica (Westendorp e cols., 1997), artrite
reumatóide (Eskdale e cols, 1998) e pode ser um fator prognóstico para rejeição seguida
de transplante renal (Sankaran e cols., 1999).
Em relação à funcionalidade, o polimorfismo -1082 (G/A) no gene IL-10 tem o seu
alelo G associado a uma maior produção de IL-10 quando comparado ao alelo A (Turner
e cols., 1997). A diferente produção de IL-10 entre as variantes polomórficas pode ser
explicada pelo fato do lócus -1082 se situar dentro de uma região de ligação com o fator
de transcrição proteína ativadora-1 (AP-1) (Kube e cols., 1995).
1.2.4- Fator de Necrose Tumoral-α
TNF-α é uma citocina de 17kD e é o principal mediador da resposta inflamatória
contra as bactérias gram-negativas e outros microrganismos. O gene TNFA está
Introdução 13
localizado na região de classe III do complexo de histocompatibilidade principal (MHC), no
braço curto do cromossomo 6 (Stuber e cols., 1995).
O TNF-α é responsável por muitas das complicações sistêmicas de vários
processos como a evolução da septicemia para falência múltipla dos órgãos. Essas
reações do hospedeiro estão associadas a níveis séricos aumentados dessa citocina
(Stuber e cols, 1995; Stuber e cols., 1996).
Pelo menos nove polimorfismos genéticos já foram descritos dentro da região
promotora do TNFA até o momento, nas posições -1301, -863, -857, -575, -376, -308, -
244 e -238, em relação ao sítio de transcrição (Bayley e cols., 2001). O polimorfismo na
posição -308 (G/A) foi associado à produção alterada de linfócitos, estando o alelo com
adenina [A] associado de seis a sete vezes à maior atividade transcricional no gene do
que o alelo [G] (Wilson e cols., 1997).
1.3- Transmissão Serotoninérgica
A serotonina (5-hidroxitriptamina) é um neurotransmissor do sistema nervoso
central e periférico, sendo sintetizada a partir de enzimas após o aminoácido precursor,
triptofano, ser transportado para dentro do neurônio serotoninérgico. A bomba de
transporte do triptofano é distinta do transportador de serotonina (5-HTT). Uma vez
transportado para o interior do neurônio serotoninérgico, o triptofano é convertido em 5-
hidroxitriptofano pela enzima triptofano hidroxilase e em seguida convertido em 5-
hidroxitriptamina pela enzima aromática triptofano decarboxilase. A serotonina é
armazenada em vesículas sinápticas onde permanece até ser liberada por um impulso
neuronal. Depois da liberação de serotonina na sinapse cerebral, este neurotransmissor é
recaptado pelo neurônio pré-sináptico via transportador de serotonina (Millan, 2003).
Introdução 14
1.3.1- Polimorfismo do Gene Transportador de Serotonina (5-HTTLPR)
O gene do transportador de serotonina foi clonado em cérebro de ratos (Millan,
2003). Posteriormente, foi então identificado uma seqüência de cDNA placentário humano
que possuía 92% de homologia em relação à seqüência encontrada no cérebro de rato.
Estes dados possibilitaram que se descobrisse um único gene, denominado SLC6A4,
responsável por codificar o transportador de serotonina e que se localiza no cromossomo
17q11.1-q12 (Ramamoorthy e cols., 1993a), flanqueado pelos marcadores D17S58 e
D17S73. (Gelernter e cols., 1995). Este gene apresenta-se em uma seqüência de 31 KB e
é organizado em 14 exons (Lesch e cols., 1994).
Dois polimorfismos genéticos já foram descritos no gene SLC6A4. O
primeiro consiste em uma série de repetições dentro da região promotora do gene
denominado por 5-HTTLPR, serotonin transporter-linked polymorfism (Heils e cols., 1995).
O segundo ocorre no intron 2, onde se pode observar um número variável de repetições
em tandem (VNTRs) de um segmento de 17 pares de base e que não tem sido
relacionado a um efeito direto na expressão do gene (Ogilvie e cols., 1996).
O 5-HTTLPR é um polimorfismo que se localiza aproximadamente 1kb acima do
sítio inicial de transcrição deste gene e é composto de 16 elementos de repetição,
elementos estes ricos em CG e formados por 20 a 23 pares de base. Existem dois alelos
comuns nesta região que diferem em 44 pares de base. A variante alélica longa (l) é
composta pelos 16 elementos de repetição e a variante curta é formada pela deleção de
44 pb (Heils e cols., 1996). A presença do alelo curto foi associada com a redução da
eficiência da transcrição do 5-HTTLPR. Além disso, foi observado que em linhagens
linfoblásticas de células humanas homozigóticas para a variante longa, a concentração de
RNA mensageiro do transportador de serotonina produzida é quase duas vezes maior que
em células contendo uma ou duas cópias da variante curta (Lesch e cols., 1996). Estes
Introdução 15
dados corroboram com estudo realizado posteriormente em plaquetas humanas
(Greenberg e cols., 1999).
Alguns estudos têm mostrado o possível envolvimento do 5-HTTLPR com vários
distúrbios psiquiátricos como comportamento suicida (Bellivier e cols., 2000; Bondy e
cols., 2000; Courtet e cols., 2001), depressão (Bellivier e cols., 1998), ansiedade (Serretti
e cols., 2002) e alcoolismo (Preuss e cols., 2000).
O alelo curto mostrou-se associado com o comportamento suicida violento (Bellivier
e cols, 2000), enquanto que, uma ligação entre o alelo curto com o número de tentativas e
tentativa mais violenta de suicídio foi observado em estudos que envolveram pacientes
alcoólatras (Preuss e cols, 2000). Posteriormente, estudos em populações de pacientes
psquiátricos corroboram estes dados (Courtet e cols, 2001).
Por outro lado, trabalhos também apresentam resultados diferentes. A associação
do alelo longo com pacientes deprimidos que tentaram suicídio também foi observada (Du
e cols., 1999; Russ e cols., 2000).
O polimorfismo 5HTTLPR pode estar associado com doenças bucais relacionadas
ao stress. Recentemente foi observada uma associação deste polimorfismo com a EUR
(Victoria e cols., 2005).
1.4- Estomatite Ulcerosa Recorrente (EUR)
A EUR, popularmente conhecida como afta, foi primeiramente descrita por
Hipócrates (460-370 AC), sendo que o termo aphthai estaria relacionado a qualquer tipo
de desordem bucal (Ship e cols., 2000). Hoje é uma das condições patológicas mais
freqüentes da mucosa bucal, sendo caracterizada pelo desenvolvimento de ulcerações
dolorosas, solitárias ou múltiplas na mucosa bucal. Tem sido estimado que pelo menos
Introdução 16
20% da população geral vão sofrer episódios de EUR pelo menos uma vez em sua vida
(Stanley, 1972; Axell & Henricsson, 1985). As lesões localizam-se em grande parte da
mucosa bucal, sendo que a ocorrência dessas lesões na gengiva inserida e no palato
duro é rara. A EUR começa como uma erosão superficial, única ou múltipla, coberta por
uma membrana cinzenta. Geralmente tem margens bem circunscritas por um halo
eritematoso. A lesão é bastante dolorosa podendo comprometer a alimentação por vários
dias (Ship, 1996; Jurge e cols., 2006).
A classificação da EUR é fundamentalmente baseada no tamanho das lesões,
distinguindo-se, portanto, as formas clínicas menores e maiores da doença. Múltiplas
lesões puntiformes, pequenas e coalescentes, caracterizam uma terceira variante clínica,
a forma herpetiforme (Ship, 1996; Natah e cols., 2004; Jurge e cols, 2006).
A EUR do tipo Menor é a forma mais comumente relatada, ocorrendo em cerca de
80% dos pacientes acometidos por EUR (Vincent & Lilly, 1992). As úlceras originam-se,
quase que exclusivamente, na mucosa não-ceratinizada. Apresentam entre 3 e 10 mm de
diâmetro, desaparecendo, sem deixar cicatrizes, em 7 a 14 dias (Greer, Jr. e cols., 1993).
As mucosas jugal e labial são os sítios mais comumente envolvidos, seguidos pela
superfície ventral da língua, fundo do vestíbulo, assoalho da boca e palato mole (Natah e
cols, 2004; Jurge e cols, 2006). Estas ulcerações se iniciam, usualmente, na infância ou
adolescência, e a freqüência das recorrências é altamente variável, oscilando de uma
ulceração em poucos anos até mais de dois episódios por mês (Jurge e cols, 2006).
Na EUR do tipo Maior as lesões são maiores e mostram maior duração por
episódio. As ulcerações são mais profundas que a variante menor, medindo de 1 a 3 cm
de diâmetro, levando de duas a seis semanas para reparar, podendo deixar cicatriz
(Natah e cols, 2004). O número de lesões varia de 1 a 10. Qualquer área de superfície
bucal pode ser afetada, mas a mucosa labial, o palato mole e as fossas amigdalianas são
Introdução 17
os sítios mais afetados. O início ocorre após a puberdade, e os episódios recorrentes
podem continuar a se desenvolver por 20 anos ou mais (Natah e cols, 2004; Jurge e cols,
2006).
Na EUR do tipo Herpetiforme existe um número maior de lesões e as recorrências
são mais freqüentes. As lesões individuais são pequenas, variando de 1 a 3 mm de
diâmetro, em um único ataque podem surgir mais de uma dezena delas (Natah e cols,
2004; Jurge e cols, 2006). É comum ocorrer agrupamento de lesões individuais resultando
na formação de ulcerações grandes e irregulares, que cicatrizam em 7 a 10 dias (Porter e
cols., 1998). Qualquer superfície bucal pode estar envolvida. Observa-se predominância
no sexo feminino com o seu início na fase adulta (Porter e cols, 1998).
Embora a etiologia da EUR não tenha sido esclarecida, diversos fatores sistêmicos
predispõem ao desenvolvimento da EUR. As lesões podem ser encontradas na doença
de Behçet (Rogers, 1997), neutropenia cíclica (Scully & Porter, 1989), em deficiências
nutricionais, com ou sem distúrbios gastrointestinais (Grattan & Scully, 1986), em
pacientes infectados pelo vírus HIV (Kerr & Ship, 2003) e portadores da Doença de Crohn
(Plauth e cols., 1991). Diversos estudos mostram que deficiências de ferro, ácido fólico e
vitamina B12 são bem mais freqüentes nos pacientes com EUR do que na população
geral (Rogers, 1997; Porter e cols, 1998). Foi observado que após a terapia de reposição
desses componentes, houve remissão completa ou pelo menos melhora das lesões
(Wray, 1982).
A hipersensibilidade alimentar tem sido relacionada como um elemento
predisponente à EUR (Nolan e cols., 1991; McCartan e cols., 1996b). Uma vez que
eliminação de determinados alimentos da dieta resulta na melhora ou remissão das
úlceras entre 25% a 75 % dos casos (Nolan e cols, 1991). Porém, outros estudos não
corroboram com estes dados (Eversole e cols., 1982).
Introdução 18
Diversos estudos sugerem associação de agentes microbianos com a EUR. Dentre
estes, a bactéria H. pylori tem sido um microorganismo de grande interesse. Devido às
similaridades histológicas entre a EUR e a úlcera gástrica, o envolvimento do H. pylori na
etiologia da EUR tem sido muito estudado (Porter e cols, 1998; Birek e cols., 1999;
Brozovic e cols., 2002; Victoria e cols., 2003). Tem se cogitado que a colonização da
mucosa bucal por bactérias como Streptococcus sanguis e Streptococcus mutans e seus
antígenos podem ser responsáveis pelo início da resposta imune (Hasan e cols., 1995;
Sun e cols., 2002).
Uma possível associação entre sistema imune e EUR foi primeiramente
considerada por volta de 1960 e confirmada por outros estudos posteriormente
(Graykowski e cols., 1966; Lewkowicz e cols., 2003; Borra e cols., 2004). Além do mais
uma produção aumentada de citocinas Th1 como, por exemplo, IL-2, TNF-α e IL-6 foi
observada em células do sangue periférico de pacientes com EUR (Lewkowicz e cols.,
2005). Recentemente foi observado que a expressão de genes Th1 estava aumentada em
relação à Th2 nas lesões da EUR do que em mucosa normal (Borra e cols, 2004). Vários
polimorfismos genéticos de interleucinas foram estudados na EUR e forte associação foi
observada com genótipos alto produtores de IL-1β. Apesar disso, resultados descordantes
são também encontrados (Bazrafshani e cols, 2002a; Bazrafshani e cols., 2002b;
Bazrafshani e cols., 2003; Guimarães AL e cols, 2006a).
As evidências atuais indicam a presença de fatores genéticos associados com EUR
uma vez que, pacientes com história familiar de EUR são mais suscetíveis a
desenvolverem a doença precocemente e apresentarem quadro clínico mais grave do que
os indivíduos sem história familiar (Ship, 1965; Miller e cols, 2001). Alem disso, há uma
alta correlação entre EUR em gêmeos monozigóticos o que não é observado em gêmeos
heterozigóticos (Miller & Ship, 1977).
Introdução 19
Foi observado uma associação entre trauma na mucosa e o aparecimento de
úlceras em pessoas susceptíveis à EUR (Wray, 1982). Um possível mecanismo para
explicar esta associação seria a diminuição da barreira protetora da mucosa causada pelo
traumatismo. Uma característica importante a se considerar é a relação inversa do uso do
tabaco com a EUR bucal (Axell & Henricsson, 1985). Embora os efeitos dos subprodutos
do tabaco no sistema imune permaneçam incertos, seu uso tem sido associado com o
surgimento da ceratinização da mucosa, e sendo assim à baixa freqüência de EUR.
1.5- Síndrome da Ardência Bucal (SAB)
A SAB é uma condição caracterizada por queimação e sensação dolorosa na boca,
porém a mucosa bucal encontra-se normal (Lamey & Lamb, 1989). A xerostomia (Gorsky
e cols., 1987; Bergdahl & Bergdahl, 1999) e a disgeusia (Scala e cols., 2003) são outros
sintomas comuns nos pacientes com SAB. Alem do mais, devido à diminuição da
lubrificação bucal, estes pacientes tornam-se mais propensos a desenvolver infecções
(Chen & Samaranayake, 2000).
O local mais comum de acometimento pela SAB é a língua, razão pela qual se
identifica esta condição também como glossodinia ou glossopirose. O lábio, a mucosa
jugal e o palato são locais que também podem ser acometidos (Basker e cols., 1978;
Gorsky e cols, 1987). A SAB é encontrada principalmente nas mulheres, entre a quinta e
sexta década de vida (Gorsky e cols, 1987; Gorsky e cols., 1991).
SAB pode ser classificada em suave, moderada e severa, sendo a SAB moderada
mais freqüente. A SAB pode variar durante o decorrer do dia e três padrões diferentes
foram propostos para os sintomas. O tipo 1 descreve períodos livres da sintomatologia
pela manhã, aumentando gradativamente até à noite.O tipo 2 envolve a sensação de
Introdução 20
queimação contínua durante o dia e o tipo 3 é caracterizado por períodos livres dos
sintomas (Lamey & Lamb, 1989). A sintomatologia intermitente é mais comum que a
contínua (Basker e cols, 1978)
A etiologia da SAB continua ainda bastante conflitante, sendo que fatores locais e
sistêmicos são levantados. Dentre os fatores locais estão incluídos os tratamentos
odontológicos, trauma, candidíase, infecções bacterianas, alergias e disfunções de
glândulas salivares (Ship, 1996; Scala e cols, 2003). Aproximadamente 65% dos
pacientes com SAB relataram não ter os sintomas antes do tratamento odontológico
(Grushka, 1983). A candidíase tem sido um fator comum na etiopatogenia da SAB
(Gorsky e cols, 1987; Gorsky e cols, 1991). Dentre as infecções bacterianas, a H. pylori
tem sido um microorganismo de interesse no estudo da etiologia da SAB (Gall-Troselj e
cols., 2001).
A queimação bucal sem a presença de lesão na mucosa ou pele representa um
sintoma típico de dor neuropática crônica (Forssell e cols., 2002). A freqüente observação
das alterações no paladar e xerostomia em pacientes com a SAB têm sugerido que esta
síndrome pode refletir uma desordem neuropática (Grushka & Sessle, 1991). Alguns
sintomas da síndrome têm um padrão similar aos observados em algumas condições
inflamatórias neurais, considerando assim, que uma possível injúria periférica no nervo
poderia estar relacionada com o aparecimento da SAB (Grushka e cols., 1998). A
neuropatia das fibras trigeminais no local primário da lesão foi observada recentemente.
Alem disso, esta neuropatia estava correlacionada com a duração dos sintomas (Lauria e
cols., 2005). A falta de inibição entre as áreas de prolongamentos centrais dos nervos do
paladar glossofaríngeo e corda timpânico, após esses nervos sofrerem injúria periférica,
pode provocar confusão no paladar (Lehman e cols., 1995; Bartoshuk e cols., 1996).
Vários autores acreditam que o aparecimento da SAB pode ser conseqüência de algum
Introdução 21
trauma envolvendo o nervo trigêmio (Svensson e cols., 1993; Gao e cols., 2000;
Heckmann e cols., 2001).
Os principais fatores sistêmicos envolvidos com a SAB são as deficiências
nutricionais e hormonais. Foi demonstrado que 53% dos pacientes com SAB tinham
deficiência de ferro (Brooke & Seganski, 1977). Deficiências de vitaminas, principalmente
do complexo B foram relacionadas com a etiologia da SAB (Faccini, 1968).
Os fatores psiquiátricos têm sido extensivamente estudados como causa da SAB,
entre eles, o estresse, a ansiedade e depressão (Rojo e cols., 1993; Al Quran, 2004).
Alguns estudos consideram a depressão como a desordem psiquiátrica mais comum nos
pacientes com a SAB (Browning e cols., 1987; Rojo e cols, 1993). Uma controvérsia
observada na literatura é o fato da depressão e ansiedade serem primárias (Pokupec-
Gruden e cols., 2000) ou secundárias (Grushka & Sessle, 1991) aos eventos relacionados
à SAB.
