Download PDF
ads:
Rodrigo Aparecido Fernandes Redondo
Estudos evolutivos em quirópteros neotropicais
Tese apresentada ao programa
de Pós Graduação em Genética
do Departamento de Biologia
Geral do Instituto de Ciências
Biológicas da Universidade
Federal de Minas Gerais, como
requisito parcial para a
obtenção do título de Doutor
em Genética
Orientador: Prof. Dr. Fabrício R. Santos
Belo Horizonte
Departamento de Biologia Geral
Instituto de Ciências Biológicas
2007
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
ads:
Índice
Resumo ______________________________________ 4
1. Introdução __________________________________ 7
1.1. Ordem Chiroptera _______________________ 8
1.2. Família Phyllostomidae (Gray, 1825) ________ 8
1.3. Gênero Artibeus (Leach, 1821) _____________ 10
1.4. Relevância e justificativa _________________ 12
2. Objetivos e estrutura da tese ____________________ 13
Capítulo 1. ____________________________________ 15
Capítulo 2. ____________________________________ 51
Capítulo 3. ____________________________________ 67
Capítulo 4. ____________________________________ 126
3. Considerações finais __________________________ 157
4. Referencias Bibliográficas______________________ 161
Resumo
Esta tese tem por objetivo principal desvendar aspectos da evolução molecular em
morcegos neotropicais nos níveis inter e intra-específico, focando na ação da seleção
natural e em estudos de filogenia e filogeografia.
O Capítulo 1 é uma revisão dos estudos de filogenia, filogeografia e evolução
moleular em morcegos neotropicais e está aceito para publicação como capítulo do
livro “Morcegos no Brasil: Biologia, Sistemática, Ecologia e Conservação” que será
lançado em maio de 2008.
No Capítulo 2 estudei a evolução da α-amilase em morcegos e outros mamíferos no
intuito de tentar relacionar efeitos de seleção natural na diversidade de ábitos
alimentares em morcegos. Para isso sequenciamos o exon 4 e intron c em 9 espécies
de morcegos e em mais 10 espécies de mamiferos e aplicamosmétodos de detecção
de seleção natural, convergência evolutiva e filogenia. Embora a correlação não
fosse encontrada no segmento de gene estudado, observamos que a α-amilase está
sob forte pressão de seleção purificadora. Alguns dos testes de seleção em
moleculas apontaram sítios possivelmente sob seleção diversificadora, porém não
encontramos quaisquer evidencias de alterações fisico-químicas nestes aminoácidos.
Existe a possibilidade destes aminoácidos alterarem a conformação da proteína por
interação com aminoácidos que também se alteraram em outra parte da molécula
em algum segmento não estudado, a ampliação deste estudo cobrindo todos os
éxons da proteína poderia elucidar este achado. Os resultados deste trabalho foram
publicados na revista “Genetica (2006) 126:199–213”.
O Capítulo 3 foi um estudo da Filogenia do Gênero
Artibeus
. Este trabalho consistiu
em uma ampla análise molecular do gênero Artibeus com uma alta amostragem
4
geográfica e individual, e que revelou padrões interessantes de diversidade. Pelo
menos quatro táxons merecem um estudo mais profundo, para três deles análises
preliminares morfológicas complementares aos dados moleculares revelaram a
existência de três (possíveis) novas espécies. Os padrões encontrados mostram que
os Andes tiveram um importante papel na evolução dos
Artibeus
, já que tanto no
subgênero
Artibeus
, quanto no subgênero
Dermanura
existem clados nitidamente
separados pelos Andes, estes resultados são coerentes com o tempo de divergência
encontrado para estes clados. Obviamente a história é muito mais complexa do que
isso, uma vez que existem espécies que cruzam estas bordas, como
Artibeus
lituratus
. Este trabalho foi enviado para a revista “Molecular Phylogenetics and
Evolution”.
O Capítulo 4 extende o trabalho do capítulo 3 entrando em detalhes da filogeografia
de 6 espécies do genero
Artibeus
. Apesar de serem morcegos generalistas, tanto em
alimentação como escolha de abrigos, os estudos mostraram que, apesar dessa
generalidade, padrões filogeográficos distintos são encontrados no gênero, variando
desde ausência total de estruturação em
A. lituratus
a uma forte estruturação
correlacionada aos diferentes biomas brasileiros em
A. obscurus
e além de grande
diversidade críptica em
A. gnomus
. Uma AMOVA revelou que cerca de 55% da
variação genética encontrada na espécie
A. obscurus
pode ser atribuida a esta
divisão dos biomas (contra apenas 4% encontrada em
A. lituratus
), especialmente
na Mata Atlântica onde uma nítida divisão entre o Norte e o Sul podem ser
verificadas. Este padrão interessante da Mata Atlântica encontrado em
A. obscurus
foi também observado por outros autores em outras espécies de morcegos. As
datações moleculares encontradas são compatíveis com o limite Plio-Pleistoceno para
as divergências dos grupos em
A. obscurus
indicando a possivel existência de
refúgios Pliocênicos semelhantes aos bem estudados Pleistocênicos. Uma parte deste
5
trabalho esta aceita para publicação na tradução brasileira do livro “Conservation
Genetics” de Frankham et al. Outra parte será submetida a revista “Journal of
Biogeography”.
6
1. Introdução
Na natureza é esperado que indivíduos de uma mesma espécie formem
grupos geograficamente definidos que exibam continuidade reprodutiva,
chamados de populações. É esperado também que indivíduos de uma
mesma população tenham mais interações reprodutivas ente si do que
com indivíduos de outras populações.
As características dos organismos são geradas por uma série de
interações complexas entre o genótipo (conjunto de alelos em genes e
outras regiões que afetam o fenótipo) e o ambiente, sendo que os genes
são a base da herança das características nos organismos, e novas formas
gênicas (e alélicas) são formadas principalmente por mutação. A mutação,
auxiliada pela recombinação, produz então a variação em que as forças
evolutivas irão atuar para “moldar” as características fenotípicas dos
organismos. A seleção natural e a deriva genética em populações finitas
podem levar às alterações de freqüências, eliminação e fixação de alelos,
e com o tempo, podem aumentar o nível de divergência entre populações
isoladas levando à sua diferenciação e, até mesmo, à especiação.
Contrariamente, o fluxo gênico (movimento de gametas, indivíduos, ou
populações) atua distribuindo as formas alélicas geradas por mutação e
reintroduzindo alelos novos e “perdidos” nas populações, levando à coesão
genética da espécie e impedindo a ação diversificadora da seleção natural
(em ambientes diferentes) e da deriva genética.
De uma forma simplificada o balanço entre estas forças e as interações
entre os organismos é o que molda então a história evolutiva e a
distribuição genética e espacial (geográfica) das espécies.
7
1.1. Ordem Chiroptera
A Ordem Chiroptera é a segunda mais numerosa Ordem de mamíferos,
possuindo mais de 1100 espécies (Simmons, 2005). Cerca de 341 destas
(aproximadamente 31%) habitam os Neotrópicos, e, pelo menos 162
ocorrem no Brasil, totalizando quase 30% do total de mamíferos
continentais com distribuição registrada para o território brasileiro
(Fonseca et al., 1996; Simmons, 2005; Tavares, Gregorin & Peracchi, in
press).
Os morcegos são particularmente interessantes para estudos evolutivos
em mamíferos, devido a uma série de características, entre elas por
serem a única ordem de mamíferos com capacidade de vôo verdadeiro.
A capacidade de vôo aumenta drasticamente o potencial para dispersão
destes animais e juntamente com seus hábitos noturnos parece ter sido
responsável pela rápida diversificação e riqueza de espécies dos
morcegos.
1.2. Família Phyllostomidae (Gray, 1825)
Quando os quirópteros chegaram aos neotrópicos surgiu a Família
Phyllostomidae, uma das maiores famílias de morcegos, sendo a terceira
8
em número de espécies (~150) e a primeira em número de gêneros
(~50) (Nowak, 1999).
A família se distribui pelas Américas desde o sul dos EUA (Texas e
Califórnia) até ao norte do Chile e Argentina. Oito subfamílias são
reconhecidas atualmente: Phyllostominae (carnívoros e insetívoros),
Glossophaginae, Lonchophyllinae e Phyllonycterinae (nectarívoros),
Stenodermatinae, Carolliinae e Brachyphyllinae (frugívoros) e
Desmodontinae (sanguívoros) (Koopman, 1993). Destas, apenas a
subfamília Phyllonycterinae é endêmica do Caribe, as outras são
amplamente distribuídas. Todas as subfamílias, com exceção de
Brachyphyllinae e Phyllonyctinae, ocorrem no Brasil. Apesar das
características de diagnóstico das subfamílias coincidirem com os grupos
alimentares, várias espécies são oportunistas e tendem a serem onívoras
dependendo dos recursos disponíveis (Fleming, 1993; Ferarezzi &
Gimenez, 1996).
Como conseqüência da diversidade de hábitos alimentares, a variação em
morfologia craniana é inigualável em qualquer outra família de mamíferos.
A variação de tamanho corporal também é imensa, vai desde 5 g de peso
e 15 cm de envergadura em Ectophylla alba até 190 g e 100 cm de
envergadura em Vampyrum spectrum.
O número de indivíduos por abrigo é bastante variável de espécie para
espécie, sendo que algumas espécies formam imensas colônias com
centenas de milhares de indivíduos como em Desmodus rotundus e outros
possuem tendências solitárias como Vampyrum spectrum (Koopman,
1993). Abrigos com colônias de múltiplas espécies são muito comuns.
9
Várias espécies, inclusive proximamente relacionadas, são encontradas
em simpatria, sendo que o número de espécies que compartilham a
mesma área de vida em Phyllostomidae é pelo menos três vezes maior do
que outros morcegos e os níveis de endemismos na família são muito
baixos (Simmons, 2005), tornando esta família um interessante modelo
para estudos de especiação.
1.3. Gênero Artibeus (Leach, 1821)
O gênero Artibeus engloba cerca de 19 espécies (muitas necessitando ou
em revisão) com distribuição neotropical (Simmons, 2005). São morcegos
com variação grande de peso (10 a 70 g) e tamanho (35 a 75 mm de
antebraço) com quatro listras faciais (ausente em algumas espécies) e
com variação de pelagem de cinza a negro e de marrom escura a
amarelo. São prioritariamente frugívoros, mas também já foram vistos
consumindo pólen, néctar, flores e até insetos (Ferarezzi & Gimenez,
1996).
Entre as frutas consumidas estão figos, mangas, bananas e um grande
número de plantas pioneiras, especialmente do gênero Cecropia, e
também espécies clímax típicas de florestas maduras (Fleming, 1993;
Charles-Dominique, 1986). Normalmente durante a noite carregam as
frutas para sítios de alimentação e ao final da noite as levam para o
abrigo, trazendo com isso um grande movimento de sementes que caem
das frutas (ou pedaços de frutas) e que também são defecadas durante o
vôo (Fleming, 1993; Charles-Dominique, 1986). Isso faz destes animais
10
importantes agentes na regeneração natural de florestas secundárias e na
manutenção de florestas maduras.
A sistemática do gênero Artibeus parece ser ainda pouco compreendida.
Owen (1987), utilizando evidências morfológicas, concluiu que o gênero é
polifilético. Esta visão, porém, não é suportada por dados moleculares
(Van den Bussche et al., 1993, Lim et al., 2004). Owen (1987) sugeriu
que as “espécies pequenas” deveriam ser separadas em um gênero
próprio Dermanura (Gervais, 1856). Jones, Arroyo-Cabrales e Owen
(1988) aceitaram Dermanura e sugeriram que a espécie A. hartii fosse
separada no gênero Enchisthenes (Andersen, 1906). Owen (1991) propôs
também que A. concolor deveria ganhar status genérico e ser colocada no
gênero Koopmania. Entretanto, baseado em dados moleculares, Van den
Bussche (1995) concluiu que não existe suporte para o gênero
Koopmania.
Dentro das espécies a sistemática também é complicada; para muitas das
espécies a identificação morfológica é difícil. O caso mais impressionante é
o de A. planirostris que durante muito tempo foi considerado uma
subespécie de A. jamaicensis e hoje, além de ser considerado como
espécie separada, possui diversas subespécies, algumas em simpatria. A
própria distinção das duas espécies não é ainda aceita por alguns autores
(Tavares, Gregorin & Peracchi, in press; Simmons, 2005) apesar das
evidências morfológicas e moleculares (Lim, et al., 2004, Guerrero et al.,
2004).
Tavares, Gregorin e Peracchi (in press), em uma recente revisão sobre a
sistemática de morcegos brasileiros, citam “...a sistemática e a taxonomia
11
de espécies de grandes Artibeus que ocorrem no Brasil (principalmente A.
lituratus e A. jamaicensis) e, especificamente, a variação dentro do S/SE
brasileiro é confusa e a definição das espécies imprecisa; esses complexos
(principalmente os grandes Artibeus do S/SE brasileiro) necessitam de
uma revisão abrangente, que inclua todas as formas geográficas”.
1.4. Relevância e justificativa
Conhecer a complexa história evolutiva dos morcegos já seria por si
motivo de interesse científico para levar ao desenvolvimento de uma tese
sobre o assunto. Apesar dos padrões filogeográficos, filogenéticos e a
sistemática de algumas espécies de morcegos já terem sido estudadas por
outros autores, nenhum destes trabalhos utilizou uma amostragem muito
ampla e com diversos marcadores diferentes. Esta abordagem detalhada
deve melhorar a resolução da história de diversificação de morcegos
neotropicais, para a reconstrução de cenários evolutivos e biogeográficos
mais coerentes, e pode ajudar na compreensão de parte dos processos
envolvidos na especiação destes organismos.
Até recentemente não existiam trabalhos publicados de evolução
molecular relacionados à busca por seleção natural e adaptação ao nicho
alimentar em genes de morcegos, o que poderia explicar a grande
quantidade de hábitos alimentares observados, principalmente na família
Phyllostomidae.
Além disso, o uso de novas abordagens para a resolução de problemas em
taxonomia, com o desenvolvimento de novas e mais precisas
12
metodologias para a identificação molecular, poderão ser expandidos para
outros organismos facilitando o trabalho em grandes inventários da
biodiversidade.
2. Objetivos e estrutura da tese
Esta tese tem por objetivo principal desvendar aspectos da evolução
molecular em morcegos neotropicais nos níveis inter e intra-específico,
focando na ação da seleção natural e em estudos de filogenia e
filogeografia, sendo que as duas últimas partes se concentraram em
estudos do gênero Artibeus (Leach, 1821).
A tese foi estruturada em capítulos independentes, cada um sendo um
artigo ou capítulo de livro, com objetivos próprios, mas que em seu
conjunto visam contribuir para o conhecimento da evolução molecular em
morcegos neotropicais
O Capítulo 1 é uma revisão sobre o estado da arte no conhecimento de
filogenia e filogeografia de morcegos neotropicais até 2005. Foi um
trabalho realizado em colaboração e sob o convite de Albert David
Ditchfield, professor da UFES. Além de escrever as partes sobre filogenia e
sistemática, coordenei a montagem do texto. Esta revisão está aceita
como capítulo no livro ‘Morcegos do Brasil: Biologia, Sistemática, Ecologia
e Conservação’ (Pacheco, Esberard e Marques, in press) que será
publicado em 2007.
O Capítulo 2 teve por objetivo verificar se existe alguma correlação entre
a diversidade de hábitos alimentares encontrados em morcegos e
13
modificações adaptativas em um segmento do gene codificador da enzima
α-amilase. Também foram testadas algumas hipóteses de relação
filogenética entre morcegos e outros mamíferos. Este artigo é uma
pequena expansão do trabalho desenvolvido durante o meu Mestrado no
Departamento de Biologia Geral da UFMG. Este trabalho foi publicado na
revista Genetica da Kluwer Academic Publishers em 2006.
O Capítulo 3 apresenta um estudo detalhado das relações filogenéticas e
de taxonomia molecular do gênero Artibeus, um dos maiores (~19
espécies) e mais complicados gêneros de morcegos filostomídeos. O
manuscrito foi submetido à Molecular Phylogenetics and Evolution da
Elsevier.
No Capítulo 4 são apresentados os dados e análises preliminares da
filogeografia comparada de 6 espécies de morcegos do gênero Artibeus.
Estes dados serão utilizados para o desenvolvimento de mais um
manuscrito a ser submetido ao Journal of Biogeography.
14
Capítulo 1.
Filogeografia e filogenia de Chiroptera na região Neotropical.
Manuscrito aceito para publicação como capítulo do livro:
Morcegos do Brasil: Biologia, Sistemática, Ecologia e Conservação’
(Pacheco, Esberard e Marques Eds, in press)
15
Filogeografia e filogenia de Chiroptera na região Neotropical.
Albert D. Ditchfield
1
, Felipe M. Martins
2
, Fabrício R. Santos
3
e Rodrigo A. F.
Redondo
3
.
1 – Departamento de Ciências Biológicas – CCHN – UFES, Av. Marechal
Campos, 1468 – Maruípe. CEP 29040-090 – Vitória - ES, BRASIL.
2 – LABEC-USP. Rua do Matão, 277 – Cidade Universitária. CEP 05508-
900 - São Paulo – SP – BRASIL.
3 – LBEM – Departamento de biologia geral - ICB/UFMG, Sala L3-244
Av. Antônio Carlos, 6627 C.P. 486 – CEP 31.270-010 Belo Horizonte, MG,
BRASIL.
Introdução e tributo aos mestres
Com a virada do novo milênio houve uma mudança de guarda e
perdemos várias pessoas importantes ao estudo de quirópteros. Nos
Estados Unidos, em 22 de setembro de 1997, perdemos o Dr. Karl F.
Koopman do American Museum of Natural History de Nova Iorque
(AMNH), um sistemata respeitadíssimo que estudou morcegos do mundo
todo, inclusive das Américas. Também perdemos, em 9 de junho de 2000,
o Dr. Charles O. Handley Jr. do Natural History Museum, Smithsonian, em
Washington, D.C., um sistemata que trabalhou na descrição de diversas
espécies novas de quirópteros Neotropicais, além de estudar aspectos da
ecologia e comportamento de muitas espécies. No Brasil, no dia 7 de
16
agosto de 2004 faleceu o Dr. Waldir Antonio Taddei, durante muitos anos
professor da UNESP em São José do Rio Preto, uma pessoa querida que
representa uma grande perda para a comunidade brasileira de
mastozoólogos. Estes três pesquisadores juntos publicaram mais de 300
trabalhos científicos e foram excepcionalmente importantes na
compreensão da fauna de morcegos da América do Sul.
A ciência é uma atividade essencialmente cumulativa que difere de
qualquer outra atividade humana. Em outros campos, freqüentemente
uma nova corrente simplesmente rejeita todas as escolas anteriores e
parte em uma nova direção, negando tudo que foi feito e dito
anteriormente. Já na ciência existe um corpo de observações que deve ser
incorporado em qualquer teoria nova que busque substituir os modelos
vigentes. A âncora da realidade externa e a enorme quantidade de fatos
observados anteriormente obrigam a se trabalhar dentro de um contexto
histórico, explicando, portanto o comentário de Newton, “se enxerguei
mais longe, era porque estava de pé nos ombros de gigantes” (Isaac
Newton, carta para Robert Hooke, 1676). Jamais podemos esquecer que
novas metodologias (moleculares, morfométricas, etc) e novas filosofias
(ex. cladística) tendem a ser incorporadas dentro de um contexto teórico
maior, e sua validade deve ser medida na sua capacidade de falsificar
hipóteses propostas dentro do âmbito da ciência. Tanto a filogeografia e a
sistemática atual, quanto os trabalhos dos pesquisadores em quirópteros
mencionados acima, foram guiados pelas bases elaboradas durante a
síntese moderna.
O último representante dos biólogos que lançaram as bases do
Neodarwinismo comemorou seu centésimo aniversário em Harvard em
17
2005, e faleceu recentemente (10 de fevereiro de 2005). Ele é o
ornitólogo Ernest Mayr, cujo trabalho tem importância extraordinária para
o pensamento evolutivo, com relevância inclusive para a área de estudos
da filogeografia de morcegos. Vamos aqui explorar esta conexão. Ernest
Mayr, em entrevista concedida à revista Science (Mayr, 2004), frisou sua
participação na grande síntese do pensamento evolutivo, que se deu nas
décadas de 1930-40. A compreensão deste evento é fundamental para
entender não só as bases da filogeografia e da sistemática molecular
como todo o trabalho daqueles que nos antecedem.
No inicio do século passado, depois que as leis de Mendel foram
redescobertas, houve um conflito entre os naturalistas e os geneticistas
em relação à origem das espécies. Os naturalistas acreditavam numa
evolução gradual resultante da ação da seleção natural seguindo o modelo
de Darwin, enquanto os geneticistas (ex. DeVries, Bateson e Johannsen)
acreditavam em evolução por mutacionismo, a despeito da seleção
natural. O trabalho de Morgan derrubou as teorias dos Mendelianos que
acreditavam em mutacionismo saltatório, com a instantânea formação de
novas espécies, e estabeleceu as bases da genética de populações, que
culminou no trabalho de Fisher, Haldane e Wright. O mais importante é
que esta nova escola de genética de populações aceitava a seleção
natural, permitindo uma síntese. Na década de 30 porém existia uma
situação curiosa, pois enquanto que a genética de populações resolveu o
problema da evolução gradual das populações através da seleção natural,
os geneticistas ainda não haviam estudado devidamente o problema da
origem das espécies, ou seja, a evolução da biodiversidade não havia sido
ainda abordada. Contudo a origem da biodiversidade era um problema
18
que foi resolvido pelos naturalistas europeus na década de 20 (Wagner,
Jordan, Poulton, Stresemann e Chetverikov). A tradição européia dava
enorme importância a variação geográfica dentro de espécies, e o papel
do isolamento geográfico na origem de novas espécies. A falta de
comunicação entre as duas áreas (genética e história natural) deixou uma
brecha no conhecimento durante muitos anos, pois ambas as áreas
negligenciavam as descobertas da outra.
Foi Dobhzhansky que tinha a formação necessária para fazer a
ponte entre estas duas tradições distintas. Ele tinha sido criado na Rússia
e trabalhava com taxonomia de besouros, mas se juntou ao laboratório de
Morgan nos EUA e se familiarizou com genética de populações. Seu livro
de 1937 mostrou que tanto a genética como a sistemática podiam ser
unidas para montar um novo paradigma Darwiniano. Dobhzhansky
convidou Mayr para escrever um livro sobre a origem da biodiversidade e
neste livro Mayr trabalhou com especiação, e definiu o conceito biológico
de espécies (grupo de populações que trocam genes). Segundo Mayr, a
origem de espécies se dá principalmente devido a especiação alopátrica,
também dita geográfica. O fluxo gênico é o principal obstáculo a
especiação. Para ocorra a especiação é necessário algum processo que
interrompa o fluxo gênico, permitindo populações coespecíficas se
diferenciarem até que percam a capacidade de trocar genes novamente se
colocadas em simpatria. Desta forma surgem novas espécies. O
mecanismo mais viável para especiação seria a formação de barreiras
geográficas que isolem populações por períodos de tempo suficiente
(Mayr, 1942). A grande síntese nos últimos 60 anos resistiu a todos os
desafios que surgiram desde então, permanecendo o paradigma principal
19
da biologia. De fato, nenhuma revisão do paradigma Darwiniano foi
necessária para acomodar as descobertas espetaculares da biologia
molecular (Mayr, 2004).
Um dos autores deste artigo (Albert David Ditchfield) teve a
oportunidade de interagir com estes quatro pesquisadores, conversando
com o Dr. Mayr após uma palestra em Berkeley, discutindo idéias com o
Dr. Koopman durante o pós-doutorado no American Museum of Natural
History (AMNH), além de dever particularmente ao Dr. Taddei, mas
também ao Dr. Handley, a identificação positiva de todos os espécimes
utilizados no artigo de filogeografia de quirópteros resultante de seu
doutorado (Ditchfield, 2000). De certa forma, portanto, as idéias da
teoria sintética permanecem vivas na filogeografia, e todos os três
principais sistematas em quirópteros que falecerem na virada do milênio
contribuíram para o primeiro trabalho de filogeografia realizado na Região
Neotropical com morcegos. Houve continuidade entre o trabalho destes
pesquisadores com os esforços científicos atuais. Este artigo é um tributo
a todos estes grandes pesquisadores.
Filogeografia.
Notavelmente, a primeira coisa que deve ser compreendida a
respeito da filogeografia é que ela foi proposta por John C. Avise, por sua
vez um ornitólogo tal qual Ernest Mayr e um notável defensor dos
princípios neodarwinistas. Por exemplo, em 1997, Avise e Wollenberg
saíram em defesa do conceito biológico de espécies, que tem sido atacado
por cladistas, usando a teoria de coalescência, um dos pilares teóricos da
filogeografia, para justificar sua posição. A defesa de Mayr por Avise não é
20
casual: filogeografia é o neodarwinismo de Mayr e Dobhzhansky aplicado
aos dados obtidos com técnicas moleculares. Existe, portanto uma
conexão direta entre o trabalho de Handley, Taddei e Koopman,
compreendendo os padrões morfológicos de diferenciação geográfica
dentro de espécies e espécies congenéricas com o trabalho filogeográfico
iniciado por Avise. Esta conexão é mediada pela importância atribuída por
Mayr à especiação geográfica e seu conceito de espécie, baseado na
quebra do fluxo gênico e isolamento reprodutivo com conseqüente
diferenciação entre populações.
Filogeografia é o estudo da distribuição geográfica das linhagens de
genes dentro de uma espécie, ou em espécies próximas (Avise et al.,
1987). A filogeografia é a ponte entre a genética de populações e a
sistemática, entre os eventos microevolutivos, que operam entre
indivíduos distribuídos em populações que levam à mudança de
frequências gênicas ao longo das gerações e os eventos macroevolutivos
que dizem respeito à diferenciação entre espécies e táxons superiores. Por
este motivo Avise considerou a filogeografia como o estudo da formação
das espécies (Avise, 2000). A filogeografia utiliza a distribuição geográfica
da diversidade genética para compreender a origem das espécies. A
filogeografia é revolucionária no sentido que ela aplica técnicas
filogenéticas para recuperar a história de alelos dentro de uma população,
quebrando um tabu imposto por Hennig (1966) de que técnicas cladísticas
não deveriam ser usadas para compreender eventos tokogenéticos
(relações dentro de populações, que podem ter padrões reticulados –ex.
híbridos). No fundo, a filogenia de genes distribuídos entre populações
dentro de uma espécie se transforma ao longo do tempo evolutivo na
21
filogenia de espécies dentro de um gênero devido ao fenômeno da
coalescência.
A importância da filogeografia comparativa para o estudo da
evolução é que padrões filogeográficos semelhantes podem ser
compartilhados por espécies ocupando uma mesma região,
potencialmente resultantes de eventos históricos comuns. Com os
métodos filogeográficos tornou-se possível aplicar o teste de hipóteses
biogeográficas devido ao fato que seqüências de DNA podem ser usadas
para inferir tanto o padrão de cladogênese entre espécies ou populações,
quanto o tempo para a diferenciação destas utilizando-se de um relógio
molecular. Cabe lembrar também que a filogeografia transcende o
contexto neodarwiniano em que foi formulada, pois as previsões de
diversos modelos de especiação diferentes podem ser testados utilizando-
se o padrão filogeográfico esperado para cada tipo de especiação dado um
gradiente ecológico (vide Moritz et al., 2000).