Introdução 22
2- ARTIGO I
ORIGINAL ARTICLE
Association of interleukin-1b polymorphism with recurrent
aphthous stomatitis in Brazilian individuals
ALS Guimara
˜
es, AR de Sa
´
, JMN Victo
´
ria, JF Correia-Silva, PS Pessoa, MG Diniz, RS Gomez
Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil
BACKGROUND: Recurrent aphthous stomatitis (RAS) is
characterized by recurrent episodes of oral ulceration in
an otherwise healthy individual. Some reports in the lit-
erature indicate that RAS may have immunological,
psychological, genetic and microbiological bases. The
purpose of the present study was to investigate the
possible association between interleukin-1b (IL-1b) +3954
(C/T) genetic polymorphism and RAS in a sample of
Brazilian patients.
SUBJECTS AND METHODS: Sixty-two consecutive
subjects affected by minor and major forms of RAS and
62 healthy volunteers were genotyped at IL-1b (+3954).
The chi-squared test was used for statistical analysis.
RESULTS: A significant increase in the high production of
IL-1b genotype CT was observed in the group with RAS
(P
¼
0.01). After stratifying RAS patients according to
the mean number of lesions per episode, a significant
difference was only observed between patients with
‡
3
lesions in each episode and control.
CONCLUSION: There is an increased frequency of
polymorphism associated with high IL-1b production in
RAS patients.
Oral Diseases (2006) 12, 580–583
Keywords: recurrent aphthous stomatitis; cytokine; polymorph-
ism; interleukin-1b; pathogenesis
Introduction
Recurrent aphthous stomatitis (RAS) is characterized
by recurrent episodes of oral ulceration in an otherwise
healthy individual (Porter et al, 1998). RAS has three
different variants: minor aphthous ulcers, major aph-
thous ulcers and herpetiform ulcers (Stanley, 1972). It
has been estimated that 20% of the general population
will suffer from RAS at some time in their lives (Stanley,
1972; Axell and Henricsson, 1985). Possibly more than
40% of patients may have a familial history of RAS
(Natah et al, 2004). Some investigators have correlated
the onset of ulcers with exposure to certain foods
(Thomas et al, 1973), but this has not been confirmed
(Eversole et al, 1982). Many studies have suggested an
association between RAS and psychological factors
including anxiety and stress (McCartan et al, 1996;
Chiappelli and Cajuli s, 2004; Natah et al, 2004).
Interleukin-1 (IL-1) is a pro-inflammatory cytokine
that plays a pivota l role in several chronic diseases
(di Giovine and Duff, 1990). This cytokine is a primary
activator of early chemotactic cytokines, as wel l as of
the expression of endothelial cell adhesion molec ules
(ECAMs) that facilitate migration of leucocytes into
tissues (Lang et al, 2000). In a recent study the expres-
sion of IL-1b cDNA was more abundant in RAS lesions
than normal mucosa (Borra et al, 2004). Genetic poly-
morphisms have been described at IL-1b gene. A
polymorphism of the IL-1b gene at +3954 (C/T) and
at )511 was found to result an increa sed production of
the cytokine (Pociot et al, 1992). Moreover, the IL-1b
polymorphism in the region )511 was strongly associ a-
ted with RAS (Bazraf shani et al, 2002a). As immuno-
logical and genetic factors have been implicated in the
pathogenesis of RAS, the purpose of the present study
was to investigate a possible association between the
functional IL-1b + 3954 (C/T) genetic polymorphism
with RAS in a sample of Brazilian patients.
Subjects and methods
Subjects and sample collection
Sixty-two consecutive subjects affected by minor and
major forms of RAS (Table 1) and 62 age- and sex-
matched control subjects (mean age ¼ 36.9 years; range
8–84 years; standard deviation 16.5) were included in
this study. There were 27 (43.5%) men and 35 (56.5%)
women in the control group. The patients were recruited
from the Oral Diagnosis Clinic at the Universida de
Federal de Minas Gerais. Both experimental and control
groups were from the same geographical area and had
Correspondence: RS Gomez, Faculdade de Odontologia, Universidade
Federal de Minas Gerais, Av. Antonio Carlos, 6627 Belo Horizonte-
MG, CEP 31270–901, Brazil. Tel: +55 31 3499 2477, Fax:
Received 9 August 2005; revised 18 November 2005, 12 December
2005; accepted 23 December 2005
Oral Diseases (2006) 12, 580–583. doi:10.1111/j.1601-0825.2006.01243.x
Ó 2006 The Authors. Journal compilation Ó 2006 Blackwell Munksgaard
All rights reserved
http://www.blackwellmunksgaard.com
identical socio-economic status. Ethnicity was not
established as the hazards of judging Brazilians by
colour, race and geographical origin was recently
demonstrated (Parra et al, 2003).
The diagnosis of RAS was based on accepted clinical
criteria (Ship et al, 2000). The control group was com-
posed of patients without any history of RAS or systemic
diseases. Exclusion criteria for both groups were the
presence, apart from dental caries, of any other significant
local or syste mic diseas es. Although periodontal disease
was not an exclusion criterion, none of the individuals in
both groups presented chronic periodontitis. The study
protocol was approved by the local Ethics Committee and
informed consent was obtained from all patients or from
the parents when subjects were less than 18 years.
Oral mucosa swabs were taken once from the buccal
mucosa of subjects. The swabs were taken with sterile
plastic tips, placed immediately in Eppendorf micro-
tubes containing 500 ll of Krebs buffer, and the pellet
obtained after 5 min of centrifugation at 13 000 g was
stored at )20°C until processing.
DNA isolation
DNA extraction was carried out as described by Boom
et al (1990) and modified as below. We added 450 llof
lyses buffer (6.0 M GuSCN, 65 mM Tris–HCl pH 6.4,
25 mM EDTA, 1.5% Triton X-100) and 20 ll silica
(SiO2, Sigma S-5631) to the micr ocentrifuge tube con-
taining the oral mucosa swab pellet. The tube was
vortexed and incubated for 10 min at 56°C, centrifuged
at 3000 g for 1 min and the supernat ant discharged. The
pellet obtained (DNA adsorbed to the silica) was washed
twice with 450 ll washing buffer (6.0 M GuSCN, 65 mM
Tris–HCl), twice with 70% ethanol, once with 450 ll
acetone and dried at 56° C for 10 min. Finally, 100 llof
TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA) was
added and incubated at 560°C for 10 min to elute the
DNA. After incubation the solution was homogenized
and centrifuged at 5000 g for 2 min and the supernatant
containing DNA transferred to a new tube.
Genotyping
Interleukin-1b (+3954) polymorphisms were assessed
by polymerase chain reaction (PCR) amplification
and digestion. The sequences of PCR primers were
5¢-CTCAGGTGTCCTCGAAGAAATCAAA-¢3 and
5¢-GCTTTTTTGCTGTGAGTCCCG-¢3 with expected
PCR product size of 194 bp, as described elsewhere
(Moreira et al, 2005). PCR was carried out in a total
volume of 50 ll, containing 10 ll of solution DNA, Pre-
mix buffer (50 mM KCl, 10 mM Tris–HCl pH 8.4, 0.1%
Triton X-100, 1.5 mM MgCl2, deoxynucleoside triphos-
phates, Taq DNA polymerase (Phoneutria Biotecnologia,
Belo Horizonte, Brazil) and primers (20 pmol/reaction).
The amplification conditions consisted of 94°C for 3 min
followed by 35 cycles of 94°C for 30 s, 54°C for 35 s and
72
°C for 30 s. The run was terminated by final elongation
at 72°C for 5 min. Lid temperature was 103°. The
products were digested with 5 U of TaqIat65°C for 4 h
and 97 + 85 + 12 bp DNA products were obtained for
allele C and 182 + 12 bp DNA products for allele
T. Visualization was performed in a 18 · 16 cm 10%
polyacrylamide gel electrophoresis staining with ethidium
bromide (0.5 lgml
)1
) (Figure 1).
Statistical analysis
Statistical significance of differences between case and
control group distributions for alleles and genotypes was
determined using the chi-squared test. A significance
level of P £ 0.05 was used. The observed genotype
frequencies were compared with those calculated from
Hardy–Weinberg equilibrium. All statistical analyses
were performed using BioStat 3.0 software (Optical
Digital Optical Technology, Bele
´
m, Brazil).
Results
The distribution of genotype frequencies of IL-1b poly-
morphism in patients with RAS and control is shown in
Table 2. There was a higher frequency of the CT genotype
in the RAS group than in the control (P ¼ 0.01). After
stratifying RAS patients according to the mean number of
lesions per episode, a significant difference was only
observed between patients with ‡3 lesions in each episode
Table 1 Summary of the clinical data of RAS patients included in the
study
Characteristics Values
Age (years)
Median 31.7
Range 7–69
Standard deviation 14.6
Gender, n (%)
Male 26 (41.9)
Female 36 (58.1)
Mean number of lesions in each episode, n (%)
<3 lesions 39 (62.9)
‡3 lesions 23 (37.1)
RAS, recurrent aphthous stomatitis.
125 bp
182
bp
97
bp
85
bp
12345
25
bp
Figure 1 Electrophoresis in a 10% polyacrylamide gel. Lane 1, ladder
25 bp; lane 2, PCR product without digestion (194 bp); lane 3,
genotype CT; lane 4, genotype CC; lane 5, genotype TT
Association of IL-1b polymorphism with RAS
ALS Guimar et al
581
Oral Dise ases
and control (P ¼ 0.04). The distribution of IL-1 b
genotypes in the case group (TT:CT:CC, 0:35:27) was
statistically different from those (5:25:31) expected from
the Hardy–Weinberg equilibrium (P ¼ 0.002). On the
other hand, the distribution of IL-1b genotypes in the
control group (TT:CT:CC, 0:21:41) was not statistically
different from tho se (1:17:42) expected from the Hardy–
Weinberg equilibrium (P ¼ 0.1084).
Discussion
Recurrent aphthous stomatitis is a very common oral
disease of unknown aetiology. Many local and systemic
factors have been associated with the condition. Some
reports in the literature indicate that RAS may have an
immunological, psychological, genetic and microbiolo-
gical bases (Porter et al, 1998; Ship et al, 2000; Natah
et al, 2004). Although studies have tried to identify the
role of the immune system in RAS, the immunopath-
ogenesis remains to be established (Natah et al, 2000;
Lewkowicz et al, 2003). Evidence suggests that ulcer-
ation results from an abnormal cytokine cascade in the
oral mucosa, leading to enhanced cell-mediated immune
response directed towards focal areas of the oral mucosa
(Buno et al, 1998; Borra et al, 2004). Recently scanning
with cDNA microarray analyses in RAS showed a more
intense activity of Th1 gene cluster relative to the Th2
gene cluster (Borra et al, 2004).
Polymorphisms associated with cytokines have been
used to investigate the pathogenesis of various diseases. A
previous study showed that polymorphisms of tumor
necrosis factor-a (TNF-a) or tumor necrosis factor-b
(TNF-b) does not appear to be a significant factor in
determining susceptibility to minor RAS (Bazrafshani
et al, 2002b). In the current study we observed that the
polymorphism at IL-1b +3954 was associ ated with RAS.
In contrast to control, genotypes in the patient group
were not distributed according to Hardy–Weinberg
equilibrium. Bazrafshani et al (2002a) demonstrated
an increased frequency of another polymorphism at
IL-1b-511 region in RAS subjects. After stratifying
RAS patients according to severity, only patients with
‡3 lesions per attack continued to show a significant
association with the high production of IL-1b. Although
polymorphism of IL-1b has been described in a ssociation
with chronic periodontitis in Brazilian patients (Moreira
et al, 2005), none of the individuals in the present study
were affected by this condition.
Interleukin-1b is a proinflammatory cytokine. The
relationship between local damage in RAS and IL-1b
could be due to the activation of early chemotactic
cytokines, and to the expression of ECAMs that
facilitate migration of leucocytes into tissues (Lang
et al, 2000; Dagia and Goetz, 2003). Increased levels of
vascular cell adhesion molecule-1 (VCAM-1) and
E-selectin, are observed in the sera of RAS patients
(Healy et al, 1997). Borra et al (2004) demonstrated
higher IL-1b transcription in RAS lesions compared
with normal mucosa. Therefore, the expression of
adhesion molecules might be increased by increased
levels of IL-1b present in individu als with the high
producer genotype. Although RAS patients showed a
genotype associated with high IL-1b production, other
authors have shown that IL-1b production by peripheral
blood mononuclear cells was not elevated in RAS
(Lewkowicz et al, 2005).
Another mechanism explaining IL-1b
polymorphism
and RAS development should also be considered. It is
well known that psychological factors are implicated in
the pathogenesis of RAS (McCartan et al, 1996;
Chiappelli and Cajulis, 2004). A previous study con-
ducted by our group showed that RAS patients have a
higher frequency of the serotonin transporter gene
polymorphism (5-HTTLPR), associated with anxiety-
related traits (Victoria et al, 2005). As IL-1b levels have
been shown to be elevated in the blood or cerebrospinal
fluid of depressed patients (Maes et al, 1991a,b), the
high producer IL-1b genotype may be more susceptible
to depression and RAS.
In conclusion, our findings demonstrate increased
frequency of the CT variant form of +3954C/T
polymorphism associated with high IL-1b production
in RAS patients. Our findings provide additional sup-
port to a genetic basis for RAS development. Further
studies are necessary to delineate the complex RA S
immunopathogenesis.
Acknowledgements
This study was supported by grants from Conselho Nacional
de Desenvolvimento Cientı
´
fico e Tecnolo
´
gico (CNPq) and
Fundac¸ a
˜
o de Amparo a
`
Pesquisa do Estado de Minas Gerais
(FAPEMIG), Brazil. Dr RS Gomez is a research fellow of
CNPq.
References
Axell T, Henricsson V (1985). The occurrence of recurrent
aphthous ulcers in an adult Swedish population. Acta
Odontol Scand 43: 121–125.
Bazrafshani MR, Hajeer AH, Ollier WE, Thornhill MH
(2002a). IL-1B and IL-6 gene polymorphisms encode
significant risk for the development of recurrent aphthous
stomatitis (RAS). Genes Immun 3: 302–305.
Bazrafshani MR, Hajeer AH, Ollier WE, Thornhill MH
(2002b). Recurrent aphthous stomatitis and gene polymor-
phisms for the inflammatory markers TNF-alpha, TNF-beta
and the vitamin D receptor: no association detected. Oral
Dis 8: 303–307.
Table 2 Distribution of the genotype of IL-1b +3954 polymorphism
in patients with recurrent aphthous stomatitis (RAS; n ¼ 62) and
control subjects (n ¼ 62)
RAS*
RAS
(<3 lesions)**
RAS
(‡3 lesions)*** Control
Genotypes, n(%)
TT 0 (0) 0 (0) 0 (0) 0 (0)
CT 35 (57) 21 (54) 14 (61) 21 (44)
CC 27 (43) 18 (46) 09 (39) 41 (66)
*vs control – P ¼ 0.01; **vs control – not significant (P ¼ 0.07); ***vs
control – P ¼ 0.04.
Association of IL-1b polymorphism with RAS
ALS Guimar et al
582
Oral Diseases
Boom R, Sol CJ, Salimans MM et al (1990). Rapid and simple
method for purification of nucleic acids. J Clin Microbiol 28:
495–503.
Borra RC, Andrade PM, Silva ID et al (2004). The Th1/Th2
immune-type response of the recurrent aphthous ulceration
analyzed by cDNA microarray. J Oral Pathol Med 33: 140–
146.
Buno IJ, Huff JC, Weston WL, Cook DT, Brice SL (1998).
Elevated levels of interferon gamma, tumor necrosis factor
alpha, interleukins 2, 4, and 5, but not interleukin 10, are
present in recurrent aphthous stomatitis. Arch Dermatol 134:
827–831.
Chiappelli F, Cajulis OS (2004). Psychobiologic views on
stress-related oral ulcers. Quintessence Int 35: 223–227.
Dagia NM, Goetz DJ (2003). A proteasome inhibitor reduces
concurrent, sequential, and long-term IL-1 beta- and TNF-
alpha-induced ECAM expression and adhesion. Am J
Physiol Cell Physiol 285: C813–C822.
Eversole LR, Shopper TP, Chambers DW (1982). Effects of
suspected foodstuff challenging agents in the etiology of
recurrent aphthous stomatitis. Oral Surg Oral Med Oral
Pathol 54: 33–38.
di Giovine FS, Duff GW (1990). Interleukin 1: the first
interleukin. Immunol Today 11: 13–20.
Healy CM, Enobakhare B, Haskard DO, Thornhill MH
(1997). Raised levels of circulating VCAM-1 and circulating
E-selectin in patients with recurrent oral ulceration. J Oral
Pathol Med 26: 23–28.
Lang NP, Tonetti MS, Suter J et al (2000). Effect of
interleukin-1 gene polymorphisms on gingival inflammation
assessed by bleeding on probing in a periodontal mainten-
ance population. J Periodontal Res 35: 102–107.
Lewkowicz N, Lewkowicz P, Kurnatowska A et al (2003).
Innate immune system is implicated in recurrent aphthous
ulcer pathogenesis. J Oral Pathol Med 32: 475–481.
Lewkowicz N, Lewkowicz, P, Banasik M, Kurnatowska A,
Tcho
´
rzewski H (2005). Predominance of type 1 cytokines
and decreased number of CD4
+
CD25
+high
T regulatory
cells in peripheral blood of patients with recurrent aphthous
ulcerations. Immunol Lett 99: 57–62.
Maes M, Bosmans E, Suy E, Minner B, Raus J (1991a). A
further exploration of the relationships between immune
parameters and the HPA-axis activity in depressed patients.
Psychol Med 21: 313–320.
Maes M, Bosmans E, Suy E et al (1991b). Depression-related
disturbances in mitogen-induced lymphocyte responses and
interleukin-1 beta and soluble interleukin-2 receptor pro-
duction. Acta Psychiatr Scand 84: 379–386.
McCartan BE, Lamey PJ, Wallace AM (1996). Salivary
cortisol and anxiety in recurrent aphthous stomatitis. J Oral
Pathol Med 25: 357–359.
Moreira PR, de Sa AR, Xavier GM et al (2005). A functional
interleukin-1 beta gene polymorphism is associated with
chronic periodontitis in a sample of Brazilian individuals.
J Periodontal Res 40: 306–311.
Natah SS, Hayrinen-Immonen R, Hietanen J, Malmstrom M,
Konttinen YT (2000). Immunolocalization of tumor necro-
sis factor-alpha expressing cells in recurrent aphthous ulcer
lesions (RAU). J Oral Pathol Med 29: 19–25.
Natah SS, Konttinen YT, Enattah NS et al (2004). Recurrent
aphthous ulcers today: a review of the growing knowledge.
Int J Oral Maxillofac Surg 33: 221–234.
Parra FC, Amado RC, Lambertucci JR et al (2003). Color and
genomic ancestry in Brazilians. Proc Natl Acad Sci U S A
100: 177–182.
Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J (1992).
A TaqI polymorphism in the human interleukin-1 beta (IL-1
beta) gene correlates with IL-1 beta secretion in vitro. Eur J
Clin Invest 22: 396–402.
Porter SR, Scully C, Pedersen A (1998). Recurrent aphthous
stomatitis. Crit Rev Oral Biol Med 9: 306–321.
Ship JA, Chavez EM, Doerr PA, Henson BS, Sarmadi M
(2000). Recurrent aphthous stomatitis. Quintessence Int 31:
95–112.
Stanley HR (1972). Aphthous lesions. Oral Surg Oral Med
Oral Pathol 33: 407–416.
Thomas HC, Ferguson A, McLennan JG, Mason DK (1973).
Food antibodies in oral disease: a study of serum antibodies
to food proteins in aphthous ulceration and other oral
diseases. J Clin Pathol 26: 371–374.
Victoria JM, Correia-Silva JF, Pimenta FJ, Kalapothakis E,
Gomez RS (2005). Serotonin transporter gene polymorph-
ism (5-HTTLPR) in patients with recurrent aphthous
stomatitis. J Oral Pathol Med 34: 494–497.
Association of IL-1b polymorphism with RAS
ALS Guimar et al
583
Oral Dise ases
Artigo II 31
3- ARTIGO II
Investigation of functional gene polymorphisms IL-1b, IL-6,
IL-10 and TNF-a in individuals with recurrent aphthous
stomatitis
Andre
´
Luiz Sena Guimara˜ es, Jeane de Fa
´
tima Correia-Silva, Alessandra Rosa de Sa
´
,
Junia Maria Netto Victo
´
ria, Marina Gonc¸alves Diniz, Fernando de Oliveira Costa,
Ricardo Santiago Gomez
*
Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal, de Minas Gerais, Belo Horizonte, Brazil
1. Introduction
Recurrent aphthous stomatitis ( RAS) is characterized by
recurrent episodes of oral ulceration in an otherwise
healthy indi vid ual.
1
Clinically, R AS includes three different
variants, minor aphthous ulcers, major aphthous ulcers an d
herpetiform ulcers.
2,3
It has been estimated that 20% of the
general population will suffer from RAS at some time i n their
lives.
2,4
Although the a etiology of RAS is unknown, current
evidence indicates the presence of genetic factors in this
disease. This has been confirmed by the finding that more
than 40% of patients may have a family history of RAS.
5
The
probability of a sibling developing RAS may also be
influenced by the parents ’ RAS status.
6
Moreover, there is
archives of oral biology 52 (2007) 268–272
article info
Article history:
Accepted 1 August 2006
Keywords:
Recurrent aphthous stomatitis
Cytokine
Polymorphism
Interleukin
Pathogenesis
abstract
Recurrent aphthous stomatitis (RAS) is characterized by recurrent episodes of oral ulcera-
tion in an otherwise healthy individual. Some reports in the literature indicate that RAS may
have immunological, psychological, genetic and microbiological bases.
Objective: The purpose of the present study was to investigate, using binary logistic regres-
sion analyses, a possible association between the functional IL-1b +3954 (C/T), IL-6 À174 (G/
C), IL-10 À1082 (G/A) and TNF-a À308 (G/A) genetic polymorphism and RAS in a sample of
Brazilian patients, using a multivariate statistical analysis.
Design: Sixty-four consecutive subjects affected by minor and major forms of RAS and 64
healthy volunteers were genotyped. To investigate the association between the single
nucleotide polymorphisms and risk of RAS, binary logistic regression models were fitted.
The associations were expressed by odd ratios (ORs) and adjusted for age and gender, with
the corresponding 95% CIs. P-values less than 0.05 were considered significant.
Results: A significant increase in the IL-1b and TNF-a heterozygous genotypes were asso-
ciated with an increased risk of RAS development (OR 2.40 and 3.07, respectively), in the
multivariate model.
Conclusion: Our findings demonstrate that polymorphisms of high IL-1b and TNF-a produc-
tion were associated with an increased risk of RAS development. Our findings also gi ve
additional support to a genetic basis for RAS pathogenesis.
# 2006 Elsevier Ltd. All rights reserved.
* Corresponding author at: Faculdade de Odontologia, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte-MG,
CEP 31270-901, Brazil. Tel.: +55 31 3499 2477; fax: +55 31 3499 2472.
available at www.sciencedirect.com
journal homepage: www.intl.elsevierhealth.com/journals/arob
0003–9969/$ – see front matter # 2006 Elsevier Ltd. All rights reserved.
doi:10.1016/j.archoralbio.2006.08.008
a high correlation of RAS in monozygote but not in dizygote
twins.
7
Psychological factors including anxiety and stress were
associated with RAS in a considerable number of studies,
5,8
thus supporting the findings of our previous study in which
RAS patients showed an increased frequency of serotonin
transporter gene polymorphism (5-HTTLPR) associated with
anxiety-related traits.
9
Some forms of immune dysfunction appear to be related to
RAS pathogenesis. An increased local expression of Th1
genes
10
and systemic production of cytokines, such as IL-2,
TNF-a and IL-6 by peripheral blood mononuclear cells were
observed in RAS patients.
11
In addition, decreased IL-10 mRNA
levels were reported in RAS patients, which suggests a failure
of the immune system to suppress inflammatory reaction to
oral mucosa.
12
A large number of functional genetic polymorphisms in the
immunological system have been described in previous
literature. Some genotypes of these polymorphisms can
increase protein production
13,14
while other polymorphisms,
such as IL-1b +3954 (C/T), were associated with RAS in a
sample of British patients.
15
Considering that immunological
alterations are reported in RAS pathogenesis, together with
evidence demonstrating that genetic factors are associated
with the disease, the purpose of the present study was to
investigate a possible association between the functional IL-1b
+3954 (C/T), IL-6 À174 (G/C), IL-10 À1082 (G/A) and TNF-a À308
(G/A) genetic polymorphisms and RAS in a sample of Brazilian
patients.
2. Material and methods
2.1. Subjects and sample collection
Sixty-four consecutive subjects affected by minor and major
forms of RAS (Table 1) and 64 age and sex matched control
subjects (mean age = 36.9 years; range 8–84 years; standard
deviation 16.5 years) were included in this study. The patients
were recruited from the Oral Diagnosis Clinic at the
Universidade Federal de Minas Gerais. Both the experimental
and control groups were of the same geographic area and had
identical socio-economic status. Ethnicity was not estab-
lished, respecting the hazards of judging Brazilians by color,
race and geographical origin as demonstrated in the past
findings.
16
The diagnosis of RAS was based on accepted clinical
criteria.
17
The control group was comprised of patients with no
history of RAS nor systemic diseases. Exclusion criteria for
both groups included the presence of any other significant
local or systemic diseases, excluding dental caries. No
individual in either group presented chronic periodontitis.
The study protocol was approved by the local Ethics
Committee and informed consent was obtained from either
the patients or the legal guardian when the patient was less
than 18 years of age.
Oral mucosa swabs were removed once from the subjects’
buccal mucosa. The swabs were performed using sterile
plastic tips and placed immediately in Eppendorf microtubes
containing 500 ml of Krebs buffer. The pellet was then obtained
after 5 min of centrifugation at 13,000 Â g and stored at À20 8C
until processing.
2.2. DNA isolation
DNA extraction was carried out as aforementioned.
18
Initially,
450 ml of lyses buffer (6.0 M GuSCN, 65 mM Tris–HCl pH 6.4,
25 mM EDTA, 1.5% Triton X-100) and 20 ml silica (SiO
2
, Sigma S-
5631) were added to the microcentrifuge tube containing the
oral mucosa swab pellet. The tube was mixed and incubated
for 10 min at 56 8C, centrifuged at 3000 Â g for 1 min and the
supernatant discharged. The pellet with the DNA adsorbed in
the silica was washed twice with a 450 ml washing buffer (6.0 M
GuSCN, 65 mM Tris–HCl), twice with 70% ethanol, once with a
450 ml acetone and then dried at 568 C for 10 min. Finally, 100 ml
of TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA) was added
and incubated at 568 C for 10 min to elute the DNA. After
incubation the solution was vortexed and centrifuged at
5000 Â g for 2 min and approximately 90 ml of supernatant
containing DNA was transferred to a new tube.
2.3. Genotyping
The polymorphisms were assessed by polymerase chain
reaction (PCR) amplification and digestion. The sequences of
PCR primers are shown in Table 2. The PCR was carried out in a
total volume of 50 ml, containing approximately 400 ng of DNA,
primers (20 pmol/reaction), and 25 ml of Pre-mix buffer
(Phoneutria Biotecnologia, Belo Horizonte, Brazil). According
to the manufacturer, the Pre-mix buffer contained 50 mM KCI,
10 mM Tris–HCl pH 8.4, 0.1% Triton X-100, 1.5 mM MgCI
2
,
deoxynucleoside triphosphates and 1.25 units of Taq DNA
polymerase. The conditions for amplification consisted of
94 8C for 3 min followed by 35 cycles of 94 8C for 30 s, 54 8C for
35 s and 72 8C for 30 s. The run was terminated by final
elongation at 72 8C for 5 min. In all steps the lid temperature
was 1038. The products were digested with restriction enzyme
according to manufacturer protocols (see Table 2). The
archives of oral biology 52 (2007) 268–272 269
Table 1 – Summary of the clinical data of RAS patients
included in the study
Characteristics Values
Age
Median age (years) 31.7
Range of years 7–69
Standard deviation 14.3
Patient gender
Male, no. (%) 28 (43.8)
Female, no. (%) 36 (56.2)
Number of lesions in aphthous episodes
Less than 3 lesions in each aphthous episode, no. (%) 41 (64.1)
3 or more lesions in each aphthous episode, no. (%) 23 (35.9)
Commitment sites
Floor of the mouth, no. (%) 15 (23.4)
Lips, no. (%) 21 (32.8)
Buccal mucosa, no. (%) 20 (31.3)
Tongue, no. (%) 7 (10.9)
Soft palate, no. (%) 1 (1.6)
visualization of the product was performed in a 6.5%
polyacrylamide gel electrophoresis staining with ethidium
bromide (0.5 mg/ml).
2.4. Statistical analysis
The univariate analyses were performed using the Fisher
exact test or the Chi-square test. To investigate the association
between the single nucleotide polymorphisms and risk of RAS,
binary logistic regression models were fitted. The associations
were expressed by odd ratios (ORs) and adjusted for age (<26
and >26 years) and gender, with the corresponding 95% CIs. P-
values less than 0.05 were considered significant. The multi-
variate analyses were assessed using SPSS (SPSS Inc.,
Chicago), version 14.0, and the univariate analyses were
performed using BioStat 3.0 software (Optical Digital Optical
Technology, Bele
´
m, Brazil)
3. Results
The distribution of genotype and allele frequencies of all
polymorphisms in patients with RAS and control are shown in
Tables3 (univariate analyses) and 4 (multivariate analyses). A
significant increase in the IL-1b and TNF-a heterozygous
genotypes was observed in the group with RAS in the
univariate analysis (P = 0.03 and 0.04). In the multivariate
model, adjusted for age and gender, the same genotypes of IL-
1b and TNF-a shown were associated with an increased risk of
RAS development (OR 2.40 and 3.07, respectively).
4. Discussion
RAS is a very common oral disease of unknown etiology. Many
local and systemic factors have been associated with the
condition. Some reports in the literature indicate that RAS
may have immunological, psycologycal, genetic and micro-
biological bases.
1,3,5,17
Although studies have tried to identify
the role of the immune system in RAS, the immunopathogen-
esis remains to be established.
19,20
Evidence suggests that the
ulceration is the result of an abnormal cytokine cascade in the
oral mucosa that leads to enhanced cell-mediated immune
response directed toward focal areas of the oral mucosa.
10,12
Recent scanning with cDNA microarray analyses in RAS
showed a more intense activity of the Th1 gene cluster relative
to the Th2 gene cluster.
10
Polymorphisms associated with cytokines have been used
to investigate the pathogenesis of various diseases. In the
current study, the univariate an alysis showed that the
polymorphism CT at IL-1b +3954 was associated with RAS.
In the multivariate analysis, we observed that this genotype
was assoc iated with an increased risk of RAS development
(OR 2.40). Previous literature has proven that this genotyp e
has been associated with two-fold IL-1b production.
13
One
such study, using a univariate analysis, also showed a n
increased frequency of IL-1b +3954 and À511 polymorphisms
archives of oral biology 52 (2007) 268–272270
Table 2 – Primer sequence, reference and restriction enzymes used for each polymorphism
Genes Primers (references) Restriction enzyme (condition) Genotypes
IL-1b +3954 (C/T) 5
0
-CTCAGGTGTCCTCGAAGAAATCAAA-3
0
Taql
a
(658/4 h) TT–182 + 12 bp
5
0
-GCTTTTTTGCTGTGAGTCCCG-3
0
CT–182 + 97 + 85 + 12 bp
(Pociot et al.
13
) CC–97 + 85 + 12 bp
IL-6 À174 (G/C) 5
0
-CAGAAGAACTCAGATGACCTG-3
0
hsp92II
a
(378/4 h) CC–229 + 122 + 51 + 29 bp
5
0
-GTGGGGCTGATTGGAAACC-3
0
CG–229 + 173 + 29;bp
(Klein et al.
32
) GG–229 + 122 + 51 + 29 bp
IL-10 À1082 (G/A) 5
0
-CCAAGACAACACTACTAAG GCTCCTTT-3
0
XagI
b
(378/8 h) AA–280 + 97 bp
5
0
-GCTTCTTATATGCTAGTCAGGTA-3
0
GA–280 + 253 + 97 + 27 bp
(Koch et al.
33
) GG–253 + 97 + 27 bp
TNF-a À3O8 (G/A) 5
0
-AGGCAATAGGTTTTGAGGGCCAT-3
0
NcoI
a
(378/12 h) AA–107 bp
5
0
-TCCTCCCTGCTCCGATTCCG-3
0
GA–107 + 87 + 20 bp
(Wilson et al.
14
) GG–87 + 20 bp
a
Promega, Madison, USA.
b
MBI Fermentas.
Table 3 – Distribution of the genotypes in patients with
recurrent aphthous stomatitis (RAS) and control subjects
using an univariate analyses
Genotypes RAS (N = 64) Control (N = 64) P-value
IL-1b +3954 (C/T) (N,%)
CC 28 (56.2) 41 (64)
CT 36 (43.8) 23 (36)
TT 0 (0) 0 (0) 0.03
IL-6 À174 (G/C) (N,%)
CC 1 (1.6) 0 (0)
GC 25 (39) 24 (37.5)
GG 38 (59.4) 40 (62.5) 0.58
IL-10 À1082 (G/A) (N,%)
AA 31 (48.4) 31 (48.4)
GA 26 (40.6) 23 (36)
GG 7 (11) 10 (15.6) 0.70
TNF-a-308 (G/A)
GG 38 (59.4) 47 (73.4)
GA 22 (34.4) 10 (15.6)
AA 4 (6.2) 7 (11) 0.04
P-values from Chi-squared test. A significance level of P 0.05 was
used.
associated with a high cy tokine producer g enotype on RAS
subjects.
15
The relation between local damage in RAS and IL-1b can be
explained by the action of this cytokine as a primary activator
of early chemotactic cytokines, as well as of the expression of
endothelial cell adhesion molecules which facilitate the
migration of leucocytes into tissues.
21,22
Increased levels of
vascular adhesion molecule-1 (VCAM-1) can be observed in
the sera of RAS patients.
23
Moreover, a recent study demon-
strated a higher IL-1b transcription in RAS lesions as
compared to normal mucosa.
10
Therefore, we may speculate
that the expression of the adhesion molecules may be induced
by increased levels of IL-1b present in the individuals with the
high producer genotype. Although RAS patients showed a
genotype associated with high IL-1b production, other authors
have shown that IL-1b production by peripheral blood
mononudear cells was not increased in RAS.
11
Another mechanism to explain IL-1b polymorphism and
RAS development may also be considered. It is well-known
that psychological factors are implied in the pathogenesis of
RAS.
8
A previous study conducted by our group showed that
RAS patients showed an increased frequency of serotonin
transporter gene polymorphism (5-HTTLPR) associated with
anxiety-related traits.
9
As IL-1b levels have proven to be higher
in the blood or cerebrospinal fluid of depressed patients,
24,25
the high producer IL-1b genotype may be more susceptible to
depression and RAS. It is interesting to note that IL-1b
polymorphism has been related to psychosis susceptibility
and early development of Alzheimer’s disease.
26
In the current study, we observed that TNF-a intermediary
producer genotype was associated with an increased risk of
RAS (OR = 3.07). The low number of individuals in case and
control groups with a high TNF-a producer genotype may
explain why this genotype was not associated with RAS. No
previous studies demonstrate the association of TNF-a À308
(G/A) polymorphism and RAS.
27
TNF-a does indeed present
some important immune regulatory activities and studies
have suggested its relation to RAS. Likewise, elevated levels of
TNF-a have been reported in the lesional mucosa and in the
peripheral blood of RAS patients.
11,12,19,28
Enhanced cytotoxic
destruction of epithelial cells by TNF-a produced by peripheral
blood mononuclear cells
29
and leucocytes
28
in RAS subjects
was demonstrated by in vitro studies. Moreover, RAS can be
prevented by endogenous TNF-a synthesis inhibitors, such as
thalidomide
30
and pentoxifylline.
19
Although IL-6 and IL-10 were implied in RAS pathogen-
esis,
11,12,31
our data shows that polymorphisms on these genes
were not associated with RAS. This is in contradiction to a
previous study that demonstrated an association between IL-6
polymorphism and RAS.