Estudos de filogeografia com a biodiversidade no Brasil tiveram
início com os trabalhos de Patton e seus alunos utilizando sequências de
citocromo b para várias espécies de pequenos mamíferos neotropicais,
incluindo roedores arbóreos e terrestres, morcegos e marsupiais (Smith &
Patton, 1991; Patton & Smith, 1992; Da Silva & Patton, 1993; ; Smith &
Patton, 1993; Patton, Da Silva & Malcom, 1994; Patton, Da Silva &
Malcolm, 1996; Patton, Reis, Da Silva, 1996; Lara, Patton, & Da Silva,
1996; Mustrangi & Patton, 1997; Patton & Da Silva, 1998; Ditchfield,
1998, 2000). A estes esforços iniciais temos que mencionar outros
estudos com primatas (Faulkes at al., 2003) e felídeos neotropicais (Eizirik
et al., 2001). A visão mais abrangante da biogeografia de mamíferos
22
neotropicais utilizando a filogeografia nos principais biomas do Brasil foi
publicada por Costa 2003. Conforme a autora a conclusão principal foi que
o modelo de refúgios Pleistocênicos falha nas previsões dos padrões
esperados e de fato as conexões entre Amazônia e Mata Atlântica são
complexas. As idades mínimas para diferenciação entre táxons da Mata
Atlântica e os grupos irmãos amazônicos variam do Quaternário ao
Mioceno, e muitas vezes espécies congenéricas da Mata Atlântica não
formam um grupo monofilético, mas representam invasões diferentes de
grupos amazônicos distintos.
O crescimento do campo da filogeografia tem sido enorme, e novos
dados para grupos diversos (ex. paralagartos do Gênero Anolis, Glor &
Larson, 1981; Anfíbios: Carnaval, 2002; Peixes teleósteos: Dergam at al.,
2002; Árvores: Collevatti at al., 2002; Microrganismos, de la Fuente at
al., 2003) tornam claro uma enorme diversidade de padrões. Alguns
estudos tem rejeitado o modelo de refúgios como apropriado para
descrever padrões geográficos em alguns táxons, pois os padrões de
cladogênese esperado e o tempo dos eventos não corresponde ao
observado (Patton et al., 1997; Vivo, 1997, Costa et al., 2003). Porém,
Avise et al. (1998) indicam que o modelo da teoria de refúgios, embora
criticado ao nível interespecífico, permanece um mecanismo importante
para explicar a variação geográfica intraespecífica molecular. Ou seja,
estudos filogeográficos de variação genética intraespecifica podem ser
usados para testar os modelos evolutivos existentes. Isto pode ser
particularmente verdadeiro para quirópteros, onde os mesmos táxons
estão presentes na Amazônia e na Mata Atlântica.
23
Apesar de possuírem no vôo um grande potencial para dispersão,
os morcegos apresentam diversos níveis de estruturação populacional,
muitas vezes, bem distinto de um padrão geral esperado para animais
com sua ecologia e comportamento (ver revisão em Ditchfield & Burns,
1998). Um pioneiro e importante trabalho sobre a filogeografia de
morcegos foi realizado por Worthington-Wilmer et al (1994) utilizando
DNAmt, e mais tarde, revisado e ampliado pelos autores, utilizando
também análises com microssatélites (Worthington-Wilmer et al., 1999).
Nestes trabalhos, os autores realizaram um estudo filogeográfico com o
morcego australiano Macroderma gigas, espécie considerada ameaçada
devido à degradação dos ambientes utilizados como colônias reprodutivas,
bem como a drástica redução de seu habitat, as florestas do norte da
Austrália. Os resultados encontrados foram notáveis: o DNAmt revelou um
alto grau de estruturação populacional, sugerindo que as diferentes
colônias de M. gigas estão virtualmente isoladas, apresentando pouco ou
nenhum fluxo gênico. Os dados de microssatélites apresentaram um
resultado muito semelhante, porém menos acentuado, sugerindo que
possa haver algum fluxo gênico entre as diferentes colônias mediado por
machos. Outro resultado interessante foi encontrado em um abrigo com
uma grande população desta espécie e que possuía duas linhagens bem
distintas de DNAmt. Este é um bom exemplo de como é possível encontrar
um padrão filogeográfico dentro de outro; tal colônia provavelmente se
originou da fusão de duas outras que, como observado para todas as
anteriores, possuíam um fluxo gênico histórico muito baixo.
Um padrão de baixa diferenciação e circunscrição geográfica foi
encontrado em diferentes espécies de morcegos migratórios, através de
24
estudos com diferentes marcadores moleculares. Em um estudo realizado
com duas espécies de raposas voadoras migratórias do gênero Pteropus
na Austrália utilizando eletroforese de proteínas, Webb & Tidemann
(1996) encontraram baixos valores de Fst (um dos mais utilizados índices
de diferenciação genética) e nenhuma correlação entre estes valores e
distâncias geográficas, sugerindo alto grau de fluxo gênico.
Aparentemente, em ambas as espécies (Macroderma gigas e Pteropus sp)
há um intenso fluxo gênico entre as populações – resultado semelhante a
um estudo anterior com outro membro do gênero Pteropus migratório nas
Filipinas (Sinclair at al., 1996), assemelhando-se muito aos resultados
encontrados para aves migratórias. Os autores sugerem que as espécies
de morcego estudadas seriam formadas cada uma por uma única
população panmítica. Outro estudo realizado no México com uma espécie
migratória de morcego – Tadarida brasiliensis, uma espécie insetívora
neotropical da família Vespertilionidae que ocorre no Brasil - utilizando
seis locos de aloenzimas, obteve resultado idêntico (McCracken at al.,
1994). Um semelhante pode ser encontrado em Wilkinson & Fleming
(1996) para a espécie migratória Leptonycteris curasoae (Phyllostomidae;
Glossophaginae), porém utilizando como marcador a região controle do
DNA mitocondrial. Esta espécie ameaçada parece migrar dentro de uma
área restrita; as duas subespécies atribuídas ao táxon estão segregadas
com altos índices de suporte estatístico nas árvores filogenéticas
construídas a partir das seqüências, e os valores de Fst são baixos para
cada uma das subespécies.
Grande parte dos esforços filogeográficos com relação aos
morcegos vem da década de 90 para cá, da Europa, com destaque para o
25
grupo do suíço Manuel Ruedi e seus estudos com morcegos do gênero
Myotis. Isto ocorre em grande parte não só porque os pesquisadores
europeus possuem verbas e infra-estrutura privilegiadas, mas também
porque os morcegos estudados hibernam e formam grandes aglomerações
em sítios reprodutivos e de hibernação, facilitando significativamente os
esforços de amostragem de espécies sobre as quais existem extensos
estudos ecológicos e de história natural.
Um destes estudos foi realizado com o morcego vespertilionídeo
Plecotus auritus na Escócia. Esta espécie forma colônias estáveis no
verão, e os estudos moleculares demonstraram que cada colônia se
comporta como uma população distinta e que o fluxo gênico entre estas
provém de cópulas que ocorrem fora dos abrigos (Burland at al., 1999).
Outro estudo realizado com o morcego Nyctalus noctula (Petit &
Mayer, 2000) comparou as seqüências de DNAmt obtidas de animais
coletados em diferentes épocas do ano, primeiro em uma colônia
reprodutiva e depois em um abrigo para hibernação. Os autores puderam
observar que as hibernáculas possuíam uma diversidade haplotípica muito
maior, ou seja, indivíduos provenientes de diferentes colônias
reprodutivas migram para os mesmo abrigos de hibernação. A composição
genética das hibernáculas mostrou-se também capaz de indicar as
possíveis rotas de migração para esta espécie.
Também utilizando DNAmt, Kerth, Mayer & Petit (2002)
demonstraram que em Myotis bechsteinii, cada colônia reprodutiva era
formada por indivíduos extremamente filopátricos, ou seja, cada colônia
era formada por no máximo duas linhagens matrilineares distintas, e cada
26
colônia possuía suas linhagens. Por outro lado, o sequênciamento de
haplótipos pertencentes a machos solitários demonstrou que os machos
são responsáveis pelo fluxo gênico entre as colônias reprodutivas,
acumulando assim mais evidências para as observações feitas no campo
de que as fêmeas são filopátricas e contribuem para a criação dos filhotes
de parentes próximos.
Diferentes tipos de marcadores moleculares podem transmitir
informações de forma diversa. A comparação dos resultados obtidos para
marcadores moleculares mitocondriais e nucleares pode revelar uma
diferente contribuição de machos e fêmeas para a dinâmica dos genes nas
populações de uma espécie. Em um estudo realizado com o morcego
Myotis myotis, Castella et al. (2000a) encontraram linhagens distintas de
DNAmt em diferentes lados da cadeia alpina, sugerindo baixo fluxo gênico
entre essas colônias. Porém, ao analisar marcadores nucleares para a
mesma amostra, não obteve distinção entre populações de diferentes
regiões geográficas, sugerindo um alto grau de fluxo gênico para esta
espécie. Assim, os autores sugerem que as fêmeas são filopátricas,
enquanto os machos migram de uma colônia para outra sem empecilhos,
impedindo a diferenciação entre populações.
Estudos filogeográficos têm contribuído para a identificação de
espécies que a taxonomia tradicional não havia ainda descrito. Partindo da
observação que haveria um certo grau de diferenciação morfológica,
Castella et al (2000b) decidiram comparar através de marcadores
moleculares, duas populações de Myotis myotis de lados opostos do
estreito de Gibraltar, a européia e a de Marrocos (africana). Os resultados
mostraram que, além da diferenciação morfológica, a distância genética
27
entre os haplótipos destas populações era algumas vezes maior do que a
distância entre estas e uma outra espécie européia claramente distinta,
Myotis blythii. Assim, os autores acabaram por sugerir que a população do
Marrocos fosse elevada à categoria de espécie denominada de Myotis
punicus.
Outros exemplos podem ser encontrados: Appleton et al. (2004)
estudou o complexo atribuído a Miniopterus schreibersii e concluiu que
esta não é uma espécie amplamente distribuída pelo velho mundo e a
Oceania, e sim um complexo parafilético de espécies, a maior parte delas
de distribuição bastante restrita. Juste et al. (2004) estudou o gênero
Plecotus e chegou a conclusões semelhantes à do estudo anterior: de que
o número de espécies pertencentes a este gênero é largamente
subestimado.
Um trabalho recente (Miller-Butterworth et al., 2003) utilizou algo
que deve se tornar a tendência central dos estudos em zoologia: a
utilização de marcadores morfológicos combinados com marcadores
moleculares com características distintas, como seqüências mitocondriais
e nucleares e microssatélites. Tal estudo encontrou para uma das
subespécies atribuídas a Miniopterus schreibersii, M. schreibersii
natalensis, não só uma diferenciação genética entre indivíduos
provenientes de distintos biomas dentro da África do Sul (descrevendo
assim um padrão de diferenciação populacional para uma espécie com
hábitos migratórios) como foi capaz de associar a esta diferenciação
genética uma diferenciação morfológica: indivíduos provenientes de zonas
distantes do sítio de hibernação possuíam asas com formato adequado
para percorrer grandes distâncias, enquanto aqueles provenientes de
28
localidades mais próximas ao abrigo de hibernação, possuíam asas que
lhes permitiam maior poder de manobra em detrimento de vôos de longa
distância.
Na América latina, um trabalho de destaque foi relizado com o
gênero Carollia (Hoffman & Baker, 2003). Neste estudo, realizado com
várias espécies do gênero, concluiu-se que os Andes tiveram um papel
fundamental na diversificação do gênero e, também, na distribuição da
variabilidade genética nas espécies atuais, além de sugerir a existência de
uma espécie nova com base nos índices de divergência nucleotídica.
No Brasil, o trabalho pioneiro e de maior relevância para
filogeografia de morcegos foi o realizado por Ditchfield (2000). Neste
trabalho, o autor analisa o DNAmt de uma série de espécies que ocorrem
no território brasileiro e em outros países da América latina em busca de
padrões filogeográficos comuns. O artigo está centrado na análise de
quatro espécies com maior número amostral, todos da família
Phyllostomidae: Carollia perspicillata, o morcego nectarívoro Glossophaga
soricina e os membros da subfamília Stenodermatinae Artibeus lituratus e
Sturnira lilium, além de análises preliminares de outras espécies cuja
amostragem não se apresentou tão significativa.
Segundo Ditchfield (2000) os dados e as análises mostraram que,
de uma forma geral, as espécies neotropicais se comportam de acordo
com o padrão esperado para animais com grande potencial de dispersão.
O caso do morcego A. lituratus é o mais emblemático: a divergência
nucleotídica média foi de apenas 1,5% numa amostragem que foi do sul
do México até o sul do Brasil (uma distância de aproximadamente 8000
29
Km) e haplótipos compartilhados entre localidades com distâncias de até
3200 Km. Além disso, 24 haplótipos foram identificados em 36 indivíduos
seqüenciados.
O morcego S. lilium mostrou um padrão semelhante. Cada
localidade possui uma alta diversidade haplotípica e os haplótipos estão
amplamente distribuídos, ao menos em relação à costa do Brasil. A árvore
que inclui haplótipos de outras localidades fora do país reflete, ainda que
grosseiramente, a relação entre as subespécies atribuídas a este táxon. O
resultado obtido para Glossophaga soricina foi bastante semelhante: a
árvore refletiu perfeitamente as subespécies atribuídas a este táxon.
Como as subespécies que ocorrem no México e no Peru foram
representadas por poucas amostras, a maior parte das análises se
concentrou nas amostras provenientes do litoral brasileiro, onde mais uma
vez foi encontrada uma alta diversidade haplotípica e haplótipos
compartilhados entre localidades distantes até 2300 Km (Ditchfield,
2000).
De todas as espécies analisadas, a que apresentou um padrão
biogeográfico mais interessante foi, sem dúvida, C. perspicillata. Para esta
espécie foram descritos dois clados com uma possível zona de contato.
Estes clados correspondem ao norte e ao sul da região costeira do Brasil,
ou seja, dois clados referentes às porções norte e sul da Mata Atlântica.
Esta subdivisão seria resultado de uma fragmentação na Floresta Atlântica
durante as flutuações climáticas do Pleistoceno, uma vez que esta espécie
é predominantemente florestal. Tal resultado possui um paralelo; esta
divisão da mata atlântica já havia sido identificada para aves (Bates et al.,
1988) e para herpetofauna (Vanzolini 1988), usando uma análise
30
parcimoniosa dos níveis de endemismo. Tal padrão também foi
recentemente reconhecido para pequenos mamíferos não voadores, como
pequenos marsupiais e roedores (Costa, 2003).
Ditchfield (2000) também apresenta os padrões obtidos em análises
preliminares com 13 espécies adicionais, que incluem taxa com hábitos
completamente díspares, como o morcego hematófago Desmodus
rotundus, o carnívoro de grande porte Trachops cirrhosus, dois
vespertilionídeos do gênero Myotis bem como outros representantes do
gênero Artibeus. A maior parte deles tende a seguir a tendência de baixa
estruturação populacional, com algumas exceções importantes, como o
morcego hematófago D. rotundus e o insetívoro Myotis nigricans, que
apresentaram uma divergência nucleotídica média de 4,0%. Estudos
posteriores utilizando o mesmo marcador mostraram esta estruturação
com dois clados mitocondriais para a Mata Atlântica (um norte e um sul)
para D. rotundus (Martins et al., 2003), bem como a existência de outros
clados geograficamente circunscritos no território nacional, num trabalho
que suscitou mais perguntas que respostas.
Filogenia Molecular
A teoria da coalescência é a base conceitual da genética de
populações molecular. Ela é a fonte de ferramentas essenciais para
realizar inferências sobre mutação, recombinação, seleção natural e
especiação. A teoria da coalescência descreve a ancestralidade genética
de uma amostra através da genealogia de alelos e faz predições sobre os
padrões de variação genética esperados e o tempo para que estes tenham
se formado, ou seja, o tempo de coalescência até um alelo ancestral.
31
Enquanto que a genética de populações tende a olhar o futuro a partir do
presente, a coalescência infere o passado a partir da variação genética
atual. Uma expectativa da teoria da coalescência é que populações que
estão isoladas e/ou após muitas gerações perderão alelos, pela ação da
seleção natural ou da deriva genética, e que a especiação levará à
monofilia reciproca (Wakeley, 2000). Este conceito é fundamental para
compreender como as relações tokogenéticas que ocorrem entre
indivíduos dentro de uma espécie resultam na distribuição difereciada de
alelos entre populações. Uma extrapolação deste processo é a filogenia
que descreve a diversificação de espécies a partir de espécies ancestrais.
A reconstrução da história da vida na Terra intriga a imaginação de
inúmeros cientistas desde o tempo de Darwin. Tentar reconstruir as
relações evolutivas entre os organismos é justamente o papel dos
sistematas. Os estudos filogenéticos e de sistemática utilizando dados
moleculares se desenvolveram junto com as técnicas de biologia
molecular, e desde a década de 60, com os trabalhos pioneiros de Cavalli-
Sforza & Edwards (1967), que utilizaram e aperfeiçoaram ambas
metodologias e propiciaram o desenvolvimento de novas (Li, 1997; Nei &
Kumar 2000; Felsenstein, 2004). Os estudos filogenéticos passaram então
a utilizar hibridização DNA-DNA, padrões eletroforéticos de DNA e
proteínas, sítios de enzimas de restrição e mais tarde, seqüências de
aminoácidos e nucleotídeos como caracteres (revisões em Li, 1997; Nei &
Kumar, 2000; Felsenstein, 2004).
Com o aumento do volume de dados gerados (tanto morfológicos
quanto moleculares) sua interpretação começou a se tornar cada vez mais
complexa, e novas metodologias e idéias começaram a ser criadas. A
32
inferência filogenética é um problema estatístico e dever ser abordada de
forma apropriada (Felsenstein, 1981; Nei & Kumar, 2000; Yang, 2000).
Entretanto, esta metodologia é ainda hoje muito controversa, sendo muito
mais aceita e estudada pelos sistematas moleculares. Deste modo a
filogenia molecular pode ser interpretada atualmente como sendo um
conjunto de técnicas de biologia molecular e inferência estatística que visa
estudar as relações evolutivas entre os organismos, ou genes.
O número de seqüências de DNA e proteínas depositadas no
GenBank (www.ncbi.nlm.nih.gov) diariamente é impressionante e a cada
dia mais e mais genes e segmentos de DNA de diferentes espécies são
seqüenciados. Este imenso volume de dados permite a construção de
árvores filogenéticas cada vez mais consistentes e congruentes (Springer
et al., 2004). Somente de morcegos existem depositados no GenBank, até
julho de 2005, oito genomas mitocondriais completos (dois de
Megachiroptera e seis de Microchiroptera), 6.334 seqüências de
nucleotídeos e 3.164 seqüências de proteína, além de 158 conjuntos de
dados populacionais de seqüências de nucleotídeos (Popsets), englobando
759 das 1023 espécies reconhecidas atualmente (IUCN, 2003).
Em meados da década de 1980, uma série de propostas baseadas
em filogenias moleculares abalou profundamente a classificação
tradicional de mamíferos e também dos morcegos (Waddel et al., 1999;
de Jong, 1998; Pumo et al., 1998; Nikaido et al., 2000; Madsen et al.,
2001; Murphy et al., 2001; Arnason et al., 2002; Springer et al., 2004).
Estas propostas foram (e ainda são) um pouco controversas, mas o
volume de dados e métodos diferentes que convergem para as mesmas
topologias nas árvores filogenéticas, e as evidências biogeográficas e do
33
registro fóssil, apontam para um consenso destas classificações muito em
breve (Springer et al., 2004; Teeling et al., 2005; Redondo & Santos,
2006).
Nas filogenias clássicas de mamíferos os quirópteros são agrupados
com as ordens Dermoptera (lêmures voadores), Primates (macacos,
micos, lêmures, humanos, etc.) e Scandentia (musaranhos arborícolas) na
superordem Archonta (Novacek, 1992). Esta classificação também recebe
suporte de algumas análises realizadas com dados moleculares (Adkins &
Honeycutt, 1991; Allard et al., 1996). Entretanto, os trabalhos recentes
(de Jong, 1998; Nikaido et al., 2000; Madsen et al., 2001; Murphy et al.,
2001; Arnason et al., 2002; Springer et al., 2004; Redondo & Santos,
2006) baseados em seqüências mitocondriais e diversos genes nucleares
não dão apoio à existência de Archonta, e sim a uma outra classificação,
onde Primates, Scandentia e Dermoptera são agrupados com Lagomorpha
(coelhos) e Rodentia (roedores), formando o grupo Euarchontoglires
(Madsen et al., 2001; Murphy et al., 2001; Arnason et al., 2002),
enquanto os Chiroptera são classificados no grupo Laurasiatheria, junto
com Carnivora (gatos, cães, ursos, focas, etc.), Pholidota (pangolim),
Perissodactyla (cavalos, rinocerontes, etc.), Cetartiodactyla (Artiodactyla:
porcos, bois, hipopótamos, carneiros; mais Cetacea: baleias, golfinhos) e
Eulipotyphla (toupeiras, musaranhos e porcos-espinhos) (Pumo et al.,
1998; Nikaido et al., 2000; Madsen et al., 2001; Murphy et al., 2001;
Arnason et al., 2002; Deusuc et al., 2002).
Esta nova proposição dos dados moleculares, retirando os morcegos
de Archonta, não requer muitas explicações do ponto de vista
morfológico. Na realidade basta admitir convergência em características
34
relacionadas ao hábito volante entre morcegos e lêmures voadores, o que,
em compensação, elimina a antiga necessidade de postular a perda dos
tornozelos especializados dos Archonta em morcegos, já que estes se
tornam Laurasiatheria (Springer et al., 2004).
Além da posição da ordem dentro dos grupos de mamíferos, a
monofilia de Chiroptera e das suas sub-ordens também é muito
controversa (Smith & Madkour, 1980, Pettigrew, 1986; Pettigrew et al.,
1989; Mindel et al., 1991; Ammerman & Hillis, 1992; Bailey et al., 1992;
Simmons, 1994; Kirsch, 1996).
A ordem Chiroptera é classicamente dividida em duas subordens:
Megachiroptera, restrita a algumas regiões da África, Índia, Austrália,
sudeste da Ásia e algumas ilhas do Oceano Pacífico e Microchiroptera, que
possui uma ampla distribuição mundial, só não ocorrendo nas regiões
polares e em algumas ilhas oceânicas (Koopman, 1993; Nowak, 1999). Os
microquirópteros são, geralmente, menores que os megaquirópteros e são
caracterizados por possuírem um complexo sistema de ecolocalização
laringeal, que funciona através da transmissão e recepção de sinais ultra-
sônicos e permite orientação e localização das presas (Jepsen, 1997;
Koopman, 1993; Nowak, 1999). Os megaquirópteros, pelo contrário,
possuem uma aguçada visão e não possuem ecolocalização, com exceção
de algumas espécies (Rousettus spp.), nas quais existe outro tipo de
ecolocalização baseada em estalos da língua (Jepsen, 1997; Pettigrew,
1986; Koopman, 1993; Nowak, 1999).
Smith & Madkour (1980) propuseram pela primeira vez que os
Megachiroptera estariam mais relacionados aos primatas do que aos
35
Microchiroptera, baseado em caracteres de morfologia peniana. Este
estudo recebeu suporte pelos estudos de Pettigrew e colaboradores (1986,
1989) que demonstraram que os megaquirópteros e os primatas
compartilham características das vias teto-retinais dos olhos ao córtex
cerebral, dando origem à hipótese do “primata voador”. Esta hipótese
sugeria então que a ordem Chiroptera era polifilética e que o vôo batido
teria evoluído independentemente nas duas linhagens, e que a
convergência para o vôo seria a responsável pelo grande número de
outras características compartilhadas pelos morcegos em geral (Pettigrew,
1986; Pettigrew et al., 1989).
Entretanto esta hipótese foi refutada posteriormente por dados
moleculares mitocondriais (Mindell et al., 1991), nucleares (Bailey et al.,
1992; Ammerman & Hiliis, 1992) e por dados morfológicos (Simmons,
1994), ficando as similaridades encontradas entre os megaquirópteros e
primatas como convergência dos caracteres relacionados à visão. Os
estudos moleculares recentes sobre as relações entre os placentários
também suportam a monofilia de Chiroptera (Madsen et al., 2001; Murphy
et al., 2001; Arnason et al., 2002; Springer et al., 2004). Entretanto,
estes estudos colocam uma nova dúvida na evolução dos morcegos
(Springer et al., 2001; Teeling et al., 2002, 2005). Aparentemente, em
todas as reconstruções moleculares com grande volume de dados,
Megachiroptera aparece como um grupo dentro de Microchiroptera,
tornando Microchiroptera um grupo parafilético (Springer et al., 2001;
Teeling et al., 2002, 2005). Esta hipótese implica ou na dupla origem da
ecolocalização laringial na família Rhinolophidae e nos Yangochiroptera
(Noctilionoidea, Vespertilionoidea e Emballonuroidea) ou uma única
36
origem ancestral, com posterior perda da característica nos
Megachiroptera (Sprinter et al., 2001; Teeling et al., 2005). A controversa
evolução dos morcegos deve-se principalmente à escassez de seu registro
fóssil e sua rápida radiação adaptativa (Jepsen, 1977; Simmons & Geisler,
1998).
Os fósseis de morcegos mais antigos datam do Eoceno e foram
encontrados em todos os continentes com exceção da Antártida (Simmons
& Geisler, 1998). Icaronycteris, Archeonycteris, Hassianycteris e
Palaeochiropteryx são os únicos fósseis encontrados até hoje que não
pertencem a uma família vivente de morcegos (Simmons & Geisler,
1998). A posição destes fósseis em Chiroptera já foi muito controversa,
mas hoje já existe um consenso de que todos eles são mais relacionados
aos microquirópteros do que aos megaquirópteros, na verdade eles são
considerados uma série de táxons irmãos de Microchiroptera (ver revisão
em Simmons & Geisler, 1998).
O mais antigo fóssil de morcego é o Icaronycteris index, que é
datado do início do Eoceno, e, apesar de possuir algumas características
consideradas ancestrais em morcegos (e algumas semelhantes a
megaquirópteros), o Icaronycteris possui todas as características
necessárias ao vôo batido, e análises cranianas sugerem fortemente a
capacidade de ecolocação igual à dos microquirópteros atuais (Jepsen,
1977; Simmons & Geisler, 1998). Estas características avançadas
sugerem que os morcegos tenham surgido em algum ponto do final do
Paleoceno e se diversificaram muito rapidamente (Jepsen, 1977; Simmons
& Geisler, 1998). As evidências moleculares e a existência dos fósseis do
37
Eoceno favorecem muito a hipótese da perda posterior da ecolocalização
nos megaquirópteros (Springer et al., 2001; Teeling et al., 2005).