27
This disparity is probably related to
population heterogeneity.
In conclusion, our findings demonstrate that polymorph-
isms of high IL-1 b and TNF-a production were asso ciated
with an increased risk of RAS development. Our findings also
give additional support to a ge netic basis for RAS pathogen-
esis.
Acknowledgements
This study was supported by grants from Conselho Nacional
de Desenvolvimento Cientı´fico e Tecno
´
logico (CNPq) and
Fundac¸a
˜
o de Amparo a Pesquisa do Estado de Minas Gerais
(FAPEMIG), Brazil. Dr. R.S. Gomez is research fellow of CNPq.
references
1. Porter SR, Scully C, Pedersen A. Recurrent aphthous
stomatitis. Crit Rev Oral Biol Med 1998;9:306–21.
archives of oral biology 52 (2007) 268–272 271
Table 4 – Pooled genotype frequencies and risks for recurrent aphthous stomatitis (RAS) analyzed by single-nucleotide
polymorphism
Characteristic RAS (N = 64) Control (N = 64) OR
a
95%CI
a
N % N % Min Max
Polymorphism
IL-1b +3954 (C/T)
CC 28 43.7 41 64.0 Referent
CT 36 56.2 23 35.9 2.40 1.11 5.20 0.03
TT 0 0 0 0 NA
IL-6-174 (G/C)
CC 1 1.5 0 0 NA
GC 25 39.0 24 37.5 Referent
GG 38 59.3 40 62.5 0.64 0.28 1.43 0.27
IL-10-1082 (G/A)
AA 31 48.4 31 48.4 1.65 0.51 5.39 0.40
AG 26 40.6 23 35.9 1.85 0.55 6.22 0.32
GG 7 10.9 10 15.6 Referent
TNF-a À308 (G/A)
GG 38 59.3 47 73.4 Referent
AG 22 34.3 10 15.6 3.07 1.22 7.74 0.02
AA 4 6.2 7 10.9 0.98 0.24 3.91 0.98
a
Adjusted for gender and age. A significance level of P 0.05 was used. NA: not applicable due to the low number of samples.
2. Stanley HR. Aphthous lesions. Oral Surg Oral Med Oral Pathol
1972;33:407–16.
3. Jurge S, Kuffer R, Scully C, Porter SR. Number VI recurrent
aphthous stomatitis. Oral Dis 2006;12 :1–21.
4. Axell T, Henricsson V. The occurrence of recurrent
aphthous ulcers in an adult Swedish population. Ada Odontol
Scand 1985;43:121–5.
5. Natah SS, Konttine n YT, Enattah NS, et al. Recurrent
aphthous ulcers today: a review of the growing knowledge.
Int J Oral Maxillofac Surg 2004;33:221–34.
6. Ship II. Epidemiologic aspects of recurrent aphthous
ulcerations. Oral Surg Oral Med Oral Pathol 1972;33:
400–6.
7. Miller MF, Ship II. A retrospective study of the prevalence
and incidence of recurrent aphthou s ulcers in a professional
population, 1958–1971. Oral Surg Oral Med Oral Pathol
1977;43:532–7.
8. McCartan BE, Lamey PJ, Wallace AM. Salivary cortisol and
anxiety in recurrent aphthous stomatitis. J Oral Pathol Med
1996;25:357–9.
9. Victoria JM, Correia-Silva JF, Pimenta FJ, Kalapothakis E,
Gomez RS. Serotonin transporter gene polymorphism (5-
HTTLPR) in patients with recurrent aphthous stomatitis. J
Oral Pathol Med 2005;34:494–7.
10. Borra RC, Andrade PM, Silva ID, et al. The Th1/Th2 immune-
type response of the recurrent aphthous ulceration
analyzed by cDNA microarray. J Oral Pathol Med 2004;33:
140–6.
11. Lewkowicz N, Lewkowicz P, Banasik M, Kurnatowska A,
Tchorzewski H. Predominance of Type 1 cytokines and
decreased number of CD4(+)CD25(+high) T regulatory cells
in peripheral blood of patients with recurrent aphthous
ulcerations. Immunol Lett 2005;99:57–62.
12. Buno IJ, Huff JC, Weston WL, Cook DT, Brice SL. Elevated
levels of interferon gamma, tumor necrosis factor alpha,
interleukins 2, 4 and 5, but not interleukin 10, are present
in recurrent aphthous stomatitis. Arch Dermatol
1998;134:827–31.
13. Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J. A Taql
polymorphism in the human interleukin-1 beta (IL-1 beta)
gene correlates with IL-1 beta secretion in vitro. Eur J Clin
Invest 1992;22:396–402.
14. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff
GW. Effects of a polymorphism in the human tumor
necrosis factor alpha promoter on transcriptional
activation. Proc Natl Acad Sci USA 1997;94:3195–9.
15. Bazrafshani MR, Hajeer AH, Ollier WE, Thornhill MH. IL-1b
and IL-6 gene polymorphisms encode significant risk for the
development of recurrent aphthous stomatitis (RAS). Genes
Immun 2002;3:302–5.
16. Parra FC, Amado RC, Lambertucci JR, et al. Color and
genomic ancestry in Brazilians. Proc Natl Acad Sci USA
2003;100:177–82.
17. Ship JA, Chavez EM, Doerr PA, Henson BS, Sarmadi M.
Recurrent aphthous stomatitis. Quintessence Int 2000;31:
95–112.
18. Guimaraes AL, de Sa AR, Victoria JM, et al. Interleukin-1 B
and serotonin transporter gene polymorphisms in Burning
Mouth Syndrome patients. J Pain 2006;9:654–8.
19. Natah SS, Hayrinen-Immonen R, Hietanen J, Malmstrom M,
Konttinen YT. Immunolocalization of tumor necrosis
factor-alpha expressing cells in recurrent aphthous ulcer
lesions (RAU). J Oral Pathol Med 2000;29:19–25.
20. Lewkowicz N, Lewkowicz P, Kurnatowska A, et al. Innate
immune system is implicated in recurrent aphthous ulcer
pathogenesis. J Oral Pathol Med 2003;32:475–81.
21. Lang NP, Tonetti MS, Suter J, et al. Effect of interleukin-1
gene polymorphisms on gingival inflammation assessed by
bleeding on probing in a periodontal maintenance
population. J Periodontal Res 2000;35:102–7.
22. Dagia NM, Goetz DJ. A proteasome inhibitor reduces
concurrent, sequential, and long-term IL-1 beta- and TNF-
alpha-induced ECAM expression and adhesion. Am J Physiol
Cell Physiol 2003;285:C813–22.
23. Healy CM, Enobakhare B, Haskard DO, Thornhill MH. Raised
levels of circulating VCAM-1 and circulating E-selectin in
patients with recurrent oral ulceration. J Oral Pathol Med
1997;26:23–8.
24. Maes M, Bosmans E, Suy E, et al. Depression-related
disturbances in mitogen-induced lymphocyte responses
and interleukin-1 beta and soluble interleukin-2 receptor
production. Ada Psychiatr Scand 1991;84:379–86.
25. Maes M, Bosmans E, Suy E, Minner B, Raus J. A further
exploration of the relationships between immune
parameters and the HPA-axis activity in depressed patients.
Psychol Med 1991;21:313–20.
26. Rosa A, Peralta V, Papiol S, et al. Interleukin-1 beta (IL-1
beta) gene and increased risk for the depressive symptom-
dimension in schizophrenia spectrum disorders. Am J Med
Genet B Neuropsychiatr Genet 2004;124:10–4.
27. Bazrafshani MR, Hajeer AH, Ollier WE, Thornhill MH.
Recurrent aphthous stomatitis and gene polymorph isms for
the inflammatory markers TNF-alpha , TNF-beta and the
Vitamin D receptor: no association detected. Oral Dis
2002;8:303–7.
28. Taylor LJ, Bagg J, Walker DM, Peters TJ. Increased production
of tumour necrosis factor by peripheral blood leukocytes in
patients with recurrent oral aphthous ulceration. J Oral
Pathol Med 1992;21:21–5.
29. Dolby AE. Recurrent aphthous ulceration. Effect of sera and
peripheral blood lymphocytes upon oral epithelial tissue
culture cells. Immunology 1969;17:709–14.
30. Sampaio EP, Sarno EN, Galilly R, Cohn ZA, Kaplan G.
Thalidomide selectively inhibits tumor necrosis factor alpha
production by stimulated human monocytes. J Exp Med
1991;173:699–703.
31. Sun A, Chia JS, Chang YF, Chiang CP. Levamisole and
Chinese medicinal herbs can modulate the serum
interleukin-6 level in patients with recurrent aphthous
ulcerations. J Oral Pathol Med 2003;32:206–14.
32. Klein W, Tromm A, Griga T, et al. The polymorphism at
position À174 of the IL-6 gene is not associated with
inflammatory bowel disease. Eur J Gastroenterol Hepatol
2001;13:45–7.
33. Koch W, Kastrati A, Bottiger C, et al. lnterleukin-10 and
tumor necrosis factor gene polymorphisms and risk of
coronary artery disease and myocar dial infarction.
Atherosclerosis 2001;159:137–44.
archives of oral biology 52 (2007) 268–272272
ArtigoIII 36
4- ARTIGO III
1
IL-1B, IL-6, IL-10 and TNFA functional gene polymorphisms in patients with
recurrent aphthous stomatitis
André Luiz Sena Guimarães
Jeane de Fátima Correia-Silva
Alessandra Rosa de Sá
Junia Maria Netto Victória
Marina Gonçalves Diniz
Fernando de Oliveira Costa
Ricardo Santiago Gomez
Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal
de Minas Gerais, Belo Horizonte, Brazil
Corresponding author:
Prof. Ricardo Santiago Gomez
Faculdade de Odontologia
Universidade Federal de Minas Gerais
Av. Antonio Carlos, 6627
Belo Horizonte-MG
Brazil CEP 31270-901
Tel: +55 31 3499-2477
Fax: +55 31 3499-2472
e-mail:
2
Abstract
Recurrent aphthous stomatitis (RAS) is characterized by recurrent episodes of oral
ulceration in an otherwise healthy individual. Literature data suggest that RAS might
have genetic background with a certain specific pattern of gene polymorphism
inheritance.
Objective: The purpose of this study was to investigate, using binary logistic regression
analyses, a possible association between the functional IL-1B +3954 (C/T), IL-6 -174
(G/C), IL-10 -1082 (G/A) and TNFA -308 (G/A) gene polymorphisms and RAS in a
sample of Brazilian patients, using a multivariate statistical analysis.
Design: Sixty-four patients with RAS (mean age = 31.7 years; range 7-69 years) and 64
healthy volunteers (mean age = 36.9 years; range 8-84 years) were genotyped.
Statistical analysis was based on the use of Chi square test together with Fischer test as
well as binary logistic regression model (p-values below 0.05 were considered as
significant).
Results: A significant increase in the IL-1B and TNFA heterozygous genotypes were
associated with an increased risk of RAS development (OR 2.40 and 3.07, respectively)
in the multivariate model
Conclusion: Our findings clearly demonstrate an association between inheritance of IL-
1B and TNFA gene polymorphisms and RAS occurrence, thus giving additional support
for genetic basis of this disease.
Key words: recurrent aphtous stomatitis; gene polymorphism, genetic
.
3
Introduction
Recurrent aphthous stomatitis (RAS) is characterized by recurrent episodes of oral
ulceration in an otherwise healthy individual
1
. Clinically, RAS includes three different
variants, minor aphthous ulcers, major aphthous ulcers, and herpetiform ulcers
2
. It has
been estimated that 20% of the general population will suffer from RAS at some time in
their lives
3;4
. Although the etiology of RAS is unknown, current evidence indicates the
presence of genetic factors in this disease. This has been confirmed not only by the
finding that more than 40% of patients may have a family history of RAS
5
, but also
because there is a high correlation of RAS in monozygotic but not in dizygotic twins
6
.
Moreover, if both parents have RAS, there is 90% probability that the child will be
affected with RAS as well
7
.
Psychological factors including anxiety and stress were associated with RAS in a
considerable number of studies
5;8
. Previously we have reported increased frequency of
serotonin transporter gene polymorphism associated with anxiety-related traits in RAS
patients
9
.
So far, data from the published literature indicate immune dysfunction in RAS
pathogenesis. An increased expression of Th1 genes is observed in RAS lesions,
10
together with high levels of IL-2, TNF-α, and IL-6 secreted by circulating mononuclear
cells of RAS patients
11
. In addition, decreased IL10 mRNA levels were reported in RAS
patients, which suggests a failure of the immune system to suppress inflammatory
reaction to oral mucosa
12
. Hematological, gastrointestinal, nutritional, allergic have also
been implicated in RAS development
13
. There are now several examples of
4
polymorphisms occurring within cytokine genes that affect protein production, some of
which are associated disease.
9;14
.
Considering that immunological alterations are reported in RAS pathogenesis,
together with evidence demonstrating that genetic factors are associated with the
disease, the purpose of the present study was to investigate a possible association
between the functional IL-1B +3954 (C/T), IL-6 -174 (G/C), IL-10 -1082 (G/A) and TNFA
-308 (G/A) gene polymorphisms and RAS in a sample of Brazilian patients.
Material and methods
Subjects and sample collection
Sixty-four consecutive subjects affected by minor and major forms of RAS (Table 1) and
64 age and sex matched control subjects (mean age = 36.9 years; range 8-84 years;
standard deviation 16.5 years) were included in this study. The patients and controls
were recruited from the Oral Diagnosis Clinic and Restorative Dentistry Clinic,
respectively, at the Universidade Federal de Minas Gerais. Both the experimental and
control groups were of the same geographic area and had identical socio-economic
status. Ethnicity was not established, respecting the hazards of judging Brazilians by
color, race and geographical origin
15
.
The diagnosis of RAS was based on accepted clinical criteria
16
. The control
group comprised of participants with no history of RAS nor clinical evidence of systemic
diseases. Exclusion criteria for both groups included the presence of any other
significant local or systemic diseases, excluding dental caries. No individual in either
group presented chronic periodontitis. The study protocol was approved by the local
5
Ethics Committee and informed consent was obtained from either the patients or the
legal guardian when the patient was less than 18 years of age.
Oral mucosa swabs were removed once from the subjects’ buccal mucosa. The
swabs were performed using sterile plastic tips and placed immediately in Eppendorf
microtubes containing 500 µl of Krebs buffer. The pellet was then obtained after 5 min of
centrifugation at 13000 g and stored at -20ºC until processing.
DNA isolation
DNA extraction was carried out as aforementioned
17
. Initially, 450 µl of lyses buffer (6.0
M GuSCN, 65 mM Tris HCl pH 6.4, 25 mM EDTA, 1.5% TritonX-100) and 20 µl silica
(SiO2, Sigma S-5631) were added to the microcentrifuge tube containing the oral
mucosa swab pellet. The tube was mixed and incubated for 10 min at 56 ºC, centrifuged
at 3,000 g for 1 min and the supernatant discharged. The pellet with the DNA adsorbed
in the silica was washed twice with a 450 µl washing buffer (6.0 M GuSCN, 65 mM Tris
HCl), twice with 70% ethanol, once with a 450 µl acetone, and then dried at 56º C for 10
min. Finally, 100 µl of TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) was added and
incubated at 56° C for 10 min to elute the DNA. After incubation the solution was
vortexed and centrifuged at 5,000 g for 2 minutes and approximately 90µL of
supernatant containing DNA was transferred to a new tube.
Genotyping
The polymorphisms were assessed by polymerase chain reaction (PCR) amplification
and digestion. The sequences of PCR primers are shown in Table 2. The PCR was
6
carried out in a total volume of 50 µl, containing approximately 400 ng of DNA, primers
(20 pmol/reaction), and 25 µl of Pre-mix buffer (Phoneutria Biotecnologia, Belo
Horizonte, Brazil). According to the manufacturer, the Pre-mix buffer contained 50 mM
KCl, 10 mM Tris-HCl pH 8.4, 0.1% Triton X-100, 1.5 mM MgCl2, deoxynucleoside
triphosphates, and 1.25 units of Taq DNA polymerase. The conditions for amplification
consisted of 94ºC for 3 min followed by 35 cycles of 94ºC for 30 s, 54ºC for 35 s and
72ºC for 30 s. The run was terminated by final elongation at 72ºC for 5 min. In all steps
the lid temperature was 103º. The products were digested with restriction enzyme
according to manufacturer protocols (see table 2). The visualization of the product was
performed in a 6.5% polyacrylamide gel electrophoresis staining with ethidium bromide
(0.5 µg/ml).
Statistical Analysis
The univariate analyses were performed using the Fisher exact test or the chi-square
test. To investigate the association between the single nucleotide polymorphisms and
risk of RAS, binary logistic regression models were fitted. The associations were
expressed by odd ratios (ORs) and adjusted for age (<26 and ≥ 26 years) and gender,
with the corresponding 95% CIs. P- values less than 0.05 were considered significant.
The multivariate analyses were assessed using SPSS (SPSS Inc., Chicago), version
14.0, and the univariate analyses were performed using BioStat 3.0 software (Optical
Digital Optical Technology, Belém, Brazil)
Results
7
The distribution of genotype and allele frequencies of all polymorphisms in patients with
RAS and control are shown in Tables 3 (univariate analyses) and 4 (multivariate
analyses). A significant increase in the IL-1B and TNFA heterozygous genotypes were
observed in the group with RAS in the univariate analysis (p= 0.03 and p=0.04,
respectively). In the multivariate model, adjusted for age and gender, the same
genotypes of IL-1B and TNFA were associated with an increased risk of RAS
development (OR 2.40 and 3.07, respectively).
Discussion
Some reports in the literature indicate that RAS may have immunological, psychological,
genetic, and microbiological bases
1;5;13;16
. Albeit there is substantial evidence upon
certain abnormalities of immune system in the pathogenesis of RAS, still its exact
mechanism is unknown
18;19
. Evidence suggests that the ulceration is the result of an
abnormal cytokine cascade in the oral mucosa that leads to enhanced cell-mediated
immune response directed toward focal areas of the oral mucosa
10;12
. Recent scanning
with cDNA microarray analyses in RAS showed a more intense activity of the Th1 gene
cluster relative to the Th2 gene cluster
10
.