Num trabalho recente Teeling et al. (2005), utilizando regiões de 17
genes nucleares totalizando 13,7 Kb, reconstruíram uma filogenia para os
morcegos que dá apoio à monofilia de Chiroptera e a parafilia de
Microchiroptera além de mostrar uma boa resolução para famílias
monotípicas e enigmáticas como Craseonycteridae e Myzopodidae, e
esclareceu muitos pontos controversos da origem e evolução dos
morcegos. A solução para a parafilia seria uma nova classificação, com
duas sub-ordens: Yinpterochiroptera (Rhinolophoidea e Pteropodidae) e
Yangochiroptera (Simmons & Geisler, 1998; Simmons, 2005, Teeling et
al., 2005). Este trabalho também aponta uma origem na Laurásia para
todas as famílias de morcegos, fósseis e viventes, com exceção de
Noctilionidae, Phyllostomidae, Mormoopidae, Thyropteridae, Mystacinidae
e Myzopodidae que formam a superfamília Noctilionoidea e possuiria
origem Gondwânica, corroborando os dados de distribuição geográfica e a
radiação adaptativa dos Phyllostomidae (Teeling et al., 2005).
Utilizando vários fósseis como ponto de calibração para datar a
origem e a radiação das famílias de morcegos, Teeling et al. (2005)
dataram a origem da ordem Chiroptera no início do Paleoceno, e que
todas as famílias conhecidas já estavam diferenciadas até o fim do
Eoceno. Estes resultados também estão de acordo com evidências fósseis
(Simmons & Geisler, 1998; Simmons, 2005; Teeling et al., 2005).
Dentro das famílias de morcegos, diversos estudos foram e estão
sendo feitos a fim de solucionar problemas filogenéticos de grupos
38
complicados e/ou refinar a história evolutiva dos morcegos (Kennedy et
al., 1999; Lewis-Oritt et al 2001; Carstens et al., 2002; Van den Bussche
et al., 1993, 2002; Lee et al., 2002; Teeling et al., 2003; Redondo &
Santos, 2006).
Os estudos moleculares realizados com morcegos brasileiros estão,
em geral, incorporados em trabalhos com amostragem geográfica mais
ampla, com objetivos diversos onde as amostras são apenas mais uma
localidade para os estudos filogenéticos e filogeográficos (Lee et al., 2002;
Hoffman & Baker, 2003; Hoffman et al., 2003). Por isso a estrutura
populacional e a história evolutiva dos morcegos no Brasil são muito
pouco conhecidas, e os animais endêmicos do país, como Chiroderma
doriae, Lonchophylla bokermanni; Lasiurus ebenus e Lasiurus egregius
são basicamente desconhecidos do ponto de vista molecular, a não ser
por duas seqüências de C. doriae depositadas no GenBank (Baker et al.,
1994; Hoffman et al., 2003).
Estudos moleculares feitos por autores brasileiros são ainda mais
raros. No Brasil, apesar de muito estudados do ponto de vista taxonômico
(tradicional, morfológico) e ecológico como dispersores de sementes,
polinizadores e em outros processos, cujos trabalhos de excelente
qualidade são númerosos demais para serem citados aqui, são poucos os
estudos genéticos e moleculares com morcegos. A maioria dos estudos
genéticos são de caracterização citogenética e evolução cariotípica de
algumas espécies como os realizados pelos grupos de pesquisa da Dra.
Maria José de Souza Lopes, UFPE; Dra. Margarette Sune Mattevi, ULBRA;
Dra. Rosina Djunko Miyazaki, UFMT; Dr. Julio Cesar Pieczarka, UFPA;
Geraldo Moretto, FURB, entre outros.
39
Um estudo recente de filogenia e evolução molecular (Redondo &
Santos, 2006) comparou genes de enzimas digestivas (α-amilases) e
genes mitocondriais na reconstrução de filogenias de morcegos e testou a
ocorrência de seleção natural em relação aos hábitos alimentares diversos
de Phyllostomidae. Não foi observado um padrão de diversificação do
gene da α-amilase com os diferentes hábitos, indicando que os processos
adaptativos alimentares nestes morcegos não se correlacionam com este
gene. No entanto, este gene autossômico e os genes mitocondriais
indicaram o agrupamento Euarchontolglires quando comparados entre as
ordens de mamíferos. Neste mesmo trabalho a posição filogenética do
gênero Sturnira, é colocada em dúvida.
Conclusão
A diversidade das espécies em morcegos tem sido pouco estudada
no Brasil. A base morfológica tem sido construída pelos esforços de
pesquisadores como Taddei, Handley e Koopman, que usaram os
princípios propostos por Mayr e outros pesquisadores durante a síntese
moderna para compreender a variação geográfica de espécies de
morcegos, delimitar espécies e definir unidades biogeográficas. É evidente
que a análise combinada de dados morfológicos e moleculares pode
render numerosos frutos. A síntese entre a metodologia molecular e os
estudos morfológicos provavelmente vai dominar a sistemática e a
biogeografia das espécies durante as próximas décadas. Portanto buscar a
interação entre sistematas morfológicos e moleculares será a palavra de
ordem de nossa comunidade. Precisamos estudar espécies iniciando-se
com estudos filogeográficos de variação intraespecifica e continuando para
níveis taxonômicos mais altos. Precisamos amostrar mais densamente a
40
Amazônia, a Mata Atlântica e principalmente a região central do Cerrado
para realmente compreender os processos potencialmente envolvidos na
diferenciação de morcegos, partindo do padrão de diversos táxons
ecologicamente distintos para inferir tendências e realmente testar os
diversos modelos propostos para a especiação na região tropical e talvez
gerar novos modelos que possam sumarizar os padrões encontrados com
maior precisão. O método comparativo será fundamental para o estudo
em quirópteros para a compreensão de padrões gerais de distribuição das
espécies e de sua biologia evolutiva.
Bibliografia
ADKINS, R.M.; & HONEYCUTT, R.L.. Molecular phylogeny of the
superorder Archonta. Proceedings of the National Academy of
Science U.S.A., v.88, p.10317-10321, 1991.
ALLARD, M.W.; MCNIFF, B.E. & MIYAMOTO, M.M. Support for interordinal
eutherian relationships, with an emphasis on Primates and their archontan
relatives. Molecular Phylogenetics and Evolution, v.5, p.78-88, 1996.
AMMERMAN, L.K., & HILLIS, D.M. A molecular test of bat relationships:
monophyly or diphyly? Systematic Biology, v.41, p.222-232, 1992.
APPLETON, B.R.; MCKENZIE, J.A. & CHRISTIDIS, L. Molecular systematics
and biogeography of the bent-wing bat complex Miniopterus schreibersii
(Kuhl, 1817) (Chiroptera: Vespertilionidae). Molecular Phylogenetics
and Evolution, v.31, n.2, p.431-439, 2004.
ARNASON, U.; ADEGOKE, A.J.; BODIN, K.; BORN,E.W.; ESA, Y.B.;
GULLBERG, A.; NILSSON, M.; SHORT, R.V.; XU, X & JANKE, A.
Mammalian mitogenomic relationships and the root of the eutherian tree.
41
Proceedings of the Natural Academy of Sciences U.S.A., v. 99, n.12,
p.8151-8156, 2002.
BAILEY, W.J.; SLIGHTOM, J.L. & GOODMAN, M. Rejection of the “flying
primate” hypothesis by phylogenetic evidence from the e-globin gene.
Science, v.256, p.86-89, 1992.
BAKER, R.J., TADDEI, V.A., HUDGEONS, J.L. & VAN DEN BUSSCHE, R.A.
Systematics relationships within Chiroderma (Chiroptera: Phyllostomidae)
based on cytochrome B sequence variation. Journal of Mammalogy,
v.75, n.2, p.321-327, 1994.
BATES, J.M.; HACKETT, S.J. & CRACRAFT, J. Area-relantionship in the
Neotropical lowlands: an hypothesis based on raw distribution of passerine
birds. Journal of Biogeography, v.25, p.783-793, 1988.
BURLAND, T.M.; BARRATT, E.M.; BEAUMONT, M.A. & RACEY, P.A.
Population genetic structure and gene flow in a gleaning bat, Plecotus
auritus. Proceedings of the Royal Society of London Series B.,
v.266, p.975-980, 1999.
CARSTENS, B.C.; LUNDRIGAN, B.L. & MYERS, P. A Phylogeny of the
Neotropical Nectar-Feeding Bats (Chiroptera: Phyllostomidae) Based on
Morphological and Molecular Data. Journal of Mammalian Evolution,
v.9, n.1/2, p.23-53, 2002.
CASTELLA, V.; RUEDI, M. & EXCOFFIER, L. Contrasted patters of
mitochondrial and nuclear structure among nursery colonies of the bat
Myotis myotis. Journal of Evolutionary Biology, v.14, p.708-720,
2000a.
42
CASTELLA, V.; RUEDI, M.; EXCOFFIER, L.; IBÁÑEZ, C.; ARLETTAZ, R. &
HAUSSER, J. Is the Gibraltar Straight a barrier to gene flow for the bat
Myotis myotis (Chiroptera: Vespertilionidae)? Molecular Ecology, v.9,
p.1761-1772, 2000b.
CAVALLI-SFORZA, L.L. & EDWARDS, A.W.F. Phylogenetic analysis: models
and estimation procedures. American Journal Human Genetics, v.19,
p.233-257, 1967.
COSTA, L.P. The historical bridge between the Amazon and the Atlantic
forest of Brazil: a study of molecular phylogeography with small
mammals. Journal of Biogeography, v.30, p.71-86, 2003.
DE JONG, W.W. Mocelules remodel the mammalian tree. Trends in
Ecology and Evolution, v.13, n.7, p. 270-275, 1998.
DEUSUC, F.; SCALLY, M.; MADSEN, O.; STANHOPE, M.J.; DE JONG, W.W.;
CATZEFLIS, F.M.; SPRINGER, M.S. & DOUZERY, E.J.P. Molecular
phylogeny of living xenarthrans and the impact of character and taxon
sampling on the placental tree rooting. Molecular Biology and
Evolution, v.19, n.10, p.1656-1671, 2002.
DITCHFIELD, A.D. & BURNS, K. DNA sequences reveal phylogeographic
similarities of neotropical bats and birds. Journal of Comparative
Biology, v.3, n.2, p.165-170, 1998.
DITCHFIELD, A.D. (2000). The comparative phylogeography of Neotropical
mammals: patterns of intraspecific mitochondrial DNA variation among
bats contrasted to nonvolant small mammals. Molecular Ecology, v.9,
p.1307-1318, 2000.
43
FELSENSTEIN, J. Infering Phylogenies. Sinauer Associates Inc.,
Massachusetts, EUA., 2004.
FELSENSTEIN, J. Evolutionary trees from DNA sequences: a maximum
likelihood approach. Journal of Molecular Evolution, v.17, p.368-376,
1981.
HENNIG, W. Phylogenetic Systematics [trad. Davis, D.D. e Zangerl,
R.]. University of Illinois Press, Urbana Illinois, EUA., 1966, 263p.
HOFFMAN, F.G. & BAKER, R.J. Comparative phylogeography of short-tailed
bats (Carollia: Phyllostomidae). Molecular Ecology, v.12, p.3403-3414,
2003.
HOFFMANN, F.G.; OWEN, J.G. & BAKER, R.J. mtDNA perspective on
chromosomal diversification and hybridization in Peter’s tent-making bat
(Uroderma bilobatum: Phyllostomidae). Molecular Ecology, v.12,
p.2981-2993, 2003.
JEPSEN, G.L. Bats origins and Evolution. In: WINSATT, W.A. Biology of
the bats Vol. I. Academic Press: New York, EUA., 1977.
JUSTE, J.; IBÁÑEZ, C.; MUÑOZ, J.; TRUJILLO, D.; BENDA, P.; KARATAS,
A. & RUEDI, M. Mitochondrial Phylogeography of the long-eared bats
(Plecotus) in the Mediterranian Palearctic and Atlantic Islands. Molecular
Phylogenetics and Evolution, v.31, n.3, p.1114-1126, 2004.
KENNEDY, M.; PATERSON, A.M.; MORALES, J.C.; PARSONS, S.;
WINNINGTON, A.P. & SPENCER, H.G. The long and short of it: branch
lengths and the problem of placing the New Zealand short-tailed bat,
Mystacina. Molecular Phylogenetics and Evolution, v.13, n.2, p.405-
416, 1999.
44
KERTH, G.; MAYER, F. & PETIT, E. Extreme sex-biased dispersal in the
communally breeding, non-migratory Bechstein’s bat (Myotis bechsteinii).
Molecular Ecology, v.11, p.1491-1498, 2002.
KIRSCH, J.A.W. Bats are monophyletic, megabats are monophyletic, but
are microbats also? Bat Research News, v.36: p.78, 1996.
KOOPMAN, K. F. Chiroptera. In: WILSON, D.E. & REEDER, D.M. Mammal
Species of the World. Smithsonian Institution Press, Washington EUA,
1993.
LEE, T.E.; STEVEN, R.; HOOFER, B. & VAN DEN BUSSCHE, R.A. Molecular
phylogenetics and taxonomic revision of the genus Tonatia (Chiroptera:
Phyllostomidae) Journal of Mammalogy, v.83, n.1, p.49–57, 2002.
LEWIS-ORITT, N.; PORTER, C.A. & BAKER, R.J. Molecular systematics of
the Family Mormoopidae (Chiroptera) based on cytochrome b and
Recombination Activating Gene 2 sequences. Molecular Phylogenetics
and Evolution, v.20, p.426-436, 2001.
LI, W.-H. Molecular Evolution. Sinauer Associates Inc., Massachusetts
EUA., 1997.
MADSEN, O.; SCALLY, M.; DOUARDY, C.J.; KAO, D.J.; DEBRY, R.W.;
ADKINS, R.M.; AMRINE, H.M.; STANHOPE, M.J.; DE JONG, W.W. &
SPRINGER, S. Parallel adaptative radiations in two major clades of
placental mammals. Nature, v.409: p.610-614, 2001.
MARTINS, F.M.; DITCHFIELD, A.D. & MORGANTE, J.S. Filogeografia
intraespecífica do morcego hematófago Desmodus rotundus (Chiroptera;
Phyllostomidae). In: Resumos do 49 congresso da Sociedade
Brasileira de Genética. Águas de Lindóia, 2003.
45
MAYR, E. What makes biology unique? Considerations on the
autonomy of a scientific discipline. Cambridge university press,
Cambridge, Inglaterra, 2004.
MCCRACKEN, G.F.; MCCRACKEN, M.K. & VAWTER, A.T. Genetic structure
in migratory populations of the bat Tadarida brasiliensis mexicana.
Journal of Mammalogy, v.75, p.500-514, 1994.
MILLER-BUTTERWORTH, C.; JACOBS, D.S. & HARLEY, E.H. Strong
population substructure is correlated with morphology and ecology in a
migratory bat. Nature, v.424, p.187-191, 2003.
MINDELL, D.P.; DICK, C.W. & BAKER, R.J. Phylogenetic relationships
among megabats, microbats, and primates. Proceedings of the Natural
Academy of Sciences U.S.A., v.88, n.22, p.10322-10326, 1991.
MURPHY, W.J.; EIZIRIK, E.; JONHSON, W.E.; ZHANG, Y.P.; RYDER, O.A. &
O’BRIEN, S.J. Molecular phylogenetics and the origin of placental
mammals. Nature, v. 409, p.614-618, 2001.
NEI, M. & KUMAR, S. Molecular Phylogenetics and Evolution. Oxford
University Press, New York EUA, 2000.
NIKAIDO, M.; HARADA, M.; CAO, Y.; HASEGAWA, M. & OKADA, N.
Monophyletic origin of the Order Chiroptera and its phylogenetic position
among Mammalia, as infered from the complete sequence of the
mitocondrial DNA of a japanese megabat, the Ryukyu flying fox (Pteropus
dasymallus). Journal of Molecular Evolution, v.51, p.318-328, 2000.
NOVACEK, M.J. Mammalian phylogeny: shaking the tree. Nature, v.256
p.121-125, 1992.
46
NOWAK, R.M. Walker’s Mammals of the World. 6.ed. Vol. I. The Johns
Hopkins press, New York, EUA., 1999.
PETIT, E. & MAYER, F. A population genetic analysis of migration: tha case
of the noctule nat (Nyctalus noctula). Molecular Ecology, v.9, p.683-
690, 2000.
PETTIGREW, J.D.; JAMIESON, B.G.; ROBSON, S.K.; HALL, L.S.;
MCANALLY, K.I. & COOPER, H.M. Phylogenetic relations between
microbats, megabats and primates (Mammalia: Chiroptera and Primates).
Philosophical Transations of the Royal Society of London series B.,
v.325, n.1229, p.489-559, 1989.
PETTIGREW, J.D. Flying primates? Megabats have the advanced pathway
from eye to midbrain. Science, v.231, p.1304-1306, 1986.
PUMO, D.E.; FINAMORE, P.S.; FRANEK, W.R.; PHILLIPS, C.J.; TARZAMI,
S. & BALZARANO, D. Complete mitochondrial genome of a neotropical
fruit bat, Artibeus jamaicensis, and a new hypothesis of the relationships
of bats to other eutherian mammals Journal of Molecular Evolution,
v.47, p.709-717, 1998.
REDONDO, R.A.F. & SANTOS, F.R. Evolutionary studies on alpha-amylase
gene segment in bats and other mammals. Genetica, v.126, p.199-213,
2006.
SIMMONS, N.B. The case for chiropteran monophyly. American Museum
Novitates, v.3103, p.1-54, 1994.
SIMMONS, N.B. & GEISLER, J.H. Phylogenetic relationships of
Icaronycteris, Archeonycteris, Hassianycteris, and Palaeochiropteryx to
extant bat lineages, with comments on the evolution of echolocation and
47
foraging strategies in microchiroptera. Bulletin of the American
Museum of Natural History, v.235, p.1-182, 1998.
SIMMONS, N.B. An Eocene Big Bang for bats. Science, v. 307, p.527-
528, 2005.
SINCLAIR, E.A.; WEBB, N.J.; MARCHANT, A.D. & TIDEMANN, C.R. Genetic
variation in the little red flying-fox, Pteropus scapulatus (Chiroptera:
Pteropodidae): implications for management. Biological Conservation,
v.76, p.45-50, 1996.
SMITH, J.D. & MADKOUR, G. Penial morphology and the question of
chiropteran phylogeny. In: WILSON, D.E. & GARDNER, A.L. Proceedings
of the Fifth International Bat Research Conference: 347-365.
Lubbock: Texas Tech Press, 1980.
SPRINGER, M.S.; TEELING, E. & STANHOPE, M.J. External Nasal Cartilages
in Bats: Evidence for Microchiropteran Monophyly?. Journal of
mammalian evolution, v.8, n.3, p.231-236, 2001.
SPRINGER, M.S.; STANHOPE, M.J.; MADSEN, O. & DE JONG, W.W.
Trends in Ecology and Evolution, v.19, n.8, p.430-438, 2004.
TEELING, E.C.; MADSEN, O.; VAN DEN BUSSCHE, R.A.; DE JONG, W.W.;
STANHOPE, M.J. & SPRINGER, M.S. Microbat paraphyly and the
convergent evolution of a key innovation in Old World rhinolophoid
microbats. Proceedings of the Natural Academy of Sciences U.S.A.,
v.99, n.3, p.1431-1436, 2001.
TEELING, E.C.; SPRINGER, M.S.; MADSEN, O.; BATES, P.; O’BRIEN, S.J. &
MURPHY, W.J. A molecular phylogeny for bats illuminates biogeography
and fossil record. Science, v.307, p.580-584, 2005.
48
TEELING, E.C.; MADSEN, O.; MURPHY, W.J.; SPRINGER, M.S. & O'BRIEN,
S.J. Nuclear gene sequences confirm an ancient link between New
Zealand's short-tailed bat and South American noctilionoid bats.
Molecular Phylogenetics and Evolution, v.28, p.208-319, 2003.
VAN DEN BUSSCHE, R.A.; HOOFER, S.R. & SIMMONS, N.B. Phylogenetic
relationships of mormoopid bats using mitochondrial gene sequences and
morphology. Journal of Mammalogy, v. 83, p.40-48, 2002.
VAN DEN BUSSCHE, R.A.; BAKER, R.J.; WICHMAN, H.A. & HAMILTON,
M.J. Molecular phylogenetics of Stenodermatini bat genera: Congruence of
data from nuclear and mitochondrial DNA. Molecular Biology and
Evolution, v.10, p.944-959, 1993.
Vanzolini, P.E. Distributional patterns of South American lizards. In:
VANZOLINI, P.E. & HEYER, W.R. Proceedings of a workshop on
Neotropical distribution patterns, 317-342p. Academia Brasileira de
Ciências, Rio de Janeiro, 1988.
WADDELL, P.; JOKADA, N. & HASEGAWA, M. Progress in resolving the
interordinal relationships of placental mammals. Systematic Biology,
v.48, p.1-5, 1999.
WAKELEY, J. The effects of subdivision on the genetic divergence of
populations and species. Evolution, v. 54, p.1092-1101, 2000.
WEBB, N.J. & TIDEMANN, C.R. Mobility of Australian flying foxes Pteropus
spp.: evidence from genetic variation. Proceedings of Royal Society of
London B., v.263, p.497-592, 1996.
49
WILKINSON, G.S. & FLEMING, T.H. Migration and evolution of lesser long-
nosed bats Leptonycteris curosoae, inferred from mitochondrial DNA.
Molecular Ecology, v.5, p.329-339, 1996.
WORTHINGTON-WILMER, J.; HALL, L.; BARRATT, E. & MORITZ, C. Genetic
structure and male-mediated gene flow in the ghost bat (Macroderma
gigas). Evolution 53, v.5, p.1582-1591, 1999.
WORTHINGTON-WILMER, J.; MORITZ, C. HALL, L. & TOOP, J. Extreme
population structuring in the threatened ghost bat, Macroderma gigas:
evidence from mitochondrial DNA. Proceedings of the Royal Society of
London B., v.257, p.193-198, 1994.
50
Capítulo 2.
Evolutionary studies on an α-amylase gene segment in bats and
other mammals
Artigo publicado no periódico:
Genetica: An International Journal of Genetics and Evolution (2006) 126:
199-213.
51
Evolutionary studies on an a-amylase gene segment in bats and other mammals
Rodrigo A.F. Redondo* & Fabrı
´
cio R. Santos
Laborato
´
rio de Biodiversidade e Evoluc¸a
˜
o Molecular, Departamento de Biologia Geral, Instituto de Cie
ˆncias
Biolo
´
gicas, Universidade Federal de Minas Gerais, C.P. 486, 31.270-010, Belo Horizonte, Minas Gerais,
Brazil; *Author for correspondence (Phone: +55-31-3499-2581; Fax: +55-31-3499-2570; E-mail:
[email protected])
Key words: a-amylase, bat diversity, mammal order phylogeny, natural selection tests
Abstract
Comparative studies of salivary glands showed that they maybe related to the adaptive radiation of bats,
especially in the family Phylostomidae. In this study we have been searching for a likely relationship
between different feeding habits found in bats and possible adaptive changes in a coding segment of the
a-amylase enzyme. We have also tested some hypothesis about the phylogenetic relationship of bats and
other mammals. A 663 bp segment of the a-amylase gene, corresponding to the exon 4 and part of the
intron c, was sequenced in nine bat species. The exon 4 was also sequenced in further ten mammalian
species. The phylogenetic trees generated with different methods produced the same results. When the
intron c and the exon 4 were independently analyzed, they showed distinct topologies involving the bat
species Sturnira lilium, different from the traditional bat phylogeny. Phylogenetic analysis of bats, primates
and rodents supports the Euarchontoglires-Laurasiather ia hypothesis about the relationship among these
groups. Selection tests showed that the a-amylase exon 4 is under strong purifying selection, probably
caused by functional constraints. The conflicting bat phylogenies could not be explained by evolutionary
convergence due to adaptive forces, and the different topologies may be likely due to the retention of
plesiomorphic characters or the indepen dent acquisition by evolutionary parallelism.
Introduction
The Chiroptera is the second most diverse order of
mammals in number of species, encompassing
more than 925 species occurring worldwide
(Nowak, 1999). Classically the Chiroptera belongs
to the Superorder Archonta, that includes Pri-
mates, Dermop tera (flying lemurs) and Scandentia
(tree shrews) (Novacek, 1992), but the traditional
view of mammalian phylogeny has been chal-
lenged by recent molecular evidence from nuclear
and mitochondrial data (Nikaido et al., 2000;
Madsen et al., 2001; Murphy et al., 2001; Arnason
et al., 2002; Deusuc et al., 2002; Springer et al.,
2004).
These recent studies give support to a very
different and more geographically correlated
classification, besides it is less clear at first look. In
this new mammalian tree, the bats are grouped
within the Laurasiatheria together Carnivora,
Pholidota, Perissodactyla, Cetartiodacty la (Artio-
dactyla plus Cetacea) and Soricomorpha. Pri-
mates, Dermoptera and Scandentia still cluster
together making up a sister group with Rodentia
and Lagomorpha within the Euarchontoglires
(Springer et al., 2004).
Although the most recent molecular data sup-
port the above views of the mammal tree, there are
still some molecular (and a bulk of morphological)
data supporting the traditional classification
(Adkins & Honeycutt, 1991; Allard, McNiff &
Miyamoto, 1996).
About 270 bat species live in the Neotropics,
most of these species (143) belongs to the
Genetica (2006) 126:199–213 Ó Springer 2006
DOI 10.1007/s10709-005-1449-9
52
Phyllostomidae family (Nowak, 1999). Phyllosto-
mid bats exhibit amazing adaptations and ac-
counts for the most radiated mammal group in
terms of feeding habits, including omnivory,
frugivory, nectarivory, insectivory/carnivory
(including piscivorous and frog eating species) and
the famous blood eating vampire bats (Ferarezzi &
Gimenez, 1996; Nowak, 1999).
Comparative studies using salivary glands in
mammals have previously suggested that their
evolution was correlated with the adaptive radia-
tion of these animals (Phillips & Tandler, 1996). The
same authors also found unique modifications on
bat’s salivary glands and showed that these features
were more correlated to their feeding habits than to
their phy logenetic relationships, suggesting con-
vergent evolution (Phillips, Tandler & Pinkstaff,
1987; Tandler, Phillips & Nagato, 1996). Immuno-
histochemistry assays and analysis of lysozyme
production in bats showed the same interesting
pattern (Phillips, Weiss & Tandler, 1998). Some
previous studies have also suggested that in frugiv-
orous mammalian species, the hydrolysis of starch
(and other polysaccharides) in the mouth helps the
identification of more nutritive food resources and a
salivary a-amylase would be favored by natural
selection (Ting et al., 1992).
However, molecular evolutionary studies of
digestive enzymes in bats have not been found in
literature, and it seems possible that the diversity of
feeding resources used by bats could be correlated
with a similar diversification of their digestive
enzymes.
The a-amylase (1,4-a-
D
-glucan glucanohy-
drolase E.C. 3.2.1.1) acts on the hydrolys is of
1,4-a-glucosidic linkages in oligosaccharides and
polysaccharides (as starch and glycogen) in a
random manner, reducing the size of these
molecules (Janecek, 1997).
In mammals, the primary structure of the a-
amylase have 496 amino acids and the catalytic
domain is composed by a triad of small and polar
amino acids, Aspartic acid, Glutamic acid and
Aspartic acid, and it is dependent of calcium
binding sites (Janecek, 1994, 1997). Most of these
features are found in the exon 4 (two catalytic sites
and two calci um binding sites).
Duplication of the a-amylase gene have been
found in some mammalian species (as primates
and rodents) but are thought to be independent
duplication events since their promoters are unre-
lated (Samuelson, Phillips & Swanberg, 1988;
Samuelson et al., 1990). The duplicated copies are
usually maintained extremely similar by concerted
evolution and gene conversion (Gumucio et al.,
1988).
In this study we have been searching for
possible adaptive changes in a coding segment of
the a-amylase enzyme that is likely correlated to
feeding habits. Besides, we have tested some
hypothesis about the phylogenetic relationship
between bats and other mammals.
Materials and methods
Samples
Nine bat species were collected with mist-nets in
distinct areas of the Atlantic Rain forest in
Southeast Brazil (Table 1). DNA was extracted
from liver tissue by standard phenol-chloroform-
isoamyl-alcohol method (Sambrook, Russell &
Sambrook, 2001).
Samples from 10 other mammalian species
(Table 1) used in this study were obtained in
scientific collections. All DNA samples were kept
at )20°C in the DNA repository of our laboratory
(Santos, Guimara
˜
es & Redondo, 2002).
DNA amplification
PCR reactions were carried out in 15 ll reactions
containing $40 ng of genomic DNA, 1X reaction
buffer 1B (Phoneutria
Ò
)1.5 mM MgCl
2
,10mM
Tris–HCl (pH 8.4), 50 mM KCl, 0.1% Triton X-
100), 200 lM dNTP mix (Amersham-Bioscienc-
es
Ò
), 0.5 lM of each primer (Table 2) and 1.25 U
of Taq DNA polymerase (Phoneutria
Ò
). PCR
cycling was conducted with a first denaturing step
at 94°C for 5 min, 35 cycles at 94°C for 30 s,
annealing temperature (Table 2) for 30s and
extension at 72°C for 80 s, and a final extension
step at 72°C for 5 min. PCR products were
checked on ethidium-bromide stained agarose gels.
The primers (Table 2, Figure 1) were designed
using sequ ences of a-amylase found in GenBank:
Homo sapiens (gi537511), Sus scrofa (gi6056337),
Mus musculus (gi6996908) and Rattus norvergicus
200
53
(gi13928683). The designed primers were previ-
ously tested on the simulation software Amplify
1.2 (Engel, 1992).
Sequencing
PCR products were purified with a 1:1 mix of 1 U of
Exonuclease I (EXO I) and 10 U of Shrimp Alka-
line Phos phatase (SAP). The sequencing reactions
were carried out with ET-DYE
Ò
kit (Amersham-
Biosciences) following manufacturer’s protocol,
with the each one of the primers used in the PCR
amplification. The sequencing runs were performed
in a MegaBACE 1000
Ò
capillary sequencer
(Amersham-Biosciences).
Base calling and consensus sequence generation
Sequence quality was checked on Phred v.0.20425
(Ewing & Green, 1998) and single individual con-
sensus sequences were assembled on Phrap
v.0.990319 (Green, 1994), and visualized and edited
on Consed 12.0 (Gordon, Abajian & Green, 1998).
Only sequences and positions with Phred values
Table 1. Species studied and source of the sequences
Species Order Sequence
Equus caballus (Linnaeus, 1758) Perissodactyla This study
Canis familiaris (Linnaeus, 1758) Carnivora This study
Cerdocyon thous (Linnaeus, 1766) Carnivora This study
Conepatus semistriatus (Boddaert, 1785) Carnivora This study
Eira barbara (Linnaeus, 1758) Carnivora This study
Bos taurus (Linnaeus, 1758) Cetartiodactyla This study
Sus scrofa (Linnaeus, 1758) Cetartiodactyla GenBank (AF064742.1)
Artibeus lituratus (Olfers, 1818) Chiroptera* This study
Chiroderma villosum (Peters, 1860) Chiroptera* This study
Molossus molossus (Pallas, 1766) Chiroptera*** This study
Myotis nigricans (Schinz, 1821) Chiroptera**** This study
Phyllostomus discolor (Wagner, 1843) Chiroptera** This study
Phyllostomus hastatus (Pallas, 1767) Chiroptera** This study
Platyrrhinus lineatus (E. Geoffroy, 1810) Chiroptera* This study
Sturnira lilium (E. Geoffroy, 1810) Chiroptera* This study
Vampyressa pusilla (Wagner, 1843) Chiroptera* This study
Sylvilagus brasiliensis (Linnaeus, 1758) Lagomorpha This study
Homo sapiens (Linnaeus, 1758) Primates GenBank (NT_021977, NM_020978.1,
M24895.1) and this study
Pan troglodytes (Blumenbach, 1775) Primates This study
Mus musculus (Linnaeus, 1758) Rodentia GenBank (NW_000201.1, NW_021792.1,
NM_007446.1, NM_009669.1)
Rattus norvegicus (Berkenhout, 1769) Rodentia GenBank (NM_031502.1, J00703.2,
NW_043548.1)
Dugong dugon (Mu
¨
ller, 1776) Sirenia This study
Gallus gallus (Linnaeus, 1758) Outgroup (Aves) GenBank (U63411.1)
Xenopus laevis (Daudin, 1802) Outgroup (Amphybia) GenBank (AF468647)
Tetraodon nigroviridis (de Proce
´
1822) Outgroup (Teleostei) GenBank (AJ427289)
Anguilla japonica (Temminck & Schlegel, 1846) Outgroup (Teleostei) GenBank (BAB85635.1)
*Phyllostomidae/Stenodermatinae.
**Phlyllostomidae/Phylostominae.
***Molossidae.
****Vespertillionidae.
201
54
over 20 were used in the analysis. Possible allelic
variants wer e checked on Polyphred software
(Nickerson, Tobe & Taylor, 1997). Some a-amylase
DNA sequences from other mammals and Verte-
brates were retrieved from GenBank (Table 1).
Data analyses
A consensus sequence was generated for each
species. Because few sequences sho wed low quality
data in positions particu larly in exon 3, we limited
our investigation on intron c and exon 4 (Figure 1)
totalizing 663 bp positions. Vampyressa pussilla
was only included on exon 4 analyses, because
only a small segment of intron c matched our
quality cut off. We have used two datasets in the
analyses (Table 1), the first one included the entire
segment (intron c + exon 4) and was analyzed in
species of Chiroptera, Primates and Rod entia
(named CPR dataset) and the second one include
only the exon 4 sequences in all available data
from distinct mammalian orders and other Verte-
brates (named ALL dataset).
Phylogenetic analysis
Phylogenetic analysis were conducted both on
PAUP* 4.08b (Swofford, 1998) and MEGA 2.1
(Kumar et al., 2001), with identical results. Maxi-
mum parsimony trees were searched with heuristic
procedure by Tree Bisection Reconnection algo-
rithm (TBR) on PAUP and Closest Neighbor In-
ter-exchange (CNI) on MEGA, both tested with
1000 bootstrap replicates and 10 rounds of ran-
dom addiction sequences. Neighbor Joining trees
were searched on MEGA 2.1, using Tamura-Nei
model (Tamura & Nei, 1993). Topology was tested
with a 1000 bootstrap replicates.
Parameters such as transition/transversion
ratio (R), GC content, nucleotide composition,
number of synonymous (S) and nonsynonymous
(N) sites and synonymous (s) and nonsynonymous
Table 2. Primer pairs developed and used in this study
Primers pairs Anealing temperature Expected size
BatAmy1 53°C $670 bp
CGAGAACTATAATGATGCTACTCAGG
BatAmy2
CTCCTGGTAAATGAAAGGTTTACTACC
BatAmy1b 53°C $715 bp
GTTCGTATTTATGTGGATGCTGTAA
BatAmy2
CTCCTGGTAAATGAAAGGTTTACTACC
BatAmy3 51°C $250 bp
GTCAGAGATTGTCGTCTGTCTGGTC
BatAmy2
CTCCTGGTAAATGAAAGGTTTACTACC
1b-2
1-2
3-2
~715 pb
~670 pb
~250 pb
Exon 3 Exon 4
intron c
intron d
Figure 1. Schematic representation of the a-amylase gene showing the location of the segments studied, the annealing primer sites
and the expected PCR fragment size. Numbers refer to primers listed in Table 2
202
55
(n) changes, and other sequence features were
calculated in MEGA 2.1.
Tests of natural selection and molecular adaptation
Only the CPR dataset was tested. We used three
different methodologies to test the influence of
natural selection in an a-amylase gene segment and
a possible episode of molecular adaptation in the
lineages.
First met hod: It is a pairwise distance test
described by Nei and Gojobory (1986) and its
modified version (Zhang, Rosemberg & Nei, 1998),
both implemented on MEGA 2.1 . The ratios d
N
(=n/N)andd
S
(=s/S) of nonsynonymous and
synonymous substitutions were also calculated on
MEGA 2.1.
A Z test was con ducted for each sequence pair
with:
Z ¼
d
N
À d
S
ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
Varðd
S
ÞþVarðd
N
Þ
p
where Var(d
N
) and Var(d
S
) are the variances of d
N
and d
S
as calculated by 1000 bootstrap replications.
The Z values were tested under three alterna-
tive hypotheses:
(a) a neutrality test; (b) a positive (darw inian)
selection test; and (c) a negative (purifying) selec-
tion test.
(a) H
0
:d
N
¼d
S
(b) H
0
:d
N
¼d
S
(c) H
0
:d
N
¼d
S
H1:d
N
6¼d
S
H
1
:d
N
>d
S
H
1
:d
N
<d
S
We have also inferred the ancestral sequences for
the 1, 2, 3, 4, 5 and P branches of the phylogenetic
tree on Figure 2a using Bayesian methods imple-
mented on PAML (Yang, Kumar & Nei, 1995;
Yang, 1997; Nielsen & Yang, 1998). These
sequences were used to calculate a Fisher exact test
for each branch and test selection among the lin-
eages as described in Zhang, Rosemberg and Nei
(1998).
Second method: The lineage test described by
Creevey and McInerney (2002) uses the Crann
software. In our study we tested both diversifying
and purifying selection and we have used the tree
shown in Figure 2a to perform this test.
Third method: The Likelihood Ratio Tests
(LRTs) were developed to detect selec tion using
many codon substitution models (Goldman &
Yang, 1994; Yang, 1998; Yang & Bielawski , 2000;
Yang & Nielsen, 2000, 2002; Yang, 2002).
The LRTs were tested as 2Â [Log(lH
0
) – Log
(lH
1
)] where lH
0
and lH
1
are the likelihood
functions of null and alternative hypothesis
(models) respectively and this value is checked on
a v
2
distribution with degrees of freedom equals to
the difference between the number of parameters
on each model. In all site-models the sites with
probability to be targets of selection were inferred
by Bayesian methods (Nielsen & Yang, 1998). All
calculations were made in the PAML program
(Yang, 1997).
Three kinds of models were tested:
(1) Branch models to detect selection on spe-
cific lineages. The lineages studied were the
same used in the Nei-Gojobory test
(Figure 2a);
(2) Site specific models that assume variable
selective pressure among sites;
(3) Branch-sites models.
Results
Sequence data
A total of 663 bp, corresponding to the entire exon
4 (231 bp) and most of the intron c (432 bp) of the
a-amylase gene were analyzed on the CPR dataset
consisting of nine at species, a human and a
chimpanzee sequences generated in our lab
(Table 1) and the sequences of human, rat and
mouse a-amylases 1 and 2. From the 663 bp, 455
sites were variable (100 bp in exon 4) and 197 bp
were invariable sites (131 in exon 4). In the ALL
dataset, several mammals were included as well as
other Vertebrates sequenced in our lab or retrieved
from the GenBank database (Table 1). The 231 bp
a-amylase exon 4 in the ALL dataset presented 147
variable and 84 invariable sites.
No indels were found in the coding region
studied and the transition/transversion ratio was
R=1.65 (CPR) and R=1.60 (ALL) , and nucleo-
tide composition A=25.4%, T=25.4%,
C=23.6% and G=25.6% for CPR datase t and
A=25.5%, T=26.4%, C= 22.5% and G=25.6%
for ALL dataset. The GC content is abo ut 49% in
the CPR dataset and 48% in the ALL dataset.
These values are according to the range observed
203
56
Artibeus lituratus
Chiroderma vilosum
Vampyressa pusilla
Platyrrhinus lineatus
Phyllostomus discolor
Phyllostomus hastatus
Myotis nigricans
Sturnira lilium
Molossus molossus
Homo sapiens Amy1
Homo sapiens Amy1*
Homo sapiens Amy2
Pan trogldytes
Rattus norvegicus Amy1
Mus musculus Amy1
Mus musculus Amy2
Rattus norvergicus Amy2
78
89
100
97
53
86
99
100
84
97
90
94
54
64
0.05
1
2
3
4
5
P
Phyllostomus hastatus
Phyllostomus discolor
Sturnira lilium
Artibeus lituratus
Chiroderma villosum
Platyrrhinus lineatus
Myotis nigricans
Molossus molossus
Mus musculus Amy
1
Mus musculus Amy
2
Rattus norvegicus
Pan troglodytes
Homo sapiens Amy
2
Homo sapiens Amy
1
Homo sapiens Amy
1*
95
100
98
96
100
83
88
59
98
99
78
92
0.1
(a)
(b)
Figure 2. Neighbor Joining phylogenetic reconstructions for the CPR dataset with different segments of the a-amylase gene. The
numbers near the branches refer to percentage of 1000 bootstrap replications. (a) exon 4 tree (231 bp), the numbers 1–5 and letter
‘P’ refer to the branches used in the selection tests (see material and methods). (b) intron c tree (432 bp).
204
57
in gene regions from Vertebrates (Nei & Kumar,
2000).
From the 231 positions in the a-amylase exon 4,
141 are zerofold degenerated for the CPR dataset
and 133 for the ALL dataset. This estimate sug-
gests that at least 60% of the sites are subjected to
nonsynonymous mutations. If we consider the
two- and fourfold degenerated sites we will have
about 86% of potential mutations to be nonsyn-
onymous, a number much greater than expected in
gene regions with equal nucleotide frequencies
(75%, Nei & Kumar, 2001). Those values could be
explained by the high GC content at 3rd codon
positions found in this exon (A3=15.3%,
T3=28.6%, C3=30.3%, G3=25.8% in CPR and
16.2, 31.0, 27.5, 25.3% in ALL) and could be
showing saturation in synonymous positions
caused by rest riction of function or spatial con-
formation of the gene product (Li, 1997; Golding
& Dean, 1998; Nei & Kumar, 2001).
Phylogenetic analyses
Our main interest in the phylogenetic reconstruc-
tions was to search for a pattern of molecular
convergence between the bats and their feeding
habits and to test if the a-amylase gene could be
useful to solve systematic problems as the rela-
tionship of mammalian orders including bats,
primates and rodents.
The first analysis was in the coding segment of
the CPR dataset (exon 4). Both neighbor joining
(NJ) and maximum parsimony consensus (MP, 6
trees with CI=0.742, RI=0.850, RCI = 0.630)
methods showed trees with identical topology
(Figure 2a), even when the deduced amino acids
sequences were used in the reconstruction (data
not shown). The trees revealed a grou p including
the vespertilionid bat Myotis nigricans and the
phyllostomid Sturnira lilium, in both nucleotide
and amino acid reconstructions. Thi s grouping
was totally unexpected since the placement of
these bat species in their respective families were
well established (Gannon, Willig & Knox-J ones,
1989; Lim, 1993; Simmon & Geisler, 1998; Nowak,
1999) and their feeding habits are quite different
(M. nigricans is a strict insectivorous and S. lilium
is a frugivorous bat) rejecting an adaptive con-
vergence hypothesis (see discussion). The positions
of other bat species in the tree were according to
the traditional view of bat phylogeny using
molecular data (Cytochrome-b, RAG-2, Van den
Bussche et al., 1993; Baker et al., 2000) and mor-
phology (Lim, 1993; Simmon & Geisler, 1998).
No resolution of the phyllostomid bat phylog-
eny could be observed at the amino acid level.
However both trees (data not shown) grouped
together the rodents and primates, supporting the
Euarchontoglires hypothesis (Madsen et al., 2001;
Murphy et al., 2001; Arnason et al., 2002; Deusuc
et al., 2002; Springer et al., 2004).
When the entire segment (intron c + exon 4,
663 bp) was analyzed, the tree topology changed
considerably (Figure 3a) and again the uniqu e
discrepancy was S. lilium that became a basal
branch of the phyllostomid bats when the tradi-
tional placement of S. lilium is at the base of
Stenodermatinae subfamily (Lim, 1993; Simmon &
Geisler, 1998). When only the intron c was ana-
lyzed (Figure 2b), S. lilium grouped with the
Phyllostominae bats Phyllostomus discolor and
P. hastatus.
The phylogenetic reconstructions using the
ALL dataset generated a tree with lots of polyto-
mies (Figure 4), presenting no resolution in the
relationship of mammal orders; even the avian
Gallus gallus sequence was placed in the middle of
the mammal polytomy.
As a final test to the Euarchontoglires versus
Archonta hypotheses, we constructed two new
trees. The CPR dataset was analyzed together
either Teleostei/Amphybia (not shown) or Dugong
dugon (Figure 3b), an Afrotheria/Panungulata
mammal, as outgroups. Both trees again gave
support to the Euarchontoglires grouping of
rodents and primates.
Selection tests
The traditional Nei-Gojobory test showed that
most of comparisons of sequence pairs revealed non
neutral evolution, suggesting purifying selection on
Z-tests. This test does not account for different
transition/transversion ratios (use R=0.5), with
could dramatically affect the d
N
and d
S
estimations
(Zhang, Rosemberg & Nei, 1998). We have esti-
mated the ratio R=1.65 in the CPR dataset, a value
at least three times higher. Thus a modified version
of this test (Zhang, Rosemberg & Nei, 1998) that
accounts for these features was applied, but the
same resul ts were obtained.
205
58
Dugong dugon
Artibeus lituratus
Chiroderma vilosum
Vampyressa pusilla
Platyrrhinus lineatus
Phyllostomus discolor
Phyllostomus hastatus
Myotis nigricans
Sturnira lilium
Molossus molossus
Homo sapiens Amy1
Homo sapiens Amy1*
Homo sapiens Amy2
Pan troglodytes
Rattus norvegicus Amy1
Mus musculus Amy1
Mus musculus Amy2
Rattus norvergicus Amy2
76
90
100
96
48
82
99
99
99
88
97
90
93
66
50
0.05
Chiroderma vilosum
Platyrrhinus lineatus
Artibeus lituratus
Phyllostomus discolor
Phyllostomus hastatus
Sturnira lilium
Myotis nigricans
Molossus molossus
Mus musculus Amy
1
Mus musculus Amy
2
Rattus norvegicus Amy
2
Pan troglodytes
Homo sapiens Amy
2
Homo sapiens Amy
1
Homo sapiens Amy
1*
100
100
100
81
100
100
98
96
99
49
100
73
0.05
(a)
(b)
Figure 3. (a) Neighbor Joining phylogenetic reconstruction for the CPR dataset with the entire fragment (663 bp) of the a-amylase
gene studied. The numbers near the branches refer to percentage of 1000 bootstrap replications. (b) Neighbor Joining phylogenetic
reconstruction for the CPR dataset (exon 4 only) using Dugong dugon (Sirenia: Afrotheria) as an outgroup. The numbers near the
branches refer to percentage of 1000 bootstrap replications.
206
59
Canis familiaris
Cerdocyon thous
Dugong dugon
Conepatus semistriatus
Eira barbara
Equus caballus
Sus scrofa
Bos taurus
Homo sapiens Amy
2
Pan troglodytes
Homo sapiens Amy
1
Homo sapiens Amy
1*
Gallus gallus
Sylvilagus brasiliensis
Rattus norvegicus Amy
1
Mus musculus Amy1
Rattus norvegicus Amy
2
Mus musculus Amy
2
Molossus molossus
Myotis nigricans
Sturnira lilium
Phyllostomus discolor
Phyllostomus hastatus
Vampyressa pusilla
Platyrrhinus lineatus
Artibeus lituratus
Chiroderma vilosum
Xenopus
Anguilla
Tetraodon
98
100
99
60
79
92
80
60
93
99
87
99
79
96
98
76
88
Figure 4. Phylogenetic reconstruction for the ALL dataset using the exon 4 segment. The numbers near the branches refer to per-
centage of 1000 bootstrap replications. Branches with less than 50% bootstrap values were collapsed.
207
60
Because the Z test is designed for large samples,
the number of synonymous and nonsynonymous
positions must be usually large. Thus we have also
used a Fisher exact test on the inferred ancestral
sequences, which is indicated for small samples
(Zhang, Kumar & Nei, 1997; Zhang, Rosem berg &
Nei, 1998). The selection tests using the Fisher exact
test were all significant at p < 0.05. However this is
a bidirectional test and the values of d
N
and d
S
must
be compared. With 168 nonsynonymous sites and
s $ 27 and 63 synonymous sites with n $ 11 we
have d
N
=0.06 and d
S
=0.4, implying a massive
presence of purifying selection with x=0.15.
Yang (2002) made several critiques on the use
of the Fisher exact tests to search for selection in
gene lineages. First, they are based on ancestral
reconstruction that many times can contain errors
or underestimate the substitutions. Second, this
kind of test does not account for GC content on
3rd codon positions, so the estimates of d
S
and d
N
are inaccurate.
The Creevey–MacInerley test detected non
neutral evolution occurring in all but two bran-
ches. It also detected an increase in nonsynony-
mous non-directional changes in three branches,
one in the branch 3 in Figure 2a and two others in
the Primates lineage (the basal and Pan troglo-
dytes-Homo sapiens a-amylase two branches). The
two neutral ones included the branch with
sequences of a-amylase 1 from GenBank and the
human sequence from our lab (this result was
expected), and the branch of a-amylase 2 in mouse
and rat. The most interesting result in this test is in
the branch 3 in Figure 2a where both the purifying
and diversifying selection tests were shown to be
significant (p < 0.05). This may indicate that
some sites could be under purifying selection by
functional restrictions while others may be
released from those restrictions (Creevey &
McInerney, 2002). This is the only branch that
contradicts the traditional phylogeny of bats.
Table 3. Likelihood results and parameter estimates in the codon models
Models Log(‘) Estimates of parameters Detected sites
M0 )1186.08 x=0.1639
Branch 1 B1 )1185.77 x=0.1715 NA
Branch 2 B1 )1186.58 x=0.1715 NA
Branch 3 B1 )1184.33 x=0.1796 NA
Branch 4 B1 )1184.93 x=0.1750 NA
Branch 5 B1 )1185.28 x=0.1709 NA
Branch P B1 )1185.72 x=0.1593 NA
Sites M1 )1192.75 NA
M2 )1192.70 p
2
=0.03 (x=4.07)
M3 )1171.47 p
2
=0.01 (x=2.38) 7 (98%)
M7b )1172.85 p=0.4
M8bx )1171.89 p
1
=0.01 (x=2.37); 7 (90%)
Branch-sites 1 MA )1189.05
MB )1171.12
Branch-sites 2 MA )1187.54
MB )1171.13
Branch-sites 3 MA )1185.01
MB )1171.43
Branch-sites 4 MA )1188.48
MB )1172.27
Branch-sites 5 MA )1189.97
MB )1172.61
Branch-sites P MA )1188.20 P
2
=0.018 (x=0.99) 63 (99%)
MB )1168.95 P
2
=0.024 (x=0.99) 23 (77%); 63 (99%)
NA: not allowed.
208
61
In the codon-substitution models tested, all x
ratios estimated for the lineages presented very low
values (Table 3), which suggest purifying selection
(Yang & Bielawski, 2000; Yang, 2002). Because
some high values of x were observed in the sites
analysis, this could indicate the presence of a
mosaic sequence with some sites that are under
functional constraints and others that are not
(Yang & Nielsen, 2002).
The first LRT analyzed was between models
M0 (one x ratio) and B1 (two x ratios), which was
intended to verify if the x values were different
between the lineage of interest and others . Each
branch labeled in Figure 2a was tested for positive
selection. The B1 model did not fit the data better
than the M0 (Table 3). Only the branch 3 pre-
sented a ‘marginal’ statistic significan ce (p=0.06).
Marginal probabilities have been used as an
indicative of a probable increa se in x (Yang &
Nielsen, 2002). However our estimates for x in this
model was very low (x=0.1796) and this
hypothesis seems unlikely.
In the tests using the sit es models, the first one
compares the one ratio model M0 with the M3
model, where x is divided in discrete classes, in our
case K=3 classes, with the proportion (p) of sites
belonging to each class estimated from data. The
discrete model fits the data much better than the
one ratio model, with p = 0.000 and a proportion
of sites p
2
= 0.01 with x
2
= 2.38. Bayesian anal-
ysis also indicates a probable site under strong
selective pressure at codon 7, with 97% of prob-
ability (Table 3). Again it seems that different
selective pressures occur among the sites. The
second test on sites models was performed with the
M1 (neutral) and M2 (selecti on) models. M1 sets
two x classes, with x
1
=1 and x
0
=0, and M2 adds
a third class with x
2
estimated from the data to
verify sites with x values higher than 1. Again this
test was not significant (p = 0.95).
The above test could be very conservative
(Yang & Nielsen, 2002) and a new comparison
with a more homogeneous distribution of x was
used. This third test on sites models uses the M7 b
model as a null hypothesis. This model make use
of a b distribution of x classes (b varies from 0 to
1) that is a flexible null hypothesis for testing
positive selection. The alternative model M8bx
adds a new site class with x estimated from data,
and despite it does not fit the da ta better than the
M7b model (p = 0.38), it estimates a x=2.37 in
1% of the sites and the bayesian analysis also
indicates the codon number 7 as a possible target
of selection with 90% of probability.
The last selection test uses the branch-sites
models. The MA model only allows sites under
selective pressure in the interest (foreground)
branches, and it was applied in the labeled bran-
ches of Figure 2a. In this LRT, the M1 model is
the null hypothesis against the MA. The MA
model fits the data better in all but one branch
(Table 3). Only the branch leading to the Steno-
dermatinae bats (branch 5) presented a ‘marginal’
p value (0.06). The model also indicates a site
under selective pressure at codon 6 3 wi th 99%
probability in the primate branch. The final LRT
was between the neutral M1 model and the
branch-site model MB that is the branch-site
model version of the M3 model with a discrete
class distribution for x among the sit es, so it can
be tested against the M3 model. This model only
fits the data better in the primate branch (P) and it
identified the same codon under selection as the
MA model (63; 99% probability) and a new one at
codon 23 with 71% probability.
Discussion
The incoherence found in the bat phylogeny using
a-amylase exon 4 could not be explained by
adaptive convergence since both anima ls involved
have very distinct feeding habits and belong to
different lineages (Gannon , Willig & Knox-Jones,
1989; Lim, 1993; Nowak, 1999). It is most likely
that the substitutions found to be shared between
S. lilium and M . nigricans could be either an evi-
dence of ancest ral character states (plesiomor-
phies) retained in S. lilium or the independent
acquisition of these characters by both taxa.
Although S. lilium and M. nigricans share some
radical nonsynonymous substitutions (Figure 5),
the raw number of differences between them is the
same as found between M. nigricans and Molossus
molossus. A phylogenetic tree constructed without
the 3rd codon positions (data not shown) groups
all three bats above and Platyrrhinus lineatus,
Phyllostomus hastatus and Phyllostomus discolor.