In the current study, the univariate analysis showed that the polymorphism CT at
IL-1B +3954 was associated with RAS. The multivariate analysis confirmed that this
genotype was associated with an increased risk of RAS development (OR 2.40).
Although no individual in both groups presented the genotype TT, which is associated
with the highest IL-1β production, the heterozygous (CT) subjects has been associated
with two-fold IL-1β production compared to the genotype CC
20
. Another study, using a
8
univariate analysis, also showed an increased frequency of IL-1B + 3954 and -511
polymorphisms associated with a high cytokine producer genotype on RAS subjects
14
.
The relation between local damage in RAS and IL-1β can be explained by the
action of this cytokine as a primary activator of early chemotactic cytokines, as well as of
the expression of endothelial cell adhesion molecules which facilitate the migration of
leukocytes into tissues
21;22
. Increased levels of vascular adhesion molecule -1 (VCAM-
1) can be observed in the sera of RAS patients
23
. Moreover, a recent study
demonstrated a higher IL-1B transcription in RAS lesions as compared to normal
mucosa
10
. Therefore, we may speculate that the expression of the adhesion molecules
may be induced by increased levels of IL-1β present in the individuals with the high
producer genotype. Despite IL-1β production by peripheral blood mononuclear cells in
RAS subjects is not increased
11
, increased transcription of IL-1B gene in RAS lesions
has been demonstrated
10
.
As increased levels of anxiety are found in some patients with RAS
8
, and
mononuclear cells of patients with stress and anxiety show increased amounts of IL-1β,
the high producer IL-1β genotype may be more susceptible to anxiety, stress and RAS
24
. We have previously demonstrated association between RAS and 5-HTTLPR
genotype
9
, another anxiety-related polymorphism.
The low number of individuals with the high TNF-α producer genotype restricted
the analysis of this genotype in relation to RAS development. Any way, we observed
that the TNF-α intermediary producer genotype was associated with an increased risk of
RAS (OR =3.07). Although this finding is in contrast to a previous study
25
, many
investigations using saliva, serum or tissues indicate that TNF-α has an important role in
9
RAS
11;12;18;26
. Moreover, enhanced cytotoxic destruction of epithelial cells by TNF-α
produced by peripheral blood mononuclear cells
27
and leukocytes
26
in RAS subjects
was demonstrated by in vitro studies.
In the current study no association between IL-6 -174 (G/C) high producer
genotype and RAS was observed in contrast to earlier observations
14
. We might
speculate that this disparity might be related to the population heterogeneity. On the
other hand, the present study confirms that IL-10 gene polymorphism is not related to
RAS patients development
28
. Although IL-6 and IL-10 were implicated in RAS
pathogenesis
11;12;14;29
, our data show that IL-6 and IL-10 gene polymorphisms were not
associated with RAS. Therefore, other biological or environmental factors were involved
with altered production of these cytokines.
There is an important limitation of the present study that should be considered. As
our investigation was restricted to a genetic analysis, no speculation could be performed
about the functional relations between cytokines, such as synergistic effects. In
conclusion, our findings clearly demonstrate an association between inheritance of IL-1
and TNFA gene polymorphisms and RAS occurrence, thus giving additional support for
genetic basis of this disease.
10
Acknowledgements
This study was supported by grants from Conselho Nacional de Desenvolvimento
Científico e Tecnológico (CNPq) and Fundação de Amparo à Pesquisa do Estado de
Minas Gerais (FAPEMIG), Brazil. Dr. RS Gomez is research fellow of CNPq.
11
References
1. Porter SR, Scully C, Pedersen A. Recurrent aphthous stomatitis. Crit Rev.Oral
Biol.Med. 1998; 9: 306-321.
2. Lehner T. RECURRENT APHTHOUS ULCERATION AND AUTOIMMUNITY.
Lancet 1964; 14: 1154-1155.
3. Stanley HR. Aphthous lesions. Oral Surg.Oral Med.Oral Pathol. 1972; 33: 407-416.
4. Axell T, Henricsson V. The occurrence of recurrent aphthous ulcers in an adult
Swedish population. Acta Odontol.Scand. 1985; 43: 121-125.
5. Natah SS, Konttinen YT, Enattah NS et al. Recurrent aphthous ulcers today: a
review of the growing knowledge. Int.J.Oral Maxillofac.Surg. 2004; 33: 221-234.
6. Miller MF, Ship II. A retrospective study of the prevalence and incidence of
recurrent aphthous ulcers in a professional population, 1958-1971. Oral Surg.Oral
Med.Oral Pathol. 1977; 43: 532-537.
7. Ship II. Epidemiologic aspects of recurrent aphthous ulcerations. Oral Surg.Oral
Med.Oral Pathol. 1972; 33: 400-406.
8. McCartan BE, Lamey PJ, Wallace AM. Salivary cortisol and anxiety in recurrent
aphthous stomatitis. J.Oral Pathol.Med. 1996; 25: 357-359.
9. Victoria JM, Correia-Silva JF, Pimenta FJ, Kalapothakis E, Gomez RS. Serotonin
transporter gene polymorphism (5-HTTLPR) in patients with recurrent aphthous
stomatitis. J.Oral Pathol.Med. 2005; 34: 494-497.
10. Borra RC, Andrade PM, Silva ID et al. The Th1 /Th2 immune-type response of the
recurrent aphthous ulceration analyzed by cDNA microarray. J.Oral Pathol.Med.
2004; 33: 140-146.
11. Lewkowicz N, Lewkowicz P, Banasik M, Kurnatowska A, Tchorzewski H.
Predominance of Type 1 cytokines and decreased number of CD4(+)CD25(+high)
T regulatory cells in peripheral blood of patients with recurrent aphthous
ulcerations. Immunol.Lett. 2005; 99: 57-62.
12. Buno IJ, Huff JC, Weston WL, Cook DT, Brice SL. Elevated levels of interferon
gamma, tumor necrosis factor alpha, interleukins 2, 4, and 5, but not interleukin 10,
are present in recurrent aphthous stomatitis. Arch.Dermatol. 1998; 134: 827-831.
13. Jurge S, Kuffer R, Scully C, Porter SR. Number VI recurrent aphthous stomatitis.
Oral Dis. 2006; 12: 1-21.
12
14. Bazrafshani MR, Hajeer AH, Ollier WE, Thornhill MH. IL-1B and IL-6 gene
polymorphisms encode significant risk for the development of recurrent aphthous
stomatitis (RAS). Genes Immun. 2002; 3: 302-305.
15. Parra FC, Amado RC, Lambertucci JR et al. Color and genomic ancestry in
Brazilians. Proc.Natl.Acad.Sci.U.S.A 2003; 100: 177-182.
16. Ship JA, Chavez EM, Doerr PA, Henson BS, Sarmadi M. Recurrent aphthous
stomatitis. Quintessence.Int. 2000; 31: 95-112.
17. Victoria JM, Guimaraes AL, da Silva LM, Kalapothakis E, Gomez RS. Polymerase
chain reaction for identification of herpes simplex virus (HSV-1), cytomegalovirus
(CMV) and human herpes virus-type 6 (HHV-6) in oral swabs. Microbiol.Res. 2005;
160: 61-65.
18. Natah SS, Hayrinen-Immonen R, Hietanen J, Malmstrom M, Konttinen YT.
Immunolocalization of tumor necrosis factor-alpha expressing cells in recurrent
aphthous ulcer lesions (RAU). J.Oral Pathol.Med. 2000; 29: 19-25.
19. Lewkowicz N, Lewkowicz P, Kurnatowska A et al. Innate immune system is
implicated in recurrent aphthous ulcer pathogenesis. J.Oral Pathol.Med. 2003; 32:
475-481.
20. Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J. A TaqI polymorphism in the
human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in
vitro. Eur.J.Clin.Invest 1992; 22: 396-402.
21. Lang NP, Tonetti MS, Suter J et al. Effect of interleukin-1 gene polymorphisms on
gingival inflammation assessed by bleeding on probing in a periodontal
maintenance population. J.Periodontal Res. 2000; 35: 102-107.
22. Dagia NM, Goetz DJ. A proteasome inhibitor reduces concurrent, sequential, and
long-term IL-1 beta- and TNF-alpha-induced ECAM expression and adhesion.
Am.J.Physiol Cell Physiol 2003; 285: C813-C822.
23. Healy CM, Enobakhare B, Haskard DO, Thornhill MH. Raised levels of circulating
VCAM-1 and circulating E-selectin in patients with recurrent oral ulceration. J.Oral
Pathol.Med. 1997; 26: 23-28.
24. Brydon L, Edwards S, Jia H et al. Psychological stress activates interleukin-1beta
gene expression in human mononuclear cells. Brain Behav.Immun. 2005; 19: 540-
546.
25. Bazrafshani MR, Hajeer AH, Ollier WE, Thornhill MH. Recurrent aphthous
stomatitis and gene polymorphisms for the inflammatory markers TNF-alpha, TNF-
beta and the vitamin D receptor: no association detected. Oral Dis. 2002; 8: 303-
307.
13
26. Taylor LJ, Bagg J, Walker DM, Peters TJ. Increased production of tumour necrosis
factor by peripheral blood leukocytes in patients with recurrent oral aphthous
ulceration. J.Oral Pathol.Med. 1992; 21: 21-25.
27. Dolby AE. Recurrent aphthous ulceration. Effect of sera and peripheral blood
lymphocytes upon oral epithelial tissue culture cells. Immunology 1969; 17: 709-
714.
28. Bazrafshani MR, Hajeer AH, Ollier WE, Thornhill MH. Polymorphisms in the IL-10
and IL-12 gene cluster and risk of developing recurrent aphthous stomatitis. Oral
Dis. 2003; 9: 287-291.
29. Sun A, Chia JS, Chang YF, Chiang CP. Levamisole and Chinese medicinal herbs
can modulate the serum interleukin-6 level in patients with recurrent aphthous
ulcerations. J.Oral Pathol.Med. 2003; 32: 206-214.
30. Klein W, Tromm A, Griga T et al. The polymorphism at position -174 of the IL-6
gene is not associated with inflammatory bowel disease.
Eur.J.Gastroenterol.Hepatol. 2001; 13: 45-47.
31. Koch W, Kastrati A, Bottiger C et al. Interleukin-10 and tumor necrosis factor gene
polymorphisms and risk of coronary artery disease and myocardial infarction.
Atherosclerosis 2001; 159: 137-144.
32. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a
polymorphism in the human tumor necrosis factor alpha promoter on transcriptional
activation. Proc.Natl.Acad.Sci.U.S.A 1997; 94: 3195-3199.
14
Table 1- Summary of the clinical data of RAS patients included in the study.
Characteristics values
Age
Median age, 31.7 years
range of years 7 - 69
standard deviation 14.3
Patient gender
- Male, n° (%) 28 (43.8)
- Female, n° (%) 36 (56.2)
Number of lesions in aphthous episodes
Less than 3 lesions in each aphthous episode n° (%) 41 (64.1)
3 or more lesions in each aphthous episode, n° (%) 23 (35.9)
Commitment sites
Floor of the mouth, n° (%) 15 (23.4)
Lips, n° (%) 21 (32.8)
Buccal mucosa, n° (%) 20 (31.3)
Tongue, n° (%) 7 (10.9)
Soft palate, n° (%) 1 (1.6)
15
Table 2- Primer sequence, reference, and restriction enzymes used for each
polymorphism.
Genes Primers (references)
Restriction
Enzime
(condition)
Genotypes
IL-1B +3954
(C/T)
5’ CTCAGGTGTCCTCGAAGAAATCAAA 3’
5’ GCTTTTTTGCTGTGAGTCCCG 3’
20
TaqI
§
(65º/4hs)
TT-182+12 bp
CT-182+97+85+12 bp
CC-97+85+12 bp
IL-6-174(G/C)
5’ CAGAAGAACTCAGATGACCTG 3’
5’ GTGGGGCTGATTGGAAACC 3’
30
hsp92II
§
(37º/8hs)
CC-229 + 122 + 51 + 29
GC-229 + 173 + 122 + 51 + 29
GG-229 + 173 + 29
IL-10-1082(G/A)
5’ CCAAGACAACACTACTAAGGCTCCTTT 3’
5’ GCTTCTTATATGCTAGTCAGGTA 3’
31
XagI
#
(37º/4hs)
AA-280+97 bp
GA-280+253+97+27 bp
GG-253+97+27 bp
TNFA-308(G/A)
5’ AGGCAATAGGTTTTGAGGGCCAT 3’
5’ TCCTCCCTGCTCCGATTCCG 3’
32
NcoI
§
(37º/12hs)
AA-107 bp
GA-107+87+20 bp
GG-87+20 bp
§
Promega, Madison, USA.
#
MBI Fermentas,
16
Table 3- Distribution of the genotypes in patients with recurrent aphthous stomatitis
(RAS) and control subjects using an univariate analyses.
Genotypes RAS(n=64) Control(n=64) P-value
IL-1B+3954(C/T)
n(%)
CC 28(56.2%) 41(64%)
CT 36(43.8%) 23(36%)
TT 0(0%) 0(0%) 0.03
IL-6-174(G/C)
n(%)
CC 1(1.6%) 0(0%)
GC 25(39%) 24(37.5%)
GG 38(59.4%) 40(62.5%) 0.58
IL-10-1082(G/A)
n(%)
AA 31(48.4%) 31(48.4%)
GA 26(40.6%) 23(36%)
GG 7(11%) 10(15.6%) 0.70
TNFA-308(G/A)
n(%)
GG 38(59.4%) 47(73.4%)
GA 22(34.4%) 10(15.6%)
AA 4(6.2%) 7(11%) 0.04
P-values from chi-squared test. A significance level of P≤0.05 was used
17
Table 4- Distribution of the genotypes in patients with recurrent aphthous stomatitis
(RAS) and control subjects and analysis by a binary logistic regression.
Characteristic RAS (N=64) Control (N=64) OR
§
95%CI
§
§
N (%) N (%) Min Max
Polymorphism
IL-1B +3954 (C/T)
CC 28 43.7 41 64.0 Referent
CT 36 56.2 23 35.9 2.40 1.11 5.20 0.03
TT 0 0 0 0 NA
IL-6 -174 (G/C)
CC 1 1.5 0 0 NA
GC 25 39.0 24 37.5 Referent
GG 38 59.3 40 62.5 0.64 0.28 1.43 0.27
IL-10 -1082 (G/A)
AA 31 48.4 31 48.4 1.65 0.51 5.39 0.40
AG 26 40.6 23 35.9 1.85 0.55 6.22 0.32
GG 7 10.9 10 15.6 Referent
TNFA -308 (G/A)
GG 38 59.3 47 73.4 Referent
AG 22 34.3 10 15.6 3.07 1.22 7.74 0.02
AA 4 6.2 7 10.9 0.98 0.24 3.91 0.98
§
Adjusted for gender and age. A significance level of P≤0.05 was used.
NA=not applicable due to the low number of samples.
Considerações Finais 53
5- CONSIDERAÇÕES FINAIS
Guimarães AL 54
Existem, na literatura, numerosas propostas para se explicar o mecanismo
etiológico da EUR. Apesar de existirem fortes evidências apontando disfunção do sistema
imune na EUR, a causa desta doença permanece desconhecida. Alguns polimorfismos
genéticos nos genes IL-1B, IL-6, IL-10 e TNFA são responsáveis por um aumento na
expressão dos mesmos genes. Com base nisto investigamos a associação entre
polimorfismos genéticos destes genes e EUR.
Estudos prévios mostraram a associação entre o polimorfismo genético na região
+3954 do gene IL-1B e EUR na população inglesa (Bazrafshani e cols, 2002a). No
presente estudo, observamos que a variante polimórfica CT do gene IL-1B foi associada
com a EUR não só quando avaliada separadamente, mas também na análise com os
outros polimorfismos. Este genótipo confere um risco aumentado de desenvolvimento de
EUR (OR 2.40). Nenhum dos dois grupos estudados apresentou o genótipo TT que é o
responsável pela maior produção de IL-1β. Porém o genótipo CT produz duas vezes mais
IL-1β in vitro que o homozigoto CC (Pociot e cols, 1992). A distribuição dos genótipos do
nosso grupo controle foi semelhante a de estudos realizados com populações na mesma
região (Moreira e cols, 2005).
Vários fatores são usados na literatura para tentar explicar a etiologia da EUR
incluindo trauma local, deficiências nutricionais, disfunção imunológica, doenças
psiquiátricas e agentes microbianos. A produção aumentada de IL-1β diante de qualquer
um destes fatores pode levar uma predisposição aumentada para o desenvolvimento da
EUR, uma vez que, a IL-1β estimula a produção de outras citocinas inflamatórias e
moléculas de adesão em células endoteliais (Lang e cols, 2000; Dagia & Goetz, 2003) .
Níveis Aumentados da molécula de adesão vascular-1 (VCAM-1) (Healy e cols, 1997) e
níveis locais aumentados de cDNA de IL-1. (Borra e cols, 2004) observados em
pacientes com EUR dão um suporte adicional para estas especulações. A IL-1β pode
Considerações Finais 55
também agir de forma central. Estudos demonstram que é observado aumento na
expressão de IL-1β em pacientes ansiosos e estressados (Brydon e cols, 2005). Além
disso, foi relatada a associação entre EUR e o 5HHTLPR, um outro polimorfismo
relacionado com ansiedade (Victoria e cols, 2005).
Devido ao pequeno número de indivíduos com genótipo alto produtor de TNF-α
(AA) deste estudo, a associação entre este genótipo e a EUR não foi observada. De toda
forma evidenciou-se a associação entre EUR e indivíduos heterozigotos (GA), que têm
produção intermediária de TNF-α. Apesar destes dados conflitarem com estudos em
outras populações (Bazrafshani e cols, 2002b), muitos trabalhos têm atribuído um
importante papel do TNF-α na etiologia da EUR (Dolby, 1969; Taylor e cols., 1992; Buno e
cols, 1998; Lewkowicz e cols, 2005).
A variante polimórfica C situada no lócus- 174 do gene IL-6, não alterara os níveis
de expressão de IL-6 mesmo após estimulação com LPS ou IL-1 (Fishman e cols, 1998).