It confirms that most of differences among them
are at 3rd codon positions, normally the most
degenerated position in coding regions (Li, 1997;
209
62
Nei & Kumar, 2000). Thus, the possibility of
independent acquisition of shared mutations
between S. lilium and M. nigricans lineages seems
likely particularly because of the presence of sat-
uration at 3rd codon positions.
S. lilium have been traditionally considered a
basal member of Stenodermatinae subfam ily (Lim,
1993; Simmon & Geisler, 1998) and it displays
remarkable cerebral morpho logical differences as
well as other features, when compared to other
Stenodermatinae bats (Gannon, Willig &
Knox-Jones, 1989).
To further investigate the place of S. lilium in
the Phyllostomidae family, it would be needed an
increment in the taxon sampling, with a higher
number of bat species, especially basal phyllosto-
mids as Macrotus and other species of the Sturnira
genus. If a similar pattern related to S. lilium were
found in other bats, then the occurrence of inde-
pendent acquisition would become more likely.
Another possible explanation is that an inde-
pendent duplication of the a-amylase gene may
have occurred, followed by a (likely) deletion of
distinct paralogous copies, misguiding our phylo-
genetic reconstructions. Independent duplications
of a-amylase genes have been described in litera-
ture for other mammals (Samuelson, Phillips &
Swanberg, 1988; Samuelson et al., 1990). However
we have not found any evidence of the presence of
distinct a-amylase copies in bats. All the sequences
have been checked with Polyphred (Nickerson,
Tobe & Taylor, 1997) to search for differences that
could be attributed to paralogous gene sequences.
The exon 4 was not useful to discriminate
mammal orders because of the presence of many
polytomies (Figure 4). Maybe the analysis of a
larger segment of the a-amylase gene, with many
coding and noncoding regions , would increase its
resolution. However, exon 4 was used to investi-
gate the relationships among the orders Chirop-
tera, Primates and Rodentia, giving support to the
Euarchontoglires hypothesis against the existence
of Archonta.
Most of selection tests showed strong evidence
of purifying selection. However some methods
imply the possible existence of sites under diver-
sifying selection in a ‘sea’ of functionally restricted
sites. No radica l amino acid change in size or
polarity could be verified in any of the sites pro-
posed to be under selection in the codon models
(codons 7, 23, 63; Table 3, Figure 5). It is unlikely
that the amino acid changes in the proposed sites
affect significantly the function of this protein
(Golding & Dean, 1998; Tourasse & Li, 2000). In
fact, only codon 7 displays a slight change in
polarity from a nonpolar to a neutral amino acid
Figure 5. Alignment of the deduced amino acid sequences for the exon 4 of the a-amylase gene in the CPR dataset, showing the
physicochemical properties classification of amino acids according to Zhang (2000). Dots (.) in the alignment mean identical amino
acid to first sequence.
210
63
(Creighton, 1993; Zhang, 2000) and it seems to be
nondirectional, uncorrelated with lineage rela-
tionship or feeding habits (Figure 5).
Only a few amino acid alterations found in this
study could be considered radical changes and may
affect the enzyme function; however there is no
indication that they are under selection. The first
one in codon 57 is a size change that occurs only in
the Stenodermatinae lineage (Sturnira lilium
included). The small and polar amino acid Glu-
tamine (Q) is found instead of the large and polar
Arginine (R in Phyllostomidae) and Lysine (K in
all other organisms studied) (Figure 5).
Another similar size change is found in codon
59, where S. lilium and M. nigricans have ag ain a
Glutamine and the other organisms presented the
large and polar Histidine (H) (Figure 5).
In codon 60, another radical change shared by
S. lilium and M. nigricans that carry the small and
neutral Proline (P) where the phyllostomid bats
have Histidine (H, large and Polar), and M. mo-
lossus and the others have small polar amino acids
(Glutamine and Asparagine, respectively)
(Figure 5). This change in size and polarity found
in the phyllostomid bats (except S. lilium) could be
taking to an important change in protein structure
and function (Creighton, 1993).
An interesting radical change appears in codon
64 and it is lineage related. Primates have the small
and polar Asparagine (N), Rodentia present the
large and polar Lysine (K) and the Chiroptera
displays the neutral and small amino acids Thre-
onine (T) and Serine (S) (Figure 5).
The last radical change happens in one of the
catalytic amino acids in the 77 codon position,
where we found Sturnira lilium and Phyllostomus
discolor with the small and neutral Glycine (G)
and the other organisms studied have small and
polar (negatively charged) amino acids. Besides
the apparent importance of this site (codon 77) as
a part of the catalytic triad of the a-amylase pro-
tein, variations have been reported in other
organisms in literature, and it is considered the
least important of the triad (Janecek, 1994, 1997).
However, Glycine has been also reported to show
a weak negative charge (Creighton, 1993).
No alterations in the other catalytic site (codon
41) or on the calcium binding sites (codon 11 and
45) were detected and these sites are the most
important for the correct functioning of a-amylase
(Janecek, 1994, 1997).
Graur (1985) showed a great correlation
between the amino acid composition and the
evolution rate in proteins, but this correlation was
extremely criticized and several works confirm that
the evolutionary rate of a protein depends mostly
on the three-dimensional structure than on its
primary sequence (Golding & Dean, 1998; Tou-
rasse & Li, 2000).
In fact, the importance of a-amylase functional
restrictions could be seen when the nucleotide
(mRNA) and the amino acid (protein) sequences
of Asterias ruber, a starfish, and Sus scrofa, the
domestic pig, (the best known a-amylase structure;
Janecek, 1994, 1997). are aligned (data not shown).
The nucleotide sequences are very divergent but at
the amino acid level they are much more similar,
showing a conserved amino acid sequence even
between such phylogenetically distant groups.
The a-amylase gene seems to be under strong
structural and functional restrictions with purify-
ing selection affecting almost all sites as attested by
our results. Because it is the main enzyme related
to the digestion of starch and sucrose (Janecek,
1994, 1997), its correct functioning is essential for
the primary metabolism. However our results may
indicate it is not related to the distinct feeding
habits observed in bats.
The present work represents a detailed analysis
of gene segments that could be likely influenced by
Natural Selection, and related to species diversifi-
cation and adaptation. Through the use of distinct
selection tests, we could identify several evidences
of purifying selection, indicating functional con-
straints affe cting in the same way distinct lineages.
Besides, the comparison with distinct mammalian
orders supported some recent findings of the
Euarchontoglires grouping. The same strategy
could be further applied to larger gene segments
and several other genes that co uld be under
selection influence.
Acknowledgments
We would like to thank to FBPN (Fundac¸ a
˜
oo
Botica
´
rio de Protec¸ a
˜
oa
`
Natureza), FAPEMIG
(Fundac¸ a
˜
o de Amparo a
`
Pesquisa de Minas Ge-
rais) and PELD-CNPq for the financial support
to the project, and CAPES and CNPq from Bra-
zil for the fellowships to RAFR and FRS. Native
211
64
animal samples were collected under licenses 011/
2000, 053/20 01 and 070/2002 issued by IBAMA,
and this work was allowed by the special autho-
rization of access to genetic resource # 03/2004
emitted by the Ministry of Environment of Brazil
(CGEN/MMA).
References
Adkins, R.M. & R.L. Honeycutt, 1991. Molecular phylogeny of
the superorder Archonta. Proc. Natl. Acad. Sci. USA 88:
10317–10321.
Allard, M.W., B.E. McNiff & M.M. Miyamoto, 1996. Support
for interordinal eutherian relationships, with an emphasis
on Primates and their archontan relatives. Mol. Phylogenet.
Evol. 5: 78–88.
Arnason, U., A.J. Adegoke, K. Bodin, E.W. Born, Y.B. Esa, A.
Gullberg, M. Nilsson, R.V. Short, X. Xu & A. Janke, 2002.
Mammalian mitogenomic relationships and the root of the
eutherian tree. Proc. Natl. Acad. Sci. USA 99(12): 8151–
8156.
Baker, R.J., C.A. Porter, J.C. Patton & R.A. Van Den Bussche,
2000. Systematics of Bats of the Family Phyllostomidae
based on RAG2 DNA Sequences. Occasional Papers The
Museum Texas Technological University 202: 1–16.
Creevey, C. & J.O. McInerney, 2002. An algorithm for
detecting directional and non-directional positive selection,
neutrality and negative selection in protein coding DNA
sequences. Gene 300: 43–51.
Creighton, T.E., 1993. Proteins: Structures and Molecular
Properties. 2nd edn. W.H. Freeman publisher, New York,
USA.
Deusuc, F., M. Scally, O. Madsen, M.J. Stanhope, W.W. de
Jong, F.M. Catzeflis, M.S. Springer & E.J.P. Douzery,
2002. Molecular phylogeny of living xenarthrans and the
impact of character and taxon sampling on the placental
tree rooting. Mol. Biol. Evol. 19(10): 1656–1671.
Engel, W., 1992. Amplify 1.2. Departament of Genetics,
University of Wisconsin.
Ewing, B. & P. Green, 1998. Basecalling of automated
sequencer traces using Phred II Error probabilities.
Genome Res. 8: 186–194.
Ferarezzi, H. & E.A. Gimenez, 1996. Systematic patterns and
the evolution of feeding habits in Chiroptera (Archonta:
Mammalia). J. Compar. Biol. 1(3–4): 75–94.
Gannon, M.R., M.R. Willig & J. Knox-Jones, 1989. Sturnira
lilium. Mammalian Species 333: 1–5.
Golding, G.B. & A.M. Dean, 1998. The structural basis of
molecular adaptation. Mol. Biol. Evol. 15(4): 355–369.
Goldman, N. & Z. Yang, 1994. A codon-based model of
nucleotide substitution for protein coding DNA sequences.
Mol. Biol. Evol. 11(5): 725–736.
Gordon, D., C. Abajian & P. Green, 1998. Consed: a graphical
tool for sequence finishing. Genome Res. 8: 195–202.
Graur, D., 1985. Amino acid composition and the evolutionary
rates of protein-coding genes. J. Mol. Evol. 22: 53–62.
Green, P. 1994. Phrap.www.genome.washington.edu/UWGC/
analysistools/phrap.htm.
Gumucio, D.L., Wiebauer, K., Caldwell, R.M.; Samuelson,
L.C. & Meisler, M.H. Concerted evolution of human
amylase genes. Mol. Cell. Biol. 8: 1197–1205.
Janecek, S., 1994. Sequence similarities and evolutionary
relationships of microbial, plant and animal a-amylases.
Eur. J. Biochem. 224: 519–524.
Janecek, S., 1994. Sequence similarities and evolutionary
relationships of microbial, plant and animal a-amylases.
Eur. J. Biochem. 224: 519–524.
Janecek, S., 1997. a-amylase family: molecular biology and
evolution. Prog. Biophys. Mol. Biol. 67(1): 67–97.
Kumar, S., K. Tamura, I.B. Jakobsen & M. Nei, 2001.
MEGA2: Molecular Evolutionary Genetics Analysis soft-
ware. Bioinformatics 17(12): 1244–1245.
Li, W.-H., 1997. Molecular Evolution. Sinauer Associates Inc,
Massachusetts USA.
Lim, B.K., 1993. Cladistic reapraisal of neotropical Stenoder-
matinae bat phylogeny. Cladistics 9: 147–165.
Madsen, O., M. Scally, C.J. Douardy, D.J. Kao, R.W. DeBry,
R.M. Adkins, H.M. Amrine, M.J. Stanhope, W.W. de Jong
& S. Springer, 2001. Parallel adaptive radiations in two
major clades of placental mammals. Nature 409: 610–614.
Murphy, W.J., E. Eizirik, W.E. Jonhson, Y.P. Zhang,
O.A. Ryder & S.J. O’brien, 2001. Molecular phylogenetics
and the origin of placental mammals. Nature 409: 614–618.
Nei, M. & T. Gojobori, 1986. Simple methods for estimating
the numbers of synonymous and nonsynonymous nucleo-
tide substitutions. Mol. Biol. Evol. 3: 418–426.
Nei, M. & S. Kumar, 2000. Molecular Evolution and Phylog-
enetics. Oxford University Press, New York USA.
Nickerson, D.A, V.O. Tobe & S.L. Taylor, 1997. Polyphred:
automating the detection and genotyping of single nucle-
otide substitutions using fluorescence-based resequencing.
Nucl. Acids Res. 25: 2745–2751.
Nielsen, R. & Z. Yang, 1998. Likelihood models for detecting
positively selected amino acid sites and applications to the
HIV-1 envelope gene. Genetics 148: 929–936.
Nikaido, M., M. Harada, Y. Cao, M. Hasegawa & N. Okada,
2000. Monophyletic origin of the Order Chiroptera and its
phylogenetic position among Mammalia, as infered from
the complete sequence of the mitocondrial DNA of a
japanese megabat, the Ryukyu flying fox (Pteropus dasy-
mallus). J.Mol. Evol. 51: 318–328.
Novacek, M.J., 1992. Mammalian phylogeny: shaking the tree.
Nature 256: 121–125.
Nowak, R.M., 1999. Walker’s Mammals of the World. 6 edn.,
Vol. I. The Johns Hopkins University Press.
Phillips, C.J. & B. Tandler, 1996. Salivary glands, cellular
evolution, and adaptive radiation in mammals. Eur. J.
Morphol. 34(3): 155–161.
Phillips, C.J., B. Tandler & C.A. Pinkstaff, 1987. Unique
salivary glands in two genera of tropical microchiropteran
bats: an example of evolutionary convergence in histology
and hystochemistry. J. Mammal. 68(2): 235–242.
Phillips, C.J., A. Weiss & B. Tandler, 1998. Plasticity and
patterns of evolution in mammalias sallivary glands:
comparative immunohistochemistry of lysozyme in bats.
Eur. J. Morphol. 36(suplement): 19–26.
Sambrook, J., D.W. Russell & J. Sambrook, 2001. Molecular
Cloning: A Laboratory Manual. 3CSHL press, New York
USA.
212
65
Samuelson, L.C., R.S. Phillips & L.J. Swanberg, 1988. Amylase
gene structures in Primates: retroposon insertions and
promoter evolution. Mol. Biol. Evol. 13(6): 767–779.
Samuelson, L.C., K Wiebauer, C.M. Snow & M.H. Meisler,
1990. Retroviral and pseudogene insertion sites reveal the
lineage of human salivary and pancreatic amylase genes
from a single gene during primate evolution. Mol. Cell.
Biol. 10: 2513–2520.
Santos, F.R., P.E.M. Guimara
˜
es & R.A.F. Redondo, 2002.
Bancos de DNA: colec¸ o
˜
es estrate
´
gicas para estudos da
biodiversidade. Lundiana: Int. J. Biodivers. 3(2): 93–98.
Simmons, N.B. & J.H. Geisler, 1998. Phylogenetic relationships
of Icaronycteris, Archeonycteris, Hassianycteris, and Palae-
ochiropteryx to extant bat lineages, with comments on the
evolution of echolocation and foraging strategies in micro-
chiroptera. Bull. Am. Museum Nat. History. 235: 1–182.
Springer, M.S., M.J. Stanhop, O. Madsen & W.W. de Jong,
2004. Molecules consolidates the placental mammal tree.
Trends Ecol. Evol. 19(8): 430–438.
Swofford, D.L. 1998. PAUP*: Phylogenetic Analysis Using
Parsimony (*and Other Methods). Version 4.08b. Sinauer
Associates Inc, Massachusetts USA.
Tamura, K. & M. Nei, 1993. Estimation of the number of
nucleotide substitutions in the control region of mitochon-
drial DNA in humans and chimpanzees. Mol. Biol. Evol.
10: 512–526.
Tandler, B., C.J. Phillips & T. Nagato, 1996. Histological
convergent evolution of the accessory submandibular
glands in four species of frog-eating bats. Eur. J. Morphol.
34(3): 163–168.
Ting, C.-N., M.P. Rosemberg, C.M. Snow, L.C. Samuelson &
H.M. Meisler, 1992. Parotid-specific expression of a human
salivary amylase gene in transgenic mice. Genes Develop. 6:
1457–1465.
Tourasse, N.J. & W.-H. Li, 2000. Selective constraints, amino
acid composition and the rate of protein evolution. Mol.
Biol. Evol. 17(4): 656–664.
Van den Bussche, R.A., R.J. Baker, H.A. Wichman &
M.J. Hamilton, 1993. Molecular phylogenetics of Steno-
dermatini bat genera: congruence of data from nuclear and
mitochondrial DNA. Mol. Biol. Evol. 10(5): 944–959.
Yang, Z. & J.P. Bielawski, 2000. Statical methods for detecting
molecular adaptation. Trends Ecol. Evol. 15(12): 496–503.
Yang, Z. & R. Nielsen, 2000. Estimating synonymous and
nonsynonymous substitution rates under realistic evolu-
tionary models. Mol. Biol. Evol. 17: 32–43.
Yang, Z. & R. Nielsen, 2002. Codon-substitution models for
detecting molecular adaptation at individual sites along
specific lineages. Mol. Biol. Evol. 19(6): 908–917.
Yang, Z., 1997. PAML: a program package for phylogenetic
analysis by maximum likelihood. CABIOS 13: 555–556.
Yang, Z., 1998. Likelihood ratio tests for detecting positive
selection and application to Primate lysozyme evolution.
Mol. Biol. Evol. 15(5): 568–573.
Yang, Z., 2002. Inference of selection from multiple species
alignments. Curr. Opin. Genet. Develop. 12: 688–694.
Yang Z, Kumar S., Nei M. (1995) A new method of inference of
ancestral nucleotide and amino acid sequences Genetics
141:1641–1650.
Zhang, J., S. Kumar & M. Nei, 1997. Small-sample tests of
episodic adaptive evolution: a case of Primate lysozymes.
Mol. Biol. Evol. 14(12): 1335–1338.
Zhang, J., H.F. Rosenberg & M. Nei, 1998. Positive Darwinian
selection after gene duplication in primate ribonuclease
genes. Proc. Natl. Acad. Sci. USA 95: 3708–3713.
Zhang, J., 2000. Rates of conservative and radical nonsynon-
ymous nucleotide substitutions in mammalian nuclear
genes. J. Mol. Evol. 50: 56–68.
213
66
Capítulo 3.
Molecular systematics of the Artibeus genus (CHIROPTERA:
PHYLLOSTOMIDAE)
Trabalho submetido para Molecular Phylogenetics and Evolution
67
Elsevier Editorial System(tm) for Molecular Phylogenetics and Evolution
Manuscript Draft
Manuscript Number: MPE-07-420R1
Title: Molecular systematics of the genus Artibeus (CHIROPTERA: PHYLLOSTOMIDAE)
Article Type: Research Paper
Section/Category:
Keywords: Artibeus; molecular taxonomy; systematics; phylogenetics; bats; Chiroptera
Corresponding Author: Dr Rodrigo AF Redondo, Ph.D
Corresponding Author's Institution: Universidade Federal de Minas gerais
First Author: Rodrigo AF Redondo, PhD
Order of Authors: Rodrigo AF Redondo, PhD; Leticia P Brina, BSc; Ricardo F Silva; Albert D Ditchfield, PhD;
Fabricio R Santos, PhD
Manuscript Region of Origin:
Abstract: A molecular phylogeny of the genus Artibeus using all recognized species, many with samples
from a broad geographic range, is presented. The analysis shows a clear distinction between the two
subgenera (or genera), the 'large' Artibeus and the 'small' Dermanura, in both mitochondrial and nuclear
genes. The placement and status of A. concolor remains inconclusive and is presented as the third
subgenus Koopmania. The phylogenies and divergence time estimates show a marked influence of the
Andes in the formation of the subgenera and the main lineages inside each subgenus. Nuclear genes
showed a highly incomplete lineage sorting among species inside subgenera Artibeus and Dermanura.
Indeed, shared alleles were also found between Artibeus and Koopmania, which are presumed to have split
apart during the Miocene, showing that great care should be taken in using these markers. Cytochrome-b
gene divergences and monophyly analyses suggest that A. lituratus and A. intermedius are indeed
conspecifics. These analyses also suggested the existence of at least four 'new' species revealing a
significant cryptic diversity inside the genus.
68
1
Manuscript for Mol. Phyl. Evol.
Molecular systematics of the genus Artibeus
(CHIROPTERA: PHYLLOSTOMIDAE)
Rodrigo A.F. Redondo
1
, Letícia P.S. Brina
1
, Ricardo F. Silva
1
, Albert D.
Ditchfield
2
and Fabrício R. Santos
1
1
Departamento de Biologia Geral, Instituto de Ciências Biológicas,
Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil
2
Departamento de Ciências Biológicas, CCHN - Universidade Federal do
Espírito Santo, Vitória, ES, Brazil
Corresponding author: Rodrigo Aparecido Fernandes Redondo
Departamento de Biologia Geral, Instituto de Ciências Biológicas,
Universidade Federal de Minas Gerais
Av Antonio Carlos, 6627 – C.P. 486
31270-010 Belo Horizonte, MG, Brazil
E-mail: re[email protected]
* Manuscript
69
2
Abstract
A molecular phylogeny of the genus Artibeus using all recognized species,
many with samples from a broad geographic range, is presented. The
analysis shows a clear distinction between the two subgenera (or genera),
the ‘large’
Artibeus and the ‘small’ Dermanura, in both mitochondrial and
nuclear genes. The placement and status of
A. concolor remains
inconclusive and is presented as the third subgenus
Koopmania. The
phylogenies and divergence time estimates show a marked influence of
the Andes in the formation of the subgenera and the main lineages inside
each subgenus. Nuclear genes showed a highly incomplete lineage sorting
among species inside subgenera
Artibeus and Dermanura. Indeed, shared
alleles were also found between
Artibeus and Koopmania, which are
presumed to have split apart during the Miocene, showing that great care
should be taken in using these markers. Cytochrome-b gene divergences
and monophyly analyses suggest that
A. lituratus and A. intermedius are
indeed conspecifics. These analyses also suggested the existence of at
least four ‘new’ species revealing a significant cryptic diversity inside the
genus.
Keywords: Artibeus, molecular taxonomy, systematics, phylogenetics,
bats, Chiroptera
70
3
1. Introduction
The genus Artibeus traditionally encompasses approximately 19 species
occurring in the Neotropics:
Artibeus jamaicensis, A. planirostris, A.
amplus, A. lituratus, A. intermedius
, A. obscurus, A. hirsutus, A.
fraterculus, A. inopinatus, A. fimbriatus, A. concolor, A. cinereus, A.
glaucus, A. gnomus, A. aztecus, A. toltecus, A. phaeotis
and A. watsoni
(Handley, 1987, 1989; Davis, 1984; Lim and Wilson 1993, Lim, 1997;
Simmons, 2005).
Based on morphological evidence, Owen (1987, 1991) suggested that the
genus should be divided into three taxa:
Artibeus, including the large
species,
Dermanura, for the small species, and a new monospecific genus,
Koopmania, for the Artibeus (Dermanura) concolor. Former molecular
evidence from the mitochondrial Cytochrome-b gene and nuclear EcoR1
defined satellite DNA (Van den Bussche et al., 1998) showed an
inconsistent support for the
Koopmania genus, which they included in
Artibeus, and also suggested Dermanura and Artibeus as sister groups.
The differences between the ‘large’ and ‘small’
Artibeus species come also
from morphology (Smith, 1976), karyology (Baker, 1973) and restriction
site data (Van den Bussche et al., 1993). However the recognition of
these two genera is not widely accepted (Simmons, 2005), and in most
publications
Dermanura is considered as a subgenus of Artibeus.
Although
Artibeus in the broad sense (including the Dermanura and
Koopmania subgenera) is widely accepted as monophyletic (Simmons,
2005), the relationships among the species inside both subgenera (or
genera) is a matter of intense debate (Van den Bussche et al., 1998; Lim
71
4
et al., 2004; Guerrero et al., 2004; Guerrero et al., 2003; Marques-
Aguiar, 1994; Owen, 1987, 1991; Handley, 1987).
Most of the works on phylogenetic relationships of
Artibeus have centered
on the ‘large’ species (Patterson et al., 1992; Marques-Aguiar, 1994;
Guerrero et al., 2003; Guerrero et al., 2004; Lim et al., 2004). So far, the
largest taxon sampling including most of the species recognized in the
genus (using few individuals from each species) was presented by Van
den Bussche et al. (1998), but it missed one of the large species (
A.
amplus
) and apparently misidentified A. jamaicensis using two individuals
of
A. planirostris in their analysis as pointed out by some authors
(Guerrero et al., 2004; Lim et al., 2004).
Particularly, the work of Lim et al. (2004) concentrated in elucidating the
relationships of the ‘large’ species, challenging a close relationship (and
the synonymization) of
A. planirostris and A. jamaicensis as proposed by
other authors (Handley, 1987; Marques-Aguiar, 1994, Simmons, 2005)
and firmly recognizing
A. amplus (Handley, 1987; Lim and Wilson, 1993)
as a separate species. However they used few individuals of each species
and the relationships among
A. obscurus, A. planirostris, A. amplus and A.
lituratus
presented low support values in their analysis, so a more
consistent phylogenetic approach is still needed.
The complex taxonomy and the use of different species’ names have
made it difficult to establish precise species’ distributions and to analyze
the full variation and phylogenetic relationships within the genus
Artibeus.
The use of molecular data to help defining and discovering species have
been widely discussed in the taxonomic community (Tautz et al., 2002,
72
5
2003; Lipscomb et al., 2003; Seberg et al., 2003; Dunn 2003), especially
the DNA-barcoding initiative (Hebert et al., 2003, 2004; DeSalle et al.,
2005). Although DNA sequence-based identification may have many
problems, an integrated approach of phylogenetic methods with DNA
sequences, morphological analysis and other evidences (as geographic
ranges, behavior, etc) can be extremely powerful (DeSalle et al., 2005).
Molecular data could complement traditional taxonomy and, in some
cases, point out outliers as possible incipient species deserving further
investigation (Bradley and Baker, 2001).
Using a combination of molecular analyses following the phylogenetic and
genetic species concept (Mishler and Theriot, 2000; Bradley and Baker,
2001), this manuscript intends to investigate in detail the phylogeny and
the systematics of the species in the genus
Artibeus. Furthermore, we use
molecular taxonomy to point out potential new species, for some of which
additional evidence is also presented.
2. Materials and Methods
2.1 Samples
Specimens examined are listed in Appendix, with sampling localities and
museum/field numbers of the vouchers. All DNA samples collected in this
study were deposited in the DNA bank of the Laboratório de
Biodiversidade e Evolução Molecular, Universidade Federal de Minas
Gerais, Brazil (Santos et al., 2002).
We sequenced the entire segment (1140 base pairs, bp) of the
mitochondrial
Cytochrome b (Cyt-b) gene of 429 bats of the genus
73
6
Artibeus and retrieved another 111 sequences from GenBank. Altogether,
the 540 sequences cover all 19 recognized
Artibeus species, spanning 15
countries of South, Central and North America, plus the Lesser Antilles,
covering almost all of their distribution (Figure 1). In addition we
sequenced 501 bp of the mitochondrial
Cytochrome Oxidase I gene (COI)
in a subset of 168 bats (12 species sampled and one additional species
retrieved from GenBank), and two fragments of the nuclear genes
RAG2
(650 bp) in 42 individuals (plus 4 GenBank retrieved sequences, 13
species sampled in total) and
BrCA1 (700 bp) in 37 specimens (12 species
sampled plus one species with a deposited sequence in GenBank).
All Cyt-b and COI sequences produced in this study were deposited on
GenBank under accession numbers
EU160667 to EU161064.
2.2 Molecular Methods
DNA extractions were performed with a standard phenol-chloroform-
isoamyl alcohol protocol (Sambrook et al., 2001) or with DNeasy
®
extraction kits (Qiagen
®
).
PCR amplifications were carried out in 15 μL reactions containing 40-80 ng
of DNA, Buffer 1B (Phoneutria
®
- 1.5 mM MgCl
2
, 10 mM Tris-HCl (pH 8.4),
50 mM KCl, 0.1% Triton X-100), 200
μM dNTPs set (Amersham-
Biosciences
®
), 0.5 μM of primers and 1.25 U of Taq DNA polymerase
(Phoneutria
®
). The primers used for Cyt-b amplifications were L14121
(GACTAATGACATGAAAAATCA) and H15318
(TATTCCCTTTGCCGGTTTACAAGACC) both developed in this study.
COI
amplifications used primers LCO1490 and HCO2198 (Folmer et al., 1994),
74
7
RAG2 used primers RAG2F220, RAG2R995, and BrCA used BRCA1f126,
BRCA1r3012, both described by Teeling et al. (2000).
Most of PCR reactions used the following cycling scheme: 5’ at 94
o
C
followed by 35 cycles of 30’’ at 94
o
C, 30’’ at 50
o
C (Cyt-b) or 55
o
C (BrCA1
and RAG2) for primer annealing and 1’ 20” at 72
o
C for extension, and a
final 9´ extension at 72
o
C after the last cycle. COI amplifications used the
cycling conditions described by Folmer et al. (1994).
PCR products were purified using a solution of 20% Polyethylene-Glycol
8000 in 2.5 M of NaCl using a protocol described by Sambrook et al.
(2001).
Sequencing of both strands were carried out in a MegaBACE 1000
®
(GE
Healthcare) automated sequencer using DYEnamic ET
®
Terminator kits
(GE Healthcare
®
) and the same primers used in PCR amplifications, except
for
Cyt-b where two additional internal primers were also used: MVZ4
(Kocher et al., 1989) and L14881 (GACATAATTCCATTCCACCCCTAC)
developed in this study. Sequences were assembled and checked for
quality using a combination of the programs Phred v.0.20425 (Ewing et
al., 1998; Ewing and Green, 1998) and Phrap v.0.990319 (Green, 1994),
and the assembled chromatograms were verified and edited (when it was
necessary) using Consed 12.0 (Gordon et al., 1998).
In the analysis of nuclear genes, the presence of heterozygous nucleotide
positions was identified in the Consed program and the haplotypes (also
called here alleles) were inferred using the software Phase 2.1 (Stephens
et al., 2001).
75
8
2.3 Phylogenetic Analysis
Out of the 540
Cyt-b sequences we used 413 unique haplotypes (complete
Cyt-b data set) in the analyses plus three Enchisthenes hartii sequences
as outgroups. We also used a reduced (103 haplotypes) data set in some
computationally intensive analyses. These two data sets were the most
explored because they contain samples of all species and a broad
geographic range. The
COI sequences revealed 93 unique haplotypes that
were used in a complementary phylogenetic analysis or combined with
Cyt-b to investigate complicated groups, using 12 species (114
individuals). We also used all nuclear gene sequences generated, although
they presented some complex results (see results).
Sequences were aligned using the Clustal-W algorithm implemented in
MEGA 3.1 (Kumar et al., 2004). MEGA 3.1 was also used to calculate
intraspecific and interspecific sequence divergence with a Kimura 2-
parameter (K2P) model to compare with published data.
Modeltest 3.7 (Posada and Crandall, 1998) was used to select the best fit
model of sequence evolution using the Bayesian Information Criterion
(Posada and Buckley, 2004). The selected model for
Cyt-b data set was
the Hasegawa-Kishino-Yano model (HKY) with a transition/transversion
ratio R = 6.397 and gamma distributed (
) rates variation across sites
(
= 0.895) and a proportion of invariant sites (I = 0.436). For the COI
data set the same model (HKY) was selected with transition/transversion
ratio R = 7.438 and gamma distributed rates (
= 1.559) and invariant
sites (I = 0.593).
76
9
We used four methods of phylogenetic inference: Neighbor Joining (NJ),
Maximum Parsimony (MP), Maximum Likelihood (ML) and MCMC Bayesian
inference (BI).
Neighbor joining analyses were performed in Paup*4.0b10 (Swofford,
1998) using maximum likelihood distances with the model selected by
Modeltest 3.7 with associated parameters. Confidence in the clades was
assessed by 1000 bootstrap replications (Felsenstein, 1985).
We used the PhyML (Guindon and Gascuel, 2003) algorithm for maximum
likelihood inference of large phylogenies with the model selected above.
Two methods for estimating the confidence in the clades were used: the
approximate likelihood ratio test (aLRT) method (Anisimova and Gascuel,
2006) with SH-like and
2
probability tests and traditional bootstrap
analysis with 1000 replicates (only used with the reduced
Cyt-b data set
and the combined
Cyt-b and COI analysis). The aLRT method assesses the
gain in the likelihood of a clade against a null hypothesis of the collapse of
that clade, and tests its significance, which seems to be more
conservative than bootstrap (Anisimova and Gascuel, 2006).
Maximum parsimony trees were searched with the Parsimony Ratchet
method (Nixon, 1999) performed on Paup*4.0b10 using a batch file
produced with the PaupRat software (Sikes and Lewis, 2001) with 18 runs
of 200 iterations and two runs of 1000 iterations; half of the runs with
10% of re-weighted characters and half with 20% re-weighted characters.
We also calculated the Bremmer support values (decay index - DI) for the
clades in strict consensus trees using the ratchet method (Müler, 2004).
77
10
MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001) was used for the
Bayesian inference using two independent runs of four Markov Chains (1
cold and 3 heated) with 2x10
6
generations and sampling every 100
generations. The first 25% of the sampling trees and estimated
parameters were burned off to allow the chains to reach stationarity for
the reduced
Cyt-b data set, and two runs of four Markov Chains (1 cold
and 3 heated) with 10
7
generations and sampling every 100 generations,
and again burning the first 25% for the complete data set.
Testing of topologies, parsimony and likelihood scores were also
performed in Paup*4.0b10.
Divergence time estimates were performed using two methods:
i) using
linearized trees by re-estimating branch lengths under the assumption of
constant rate of evolution (Takezaki et al., 1995) implemented in MEGA
3.1; and
ii) using a Bayesian method described by Thorne et al. (1998)
and modified by Kishino et al. (2001) implemented in the program
MultiDivTime that does not assume a constant rate of evolution and
incorporates variation of rates across lineages. In both methods,
outgroups from other subfamilies of Phyllostomidae bats (
Desmodus,
Tonatia
and Glossophaga) were included in the analyses to permit
constraints in the time of splits based in fossil calibrations and previous
divergence time estimates (Teeling et al., 2005).
3. Results
3.1 Mitochondrial DNA analyses
We found 413 unique
Cyt-b haplotypes for Artibeus and three for
Enchisthenes hartii (Table 1). The complete Cyt-b data set (1140 bp
78
11
alignment) shows 595 constant and 545 variable positions, from which
135 present singletons (autapomorphic) and 410 present parsimony
informative characters. The
COI data set (93 haplotypes) had 501 bp, 333
constant sites, 168 variable sites, 136 of which were parsimony
informative sites and 32 singletons.
Figure 2 shows the maximum likelihood tree using the complete data set.
Haplotypes that grouped separately from their respective ‘expected’
clades were named as ‘sp2’ (see ‘molecular taxonomy’ section and the
‘Discussion’ section).
Maximum Likelihood (ML) and Bayesian (BI) trees presented identical
interspecific topologies, while Maximum Parsimony (MP) trees differed
from them only in the placement of
A. cinereus sp2 and A. concolor
(Figures 3 and 4).
The ML tree using the complete data set presented a likelihood score of
lnL -17,569.301 and the topology showed in figures 2 and 3. In this
analysis,
A. concolor clusters with the ‘small’ (Dermanura) Artibeus with
low (aLRT
2
= 52) to very low values (aLRT SH-like= 18), and A. cinereus
sp2 is basal to a clade formed by A. cinereus, A. glaucus, A. gnomus and
A. anderseni.
In the MP trees,
A. cinereus sp2 appears as a basal group to the ‘small’
(
Dermanura) Artibeus, and A. concolor is an external group sister to all
Artibeus.
The BI analysis showed the same topology of the ML tree, grouping
A.
concolor
with the ‘small’ Artibeus displaying a Bayesian posterior
probability of 0.57.
79
12
The parsimony ratchets found 2536 MP trees of 2940 steps, with
ensemble consistence index (CI) of 0.238 and ensemble retention index
(RI) of 0.853. All rearrangements in MP trees with the complete
Cyt-b
dataset were intraspecific swaps as it was shown by the absolute
frequency of bipartitions between the species on the majority rule
consensus tree (Figure 4).
The NJ tree presented a different topology from all other methods, but
almost all clades showed very low support values (not shown). In this
analysis
A. concolor clusters with the ‘large’ Artibeus group with a low
bootstrap value of 47%, and
A. cinereus sp2 is a sister group to a cluster
of
A. cinereus and A. anderseni, with a very low bootstrap support (34%).
Many other species’ relationships are also different in this tree but always
with low support values. However, all entities called as ‘sp2’ remain as
separate monophyletic groups, independent of their ‘expected’ clades, no
matter which method or mitochondrial gene was used for phylogenetic
reconstruction.
The combined
COI-Cyt-b dataset clustered A. concolor with the ‘large’
Artibeus group in all methods (data not shown) with support values
ranging in ML trees from low (SH-like= 43 and bootstrap-ML= 55) to high
(
2
= 80), and the remainder part of the trees shows a topology
compatible with the trees of their respective methods (Figure 3). When
only the
COI gene is used, A. concolor also clusters with the ‘large’
Artibeus in all methods used (SH-like=63
2
= 60 in ML trees and
bootstrap-NJ= 38). The
COI phylogenies could also discriminate all
species studied, but the support values for interspecies relationships were
very low in most cases (data not shown).
80
13
We tested the alternate topologies concerning the placement of
A.
concolor
and A. cinereus sp2 (the only discrepancies among optimization
methods used) and also the probability of existence of the groups labeled
as ‘sp2’ against the null hypothesis of they belonging to their respective
‘expected’ species. For this, we constrained the concurrent topologies and
then searched the 95% credibility universe of the trees sampled during
the MCMC procedure of the BI analysis for trees that match the
constraints. Since we are searching in the posterior distribution of the
trees, if one alternative hypothesis (topology) does not exist in the 95%
credible set, the hypothesis can be rejected at P < 0.05 (Brandley et al.,
2005).
The topology of the BI and ML trees were the same so we tested the clade
found on MP trees with
A. concolor as a sister group to all other Artibeus
species and the one of NJ tree, presenting A. concolor as a sister group to
the ‘large’ species (figures 3, and 4). Both alternative hypotheses could
not be rejected since trees with their respective topologies can be found in
the 95% credible set, the first one in 6.51% of the trees and the second in
17.97%.
For
A. cinereus, the first alternative hypothesis (MP), with A. cinereus sp2
being a sister clade to all other ‘small’
Artibeus, could not be rejected and
was also quite frequent (17.94%). However, the second one (NJ), with
A.
cinereus
sp2 as a sister group to only A. anderseni and A. cinereus, was
rejected even in the interval of 99% credible trees.
As a complement to the topology tests concerning the placement of
A.
concolor
and A. cinereus sp2, we took one of the most parsimonious trees
81
14
of the
Cyt-b dataset and constrained the topologies with the tree around
different placements of figure 4, retaining the rest of the tree, and
recalculated the number of steps of these trees.
Only one more step (2941 steps total) is required to let
A. concolor
become part of the ‘large’ Artibeus group, and two steps (2942 steps) to
place it together with the ‘small’ group showing that very few steps
separates the topologies in a parsimony-based decision. The same
procedure was repeated with the two different placements of
A. cinereus
sp2, we constrained the topology discrepant with the MP tree. The
alternative topology (the same of the ML tree for this group) is two steps
longer than the MP tree, while the NJ tree had so many different
groupings that is difficult to constrain the topology around
A. cinereus sp2
and involved taxa without changing the rest of the tree, however it is at
least 15 steps longer than the MP tree.
We also tested the monophyly of
A. cinereus, A. obscurus and A.
jamaicensis
, when including their ‘sp2’ counterparts and also the odd case
of the two
A. phaeotis (see below). Both A. phaeotis and A. obscurus
monophylies were rejected, while A. jamaicensis and A. cinereus were
not, but the frequencies of occurrence were very low, 0.19% and 1.32%
respectively.
3.2 Nuclear DNA analyses
The BrCA1 exon 11 fragment (700 bp) presented only four parsimony-
informative sites. Many alleles were found and shown to cluster in two
distinct groups (plus the outgroup
E. hartii), one with the ‘small’ Artibeus
alleles and one with the ‘large’ Artibeus. Alleles were also shared among
82
15
species inside the groups. The most impressive example was the allele
BrCA1-1 found in
A. lituratus, A. planirostris, A. obscurus, A. fimbriatus,
A. concolor and the GenBank sequence of A. jamaicensis (AY834647).
The RAG2 sequences (650 bp) were more informative than BRCA1,
presenting 15 parsimony informative sites and again showing two distinct
clusters of
Artibeus. Once more, shared alleles were observed, but only
among species of the “large”
Artibeus. One of the A. concolor specimens
shares alleles with
A. lituratus, A. obscurus, A. fimbriatus and the
GenBank sequence
AF316433 for A. hirsutus.
Because of the shared alleles among species for the two analyzed
autosomal genes, the topology of the tree inside the two groups cited
previously is unreliable, and a more extensive analysis could not be
performed with these datasets.
3.3 Molecular taxonomy
Using the complete
Cyt-b dataset, A. fraterculus, A. phaeotis, A.
jamaicensis
, A. obscurus and A. cinereus showed up as merophyletic
(non-monophyletic) taxa and
A. intermedius haplotypes were mixed
among the high number of
A. lituratus haplotypes (Figure 5). All other
species showed monophyletic status.
All
A. intermedius haplotypes downloaded from GenBank (see Appendix
for accession numbers) fall inside a large clade of
Artibeus lituratus and do
not form a monophyletic clade themselves (Figure 5). Some of the
haplotypes clustered with individuals of
A. lituratus collected as far as
southern Brazilian Atlantic Forest, Brazilian and Peruvian Amazon and
Central America.
83
16
Both Van Den Bussche et al. (1998) and Lim et al. (2004) found low
values for
Cyt-b sequence divergence between A. intermedius and A.
lituratus
(2.5% and 2.8% respectively; we found a smaller value of 1.8%)
but they only have one sequence of each species in their work, so they
appeared to be sister clades in these papers. Because of the polyphyletic
status, small sequence divergence and the lack of supporting
morphological evidence, we do not recognize
A. intermedius as a proper
species in this work and the
A. intermedius haplotypes are considered as
part of the
A. lituratus species diversity.
The
A. fraterculus haplotype Afra_6 (GenBank accession number
AY684772) grouped inside the clade of A. fimbriatus and, since it was
collected in Peru and endemic to the Western slope of the Andes (voucher
FMNH 129105, see Appendix) while
A. fimbriatus is endemic of the
Atlantic Forest in coastal Brazil and south of Paraguay (Simmons, 2005),
we believe it was likely a mistake made when uploading (or handling) data
to GenBank. Similar cases include
AY684768 (voucher MVZ185677, also
named AD519), which is an
A. fimbriatus in the Museum of Vertebrate
Zoology (MVZ) database (also in the field notes of A.D. Ditchfield), but the
sequence in GenBank clusters with
A. obscurus (and it is identical to
AY684767, an A. obscurus in the MVZ database). Moreover, we also
sequenced this specimen (AD519) and it shows a common
A. fimbriatus
haplotype. A. obscurus AY684765 and A. hirsutus AY684764 also
display identical sequences.
This illustrates that great care must be taken in both uploading sequences
in a public database and in using them in analyses and publications. None
84
17
of these sequences were used in our analysis. Thus, if we exclude the
haplotype Afra_6,
A. fraterculus becomes a monophyletic species.
A. phaeotis represents another issue with haplotypes Apha_1
(
APU66514, Van Den Bussche et al., 1998) and Apha_2 (AY157584,
Porter and Baker, 2004) that are clearly different (11% sequence
divergence) and cluster with distinct species (Figures 2, 3 and 4): Apha_1
with
A. toltecus (5.4% divergence) and Apha_2 with a clade formed by A.
watsoni
and A. aztecus (8.8% divergence).
In
A. jamaicensis, two haplotypes, Ajam_28 (AY572353) and Ajam_30
(
AY572355) (Carstens et al., 2004), are also divergent from all other A.
jamaicensis
haplotypes (5.4%). Besides, they form a monophyletic clade
basal to
A. amplus, A.obscurus, A.planirostris and A.lituratus with short
branch length but with moderate to high support values in all tests (Figure
2). A similar situation happens with
A. obscurus sp2, where two
individuals collected in the Acre state of the Brazilian Amazon presented
the same haplotype (Aobs_38). It displays 7.4% sequence divergence
from all other
A. obscurus haplotypes and appears to be basal to A.
jamaicensis
sp2 (figures 2, 3 and 4), also with short branch length but
with relatively good support values.
Artibeus cinereus sp2 haplotypes Acin_20, Acin_21 and Acin_22 also form
a monophyletic group that is highly divergent from
A. cinereus (8.2%).
These haplotypes were found in two localities in the Serra do Mar, a
mountain chain in the Brazilian Atlantic Forest. They were called
Artibeus
sp1 in a phylogeography paper by Ditchfield (2000) due to morphological
and
Cyt-b differences (see discussion).
85
18
The graph on figure 6 shows two plots of the maximum intraspecific
divergence against the minimum interspecific divergence for all species
studied. In the first graph (figure 6A) the divergences were calculated
using the current
Artibeus taxonomy and the identity of the specimens
assigned to the species by traditional methods (species keys) and/or
identifications in databases (GenBank or museums), excluding obvious
mistakes of public databases (as some described above). The figure 6B
shows the graph recalculated taking the species called as ‘sp2’ in the trees
as true species. Note that these species and
A. gnomus (marked as
triangles in the graph) are more dispersed in figure 6A, ranging over 6.5%
of intraspecific sequence divergence, than in figure 6B where all species
are more aggregated with a maximum of 5.4% divergence.
Although the haplotypes of
A. gnomus form a monophyletic group in the
trees of all methods, they can be resolved as two sister clusters (Figure
7): one with haplotypes from the Amazon (Agno_1, Agno_2, Agno_3,
Agno_4, Agno_5 and Agno_10) and another with Brazilian Cerrado
haplotypes (Agno_7, Agno_8, Agno_9) plus one Amazonian haplotype
(Agno_6). The divergence between the two clusters is high, about 7.1%,
and there are some morphological differences between the individuals of
different clusters (see discussion).
3.4 Divergence times
Times of splits were calibrated with both fossil and previous genetic
estimates (Teeling et al., 2005) for the Phyllostomidae phylogeny. Both
methods presented similar results.
86
19
The split between Phyllostominae (here represented by the
Tonatia genus)
and the group formed by Glossophaginae (represented by
Glossophaga)
plus Stenodermatinae (represented by
Artibeus and Enchisthenes) was
about 22.4 million years ago (m.y.a., max= 26.1, min= 21), in the
Oligocene-Miocene transition. Stenodermatinae diverged from
Glossophaginae around 20.4 (24.4 - 17) m.y.a. in the Miocene.
The
Artibeus diversification starts around 13.2 m.y.a. (17.9- 8.8) in the
Miocene, splitting into the large (
Artibeus) and small (Dermanura) clades.
The two sub-genera starts diversifying about the same time at 11.7 (16.5
– 7.5) m.y.a. and 12.2 (16.9 - 7.9) m.y.a., respectively, also in the
Miocene epoch.
4. Discussion
4.1 Artibeus concolor
The taxonomic status of A. concolor was always a matter of hot debate in
bats’ systematics. When first discovered by Peters in 1865 in Paramaribo,
Suriname, it was described as an
Artibeus (Owen, 1991). In 1908,
Andersen suggested that it could be related to the ‘large’ species of the
genus, based largely on the presence of 3/3 molars (third molar present in
both jaws) (Owen, 1991). Despite its ‘intermediate’ size,
A. concolor
presented a shortened rostrum and other morphological characteristics,
differentiating it from small and large species of
Artibeus (Owen, 1991).
In the following years, many authors aligned
A. concolor with the small
species instead of the large ones based on other morphological evidences
(Owen, 1987; Handley, 1987). Owen (1991) concluded that
A. concolor
87
20
(
Dermanura concolor in that paper) should be included in its own genus,
Koopmania, with K. concolor as the only species.
In the first molecular analysis of the
Artibeus genus, Van den Bussche et
al. (1998), using the complete sequences of the
Cyt-b gene and variation
in the
EcoR1 defined satellite DNA, concluded that there is no support for
the
Koopmania genus and A. concolor should be recognized as a member
of the large
Artibeus group. Later, Lim et al. (2004) also analyzed Cyt-b
variation, but using more individuals and species of the large group, and
reached the same conclusion that
A. concolor is more related to the ‘large’
group.
We found three different placements for
A. concolor in our trees, varying
with the phylogenetic method, gene or number of samples used. However
none of the methods presented high support values for the association of
A. concolor with any other groups (Figures 2, 3, and 4). There is a
relatively large number of homoplasious (and autapomorphic) characters
in the trees (CI = 0.238), but also a very large amount of synapomorphies
(RI = 0.853) and no saturation was verified for both
COI and Cyt-b (data
not shown). Beyond the existence of several synapomorphic sites that
clearly define
A. concolor, there are no sites that unambiguously connect
it to any of the large or small
Artibeus species.
The most compelling evidence of a closer relationship of
A. concolor with
the large
Artibeus group comes from the nuclear genes studied. In both
genes we found alleles shared between
A. concolor and other species of
the large species group, but never with the small one. However this
evidence is relatively weak, since
A. concolor appears sometimes as a
88
21
basal group to all other
Artibeus among the trees obtained, casting the
possibility of these alleles being plesiomorphic.
Because of the ambiguous results and low support values in the
phylogenetic methods used, and the lack of concrete morphological
evidence favoring
Artibeus or Dermanura groups, we recommend a
provisional allocation of
A. concolor in the Subgenus or Genus Koopmania,
as proposed by Owen (1991).
4.2 The large
Artibeus group
The resulting trees presented usually the same topology for the large
species group in all methods, with the exception of small incongruences
(with very low support) in the NJ-tree.
Apart the possibility of
A. concolor belonging to the large group, this
cluster branches into two clades, one formed by
A. inopinatus, A. hirsutus
and A. fraterculus and another with all other large species.
The first clade is highly supported (ML SH-like = 95,
2
= 99, boot-ML =
96; DI = 6) with
A. inopinatus as sister taxon to a group formed by A.
hirsutus
and A. fraterculus with moderate to low support values (Figures
2, 3 and 4). Lim et al. (2004) found this same grouping but the entire
group branched after
A. fimbriatus (the first of the ‘large’ Artibeus to
diverge just after
A. concolor in their analysis). In the work of Van den
Bussche et al. (1998), the group also branches after
A. fimbriatus but the
clade is formed by
A. fraterculus as sister taxon to A. hirsutus plus A.
inopinatus
. A. hirsutus and A. inopinatus are considered closely related
(Webster and Jones, 1983) and, in fact, Marques-Aguiar (1994) scored
both identical in her morphological phylogenetic analysis, despite
89
22
recognizing them as separate species. They have very furred uropatagium
(Webster and Jones, 1983) and were among the smallest of the large
Artibeus group; indeed A. inopinatus overlaps with A. aztecus (the largest
Dermanura) in size (Lim et al., 2004). Our data indicates that A.
fraterculus
is more closely related to A. hirsutus, but with low support
values in most of the analyses. These three species occur only west of the
Andes (Koopman, 1982; Patterson et al., 1992) and little is known about
the biology of this group. We estimate the divergence time between this
clade and other large
Artibeus in 11.7 (16 – 7.5) m.y.a., a time
compatible with the elevation of the Andes during the middle Miocene.
The second clade is also highly supported (ML SH-like = 77,
2
= 86, boot-
ML = 85; DI = 4), where
A. fimbriatus is the first species to branch out. A.
fimbriatus
is also considered a basal species to all large Artibeus
(excepting A. concolor) in other morphological (Marques-Aguiar, 1994)
and molecular analyses (Lim et al., 2004; Van den Bussche et al., 1998),
with low to moderate support values (MP-bootstraps <50 and 76 and
decay index of 2 and 22, respectively, in the molecular studies). This
species seems to be endemic to the Atlantic Forest and ranges from
southern Brazil and Paraguay to coastal northeast Brazil in Bahia state
(Handley, 1989; Simmons, 2005).
The next species to branch out is
A. jamaicensis, with very high support
values (ML SH-like = 97,
2
= 99, boot-ML = 94; DI = 4). A. jamaicensis
was once considered a very variable and widely distributed species with
many subspecies, including
A. planirostris (Handley, 1987; Marques-
Aguiar, 1994). Van den Bussche et al. (1998) found little divergence
between
A. jamaicensis and A. planirostris (3.9%), which were sister
90
23
groups in their analysis. However other molecular works (Lim et al., 2004;
Guerrero et al., 2004) found that
A. planirostris is more closely related to
A. obscurus, and based on geographic distributions concluded that Van
den Bussche et al. used only
A. planirostris sequences in their study. Lim
et al. (2004) suggested that
A. jamaicensis is only distributed north of
Orinoco River into Central-America, although the limit of the species in the
Llanos region of Venezuela could not be traced for sure. Our results agree
partially with Lim et al. (2004), but a detailed analysis suggests that
A.
jamaicensis
does not exist in South America even north of Orinoco River
in the Llanos region in Venezuela. We retrieved from GenBank one
sequence of
A. jamaicensis collected in Calabozo, north of the Orinoco
River in Venezuela (
AY684778) and many of the A. planirostris
sequences used by Lim et al. (2004). The A. jamaicensis sequence also
showed an
A. planirostris haplotype suggesting that either the species is
sympatric in this region or
A. jamaicensis does not exist in South America.
Therefore, it is crucial to analyze individuals of both species from
Venezuela, Colombia, Panama and Ecuador West of the Andes to
determine precisely their distribution limits. Despite the molecular (Lim et
al., 2004; Guerrero et al., 2004) and morphometric (Guerrero et al.,
2003) evidences, some authors still think of
A. planirostris as conspecific
with
A. jamaicensis (Handley, 1987; Simmons, 2005). Moreover, the
mixed use of the names
A. jamaicensis planirostris and A. planirostris in
the literature or GenBank entries causes many problems, since “
A.
jamaicensis
” may be used to refer to any of the two species. As discussed
in Lim et al. (2004) and also presented in our results, this practice should
91
24
be discontinued because the inclusion of
A. planirostris in A. jamaicensis
generates a paraphyletic taxon.