Com base neste dado era de se esperar que grande parte das doenças autoimunes e
inflamatórias, assim como na EUR, estariam sempre associadas com a variante
polimórfica G, que confere maior produção de IL-6. Fato este observado previamente
(Bazrafshani e cols, 2002a), mas não no presente estudo. Uma possível explicação para
este fato seria uma heterogeneidade da população estudada. Por outro lado, os nossos
resultados confirmam a não associação do polimorfismo -1082 no gene IL-10 e EUR
(Bazrafshani e cols, 2003).
Com base nestes fatos concluímos que os polimorfismos genéticos dos genes IL-
1B e TNFA estão associados com a EUR em nossa população evidenciando a base
genética desta doença.
Guimarães AL 56
A ausência de estudos sobre polimorfismos na SAB, aliado ao fato de que os
polimorfismos IL1B +3954 e 5HTTLPR estão relacionados com alterações na percepção
de dor e alterações psiquiátricas, nos levaram a investigar estes genótipos em pacientes
com SAB.
No presente estudo, nenhum dos dois grupos estudados apresentou o genótipo TT
que é o responsável pela maior produção de IL-1β. Porém, o genótipo CT, que leva
também a uma produção aumentada de IL-1β em relação ao homozigoto CC (Pociot e
cols, 1992), mostrou associação com a SAB nesta população. Evidências mostram
associação entre aumento na expressão de IL-1β em pacientes acometidos por stress e
ansiedade (Brydon e cols, 2005). Além disso, stress e depressão são observados
frequentemente associados com a SAB (Grushka e cols, 1998; Pokupec-Gruden e cols,
2000). Uma possível forma de atuação desta citocina na SAB seria devido à capacidade
de desencadear hiperalgesia não só em doenças inflamatórias, mas também em doenças
possivelmente neuropáticas, como a SAB, (Opree & Kress, 2000). Por outro lado, a
variante polimórfica curta do polimorfismo 5HTTLPR, que esta associada com ansiedade
(Serretti e cols, 2002), não mostrou relação com a SAB. Apesar disso, outros mecanismos
envolvidos na síntese de serotonina devem ser estudados posteriormente.
Dois pontos importantes devem ser considerados durante a análise do estudo de
polimorfismos genéticos. Primeiro devemos lembrar que o fenótipo, por definição, é o
resultado da interação entre o genótipo e o meio ambiente. Com isto, vale a pena lembrar
que uma limitação de estudos que avaliam exclusivamente o status genético das
populações é a impossibilidade de inferências qualitativas e quantitativas sobre as
proteínas codificadas por estes genes.
Segundo, outros polimorfismos genéticos alto produtores de uma proteína
antagonista podem estar em desequilíbrio de ligação com o polimorfismo de estudo. Isto
Considerações Finais 57
normalizaria a ação destas proteínas. A solução para este problema só é possível através
de consórcios internacionais de mapas haplóticos (Hapmap), que avaliam a distribuição
de vários polimorfismos em várias populações (*, 2005). Com base nisso, o objetivo geral
deste trabalho foi realizar uma investigação inicial na busca de variações genéticas na
EUR e SAB.
Os estudos de associação entre polimorfismos genéticos e doenças têm se
mostrado uma importante ferramenta não só para investigar a etiologia das doenças, mas
também para prognóstico dos tratamentos a serem instituídos nas mesmas. Um exemplo
disso é que pacientes com genótipos que conferem uma maior produção de IL-1β têm
maior sucesso ao tratamento anti viral para hepatite B (Chan e cols., 2006). Em doenças
onde não se observa um único agente etiológico definido, como a EUR e a SAB, a
possibilidade de se encontrar um guia terapêutico, baseado em possível genotipagem,
poderá trazer um impacto positivo para qualidade de vida dos portadores destas
enfermidades.
58
5- REFERÊNCIAS BIBLIOGRÁFICAS
Referências Bibliográficas 59
1. * (2005) A haplotype map of the human genome. Nature 437:1299-1320.
2. Abiko, Y., Hiratsuka, K., Kiyama-Kishikawa, M., Tsushima, K., Ohta, M., Sasahara,
H. (2004) Profiling of differentially expressed genes in human gingival epithelial
cells and fibroblasts by DNA microarray. J. Oral Sci. 46:19-24.
3. Akira, S., Taga, T., Kishimoto, T. (1993) Interleukin-6 in biology and medicine. Adv.
Immunol. 54:1-78.
4. Akira, S., Uematsu, S., Takeuchi, O. (2006) Pathogen recognition and innate
immunity. Cell 124:783-801.
5. Al Quran, F.A. (2004) Psychological profile in burning mouth syndrome. Oral Surg.
Oral Med. Oral Pathol. Oral Radiol. Endod. 97:339-344.
6. Arai, K., Watanabe, S., Koyano, N., Lee, H.J., Miyajima, A., Yssel, H., Arai, N.,
Yokota, T. (1992) Cytokine network: control of allergic response and hemopoiesis
by hemopoietic growth factors. J. Dermatol. 19:575-583.
7. Arend, W.P. (2002) The balance between IL-1 and IL-1Ra in disease. Cytokine
Growth Factor Rev. 13:323-340.
8. Assimakopoulos, D., Patrikakos, G., Fotika, C., Elisaf, M. (2002) Benign migratory
glossitis or geographic tongue: an enigmatic oral lesion. Am. J. Med. 113:751-755.
9. ATKINS, E. (1960) Pathogenesis of fever. Physiol Rev. 40:580-646.
Guimarães AL 60
10. Axell, T., Henricsson, V. (1985) The occurrence of recurrent aphthous ulcers in an
adult Swedish population. Acta Odontol. Scand. 43:121-125.
11. Balto, K., Sasaki, H., Stashenko, P. (2001) Interleukin-6 deficiency increases
inflammatory bone destruction. Infect. Immun. 69:744-750.
12. Banoczy, J., Szabo, L., Csiba, A. (1975) Migratory glossitis. A clinical-histologic
review of seventy cases. Oral Surg. Oral Med. Oral Pathol. 39:113-121.
13. Barton, D.H., Spier, S.K., Crovello, T.J. (1982) Benign migratory glossitis and
allergy. Pediatr. Dent. 4:249-250.
14. Bartoshuk, L.M., Duffy, V.B., Reed, D., Williams, A. (1996) Supertasting, earaches
and head injury: genetics and pathology alter our taste worlds. Neurosci. Biobehav.
Rev. 20:79-87.
15. Basker, R.M., Sturdee, D.W., Davenport, J.C. (1978) Patients with burning mouths.
A clinical investigation of causative factors, including the climacteric and diabetes.
Br. Dent. J. 145:9-16.
16. Bauer, J., Herrmann, F. (1991) Interleukin-6 in clinical medicine. Ann. Hematol.
62:203-210.
17. Baumann, H., Gauldie, J. (1994) The acute phase response. Immunol. Today
15:74-80.
Referências Bibliográficas 61
18. Bayley, J.P., de, R.H., van den Elsen, P.J., Huizinga, T.W., Verweij, C.L. (2001)
Functional analysis of linker-scan mutants spanning the -376, -308, -244, and -238
polymorphic sites of the TNF-alpha promoter. Cytokine 14:316-323.
19. Bazrafshani, M.R., Hajeer, A.H., Ollier, W.E., Thornhill, M.H. (2002a) IL-1B and IL-6
gene polymorphisms encode significant risk for the development of recurrent
aphthous stomatitis (RAS). Genes Immun. 3:302-305.
20. Bazrafshani, M.R., Hajeer, A.H., Ollier, W.E., Thornhill, M.H. (2002b) Recurrent
aphthous stomatitis and gene polymorphisms for the inflammatory markers TNF-
alpha, TNF-beta and the vitamin D receptor: no association detected. Oral Dis.
8:303-307.
21. Bazrafshani, M.R., Hajeer, A.H., Ollier, W.E., Thornhill, M.H. (2003) Polymorphisms
in the IL-10 and IL-12 gene cluster and risk of developing recurrent aphthous
stomatitis. Oral Dis. 9:287-291.
22. Bellivier, F., Henry, C., Szoke, A., Schurhoff, F., Nosten-Bertrand, M., Feingold, J.,
Launay, J.M., Leboyer, M., Laplanche, J.L. (1998) Serotonin transporter gene
polymorphisms in patients with unipolar or bipolar depression. Neurosci. Lett.
255:143-146.
23. Bellivier, F., Szoke, A., Henry, C., Lacoste, J., Bottos, C., Nosten-Bertrand, M.,
Hardy, P., Rouillon, F., Launay, J.M., Laplanche, J.L., Leboyer, M. (2000) Possible
association between serotonin transporter gene polymorphism and violent suicidal
behavior in mood disorders. Biol. Psychiatry 48:319-322.
Guimarães AL 62
24. Bergdahl, M., Bergdahl, J. (1999) Burning mouth syndrome: prevalence and
associated factors. J. Oral Pathol. Med. 28:350-354.
25. Birek, C., Grandhi, R., McNeill, K., Singer, D., Ficarra, G., Bowden, G. (1999)
Detection of Helicobacter pylori in oral aphthous ulcers. J. Oral Pathol. Med.
28:197-203.
26. Bondy, B., Erfurth, A., de, J.S., Kruger, M., Meyer, H. (2000) Possible association of
the short allele of the serotonin transporter promoter gene polymorphism (5-
HTTLPR) with violent suicide. Mol. Psychiatry 5:193-195.
27. Boom, R., Sol, C.J., Salimans, M.M., Jansen, C.L., Wertheim-van Dillen, P.M., van
der, N.J. (1990) Rapid and simple method for purification of nucleic acids. J. Clin.
Microbiol. 28:495-503.
28. Borra, R.C., Andrade, P.M., Silva, I.D., Morgun, A., Weckx, L.L., Smirnova, A.S.,
Franco, M. (2004) The Th1 /Th2 immune-type response of the recurrent aphthous
ulceration analyzed by cDNA microarray. J. Oral Pathol. Med. 33:140-146.
29. Botstein, D., White, R.L., Skolnick, M., Davis, R.W. (1980) Construction of a genetic
linkage map in man using restriction fragment length polymorphisms. Am. J. Hum.
Genet. 32:314-331.
30. Brambilla, F., Monteleone, P., Maj, M. (2004) Interleukin-1beta and tumor necrosis
factor-alpha in children with major depressive disorder or dysthymia. J. Affect.
Disord. 78:273-277.
Referências Bibliográficas 63
31. Brooke, R.I., Seganski, D.P. (1977) Etiology and investigation of the sore mouth.
Dent. J. 43:504-506.
32. Browning, S., Hislop, S., Scully, C., Shirlaw, P. (1987) The association between
burning mouth syndrome and psychosocial disorders. Oral Surg. Oral Med. Oral
Pathol. 64:171-174.
33. Brozovic, S., Vucicevic-Boras, V., Mravak-Stipetic, M., Jukic, S., Kleinheinz, J.,
Lukac, J. (2002) Salivary levels of vascular endothelial growth factor (VEGF) in
recurrent aphthous ulceration. J. Oral Pathol. Med. 31:106-108.
34. Brydon, L., Edwards, S., Jia, H., Mohamed-Ali, V., Zachary, I., Martin, J.F., Steptoe,
A. (2005) Psychological stress activates interleukin-1beta gene expression in
human mononuclear cells. Brain Behav. Immun. 19:540-546.
35. Buno, I.J., Huff, J.C., Weston, W.L., Cook, D.T., Brice, S.L. (1998) Elevated levels
of interferon gamma, tumor necrosis factor alpha, interleukins 2, 4, and 5, but not
interleukin 10, are present in recurrent aphthous stomatitis. Arch. Dermatol.
134:827-831.
36. Chan, H.L., Tse, A.M., Zhang, M.D., Wong, V.W., Chim, A.M., Hui, A.Y., Sung, J.J.
(2006) Genetic polymorphisms of interleukin-1-beta in association with sustained
response to anti-viral treatment in chronic hepatitis B in Chinese. Aliment.
Pharmacol. Ther. 23:1703-1711.
Guimarães AL 64
37. Chen, Q., Samaranayake, L.P. (2000) Growth of the fungal pathogen Candida in
parotid saliva of patients with burning mouth syndrome. Microbios 102:45-52.
38. Courtet, P., Baud, P., Abbar, M., Boulenger, J.P., Castelnau, D., Mouthon, D.,
Malafosse, A., Buresi, C. (2001) Association between violent suicidal behavior and
the low activity allele of the serotonin transporter gene. Mol. Psychiatry 6:338-341.
39. Cox, A., Camp, N.J., Cannings, C., di Giovine, F.S., Dale, M., Worthington, J., John,
S., Ollier, W.E., Silman, A.J., Duff, G.W. (1999) Combined sib-TDT and TDT
provide evidence for linkage of the interleukin-1 gene cluster to erosive rheumatoid
arthritis. Hum. Mol. Genet. 8:1707-1713.
40. Crowl, R.M., Stoller, T.J., Conroy, R.R., Stoner, C.R. (1991) Induction of
phospholipase A2 gene expression in human hepatoma cells by mediators of the
acute phase response. J. Biol. Chem. 266:2647-2651.
41. D'Andrea, A., ste-Amezaga, M., Valiante, N.M., Ma, X., Kubin, M., Trinchieri, G.
(1993) Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-
production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in
accessory cells. J. Exp. Med. 178:1041-1048.
42. Dagia, N.M., Goetz, D.J. (2003) A proteasome inhibitor reduces concurrent,
sequential, and long-term IL-1 beta- and TNF-alpha-induced ECAM expression and
adhesion. Am. J. Physiol Cell Physiol 285:C813-C822.
Referências Bibliográficas 65
43. Daneshpazhooh, M., Moslehi, H., Akhyani, M., Etesami, M. (2004) Tongue lesions
in psoriasis: a controlled study. BMC. Dermatol. 4:16-
44. de Waal, M.R., Yssel, H., Roncarolo, M.G., Spits, H., de Vries, J.E. (1992)
Interleukin-10. Curr. Opin. Immunol. 4:314-320.
45. den Dunnen, J.T., Antonarakis, S.E. (2001) Nomenclature for the description of
human sequence variations. Hum. Genet. 109:121-124.
46. di Giovine, F.S., Duff, G.W. (1990) Interleukin 1: the first interleukin. Immunol.
Today 11:13-20.
47. Dinarello, C.A. (1989) Interleukin-1 and its biologically related cytokines. Adv.
Immunol. 44:153-205.
48. Dinarello, C.A. (2000) Proinflammatory cytokines. Chest 118:503-508.
49. Dinarello, C.A. (1997) Blocking interleukin-1 and tumor necrosis factor in disease.
Eur. Cytokine Netw. 8:294-296.
50. Dolby, A.E. (1969) Recurrent aphthous ulceration. Effect of sera and peripheral
blood lymphocytes upon oral epithelial tissue culture cells. Immunology 17:709-714.
51. Dominici, R., Malferrari, G., Mariani, C., Grimaldi, L., Biunno, I. (2002) The
Interleukin 1-beta exonic (+3953) polymorphism does not alter in vitro protein
secretion. Exp. Mol. Pathol. 73:139-141.
Guimarães AL 66
52. Du, L., Faludi, G., Palkovits, M., Demeter, E., Bakish, D., Lapierre, Y.D., Sotonyi,
P., Hrdina, P.D. (1999) Frequency of long allele in serotonin transporter gene is
increased in depressed suicide victims. Biol. Psychiatry 46:196-201.
53. Eidelman, E., Chosack, A., Cohen, T. (1976) Scrotal tongue and geographic
tongue: polygenic and associated traits. Oral Surg. Oral Med. Oral Pathol. 42:591-
596.
54. Eli, I., Kleinhauz, M., Baht, R., Littner, M. (1994) Antecedents of burning mouth
syndrome (glossodynia)--recent life events vs. psychopathologic aspects. J. Dent.
Res. 73:567-572.
55. Endres, S., Cannon, J.G., Ghorbani, R., Dempsey, R.A., Sisson, S.D., Lonnemann,
G., van der Meer, J.W., Wolff, S.M., Dinarello, C.A. (1989) In vitro production of IL 1
beta, IL 1 alpha, TNF and IL2 in healthy subjects: distribution, effect of
cyclooxygenase inhibition and evidence of independent gene regulation. Eur. J.
Immunol. 19:2327-2333.
56. Eskdale, J., McNicholl, J., Wordsworth, P., Jonas, B., Huizinga, T., Field, M.,
Gallagher, G. (1998) Interleukin-10 microsatellite polymorphisms and IL-10 locus
alleles in rheumatoid arthritis susceptibility. Lancet 352:1282-1283.
57. Eversole, L.R., Shopper, T.P., Chambers, D.W. (1982) Effects of suspected
foodstuff challenging agents in the etiology of recurrent aphthous stomatitis. Oral
Surg. Oral Med. Oral Pathol. 54:33-38.
Referências Bibliográficas 67
58. Faccini, J.M. (1968) Oral manifestations of vitamin B12 deficiency. Br. J. Oral Surg.
6:137-140.
59. Fattori, E., Cappelletti, M., Costa, P., Sellitto, C., Cantoni, L., Carelli, M., Faggioni,
R., Fantuzzi, G., Ghezzi, P., Poli, V. (1994) Defective inflammatory response in
interleukin 6-deficient mice. J. Exp. Med. 180:1243-1250.
60. Ferreira, S.H., Lorenzetti, B.B., Bristow, A.F., Poole, S. (1988) Interleukin-1 beta as
a potent hyperalgesic agent antagonized by a tripeptide analogue. Nature 334:698-
700.
61. Figueredo, C.M., Ribeiro, M.S., Fischer, R.G., Gustafsson, A. (1999) Increased
interleukin-1beta concentration in gingival crevicular fluid as a characteristic of
periodontitis. J. Periodontol. 70:1457-1463.
62. Fishman, D., Faulds, G., Jeffery, R., Mohamed-Ali, V., Yudkin, J.S., Humphries, S.,
Woo, P. (1998) The effect of novel polymorphisms in the interleukin-6 (IL-6) gene
on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset
juvenile chronic arthritis. J. Clin. Invest 102:1369-1376.
63. Forssell, H., Jaaskelainen, S., Tenovuo, O., Hinkka, S. (2002) Sensory dysfunction
in burning mouth syndrome. Pain 99:41-47.