A. obscurus sp2 is the next to branch out with low support values (ML SH-
like = 55,
2
= 71, boot-ML = 43; DI = 1) but it is recognizable as a
distinct entity of true
A. obscurus in all phylogenetic trees and Bayesian
monophyly tests (100% rejection), they also presented 7.34% divergence
with
Cyt-b. We examined two specimens identified as A. obscurus sp2
(see Appendix) from the Acre state in the Brazilian Amazon, very near the
border with Peru. Both specimens presented the same haplotype, distinct
from other
A. obscurus as described above. Morphologically, they are a
little larger than the common
A. obscurus (forearm with 64 mm against
~60 mm), have a larger and broader rostrum and mandibular arc (data
from Redondo and Aires, in preparation). Ditchfield (1996) found a
‘strange’ haplotype in three individuals identified as
A. obscurus from
Venezuela. They did not form a group with the other
A. obscurus and were
external groups to both
A. lituratus and A. planirostris in his analysis. We
reanalyzed his data (402 bp of
Cyt-b) including all our haplotypes, and
found that his ‘strange’ haplotypes cluster with our
A. obscurus sp2 with
strong support (ML-SHlike = 90) and little divergence (2.8%). These
results suggest that they are also
A. obscurus sp2.
In 1989, Handley reanalyzed
A. fuliginosus Gray and A. obscurus Schinz
and concluded that
A. fuliginosus was one of the many variant forms of A.
jamaicensis
(A. planirostris because of the locality in Peru), and A.
obscurus
was the valid name for the small blackish Artibeus. The A.
obscurus
sp2 individuals that we analyzed have a similar size and also five
warts in either side of the chin, as in Gray’s
A. fuliginosus description (A.
92
25
obscurus have 3-4 warts) but do not present the soft long fur, typical of A.
obscurus
(Handley, 1987). Although there are morphological (and
molecular) differences between
A. obscurus and A. obscurus sp2, their
morphological characteristics were not exclusive, found also in
A.
jamaicensis
and A. planirostris. Then, to perform a detailed morphological
and molecular analysis more individuals from the area between Venezuela
and Peru are needed to likely resurrect the name
Artibeus fuliginosus (or
to name it as something else) for what we name here as
A. obscurus sp2.
The next to branch out is
A. jamaicensis sp2 with high and some low
support values (ML SH-like = 83,
2
= 98, boot-ML = 68; DI = 2). These
two haplotypes were first described by Carstens et al. (2004), who found
a very distinct group of three haplotypes (we removed haplotype W of
Carstens et al. because it was an incomplete sequence) diverging 7.2%
from other
A. jamaicensis from the Lesser Antilles (only 5.4% divergence
is found in our analysis using many more sequences). Carstens et al. have
not included any outgroup species, thus these haplotypes appeared as a
sister group to other
A. jamaicensis. They also concluded that these
haplotypes were more closely related to South American haplotypes
(actually
A. planirostris) than to other ones found in the Lesser Antilles.
These results were similar to ours since the sequence divergence between
A. jamaicensis sp2 and A. planirostris (5.48%) is smaller than between A.
jamaicensis
sp2 and A. jamaicensis (6.86%). However, Bayesian
monophyly test analysis could not exclude the possibility of
A. jamaicensis
sp2 forming a monophyletic group with A. jamaicensis, even if the
probability is very low (0.19%) and they did not group together in our
93
26
trees. More molecular and morphological data are also needed to establish
the identity of this taxon.
The widely distributed
A. lituratus branches out next, also with high
support values (ML SH-like = 89,
2
= 99, boot-ML = 71; DI = 2). A.
lituratus
and A. intermedius have been usually recognized as distinct
species (Davis, 1984, Guerrero et al., 2003) and sometimes as conspecific
(Marques-Aguiar, 1994). Molecular data have suggested that the
divergence between
A. lituratus and A. intermedius is very small, ranging
from 2.5 to 2.8% (Van den Bussche et al., 1998; Lim et al., 2004).
Simmons (2005) argued that there is no morphological character that
unambiguously differentiates
A. lituratus palmarum (a subspecies from
Central America) from
A. intermedius (Davis, 1984; Marques-Aguiar,
1994) and concluded that
A. intermedius represents individuals of A.
lituratus palmarum
that are in the lower range of normal size variation.
Our results show that
A. lituratus and A. intermedius are conspecific
according to phylogenetic and genetic species concepts (Mishler and
Theriot, 2000; Bradley and Baker, 2001).
A. intermedius haplotypes
display a very small divergence among them and do not form a
monophyletic clade, being part of the variation found in
A. lituratus
(Figure 5). In addition, no morphological character analyzed so far could
be used to differentiate them unambiguously (Marques-Aguiar, 1994;
Simmons, 2005).
Following
A. lituratus, the next species to branch out is A. obscurus (ML
SH-like = 77,
2
= 93, boot-ML = 54; DI = 2). A. obscurus seems to be
related to humid environments, especially to the Atlantic and Amazon
94
27
Forests in South America. Although
A. obscurus is easily distinguishable
from other large
Artibeus, the phylogenetic relationship of this species is
poorly resolved in morphological analysis (Marques-Aguiar, 1994). In the
molecular works of Lim et al. (2004),
A. obscurus appears to be more
related to
A. planirostris, although with low support values (MP-bootstrap
< 50 and decay index of 2). This result is also shared by Van den Bussche
et al. (1998), but they have not included
A. amplus in their analysis. Our
analysis shows
A. obscurus as sister taxon to a clade formed by A.
planirostris
and A. amplus with large support values (ML SH-like = 80,
2
= 97, boot-ML = 92; DI = 2), the last branch of the large Artibeus group.
Morphometric analysis (Guerrero et al., 2003) have grouped
A. amplus
and A. lituratus as sister taxa, though they resemble more A. planirostris
(A. jamaicensis in Handley, 1987) by morphology. The phylogenetic
analysis of Marques-Aguiar (1994) places
A. amplus as an external group
to all other large
Artibeus, excepting A. fimbriatus and A. concolor. Lim et
al. (2004) found
A. amplus as a sister taxon to a group formed by A.
planirostris
and A. obscurus (all with very low support values) and argues
that Guerrero et al. (2003) morphometric analysis is biased because of
the large sizes of
A. amplus and A. lituratus. A. amplus inhabits the
Amazon and occurs in Venezuela, Colombia, Guyana and Suriname
(Simmons, 2005; Lim et al., 2004). We collected two individuals of
A.
amplus
from Brazil in Barcelos, Amazonas State, near the border with
Venezuela somewhat expanding its known distributional range. They were
first identified in the field as
A. planirostris fallax, a large subspecies of A.
planirostris,
but a closer examination showed that it was an A. amplus.
95
28
Several characters can be used to distinguish both species, including
exclusive ectoparasites (Handley, 1987).
4.3 The small
Artibeus group (Dermanura)
The small
Artibeus group showed a more complicated tree structure
varying with reconstruction methods (Figures 2, 3, and 4), but most of the
clades are found in all trees for all genes studied. We will follow the
Maximum Likelihood (and Bayesian) branching structure in the following
description, pointing out differences among reconstruction methods. Again
we are not including
A. concolor in this group even if it branches together
Dermanura in ML and BI methods, but with low support values (ML SH-
like = 23, BP= 67).
The first bifurcation in the small
Artibeus divides the group (ML SH-like =
93,
2
= 99, boot-ML = 73, BP = 96) into a small clade of three
Mesoamerican species
A. watsoni, A. aztecus and A. phaeotis
(AY157584, Porter and Baker, 2004), and the other species A. cinereus,
A. cinereus sp2, A. gnomus, A. glaucus, A. anderseni, A. toltecus and A.
phaeotis
(APU66514, Van den Busche et al., 1998). Both clades are
supported by high to very high values (Figures 2, 3, and 4).
Starting with the smaller Mesoamerican clade,
A. phaeotis appears as a
sister taxon to a clade formed by
A. aztecus and A. watsoni with very high
support values (ML SH-like = 98,
2
= 99, boot-ML = 98; DI = 16; BP=
100). This clade is also observed in the MP trees but as sister group of a
clade formed by
A. cinereus, A. glaucus, A. gnomus and A. anderseni, with
the exclusion of the other species. However,
A. phaeotis sequences
retrieved from GenBank are clearly not the same species. The monophyly
96
29
of the two sequences was rejected in Bayesian tests, they do not form
clades in the trees of any methods and have a extremely large sequence
divergence (~11%). It is more probable that one of the specimens was
misidentified. For example, the
A. phaeotis sequence AY157584 from
Esmeraldas, Ecuador (Porter and Baker, 2004) is identified as
Dermanura
rosenbergi
in Hoofer and Baker (2006) (A. glaucus rosembergii, Handley,
1987), but also identified as a
Vampyressa pusilla in the TTU database.
In any case, which species those sequences belong to?
A. phaeotis
AY157584 from Ecuador presents 8.8% mean sequence divergence with
its closest clade (
A. aztecus and A. watsoni) while A. phaeotis APU66514
from Nicaragua presents 5.4% sequence divergence to A. toltecus, its
closest relative in all analysis. Both values are in the range expected for
typical sister species divergence, but are high for intraspecific divergence
(Bradley and Baker, 2001).
We see two possible scenarios to solve this issue. First, Koopman (1982
apud Timm, 1985) synonymized
A. ravus and A. phaeotis (also followed
by Handley, 1987).
A. ravus was also described as a subspecies of A.
toltecus
from Ecuador (Webster and Jones, 1982a), showing remarkable
external similarities, but was refused by other authors (Handley, 1987;
Simmons, 2005).
A. ravus original description comes also from
Esmeraldas, Ecuador and perhaps the sequence
AY157584 was indeed
an
A. ravus sequence, so the synonymy of A. ravus and A. phaeotis must
be considered. Second, the sequence
APU66514 from Nicaragua
probably belongs to
A. phaeotis palatinus a clearly demarked subspecies
restricted to the western coast of Central America (Timm, 1985); if so, the
subspecific status of
A. p. palatinus should be reviewed.
97
30
A. aztecus is the largest of the small Artibeus and morphologically is
closely related to
A. toltecus, even with a large size difference (Webster
and Jones, 1982b; Handley, 1987). In our analysis,
A. aztecus appears to
be more related to
A. watsoni with high support values.
The first group to branch out of the second clade of the
Dermanura group
is formed by
A. phaeotis APU66514 and A. toltecus. The situation of A.
phaeotis
was already discussed; A. toltecus is also distributed in Central
and North America (Simmons, 2005).
The next to branch out is
A. cinereus sp2, with moderate to high support
values (ML SH-like = 85,
2
= 99, boot-ML = 64; BP = 76). A. cinereus
sp2 was collected in the Serra do Mar, in the Atlantic Forest, and was
recognized as a different species from
A. cinereus by Ditchfield (1996 and
2000). It is very distinct in the trees made by all methods; in the MP tree
it is sister to all small species. Sequence divergence is high, reaching
8.17% when compared to other
A. cinereus and 8.11% to A. anderseni,
the two closest taxa. Both values are high for intraspecific divergence but
commonly found between sister species (Bradley and Baker, 2001).
Bayesian monophyly test could not reject the clustering with
A. cinereus,
but its frequency in the posterior distribution of trees is only 1.32%.
Morphometric analysis shows that
A. cinereus sp2 is larger than common
A. cinereus of both subspecies (A. c. quadrivittatus and A. c. cinereus) and
it also presents a darker fur color than typical
A. cinereus (data from
Ditchfield and Redondo in preparation). We did not find any possible
synonyms for this species and its distribution is perhaps only shared with
A. gnomus and A. glaucus (Tavares et al., 2007; Simmons, 2005), both
easily distinguishable from
A. cinereus sp2 by morphology and molecular
98
31
analysis. We do believe that it is a new species, its formal description will
be published elsewhere (Ditchfield and Redondo in preparation).
The last clade is formed (in branching order) by
A. cinereus, A. anderseni,
A. glaucus and A. gnomus with low (A. cinereus and A. anderseni
branching) to high (A. glaucus plus A. gnomus clade) support values. This
branching order is the same recovered by Van den Bussche et al. (1998).
Prior to the revision by Handley (1987), all of these species (except for
A.
gnomus
described in that work) were considered subspecies of A.
cinereus
. A. cinereus has a distribution ranging from northern South
America in the Amazon to coastal Atlantic Forest in Brazil (Simmons,
2005; Handley, 1987; Ditchfield, 2000), distinct from
A. anderseni that
ranges in northwest South-America (Bolivia, Ecuador, Peru and northwest
Brazil). Because of low support values for the
A. anderseni branching we
searched in the posterior distribution of Bayesian trees for the ones where
A. anderseni and A. cinereus form a mixed group. This hypothesis could
not be rejected at P< 0.05 but its probability is only 0.0158. They also
form very clearly defined monophyletic groups on the trees and the mean
sequence divergence is about 6.96%.
Artibeus glaucus and A. gnomus form a monophyletic clade with very high
support values in all analysis (ML SH-like = 97,
2
= 99, boot-ML = 98; DI
= 10; BP = 100). This also correlates with morphological features shared
by the two species (Handley, 1987), even though they are easily
distinguishable in external characteristics (Handley, 1987).
A. glaucus is
thought to have a discontinuous distribution, ranging in northwest South
America (not in the Brazilian Amazon), then reappearing in southern Brazil
(Simmons, 2005; Tavares et al., 2007). Marinho-Filho and Sazima (1998)
99
32
argue that the species should occur in the Brazilian Amazon, Atlantic
Forest and Pantanal. However we found no record for this species in any
of these habitats, which was not collected during the large field survey in
Atlantic Forest by Ditchfield (1996) and other expeditions carried out
during this work.
Artibeus gnomus has a large, ragged distribution, being found in northern
South America (Amazon), central (Cerrado) and southeast (Atlantic
Forest) Brazil (Simmons, 2005; Handley, 1987; Tavares et al., 2007;
Ditchfield, 2000; Gonçalves and Gregorin, 2004). We found two very
distinct clades (7.1% sequence divergence, Figures 7 and 8) with very
high support values for each (ML SH-like = 99,
2
= 99, boot-ML = 100;
DI = 22; BP = 100 and ML SH-like = 99,
2
= 99, boot-ML = 100; DI =
18; BP = 100). The first is formed mainly by
A. gnomus haplotypes from
the Cerrado region plus one from Amazon, and the second is formed only
by Amazonian haplotypes. Ditchfield (2000) found 3.3% sequence
divergence between one Atlantic Forest haplotype and Amazonian
haplotypes, which is an expected value for a species with a marked
geographic structure (Bradley and Baker, 2001). However, the large
divergence observed between the two
A. gnomus clades (7.1%) is high for
intraspecific divergence (Bradley and Baker, 2001). There are differences
in size and color between individuals of the two clades, the Amazonian
individuals have the common size for forearm (mean 37.1 mm) and
greatest length of the skull (mean 18.3 mm), while the Cerrado
individuals present a mean forearm length of 40.6 mm and skull length of
20.3 mm. When treated as two separate species they fall in the range of
between species variation for
Cyt-b (Bradley and Baker, 2001) and
100
33
congruent with our results (Figure 7). Although more morphological and
molecular analyses are still needed, we are confident that the
A. gnomus
from Cerrado could be considered a distinct taxon, at least in the
subspecies level.
Finally, this study shows a detailed analysis of molecular markers applied
to systematics and phylogeny of bat species belonging to a highly diverse
genus of the Neotropical region. In addition, it exemplifies the use of
molecular data and analysis in conjunction with classical taxonomy studies
(morphology and biogeography) to suggest and support the identification
of new taxa or to direct new taxonomic studies and revisions.
Acknowledgments
We are grateful to all people who helped in the field works and those who
contributed with samples, in special we would like to thank: Dr. B.
Patterson (FMNH), V.C. Tavares (AMNH/UFMG), F.A. Perini (UFMG), M.H.
Marcos, M.O. Garcia-Lopes (UFMG), C. Aires (USP), F. Martins (USP), A.C.
Pavan (USP), R.Z. Coutinho (UFES), A.P. de Araújo (UFPB) and K. Santos
(UFPB). We also want to thank Dr. B. Patterson again and one anonymous
reviewer for their comments and suggestions that greatly improved this
manuscript. RAFR, LPSB, RFS and FRS were supported by CNPq (Brazil).
This project received grants from FAPEMIG, CNPq, PELD-MCT/CNPq and
Fundação o Boticário (FBPN), all from Brazil.
101
34
References
Anisimova, M., Gascuel, O., 2006. Approximate Likelihood-Ratio Test for
Branches: A Fast, Accurate, and Powerful Alternative. Syst. Biol. 55 (4),
539–552.
Baker, R.J., 1973. Comparative cytogenetics of the New World leaf-nosed
bats (Phyllostomidae). Period. Biol. 75, 37-45.
Bradley, R.D., Baker, R.J., 2001. A test of the genetic species concept:
Cytochrome-b sequences and mammals. J. Mammal. 82 (4), 960–97.
Brandley, M.C., Schmitz, A., Reeder, T.W., 2005. Partitioned Bayesian
Analyses, Partition Choice, and the Phylogenetic Relationships of Scincid
Lizards. Syst. Biol. 54 (3), 373-390.
Carstens, B.C., Sullivan, J., Davalos, L.M., Larsen, P.A., Pedersen, S.C.,
2004. Exploring population genetic structure in three species of Lesser
Antillean bats. Mol. Ecol. 13, 2557–2566.
Davis, W.B., 1984. Review of the large fruit-eating bats of the
Artibeus
‘lituratus’
complex (Chiroptera: Phyllostomidae) in Middle America. Occas.
Pap., Mus. Texas Tech. Univ. 93: 1–16.
DeSalle, R. Egan, M.G., Siddall, M., 2005. The unholy trinity: taxonomy,
species delimitation and DNA barcoding. Phil. Trans. R. Soc. B 360, 1905–
1916.
Ditchfield, A.D., 1996. Phylogeography of neotropical bats using
mitochondrial DNA sequences. PhD. Thesis Dissertation. University of
California, Berkeley. 140 pp.
102
35
Ditchfield, A.D., 2000. The comparative phylogeography of Neotropical
mammals: patterns of intraspecific mitochondrial DNA variation among
bats contrasted to nonvolant small mammals. Mol. Ecol. 9, 1307-1318.
Dunn, C.P., 2003. Keeping taxonomy based in morphology. Trends Ecol.
Evol. 18 (6), 270-271.
Ewing, B., Green, P., 1998. Basecalling of automated sequencer traces
using Phred II: error probabilities. Genome Res. 8, 186-194.
Ewing, B., Hillier, L., Wendi, M., Green, P., 1998. Basecalling of
automated sequencer traces using Phred I: accuracy assessment. Genome
Res. 8, 175-185.
Felsenstein, J., 1985. Confidence limits on phylogenies: An approach using
the bootstrap. Evolution 39, 783–791.
Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA
primers for amplification of mitochondrial cytochrome c oxidase subunit I
from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3 (5),
294-299.
Gonçalves, E., Gregorin, R., 2004. Quirópteros da Estação Ecológica Serra
das Araras, Mato Grosso, Brasil, com o primeiro registro de
Artibeus
gnomus
e A. anderseni para o Cerrado. Lundiana 5 (2), 135-142.
Gordon, D., Abajian, C., Green, P., 1998. Consed: A graphical tool for
sequence finishing. Genome Res. 8, 195-202.
Green, P., 1994. Phrap.
www.genome.washington.edu/UWGC/analysistools/phrap.htm.
103
36
Guerrero, J.A.; de Luna, E., González, D., 2004. Taxonomic status of
Artibeus jamaicensis triomylus inferred from molecular and morphometric
data. J. Mammal. 85 (5), 866-874.
Guerrero, J.A.; de Luna, E., Sánchez-Hernández, C., 2003. Morphometrics
in the quantification of character state identity for the assessment of
primary homology: an analysis of character variation of the genus
Artibeus (Chiroptera: Phylostomidae). Biol. J. Linn. Soc. 80, 45-55.
Guindon, S., Gascuel, O., 2003. A Simple, Fast, and Accurate Algorithm to
Estimate Large Phylogenies by Maximum Likelihood. Syst. Biol. 52 (5),
696–704.
Handley, C.O., 1987. New Species of Mammals from Northern South
America: Fruit-Eating Bats, Genus
Artibeus Leach. Fieldiana: Zoology 39,
163-172.
Handley, C.O., 1989. The
Artibeus of Gray 1838. In: Redford, K.H.,
Eisenberg, J.F. (Eds), Advances in Neotropical Mammalogy. Sandhill Crane
Press, Gainesville, FL, pp. 443-468.
Hebert, P.D.N., Cywinska, A., Ball, S.L., deWaard, J.R., 2003. Biological
identification through DNA barcodes. P. Roy. Soc. B Biol. Sci. 270, 313–
321.
Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen,D.H., Hallwachs, W.,
2004. Ten species in one: DNA barcoding reveals cryptic species in the
neotropical skipper butterfly
Astraptes fulgerator. Proc. Natl Acad. Sci.
USA 101, 14812–14817.
Hoofer, S.R., Baker, R.J., 2006. Molecular systematics of Vampyressine
bats (Phyllostomidae: Stenodermatinae) with comparison of direct and
104
37
indirect surveys of mitochondrial DNA variation. Mol. Phylogenet. Evol. 39,
424–438.
Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of
phylogenetic trees. Bioinformatics 17, 754-755.
Kishino, H., Thorne, J.L., Bruno, W.J., 2001. Performance of a Divergence
Time Estimation Method under a Probabilistic Model of Rate Evolution.
Mol. Biol. Evol. 18 (3), 352–361.
Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V.E., Pääbo, S.,
Villablanca, F.X., Wilson, A.C., 1989. Dynamics of mitochondrial DNA
evolution in animals: amplification and sequencing with conserved
primers. Proc. Natl. Acad. Sci. USA. 86, 6196-6200.
Koopman, K.F., 1982. Biogegraphy of bats of South America. In: Mares,
M.A., Genoways, H.H. (Eds) Mammalian Biology in South America. Special
Publications Series 6, Pymatuning Laboratory of Ecology, University of
Pittsburgh. pp. 237–302.
Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: Integrated software for
Molecular Evolutionary Genetics Analysis and sequence alignment. Brief.
Bioinform. 5, 150-163.
Lim, B. K.; Engstrom, M. D.; Lee, T. E.; Patton, J. C. & Bickham, J. W.,
2004. Molecular differentiation of large species of fruit-eating bats
(
Artibeus) and phylogenetic relationships based on the cytochrome b
gene. Acta Chiropterol. 6 (1), 1-12.
Lim, B.K., 1997. Morphometric differentiation and species status of the
allopatric fruit-eating bats
Artibeus jamaicensis and A. planirostris in
Venezuela. Studies in Neotropical Fauna and Environment 32, 65–71.
105
38
Lim, B.K., Wilson, D.E., 1993. Taxonomic status of
Artibeus amplus
(Chiroptera: Phyllostomidae) in northern South America. J. Mammal. 74,
763–768.
Lipscomb, D., Platnick, N., Wheeler, Q., 2003. The intellectual content of
taxonomy: a comment on DNA taxonomy. Trends Ecol. Evol. 18 (6), 65–
66.
Marinho-Filho, J., Sazima, I., 1998. Brazilian bats and conservation
biology. A first survey. In: Kunz, T.H., Racey, P.A. (Eds.), Bat Biology and
Conservation. Smithsonian Institution, Washington, DC, pp. 282-294.
Marques-Aguiar, S.A., 1994. A systematic review of the large species of
Artibeus Leach, 1821 (Mammalia: Chiroptera), with some phylogenetic
inferences. Boletim do Museu Paraense Emílio Goeldi, Zoologia 10, 3-83.
Mishler, B.D., Theriot, E., 2000. The phylogenetic species concept (sensu
Mishler and Theriot): Monophyly, apomorphy, and phylogenetic species
concepts. In: Wheeler, Q.D., Meier, R. (Eds) Species concepts and
phylogenetic theory. Columbia University Press, New York. pp. 44–54.
Müller, K., 2004. PRAP – computation of Bremmer support for large data
sets. Mol. Phylogenet. Evol. 31, 780–782.
Nixon, K.C., 1999. The Parsimony Ratchet, a new method for rapid
parsimony analysis. Cladistics 15, 407-414.
Owen, R.D., 1987. Phylogenetic analyses of the bat subfamily
Sternodermatinae (Mammalia: Chyroptera). Spec. Pub., Mus. Texas Tech.
Univ. 26, 1-65.
106
39
Owen, R.D., 1991. The systematic status of
Dermanura concolor (Peters,
1865) (Chiroptera: Phyllostomidae), with description of a new genus. B.
Am. Mus. Nat. Hist. 206, 18-25.
Patterson, B.D., Pacheco, V., Ashley, V.M. 1992. On the origins of the
Western Slope region of endemism: systematics of fig-eating bats, genus
Artibeus. In: Young, K.R., Valencia, N. (Eds), Biogeografía, ecología y
conservación del bosque montano en el Perú. Universidad Nacional Mayor
de San Marcos, Lima. pp. 189–205.
Porter, C.A., Baker, R.J., 2004. Systematics of
Vampyressa and related
genera of phyllostomid bats as determined by cytochrome b sequences. J.
Mammal. 85, 126–132.
Posada, D., Buckley, T.R., 2004. Model selection and model averaging in
phylogenetics: advantages of the AIC and Bayesian approaches over
likelihood ratio tests. Syst. Biol. 53, 793-808.
Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA
substitution. Bioinformatics 14, 817–818.
Sambrook, J., Russell, D.W., Sambrook, J., 2001. Molecular Cloning: A
Laboratory Manual. 3.Ed. CSHL press, New York USA.
Santos, F.R., Guimarães, P.E.M., Redondo, R.A.F., 2002. Bancos de DNA:
coleções estratégicas para estudos da biodiversidade. Lundiana 3 (2), 93-
98.
Seberg, O., Humphries, C.J., Knapp, S., Stevenson, D.W., Petersen, G.,
Scharff, N., Andersen, N.M., 2003. Shortcuts in systematics? A
commentary on DNA-based taxonomy. Trends Ecol. Evol. 18, 63–65.
107
40
Sikes, D.S., Lewis, P.O., 2001. PAUPRat: A tool to implement Parsimony
Ratchet searches using PAUP*.
http://www.ucalgary.ca/~dsikes/software2.htm.
Simmons, N.B., 2005. Order Chiroptera. In: Wilson, D.E., Reeder, D.M.
(Eds.), Mammal Species of the World, a Taxonomic and Geographic
reference, Vol 1, third ed. John Hopkins University Press, Washington, DC,
pp. 312–529.
Smith, J.D., 1976. Chiropteran evolution. Spec. Pub., Mus. Texas Tech.
Univ. 10, 46-49.
Stephens, M., Smith, N.J., Donnelly,P., 2001. A new statistical method for
haplotype reconstruction from population data. Am. J. Hum. Genet. 68,
978-989.
Swofford, D.L., 1998. PAUP*: Phylogenetic Analysis Using Parsimony
(*and Other Methods). Version 4.08b10. Sinauer Associates Inc,
Massachusetts USA.
Takezaki, N., Rzhetsky, A., Nei, M., 1995. Phylogenetic Test of the
Molecular Clock and Linearized Trees. Mol. Biol. Evol. 12 (5), 823-833.
Tautz, D., Arctander, P., Minelli, A., Thomas, R.H., Vogler, A.P., 2002.
DNA points the way ahead of taxonomy – in assessing new approaches,
it’s time for DNA’s unique contribution to take a central role. Nature 418,
479.
Tautz, D., Arctander, P., Minelli, A., Thomas, R.H., Vogler, A.P., 2003. A
plea for DNA taxonomy. Trends Ecol. Evol. 18 (6), 70–74.
108
41
Tavares, V.C., Gregorin, R., Peracchi, A.L., 2007. A diversidade de
morcegos no Brasil. In: Pacheco, S.M., Esberard, C.E.L, Marques, R.V.
(Eds) Morcegos do Brasil: Biologia, Sistemática, Ecologia e Conservação.
Planta, Londrina, PR.
In press.
Teeling, E.C., Scally, M. Kao, D.J., Romagnoli, M.L., Springer, M.S.,
Stanhope, M.J., 2000. Molecular evidence regarding the origin of
echolocation and flight in bats. Nature 403, 188-192.
Thorne, J.L., Kishino, H., Painter, I.S., 1998. Estimating the Rate of
Evolution of the Rate of Molecular Evolution. Mol. Biol. Evol. 15 (12),
1647–1657.
Timm, R.M., 1985.
Artibeus phaeotis. Mammalian Species 235, 1-6.
Van Den Bussche, R.A., Hudgeons, J.L., Baker, R.J., 1998. Phylogenetic
accuracy, stability, and congruence: relationships within and among the
New World bat genera
Artibeus, Dermanura and Koopmania. In: Kunz,
T.H., Racey, P.A. (Eds.), Bat Biology and Conservation. Smithsonian
Institution, Washington, DC, pp. 43–58.
Van Den Bussche, RA., Baker, RJ., Wichman, HA., Hamilton, MJ., 1993.
Molecular phylogenetics of Stenodermatini bat genera: Congruence of
data from nuclear and mitochondrial DNA. Mol. Biol. Evol. 10, 944-959.
Webster, W.D., Jones, J.K., 1982a.
Artibeus toltecus. Mammalian Species
178, 1-3.
Webster, W.D., Jones, J.K., 1982b.
Artibeus aztecus. Mammalian Species
177, 1-3.
109
42
Webster, W.D., Jones, J.K., 1983.
Artibeus hirsutus and Artibeus
inopinatus
. Mammalian Species 199, 1-3.
110
43
Figure legends
Figure 1. Map showing the distribution of sampling sites, including those
samples retrieved from GenBank.
Figure 2. Maximum Likelihood tree using all 413
Artibeus Cyt-b haplotypes
of
Artibeus plus 3 outgroup haplotypes. Haplotype sequences of the same
species were ‘condensed’ in triangles with the base size proportional to
sample size and height proportional to the depth of species divergence.
Numbers near the branches represent SH-like test support values.
Figure 3. Maximum Likelihood and Bayesian tree topology using all 413
unique Cyt-b haplotypes of
Artibeus plus 3 outgroup haplotypes.
Haplotype sequences of the same species were 'condensed' in one branch
to facilitate visualization. Numbers above the branches represent the SH-
like test support values and
2
test support values for ML tree,
respectively. Numbers below the branches represent bootstrap support
values (calculated with the 'reduced' dataset) for ML and Bayesian
posterior probabilities respectively. **represents partitions not found in
the bootstrap test.
Figure 4. Maximum Parsimony consensus tree (2940 steps, CI= 0.24, RI=
0.85) using all 413 unique Cyt-b haplotypes of
Artibeus plus 3 outgroup
haplotypes. Haplotype sequences of the same species were 'condensed' in
one branch to facilitate visualization. Numbers above the branches
represent the frequency of the bipartitions found among the 2536 MP
111
44
trees; numbers below the branches are Bremmer Decay Index support
values.
Figure 5. Maximum Likelihood tree topology of
A. lituratus and A.
intermedius
(showed in brackets) haplotypes. A.obscurus haplotypes were
used as outgroup.
Figure 6. Scatter plot of the maximum intraspecific divergence against the
minimum interspecific divergence found in
Artibeus species. A)
Divergences calculated using the 'traditional' species scheme. B)
Divergences calculated taking the taxa called here as 'sp2' as 'true
species'. A triangle represents species that have ‘sp2’ counterparts.
Figure 7. A detail of the ML tree showing the divergence between the two
clades of
Artibeus gnomus that could represent different species. Numbers
below the branches represent SH-like test support values, numbers above
the branches of each clade of
A. gnomus are the Bremmer Decay Index
support values found on the maximum parsimony strict consensus tree.
112
45
Appendix
Species, Sample locations (COUNTRY, location), voucher/field numbers or GenBank
accession number of samples (between parentheses) used in this study
Artibeus amplus
. – BRAZIL. Amazonas: Barcelos (RZ019, RZ044). VENEZUELA.
Pozon (AY642923*, AY642924*). Puerto Cabello (AY684756*).
Artibeus anderseni
. –
BOLIVIA. Pando: Madre de Dios (U66509*). BRAZIL. Acre: Rodrigues Alves (CA032,
CA038, CA043).
Artibeus aztecus
. – MEXICO. Sinaloa (U66510*).
Artibeus cinereus
.
BRAZIL. Espírito Santo: Aracruz (AD333, AD334). Espírito Santo: Guarapari (MON09,
MON13, MON21, MON22, MON23, MON24). Maranhão: Posto Franco (TOC06,
TOC62, TOC70, TOC73). Maranhão: São Luís (VCT358, VCT380, VCT381). Paraíba:
Mamanguape (AD59, AD69, AD79, AD80, AD100). Pernambuco: Tamandaré (AD124,
AD146). Rio Grande do Norte: Baía Formosa (AD104, AD109). Sergipe: Santo Amaro
das Brotas (AD159, AD160, AD161). Tocantins: Jalapão (EG360). FRENCH GUIANA.
Paracou (U66511*).
Artibeus cinereus
sp2. São Paulo: Iguapé (AD626). São Paulo:
Ubatuba (AD437, AD438).
Artibeus concolor
. – BRAZIL. Amazonas: Barcelos
(AD898). Amazonas: Santa Isabel do Rio Negro (AD804, AD850). Pará: Porto de
Trombetas (VCT08b, VCT480). SURINAM. Brokopondo (U66519*). Commewijne
(U66518*).
Artibeus fimbriatus
– BRAZIL. Bahia: Andaraí (UFPB5126). Bahia:
Caravelas (AD212, AD213, AD214). Bahia: Mucugê (LG315). Bahia: Rio de Contas
(UFPB5123). Espírito Santo: Santa Tereza (AD302, AD309). Minas Gerais: Caratinga
(AD363, AD364, AD368, AD376). Minas Gerais: Santa Bárbara (PETI009, PETI022,
PETI033, PETI036, PETIfita45, PETIfita47). Paraná: Guaraqueçaba (AD966). Paraná:
Guaratuba (AD495, AD507, AD519). Paraná: Morretes (AD693, AD695). Rio de
Janeiro: Itatiaia (AD278). Rio de Janeiro: Sumidouro (AD287). São Paulo: Cunha
(AD712, AD718, AD725, AD727, AD728, AD729, AD748). São Paulo: Iguapé
(AD617). São Paulo: Ilha Bela (AD235, AD239). São Paulo: Moji das Cruzes (AD759,
113
46
AD764). São Paulo: Salesópolis (U66498*). São Paulo: Sete Barras (AD569, AD574,
AD594, AD595, AD602). São Paulo: Ubatuba (AD425, AD429).
Artibeus fraterculus
. -
PERU. Lambayeque: Olmos (AFU66499*). Lima: Huarochiri (AY684772*). Amazonas:
Chachapoyas (FMNH128960, FMNH129021, FMNH129076, FMNH129079). Location
Unavailable (AY684777*).
Artibeus glaucus
. – PERU. Cuzco (AGU66512*).
Amazonas: Chachapoyas (FMNH128936, FMNH128938, FMNH170051, FMNH172086,
FMNH174682).
Artibeus gnomus
. – BRAZIL. Amazonas: Barcelos (RZ064).
Amazonas: Santa Isabel do Rio Negro (AD837, AD875). Mato Grosso: Aripuanã
(ARI18). Minas Gerais: Brasilândia de Minas (BREJ10). Minas Gerais: Unaí (MOL31,
MOL34, QUE50). Pará: Porto de Trombetas (VCT430). Rondônia: Ji-Paraná
(FMNHALG14885*). FRENCH GUIANA. Paracou (AGU66513*).
Artibeus hirsutus.
–
MEXICO. Huejuquilla Del Alto (AY684759*, AY684761*, AY684764*). Morelos
(AY144341*). Sonora (AHU66500*).
Artibeus inopinatus
. HONDURAS. Valle: San
Lorenzo (AIU6650*). Location unavailable (AY684773*).
Artibeus jamaicensis
. -
HONDURAS. (AY382783*). Catacamas (AY684742*, AY684745*, AY684751*).
MEXICO. Chiapas (AY382785*, AY382786*). Colima (AY144345*). Guerrero
(AY144342*). Morelos (AY144346*). Quitana Roo (AY144343*). No more details
(AY684748*, AY684749*). Veracruz (AY144340*). PANAMA. No more details
(AY382784*), LESSER ANTILLES (AY572338*, AY572340*, AY572341*, AY572342*,
AY572343*, AY572344*, AY572345*, AY572346*, AY572347*, AY572348*,
AY572349*, AY572352*, AY572353*, AY572354*, AY572355*, AY572356*,
AY572358*, AY572361*, AY572362*, AY572363*, AY572364*).
Artibeus lituratus
.
BRAZIL. – Acre: Rodrigues Alves (CA002, CA011, CA024, CA051, CA053). Amazonas:
Santa Isabel do Rio Negro (AD800, AD801, AD815, AD816, AD838, AD844, AD879).
Bahia: Entre Rios (AD175). Espírito Santo: Aracruz (AD327, AD328, AD329, AD330,
AD331). Espírito Santo: Linhares (AD357, AD359, AD360). Espírito Santo: Santa
114
47
Tereza (AD305, AD306, AD307, AD308). Espírito Santo: Vitória (AD921, AD927,
AD938). Maranhão: Porto Franco (TOC10, TOC11). Mato Grosso: Aripuanã (ARI02,
ARI35, ARI38). Minas Gerais: Belo Horizonte (BH01, BH02, EE10, EE15, EE29,
HF003, HF008, K3-3, K3-4, K3-5, K3-6, K3-7). Minas Gerais: Brasilândia de Minas
(BREJ20). Minas Gerais: Caratinga (AD366, AD367, AD377, AD379). Minas Gerais:
Doresópolis (MF16). Minas Gerais: Furnas (MF05). Minas Gerais: Marliéria (PERD05,
PERD06, PERD07, PERDBH528, PERDBH529, PERDMO03, PERDVT10, PERDVT14,
PERDVT16). Minas Gerais: Ouro Preto (AD387). Minas Gerais: Santa Bárbara
(PETI002, PETI010, PETI013, PETI028, PETI030, PETI031, PETIfita46). Minas
Gerais: Unaí (MOL052, MOL127, QUE129). Pará: Porto de Trombetas (VCT387,
VCT398, VCT406, VCT407, VCT409). Paraíba: Mamanguape (AD081). Paraná: Foz do
Iguaçu (AD537, AD538, AD539, AD540, AD541, AD542, AD543, AD544, AD545,
AD546). Paraná: Guaraqueçaba (AD964, AD965). Paraná: Guaratuba (AD494,
AD501, AD502, AD503, AD504, AD505, AD506, AD516, AD517, AD518). Paraná:
Morretes (AD679, AD680, AD681). Paraná: Santa Terezinha de Itaipu (AD531,
AD532, AD535, AD536). Piauí: Floriano (UFPB5115). Piauí: Palmeirais (UFPB5128).
Rio de Janeiro: Duas Barras (AD291, AD292, AD293). Rio de Janeiro: Itatiaia
(AD276, AD277, AD279). Rio de Janeiro: Mangaratiba (AD280, AD285, AD286). Rio
de Janeiro: Sumidouro (AD288). São Paulo: Cajuru (AD404, AD405). São Paulo:
Cubatão (CA070, CA081). São Paulo: Cunha (AD703, AD704, AD707). São Paulo:
Iguapé (AD615, AD616, AD632). São Paulo: Ilha do Cardoso (FMNH141704,
FMNH141705). São Paulo: Jundiaí (AD448, AD449). São Paulo: Moji das Cruzes
(AD763). São Paulo: Sete Barras (AD559, AD560, AD561, AD562, AD563, AD564,
AD565, AD566, AD567, AD570, AD571, AD590, AD591, AD592, AD593, AD600,
AD601, SM02). São Paulo: Ubatuba (AD426, AD427). COSTA RICA. Guanacaste
(AIU66502*). ECUADOR. Puyo (AY684733*). HONDURAS. Playitas (AY684729*,
115
48
AY684730*). MEXICO. Morelos (AY144338*). Veracruz (AY144339*). PANAMA.
Bocas del Toro (AY684731*). PERU. Amazonas: Luya (FMNH129117, FMNH129118).
TRINIDAD AND TOBAGO. Saint George (ALU66505*). Location unavailable
(AY684732*, AY684737*, AY684738*, AY684740*).
Artibeus obscurus.
- BRAZIL.
Acre: Rodrigues Alves (CA021, CA026). Amazonas: Barcelos (RZ049, RZ068, RZ089,
RZ091, RZ096, RZ097, RZ099). Amazonas: Santa Isabel do Rio Negro (AD812,
AD814, AD826, AD860, AD888, AD889, AD890, AD908). Bahia: Una (AD202). Bahia:
Valença (AD191). Espírito Santo: Aracruz (AD332). Espírito Santo: Santa Tereza
(AD301, AD304). Mato Grosso: Aripuanã (ARI12). Minas Gerais: Caratinga (AD369,
AD380). Minas Gerais: Marliéria (PERD13, PERD14, PERD16). Pará: Porto de
Trombetas (VCT391, VCT400, VCT402,, VCT403, VCT411, VCT438). Paraíba: João
Pessoa (AD041). Paraíba: Mamaguape (AD073). Paraná: Guaratuba (AD521).
Paraná: Morretes (AD691, AD700). Rio Grande do Norte: Baía Formosa (AD106).
Rondônia: Ji-Paraná (FMNHALG14887, FMNHALG14894). São Paulo: Iguapé (AD618,
AD630, AD631). São Paulo: Ilha Bela (AD224). São Paulo: Ilha do Cardoso
(AY684766*). São Paulo: Sete Barras (AD572, AD573). GUYANA. Poataro
(AF423079*). PERU. Madre de Dios (AY684757*, AY684758*). SURINAM. Zanderiji
(AOU66506*). VENEZUELA. Puerto Cabello (AY642921*, AY642922*).
Artibeus
obscurus
sp2. BRAZIL. Acre: Rodrigues Alves (CA022, CA046)
Artibeus phaeotis.
-
ECUADOR. Esmeraldas (AY157584*). NICARAGUA. Manágua (APU66514*).
Artibeus
planirostris.
BRAZIL. – Acre: Rodrigues Alves (CA010). Amazonas: Barcelos (RZ045,
RZ053, RZ061, RZ121, RZ122). Amazonas: Santa Isabel do Rio Negro (AD824,
AD836, AD855, AD856, AD857, AD869, AD876, AD884, AD891). Bahia: Andaraí
(UFPB5127). Bahia: Entre Rios (AD176, AD177, AD184). Bahia: Palmeiras (LG246,
LG255, LG272, LG291). Bahia: Rio de Contas (UFPB5125). Bahia: Valença (AD190,
AD192). Maranhão: Cândido Mendes (LK09, LK10). Maranhão: Godofredo Viana
116
49
(LK01). Maranhão: São Luís (VCT305, VCT318, VCT321, VCT324, VCT326b,
VCT341b, VCT345, VCT359, VCT372, VCT376, VCT377). Mato Grosso: Aripuanã
(ARI30). Mato Grosso do Sul: Aquidauana (4521, 4522, 4530). Minas Gerais: Belo
Horizonte (EE14). Minas Gerais: Brasilândia de Minas (BREJ14, BREJ15, BREJ16,
BREJ17, BREJ19, BREJ21, BREJ22, BREJBH509, BREJBH510, BREJBH511,
BREJBH512, BREJBH514A, BREJBH514B, BREJBH516, BREJBH517, BREJBH519,
BREJBH520). Minas Gerais: Dores do Indaiá (DI006, DI008). Minas Gerais:
Doresópolis (MF15). Minas Gerais: Itacarambi (PNP005, PNP010, PNPBH530,
PNPBH533, PNPBH538, PNPBH539, PNPBH542). Minas Gerais: Monjolos (MOL229,
MOL230). Minas Gerais: Unaí (MOL042, MOL045, MOL054, MOL060, MOL133,
QUE016). Pará: Porto de Trombetas (VCT397, VCT404, VCT408). Paraíba: Campina
Grande (AD034). Paraíba: João Pessoa (AD038, AD039, AD040, UFPB5120,
UFPB5121). Paraíba: Mamaguape (AD066, AD072, AD076, AD077, AD082, AD083,
AD087, AD091). Pernambuco: Olinda (AD155, AD156, AD157, AD158). Pernambuco:
Tamandaré (AD134, AD136, AD143, AD144, AD145). Piauí: Floriano (UFPB5107,
UFPB5109). Piauí: Palmeirais (UFPB5111, UFPB5129). Piauí: Uruçuí (UFPB5106). Rio
Grande do Norte: Baía Formosa (AD107). São Paulo: Sales Oliveira (AD753).
BOLIVIA. La Paz (AY684718*, AY684723*). ECUADOR. Puyo (AY684713*,
AY684714*, AY684717*, AY684719*, AY684721*, AY684727*, AY684753*). FRENCH
GUIANA. Paracou (AJU66503*). PARAGUAY. Concepción: Serranía San Luis
(AY684775*). PERU. Cuzco (AY684725, AY684726). Amazonas: Chachapoyas
(APU66508*, AY684716*, AY684722*, AY684724*, AY684743*, AY684754*,
FMNH129120, FMNH169902). Location unavailable (AY684720*, AY684774*).
Artibeus toltecus
. PANAMA. Darien (ATU66515*).
Artibeus watsoni
. NICARÁGUA.
Zelaya (AGU66516*).
Enchisthenes hartii
. PERU. Huanuco (AHU66517*). Cuzco:
Paucartambo (FMNH174703, FMNH174704).
117
50
* GenBank accession numbers
118
Table 1. Sumary of the sampling and molecular diversity information found in all
Artibeus
species studied
Species
Number of
individuals
Number of
localities
sampled
Number of
haplotypes
found
Haplotype
diversity
(H)
Nucleotide
diversity
(π)
Maximum
interspecific
diversity
(K2P)
Minimum
intraspecific
diversity
(K2P)
Artibeus (Artibeus) amplus
5 3 5 1 0.0059 0.0106 0.0418
Artibeus (Dermanura) anderseni
4 2 4 1 0.0131 0.0187 0.0696
Artibeus (Dermanura) aztecus
1 1 1 1 NC NC 0.0485
Artibeus (Dermanura) cinereus
30 11 19 0.9379 0.0060 0.0315 0.0696
Artibeus (Dermanura) cinereus sp2
3 2 3 1 0.0059 0.0079 0.0811
Artibeus (Koopmania) concolor
7 5 7 1 0.0226 0.0334 0.0993
Artibeus (Artibeus) fimbriatus
46 19 37 0.9884 0.0149 0.0409 0.0677
Artibeus (Artibeus) fraterculus
6 5 5 0.9333 0.0114 0.0169 0.0671
Artibeus (Dermanura) glaucus
5 4 4 0.9000 0.0281 0.0428 0.0890
Artibeus (Dermanura) gnomus
'Amazonian clade'
6 5 6 1 0.0379 0.0523 0.0701
Artibeus (Dermanura) gnomus
'Cerrado clade'
5 3 4 0.9000 0.0032 0.0053 0.0701
Artibeus (Artibeus) hirsutus
6 4 6 1 0.0122 0.0241 0.0671
Artibeus (Artibeus) inopinatus
1 1 1 1 NC NC 0.0758
Artibeus (Artibeus) jamaicensis
33 25 33 1 0.0208 0.0533 0.0543
Artibeus (Artibeus) jamaicensis sp2
2 1 2 1 0.0090 0.0035 0.0492
Artibeus (Artibeus) lituratus
169 53 122 0.9908 0.0140 0.0389 0.0524
Artibeus (Artibeus) obscurus
55 28 37 0.9785 0.0255 0.0539 0.0555
Artibeus (Artibeus) obscurus sp2
2 1 1 1 NC NC 0.0550
Artibeus (Dermanura) phaeotis**
2 2 2 1 0.1294 0.1098 0.0847
Artibeus (Artibeus) planirostris
146 47 111 0.9855 0.0166 0.0474 0.0418
Artibeus (Dermanura) toltecus
1 1 1 1 NC NC 0.0847
Artibeus (Dermanura) watsoni
1 1 1 1 NC NC 0.0485
**
A.phaeotis
clearly represents an composite species (see discussion); NC = non calculable; K2P = Kimura 2 parameter model
119
Figure 1
120
A. (Artibeus) planirostris
A. (Artibeus) amplus
A. (Artibeus) obscurus
A. (Artibeus) lituratus
A. (Artibeus) jamaicensis sp2
A. (Artibeus) obscurus sp2
A. (Artibeus) jamaicensis
A. (Artibeus) fimbriatus
A. (Artibeus) inopinatus
A. (Artibeus) fraterculus
A. (Artibeus) hirsutus
A. (Koopmania) concolor
A. (Dermanura) watsoni
A. (Dermanura) aztecus
A. (Dermanura) phaeotis AY157584
A. (Dermanura) toltecus
A. phaeotis (Dermanura) APU66514
A. (Dermanura) cinereus sp2
A. (Dermanura) gnomus
A. (Dermanura) glaucus
A. (Dermanura) anderseni
A. (Dermanura) cinereus
Enchisthenes hartii
100
98
93
99
80
77
89
99
83
55
95
97
100
77
100
99
73
95
86
100
100
100
99
96
97
68
100
67
85
99
88
98
98
93
18
100
0.05
Figure 2
121
A. planirostris
A. amplus
A. obscurus
A. lituratus
A. jamaicensis sp2
A. obscurus sp2
A. jamaicensis
A. fimbriatus
A. inopinatus
A. fraterculus
A. hirsutus
A. concolor
A. watsoni
A. aztecus
A. phaeotis AY157584
A. toltecus
A. phaeotis APU66514
A. cinereus sp2
A. gnomus
A. glaucus
A. anderseni
A. cinereus
Enchisthenes hartii
100, 99
98, 99
93, 97
99, 99
80, 97
77, 93
89, 99
99, 99
83, 98
55, 71
95, 99
97, 99
100, 99
77, 86
100, 99
99, 99
73, 81
95, 99
86, 99
100, 99
100, 99
100, 99
99, 99
96, 99
97, 99
68, 42
100, 99
67, 99
85, 99
99, 99
88, 99
98, 99
98, 99
93, 99
18, 52
100, 99
**, 57
98, 73
92, 73
99, 100
73, 73
64, 55
60, 52
54, 64
46, 51
100,100
86, 88
96, 100
96, 71
85, 68
94, 73
43, 45
68, 73
71, 73
54, 92
60, 86
Figure 3
122
A. planirostris
A. amplus
A. obscurus
A. lituratus
A. jamaicensis sp2
A. obscurus sp2
A. jamaicensis
A. fimbriatus
A. inopinatus
A. fraterculus
A. hirsutus
A. cinereus sp2
A. phaeotis APU66514
A. toltecus
A. aztecus
A. watsoni
A. phaeotis AY157584
A. gnomus
A. glaucus
A. anderseni
A. cinereus
A. concolor
Enchisthenes hartii
1
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
4
100
100
100
77
1
3
6
3
100
3
4
1
2
2
2
2
2
2
13
16
10
3
10
Figure 4
123
A.fimbriatus
A.glaucus
A.gnomus
A.lituratus
A.amplus
A.concolor
A.hirsutus
A.phaeotis**
A.aztecus
A.toltecus
E.hartii
A.cinereus
A.anderseni
A.jamaicensis
A.planirostris
A.obscurus
A.fraterculus*
A.inopinatus
A.watsoni
0%
2%
4%
6%
8%
10%
12%
14%
16%
0% 2% 4% 6% 8% 10% 12% 14% 16%
Maximum intraspecific divergence
Minimum interspecific divergence
A.cinereus sp2
A.glaucus
A.gnomus
A.lituratus
A.planirostris
A.obscurus sp2
A.concolor
A.phaeotis**
E.hartii
A.cinereus
A.fimbriatus
A.gnomus sp2
A.anderseni
A.jamaicensis
A.jamaicensis sp2
A.obscurus
A.amplus
A.fraterculus
A.hirsutus
A.aztecus
A.toltecus
A.watsoni
0%
2%
4%
6%
8%
10%
12%
14%
16%
0% 2% 4% 6% 8% 10% 12% 14% 16%
Maximum intraspecific divergence
Minimum interspecific divergence
Figure 6
124
Capítulo 4.
Filogeografia Comparada de 6 espécies de morcegos
frugívoros do gênero Artibeus, Leach, 1821 (Chiroptera:
Phyllostomidae)
Manuscrito ainda em preparação a ser submetido ao Journal of
Biogeography
125
Filogeografia Comparada de 6 espécies de morcegos
frugívoros do gênero Artibeus, Leach, 1821 (Chiroptera:
Phyllostomidae)
Rodrigo A. F. Redondo
1
*, Albert David Ditchfield
2
*, Letícia P.S. Brina
1
&
Fabrício R. Santos
1
1
Departamento de Biologia Geral, Instituto de Ciências Biológicas,
Universidade Federal de Minas Gerais
2
Departamento de Ciências Biológicas, CCHN - Universidade Federal do
Espírito Santo
* Estes autores contribuiram igualmente para este trabalho.
126
1. Introdução
Este capítulo visa apresentar dados e análises filogeográficas preliminares de 6
espécies do gênero
Artibeus
utilizando DNA mitocondrial, que serão posteriormente
utilizados para a elaboração de um manuscrito a ser submetido para o ‘Jornal of
Biogeography’. Este trabalho foi feito em colaboração com o Dr. Albert David
Ditchfield da Universidade Federal do Espírito Santo, as discussões e conclusões
apresentadas foram fruto desta colaboração com ativa participação do Dr. Ditchfield.
Uma revisão do termo filogeografia e do conhecimento atual em filogeografia de
morcegos foi apresentado no Capítulo 1. As espécies analisadas nesta seção foram:
Artibeus lituratus
,
Artibeus planirostris
,
Artibeus obscurus
,
Artibeus fimbriatus
,
Artibeus cinereus
e
Artibeus gnomus
.
2. Material e Métodos
2.1. Amostragem
A amostragem foi realizada principalmente por 3 meios: coleta de indivíduos ou
tecido em trabalhos de campo, empréstimo de material de coleções: Dr. Albert
Ditchfield da UFES, Dr. Bruce Patterson do Field Museum of Natural History, Ana
Paloma de Araujo UFPB e doações de amostras ao banco de DNA do Lbem da UFMG,
estas doações foram feitas principalmente pelos biólogos Fernando A. Perini da
FUNCESI/UFRJ, Maria Olímpia G. Lopes, Marcelo H. Marcos da Secretaria de Saúde
Pública –MG e