64. Gall-Troselj, K., Mravak-Stipetic, M., Jurak, I., Ragland, W.L., Pavelic, J. (2001)
Helicobacter pylori colonization of tongue mucosa--increased incidence in atrophic
glossitis and burning mouth syndrome (BMS). J. Oral Pathol. Med. 30:560-563.
Guimarães AL 68
65. Gao, S., Wang, Y., Wang, Z. (2000) Assessment of trigeminal somatosensory
evoked potentials in burning mouth syndrome. Chin J. Dent. Res. 3:40-46.
66. Gelernter, J., Pakstis, A.J., Kidd, K.K. (1995) Linkage mapping of serotonin
transporter protein gene SLC6A4 on chromosome 17. Hum. Genet. 95:677-680.
67. Gorsky, M., Silverman S Jr, Chinn, H. (1991) Clinical characteristics and
management outcome in the burning mouth syndrome. An open study of 130
patients. Oral Surg. Oral Med. Oral Pathol. 72:192-195.
68. Gorsky, M., Silverman S Jr, Chinn, H. (1987) Burning mouth syndrome: a review of
98 cases. J. Oral Med. 42:7-9.
69. Grattan, C.E., Scully, C. (1986) Oral ulceration: a diagnostic problem. Br. Med. J.
(Clin. Res. Ed) 292:1093-1094.
70. Graykowski, E.A., Barile, M.F., Lee, W.B., Stanley, H.R., Jr. (1966) Recurrent
aphthous stomatitis. Clinical, therapeutic, histopathologic, and hypersensitivity
aspects. JAMA 196:637-644.
71. Greenberg, B.D., Li, Q., Lucas, F.R., Hu, S., Sirota, L.A., Benjamin, J., Lesch, K.P.,
Hamer, D., Murphy, D.L. (2000) Association between the serotonin transporter
promoter polymorphism and personality traits in a primarily female population
sample. Am. J. Med. Genet. 96:202-216.
Referências Bibliográficas 69
72. Greenberg, B.D., Tolliver, T.J., Huang, S.J., Li, Q., Bengel, D., Murphy, D.L. (1999)
Genetic variation in the serotonin transporter promoter region affects serotonin
uptake in human blood platelets. Am. J. Med. Genet. 88:83-87.
73. Greer, R.O., Jr., Lindenmuth, J.E., Juarez, T., Khandwala, A. (1993) A double-blind
study of topically applied 5% amlexanox in the treatment of aphthous ulcers. J. Oral
Maxillofac. Surg. 51:243-248.
74. Grosshans, E., Gerber, F. (1983) [Kinetics of lesions in geographic tongue]. Ann.
Dermatol. Venereol. 110:1037-1040.
75. Grossman, R.M., Krueger, J., Yourish, D., Granelli-Piperno, A., Murphy, D.P., May,
L.T., Kupper, T.S., Sehgal, P.B., Gottlieb, A.B. (1989) Interleukin 6 is expressed in
high levels in psoriatic skin and stimulates proliferation of cultured human
keratinocytes. Proc. Natl. Acad. Sci. U. S. A 86:6367-6371.
76. Grushka, M. (1983) Burning mouth: a review and update. Ont. Dent. 60:56-7, 59,
61.
77. Grushka, M., Epstein, J., Mott, A. (1998) An open-label, dose escalation pilot study
of the effect of clonazepam in burning mouth syndrome. Oral Surg. Oral Med. Oral
Pathol. Oral Radiol. Endod. 86:557-561.
78. Grushka, M., Sessle, B.J. (1991) Burning mouth syndrome. Dent. Clin. North Am.
35:171-184.
Guimarães AL 70
79. Grushka, M., Sessle, B.J., Miller, R. (1987) Pain and personality profiles in burning
mouth syndrome. Pain 28:155-167.
80. Guimarães AL, de Sá AR, Victória JM, Correa-Silva JF, Pessoa PS, Diniz MG,
Gomez RS (2006a) Association of IL-1 beta polymorphism with RAS in Brazilian
individuals. Oral Diseases in press:
81. Guimarães AL, de Sa, A.R., Victoria, J.M., Correa-Silva JF, Gomez MV, Gomez RS
(2006b) Interleukin-1 B and serotonin transporter gene polymorphisms in Burning
Mouth Syndrome patients. Journal of Pain In press:
82. Hagelberg, N., Forssell, H., Rinne, J.O., Scheinin, H., Taiminen, T., Aalto, S.,
Luutonen, S., Nagren, K., Jaaskelainen, S. (2003) Striatal dopamine D1 and D2
receptors in burning mouth syndrome. Pain 101:149-154.
83. Hakeberg, M., Berggren, U., Hagglin, C., Ahlqwist, M. (1997) Reported burning
mouth symptoms among middle-aged and elderly women. Eur. J. Oral Sci.
105:539-543.
84. Hart, T.C., Kornman, K.S. (1997) Genetic factors in the pathogenesis of
periodontitis. Periodontol. 2000. 14:202-215.
85. Hasan, A., Childerstone, A., Pervin, K., Shinnick, T., Mizushima, Y., Van der, Z.R.,
Vaughan, R., Lehner, T. (1995) Recognition of a unique peptide epitope of the
mycobacterial and human heat shock protein 65-60 antigen by T cells of patients
with recurrent oral ulcers. Clin. Exp. Immunol. 99:392-397.
Referências Bibliográficas 71
86. Healy, C.M., Enobakhare, B., Haskard, D.O., Thornhill, M.H. (1997) Raised levels of
circulating VCAM-1 and circulating E-selectin in patients with recurrent oral
ulceration. J. Oral Pathol. Med. 26:23-28.
87. Heckmann, S.M., Heckmann, J.G., HiIz, M.J., Popp, M., Marthol, H., Neundorfer,
B., Hummel, T. (2001) Oral mucosal blood flow in patients with burning mouth
syndrome. Pain 90:281-286.
88. Heils, A., Teufel, A., Petri, S., Seemann, M., Bengel, D., Balling, U., Riederer, P.,
Lesch, K.P. (1995) Functional promoter and polyadenylation site mapping of the
human serotonin (5-HT) transporter gene. J. Neural Transm. Gen. Sect. 102:247-
254.
89. Heils, A., Teufel, A., Petri, S., Stober, G., Riederer, P., Bengel, D., Lesch, K.P.
(1996) Allelic variation of human serotonin transporter gene expression. J.
Neurochem. 66:2621-2624.
90. Hirano, T., Matsuda, T., Turner, M., Miyasaka, N., Buchan, G., Tang, B., Sato, K.,
Shimizu, M., Maini, R., Feldmann, M., . (1988) Excessive production of interleukin
6/B cell stimulatory factor-2 in rheumatoid arthritis. Eur. J. Immunol. 18:1797-1801.
91. Hopkins, S.J. (2003) The pathophysiological role of cytokines. Leg. Med. (Tokyo) 5
Suppl 1:S45-S57.
Guimarães AL 72
92. Hurme, M., Lahdenpohja, N., Santtila, S. (1998) Gene polymorphisms of
interleukins 1 and 10 in infectious and autoimmune diseases. Ann. Med. 30:469-
473.
93. Jaaskelainen, S.K., Forssell, H., Tenovuo, O. (1997) Abnormalities of the blink
reflex in burning mouth syndrome. Pain 73:455-460.
94. Jilka, R.L., Hangoc, G., Girasole, G., Passeri, G., Williams, D.C., Abrams, J.S.,
Boyce, B., Broxmeyer, H., Manolagas, S.C. (1992) Increased osteoclast
development after estrogen loss: mediation by interleukin-6. Science 257:88-91.
95. Jordan, M., Otterness, I.G., Ng, R., Gessner, A., Rollinghoff, M., Beuscher, H.U.
(1995) Neutralization of endogenous IL-6 suppresses induction of IL-1 receptor
antagonist. J. Immunol. 154:4081-4090.
96. Jurge, S., Kuffer, R., Scully, C., Porter, S.R. (2006) Number VI recurrent aphthous
stomatitis. Oral Dis. 12:1-21.
97. Kerr, A.R., Ship, J.A. (2003) Management strategies for HIV-associated aphthous
stomatitis. Am. J. Clin. Dermatol. 4:669-680.
98. Kishimoto, T. (1989) The biology of interleukin-6. Blood 74:1-10.
99. Kopf, M., Baumann, H., Freer, G., Freudenberg, M., Lamers, M., Kishimoto, T.,
Zinkernagel, R., Bluethmann, H., Kohler, G. (1994) Impaired immune and acute-
phase responses in interleukin-6-deficient mice. Nature 368:339-342.
Referências Bibliográficas 73
100. Kornman, K.S., Crane, A., Wang, H.Y., di Giovine, F.S., Newman, M.G., Pirk, F.W.,
Wilson, T.G., Jr., Higginbottom, F.L., Duff, G.W. (1997) The interleukin-1 genotype
as a severity factor in adult periodontal disease. J. Clin. Periodontol. 24:72-77.
101. Kube, D., Platzer, C., von, K.A., Straub, H., Bohlen, H., Hafner, M., Tesch, H.
(1995) Isolation of the human interleukin 10 promoter. Characterization of the
promoter activity in Burkitt's lymphoma cell lines. Cytokine 7:1-7.
102. Kullaa-Mikkonen, A., Mikkonen, M., Kotilainen, R. (1982) Prevalence of different
morphologic forms of the human tongue in young Finns. Oral Surg. Oral Med. Oral
Pathol. 53:152-156.
103. Kupper, T.S. (1990) Immune and inflammatory processes in cutaneous tissues.
Mechanisms and speculations. J. Clin. Invest 86:1783-1789.
104. Lamb, A.B., Lamey, P.J., Reeve, P.E. (1988) Burning mouth syndrome:
psychological aspects. Br. Dent. J. 165:256-260.
105. Lamey, P.J., Lamb, A.B. (1989) The usefulness of the HAD scale in assessing
anxiety and depression in patients with burning mouth syndrome. Oral Surg. Oral
Med. Oral Pathol. 67:390-392.
106. Lang, N.P., Tonetti, M.S., Suter, J., Sorrell, J., Duff, G.W., Kornman, K.S. (2000)
Effect of interleukin-1 gene polymorphisms on gingival inflammation assessed by
bleeding on probing in a periodontal maintenance population. J. Periodontal Res.
35:102-107.
Guimarães AL 74
107. Lauria, G., Majorana, A., Borgna, M., Lombardi, R., Penza, P., Padovani, A.,
Sapelli, P. (2005) Trigeminal small-fiber sensory neuropathy causes burning mouth
syndrome. Pain 115:332-337.
108. Lehman, C.D., Bartoshuk, L.M., Catalanotto, F.C., Kveton, J.F., Lowlicht, R.A.
(1995) Effect of anesthesia of the chorda tympani nerve on taste perception in
humans. Physiol Behav. 57:943-951.
109. Leonard, W.J., O'Shea, J.J. (1998) Jaks and STATs: biological implications. Annu.
Rev. Immunol. 16:293-322.
110. Lesch, K.P., Balling, U., Gross, J., Strauss, K., Wolozin, B.L., Murphy, D.L.,
Riederer, P. (1994) Organization of the human serotonin transporter gene. J. Neural
Transm. Gen. Sect. 95:157-162.
111. Lesch, K.P., Bengel, D., Heils, A., Sabol, S.Z., Greenberg, B.D., Petri, S., Benjamin,
J., Muller, C.R., Hamer, D.H., Murphy, D.L. (1996) Association of anxiety-related
traits with a polymorphism in the serotonin transporter gene regulatory region.
Science 274:1527-1531.
112. Lewkowicz, N., Lewkowicz, P., Banasik, M., Kurnatowska, A., Tchorzewski, H.
(2005) Predominance of Type 1 cytokines and decreased number of
CD4(+)CD25(+high) T regulatory cells in peripheral blood of patients with recurrent
aphthous ulcerations. Immunol. Lett. 99:57-62.
Referências Bibliográficas 75
113. Lewkowicz, N., Lewkowicz, P., Kurnatowska, A., Banasik, M., Glowacka, E.,
Cedzynski, M., Swierzko, A., Lauk-Puchala, B., Tchorzewski, H. (2003) Innate
immune system is implicated in recurrent aphthous ulcer pathogenesis. J. Oral
Pathol. Med. 32:475-481.
114. Licastro, F., Veglia, F., Chiappelli, M., Grimaldi, L.M., Masliah, E. (2004) A
polymorphism of the interleukin-1 beta gene at position +3953 influences
progression and neuro-pathological hallmarks of Alzheimer's disease. Neurobiol.
Aging 25:1017-1022.
115. Lin, S.S., Chou, M.Y., Ho, C.C., Kao, C.T., Tsai, C.H., Wang, L., Yang, C.C. (2005)
Study of the viral infections and cytokines associated with recurrent aphthous
ulceration. Microbes. Infect. 7:635-644.
116. Lipton, J.A., Ship, J.A., Larach-Robinson, D. (1993) Estimated prevalence and
distribution of reported orofacial pain in the United States. J. Am. Dent. Assoc.
124:115-121.
117. Littlewood, A.J., Russell, J., Harvey, G.R., Hughes, D.E., Russell, R.G., Gowen, M.
(1991) The modulation of the expression of IL-6 and its receptor in human
osteoblasts in vitro. Endocrinology 129:1513-1520.
118. Macatonia, S.E., Doherty, T.M., Knight, S.C., O'Garra, A. (1993) Differential effect
of IL-10 on dendritic cell-induced T cell proliferation and IFN-gamma production. J.
Immunol. 150:3755-3765.
Guimarães AL 76
119. Maes, M., Bosmans, E., Suy, E., Minner, B., Raus, J. (1991a) A further exploration
of the relationships between immune parameters and the HPA-axis activity in
depressed patients. Psychol. Med. 21:313-320.
120. Maes, M., Bosmans, E., Suy, E., Vandervorst, C., DeJonckheere, C., Raus, J.
(1991b) Depression-related disturbances in mitogen-induced lymphocyte responses
and interleukin-1 beta and soluble interleukin-2 receptor production. Acta Psychiatr.
Scand. 84:379-386.
121. Maina, G., Vitalucci, A., Gandolfo, S., Bogetto, F. (2002) Comparative efficacy of
SSRIs and amisulpride in burning mouth syndrome: a single-blind study. J. Clin.
Psychiatry 63:38-43.
122. Marks, R., Czarny, D. (1984) Geographic tongue: sensitivity to the environment.
Oral Surg. Oral Med. Oral Pathol. 58:156-159.
123. McCartan, B.E., Lamey, P.J., Wallace, A.M. (1996a) Salivary cortisol and anxiety in
recurrent aphthous stomatitis. J. Oral Pathol. Med. 25:357-359.
124. McCartan, B.E., Lamey, P.J., Wallace, A.M. (1996b) Salivary cortisol and anxiety in
recurrent aphthous stomatitis. J. Oral Pathol. Med. 25:357-359.
125. McNally, G.P. (1999) Pain facilitatory circuits in the mammalian central nervous
system: their behavioral significance and role in morphine analgesic tolerance.
Neurosci. Biobehav. Rev. 23:1059-1078.
Referências Bibliográficas 77
126. McQuay, H.J., Tramer, M., Nye, B.A., Carroll, D., Wiffen, P.J., Moore, R.A. (1996) A
systematic review of antidepressants in neuropathic pain. Pain 68:217-227.
127. Mehrian, R., Quismorio, F.P., Jr., Strassmann, G., Stimmler, M.M., Horwitz, D.A.,
Kitridou, R.C., Gauderman, W.J., Morrison, J., Brautbar, C., Jacob, C.O. (1998)
Synergistic effect between IL-10 and bcl-2 genotypes in determining susceptibility to
systemic lupus erythematosus. Arthritis Rheum. 41:596-602.
128. Merriman, C.R., Pulliam, L.A., Kampschmidt, R.F. (1977) Comparison of leukocytic
pyrogen and leukocytic endogenous mediator. Proc. Soc. Exp. Biol. Med. 154:224-
227.
129. Mignogna, M.D., Fedele, S., Lo, R.L., Leuci, S., Lo, M.L. (2005) The diagnosis of
burning mouth syndrome represents a challenge for clinicians. J. Orofac. Pain
19:168-173.
130. Millan, M.J. (2003) The neurobiology and control of anxious states. Prog. Neurobiol.
70:83-244.
131. Miller, M.C., Mohrenweiser, H.W., Bell, D.A. (2001) Genetic variability in
susceptibility and response to toxicants. Toxicol. Lett. 120:269-280.
132. Miller, M.F., Ship, I.I. (1977) A retrospective study of the prevalence and incidence
of recurrent aphthous ulcers in a professional population, 1958-1971. Oral Surg.
Oral Med. Oral Pathol. 43:532-537.
Guimarães AL 78
133. Molvig, J., Baek, L., Christensen, P., Manogue, K.R., Vlassara, H., Platz, P.,
Nielsen, L.S., Svejgaard, A., Nerup, J. (1988) Endotoxin-stimulated human
monocyte secretion of interleukin 1, tumour necrosis factor alpha, and prostaglandin
E2 shows stable interindividual differences. Scand. J. Immunol. 27:705-716.
134. Moore, K.W., O'Garra, A., de Waal, M.R., Vieira, P., Mosmann, T.R. (1993)
Interleukin-10. Annu. Rev. Immunol. 11:165-190.
135. Moreira, P.R., de Sa, A.R., Xavier, G.M., Costa, J.E., Gomez, R.S., Gollob, K.J.,
Dutra, W.O. (2005) A functional interleukin-1 beta gene polymorphism is associated
with chronic periodontitis in a sample of Brazilian individuals. J. Periodontal Res.
40:306-311.
136. Moretti, T.R., Baumstark, A.L., Defenbaugh, D.A., Keys, K.M., Smerick, J.B.,
Budowle, B. (2001) Validation of short tandem repeats (STRs) for forensic usage:
performance testing of fluorescent multiplex STR systems and analysis of authentic
and simulated forensic samples. J. Forensic Sci. 46:647-660.
137. Morris, L.F., Phillips, C.M., Binnie, W.H., Sander, H.M., Silverman, A.K., Menter,
M.A. (1992) Oral lesions in patients with psoriasis: a controlled study. Cutis 49:339-
344.
138. Natah, S.S., Hayrinen-Immonen, R., Hietanen, J., Malmstrom, M., Konttinen, Y.T.
(2000) Immunolocalization of tumor necrosis factor-alpha expressing cells in
recurrent aphthous ulcer lesions (RAU). J. Oral Pathol. Med. 29:19-25.
Referências Bibliográficas 79
139. Natah, S.S., Konttinen, Y.T., Enattah, N.S., Ashammakhi, N., Sharkey, K.A.,
Hayrinen-Immonen, R. (2004) Recurrent aphthous ulcers today: a review of the
growing knowledge. Int. J. Oral Maxillofac. Surg. 33:221-234.
140. Nicklin, M.J., Weith, A., Duff, G.W. (1994) A physical map of the region
encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1
receptor antagonist genes. Genomics 19:382-384.
141. Nolan, A., Lamey, P.J., Milligan, K.A., Forsyth, A. (1991) Recurrent aphthous
ulceration and food sensitivity. J. Oral Pathol. Med. 20:473-475.
142. Obuchowicz, E., Kowalski, J., Labuzek, K., Krysiak, R., Pendzich, J., Herman, Z.S.
(2005) Amitriptyline and nortriptyline inhibit interleukin-1beta and tumour necrosis
factor-alpha release by rat mixed glial and microglial cell cultures. Int. J.
Neuropsychopharmacol. 1-9.
143. Ogilvie, A.D., Battersby, S., Bubb, V.J., Fink, G., Harmar, A.J., Goodwim, G.M.,
Smith, C.A. (1996) Polymorphism in serotonin transporter gene associated with
susceptibility to major depression. Lancet 347:731-733.
144. Oka, T., Aou, S., Hori, T. (1993) Intracerebroventricular injection of interleukin-1
beta induces hyperalgesia in rats. Brain Res. 624:61-68.
145. Opree, A., Kress, M. (2000) Involvement of the proinflammatory cytokines tumor
necrosis factor-alpha, IL-1 beta, and IL-6 but not IL-8 in the development of heat
Guimarães AL 80
hyperalgesia: effects on heat-evoked calcitonin gene-related peptide release from
rat skin. J. Neurosci. 20:6289-6293.
146. Papassotiropoulos, A., Bagli, M., Jessen, F., Bayer, T.A., Maier, W., Rao, M.L.,
Heun, R. (1999) A genetic variation of the inflammatory cytokine interleukin-6
delays the initial onset and reduces the risk for sporadic Alzheimer's disease. Ann.
Neurol. 45:666-668.
147. Parkhill, J.M., Hennig, B.J., Chapple, I.L., Heasman, P.A., Taylor, J.J. (2000)
Association of interleukin-1 gene polymorphisms with early-onset periodontitis. J.
Clin. Periodontol. 27:682-689.
148. Parra, F.C., Amado, R.C., Lambertucci, J.R., Rocha, J., Antunes, C.M., Pena, S.D.
(2003) Color and genomic ancestry in Brazilians. Proc. Natl. Acad. Sci. U. S. A
100:177-182.
149. Petruzzi, M., Lauritano, D., De, B.M., Baldoni, M., Serpico, R. (2004) Systemic
capsaicin for burning mouth syndrome: short-term results of a pilot study. J. Oral
Pathol. Med. 33:111-114.
150. Plauth, M., Jenss, H., Meyle, J. (1991) Oral manifestations of Crohn's disease. An
analysis of 79 cases. J. Clin. Gastroenterol. 13:29-37.
151. Pociot, F., Molvig, J., Wogensen, L., Worsaae, H., Nerup, J. (1992) A TaqI
polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1
beta secretion in vitro. Eur. J. Clin. Invest 22:396-402.
Referências Bibliográficas 81
152. Pokupec-Gruden, J.S., Cekic-Arambasin, A., Gruden, V. (2000) Psychogenic
factors in the aetiology of stomatopyrosis. Coll. Antropol. 24 Suppl 1:119-126.
153. Poli, V., Balena, R., Fattori, E., Markatos, A., Yamamoto, M., Tanaka, H., Ciliberto,
G., Rodan, G.A., Costantini, F. (1994) Interleukin-6 deficient mice are protected
from bone loss caused by estrogen depletion. EMBO J. 13:1189-1196.
154. Porter, S.R., Scully, C., Pedersen, A. (1998) Recurrent aphthous stomatitis. Crit
Rev. Oral Biol. Med. 9:306-321.
155. Preuss, U.W., Soyka, M., Bahlmann, M., Wenzel, K., Behrens, S., de, J.S., Kruger,
M., Bondy, B. (2000) Serotonin transporter gene regulatory region polymorphism (5-
HTTLPR), [3H]paroxetine binding in healthy control subjects and alcohol-dependent
patients and their relationships to impulsivity. Psychiatry Res. 96:51-61.
156. Ramamoorthy, S., Bauman, A.L., Moore, K.R., Han, H., Yang-Feng, T., Chang,
A.S., Ganapathy, V., Blakely, R.D. (1993b) Antidepressant- and cocaine-sensitive
human serotonin transporter: molecular cloning, expression, and chromosomal
localization. Proc. Natl. Acad. Sci. U. S. A 90:2542-2546.
157. Ramamoorthy, S., Bauman, A.L., Moore, K.R., Han, H., Yang-Feng, T., Chang,
A.S., Ganapathy, V., Blakely, R.D. (1993a) Antidepressant- and cocaine-sensitive
human serotonin transporter: molecular cloning, expression, and chromosomal
localization. Proc. Natl. Acad. Sci. U. S. A 90:2542-2546.
Guimarães AL 82
158. Ramsay, A.J., Husband, A.J., Ramshaw, I.A., Bao, S., Matthaei, K.I., Koehler, G.,
Kopf, M. (1994) The role of interleukin-6 in mucosal IgA antibody responses in vivo.
Science 264:561-563.
159. Ray, A., LaForge, K.S., Sehgal, P.B. (1990) On the mechanism for efficient
repression of the interleukin-6 promoter by glucocorticoids: enhancer, TATA box,
and RNA start site (Inr motif) occlusion. Mol. Cell Biol. 10:5736-5746.
160. Redman, R.S. (1970) Prevalence of geographic tongue, fissured tongue, median
rhomboid glossitis, and hairy tongue among 3,611 Minnesota schoolchildren. Oral
Surg. Oral Med. Oral Pathol. 30:390-395.
161. Rogers, R.S. (1997) Recurrent aphthous stomatitis in the diagnosis of Behcet's
disease. Yonsei Med. J. 38:370-379.
162. Rojo, L., Silvestre, F.J., Bagan, J.V., De, V.T. (1993) Psychiatric morbidity in
burning mouth syndrome. Psychiatric interview versus depression and anxiety
scales. Oral Surg. Oral Med. Oral Pathol. 75:308-311.
163. Rosa, A., Peralta, V., Papiol, S., Cuesta, M.J., Serrano, F., Martinez-Larrea, A.,
Fananas, L. (2004) Interleukin-1beta (IL-1beta) gene and increased risk for the
depressive symptom-dimension in schizophrenia spectrum disorders. Am. J. Med.
Genet. B Neuropsychiatr. Genet. 124:10-14.
164. Roux, J., Kawakatsu, H., Gartland, B., Pespeni, M., Sheppard, D., Matthay, M.A.,
Canessa, C.M., Pittet, J.F. (2005) Interleukin-1beta decreases expression of the
Referências Bibliográficas 83
epithelial sodium channel alpha-subunit in alveolar epithelial cells via a p38 MAPK-
dependent signaling pathway. J. Biol. Chem. 280:18579-18589.
165. Russ, M.J., Lachman, H.M., Kashdan, T., Saito, T., Bajmakovic-Kacila, S. (2000)
Analysis of catechol-O-methyltransferase and 5-hydroxytryptamine transporter
polymorphisms in patients at risk for suicide. Psychiatry Res. 93:73-78.
166. Sankaran, D., Asderakis, A., Ashraf, S., Roberts, I.S., Short, C.D., Dyer, P.A.,
Sinnott, P.J., Hutchinson, I.V. (1999) Cytokine gene polymorphisms predict acute
graft rejection following renal transplantation. Kidney Int. 56:281-288.
167. Sato, T., Ito, A., Mori, Y. (1990) Interleukin 6 enhances the production of tissue
inhibitor of metalloproteinases (TIMP) but not that of matrix metalloproteinases by
human fibroblasts. Biochem. Biophys. Res. Commun. 170:824-829.
168. Scala, A., Checchi, L., Montevecchi, M., Marini, I., Giamberardino, M.A. (2003)
Update on burning mouth syndrome: overview and patient management. Crit Rev.
Oral Biol. Med. 14:275-291.
169. SCHINDLER, H. (1952) [Contents of therapeutic plants and examination methods
for tinctures: belladonna.]. Arzneimittelforschung. 2:40-44.
170. Schulte, T., Schols, L., Muller, T., Woitalla, D., Berger, K., Kruger, R. (2002)
Polymorphisms in the interleukin-1 alpha and beta genes and the risk for
Parkinson's disease. Neurosci. Lett. 326:70-72.
Guimarães AL 84
171. Scully, C., Porter, S. (1989) Recurrent aphthous stomatitis: current concepts of
etiology, pathogenesis and management. J. Oral Pathol. Med. 18:21-27.
172. Sehgal, P.B., May, L.T., Tamm, I., Vilcek, J. (1987) Human beta 2 interferon and B-
cell differentiation factor BSF-2 are identical. Science 235:731-732.
173. Serretti, A., Lilli, R., Smeraldi, E. (2002) Pharmacogenetics in affective disorders.
Eur. J. Pharmacol. 438:117-128.
174. Ship, I.I. (1965) Inheritance of aphthous ulcers of the mouth. J. Dent. Res. 44:837-
844.
175. Ship, J.A. (1996) Recurrent aphthous stomatitis. An update. Oral Surg. Oral Med.
Oral Pathol. Oral Radiol. Endod. 81:141-147.
176. Ship, J.A., Chavez, E.M., Doerr, P.A., Henson, B.S., Sarmadi, M. (2000) Recurrent
aphthous stomatitis. Quintessence. Int. 31:95-112.
177. Sigal, M.J., Mock, D. (1992) Symptomatic benign migratory glossitis: report of two
cases and literature review. Pediatr. Dent. 14:392-396.
178. SIRCUS, W., CHURCH, R., KELLEHER, J. (1957) Recurrent aphthous ulceration of
the mouth; a study of the natural history, aetiology, and treatment. Q. J. Med.
26:235-249.
Referências Bibliográficas 85
179. Stanley, H.R. (1972) Aphthous lesions. Oral Surg. Oral Med. Oral Pathol. 33:407-
416.
180. Stuber, F., Petersen, M., Bokelmann, F., Schade, U. (1996) A genomic
polymorphism within the tumor necrosis factor locus influences plasma tumor
necrosis factor-alpha concentrations and outcome of patients with severe sepsis.
Crit Care Med. 24:381-384.
181. Stuber, F., Udalova, I.A., Book, M., Drutskaya, L.N., Kuprash, D.V., Turetskaya,
R.L., Schade, F.U., Nedospasov, S.A. (1995) -308 tumor necrosis factor (TNF)
polymorphism is not associated with survival in severe sepsis and is unrelated to
lipopolysaccharide inducibility of the human TNF promoter. J. Inflamm. 46:42-50.
182. Sun, A., Chia, J.S., Chang, Y.F., Chiang, C.P. (2003) Levamisole and Chinese
medicinal herbs can modulate the serum interleukin-6 level in patients with
recurrent aphthous ulcerations. J. Oral Pathol. Med. 32:206-214.
183. Sun, A., Chia, J.S., Chiang, C.P. (2002) Increased proliferative response of
peripheral blood mononuclear cells and T cells to Streptococcus mutans and
glucosyltransferase D antigens in the exacerbation stage of recurrent aphthous
ulcerations. J. Formos. Med. Assoc. 101:560-566.
184. Svensson, P., Bjerring, P., rendt-Nielsen, L., Kaaber, S. (1993) Sensory and pain
thresholds to orofacial argon laser stimulation in patients with chronic burning
mouth syndrome. Clin. J. Pain 9:207-215.
Guimarães AL 86
185. Taylor, L.J., Bagg, J., Walker, D.M., Peters, T.J. (1992) Increased production of
tumour necrosis factor by peripheral blood leukocytes in patients with recurrent oral
aphthous ulceration. J. Oral Pathol. Med. 21:21-25.
186. Terry, C.F., Loukaci, V., Green, F.R. (2000) Cooperative influence of genetic
polymorphisms on interleukin 6 transcriptional regulation. J. Biol. Chem. 275:18138-
18144.
187. Thomas, H.C., Ferguson, A., McLennan, J.G., Mason, D.K. (1973) Food antibodies
in oral disease: a study of serum antibodies to food proteins in aphthous ulceration
and other oral diseases. J. Clin. Pathol. 26:371-374.
188. Tilg, H., Dinarello, C.A., Mier, J.W. (1997) IL-6 and APPs: anti-inflammatory and
immunosuppressive mediators. Immunol. Today 18:428-432.
189. Tilg, H., Trehu, E., Atkins, M.B., Dinarello, C.A., Mier, J.W. (1994) Interleukin-6 (IL-
6) as an anti-inflammatory cytokine: induction of circulating IL-1 receptor antagonist
and soluble tumor necrosis factor receptor p55. Blood 83:113-118.
190. Trikkas, G., Nikolatou, O., Samara, C., Bazopoulou-Kyrkanidou, E., Rabavilas,
A.D., Christodoulou, G.N. (1996) Glossodynia: personality characteristics and
psychopathology. Psychother. Psychosom. 65:163-168.
191. Turner, D.M., Williams, D.M., Sankaran, D., Lazarus, M., Sinnott, P.J., Hutchinson,
I.V. (1997) An investigation of polymorphism in the interleukin-10 gene promoter.
Eur. J. Immunogenet. 24:1-8.
Referências Bibliográficas 87
192. Van Wyk, J.J. (1992) Remembrances of our founders: will growth factors,
oncogenes, cytokines, and gastrointestinal hormones return us to our beginnings?
Endocrinology 130:3-5.
193. van, D.M., Dofferhoff, A.S., van der Meer, J.W. (1992) Cytokines and the response
to infection. J. Pathol. 168:349-356.
194. Victoria, J.M., Correia-Silva, J.F., Pimenta, F.J., Kalapothakis, E., Gomez, R.S.
(2005) Serotonin transporter gene polymorphism (5-HTTLPR) in patients with
recurrent aphthous stomatitis. J. Oral Pathol. Med. 34:494-497.
195. Victoria, J.M., Kalapothakis, E., Silva, J.F., Gomez, R.S. (2003) Helicobacter pylori
DNA in recurrent aphthous stomatitis. J. Oral Pathol. Med. 32:219-223.
196. Vieira, P., de Waal-Malefyt, R., Dang, M.N., Johnson, K.E., Kastelein, R.,
Fiorentino, D.F., deVries, J.E., Roncarolo, M.G., Mosmann, T.R., Moore, K.W.
(1991) Isolation and expression of human cytokine synthesis inhibitory factor cDNA
clones: homology to Epstein-Barr virus open reading frame BCRFI. Proc. Natl.
Acad. Sci. U. S. A 88:1172-1176.
197. Vincent, S.D., Lilly, G.E. (1992) Clinical, historic, and therapeutic features of
aphthous stomatitis. Literature review and open clinical trial employing steroids.
Oral Surg. Oral Med. Oral Pathol. 74:79-86.
198. Watkins, L.R., Maier, S.F. (2000) The pain of being sick: implications of immune-to-
brain communication for understanding pain. Annu. Rev. Psychol. 51:29-57.
Guimarães AL 88
199. Watkins, L.R., Wiertelak, E.P., Goehler, L.E., Smith, K.P., Martin, D., Maier, S.F.
(1994) Characterization of cytokine-induced hyperalgesia. Brain Res. 654:15-26.
200. Westendorp, R.G., Langermans, J.A., Huizinga, T.W., Verweij, C.L., Sturk, A.
(1997) Genetic influence on cytokine production in meningococcal disease. Lancet
349:1912-1913.
201. Whyte, M., Hubbard, R., Meliconi, R., Whidborne, M., Eaton, V., Bingle, C., Timms,
J., Duff, G., Facchini, A., Pacilli, A., Fabbri, M., Hall, I., Britton, J., Johnston, I., Di,
G.F. (2000) Increased risk of fibrosing alveolitis associated with interleukin-1
receptor antagonist and tumor necrosis factor-alpha gene polymorphisms. Am. J.
Respir. Crit Care Med. 162:755-758.
202. Wilson, A.G., Symons, J.A., McDowell, T.L., McDevitt, H.O., Duff, G.W. (1997)
Effects of a polymorphism in the human tumor necrosis factor alpha promoter on
transcriptional activation. Proc. Natl. Acad. Sci. U. S. A 94:3195-3199.
203. Wolf, G., Yirmiya, R., Goshen, I., Iverfeldt, K., Holmlund, L., Takeda, K., Shavit, Y.
(2003) Impairment of interleukin-1 (IL-1) signaling reduces basal pain sensitivity in
mice: genetic, pharmacological and developmental aspects. Pain 104:471-480.
204. Wray, D. (1982) A double-blind trial of systemic zinc sulfate in recurrent aphthous
stomatitis. Oral Surg. Oral Med. Oral Pathol. 53:469-472.
205. Yu, Y.W., Chen, T.J., Hong, C.J., Chen, H.M., Tsai, S.J. (2003) Association study of
the interleukin-1 beta (C-511T) genetic polymorphism with major depressive
Referências Bibliográficas 89
disorder, associated symptomatology, and antidepressant response.
Neuropsychopharmacology 28:1182-1185.
6- ANEXOS
Anexo I 91
Anexo I (ASPECTOS ÉTICOS)
A realização do presente estudo foi aprovada pelo Comitê de Ética em Pesquisa da
UFMG – COEP, conforme protocolo Nº 009/00.
Anexo I 92
Anexo II (Genótipos)
Genótipos IL6
Genótipos IL1B Genótipos TNFA
Genótipos IL10
Genótipos SLC6A4
478
522
Anexo III 105
Anexo III (Sequências dos polimorfismos genético)
Os primers estão sublinhados e os sítios de restrição apontados por setas
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
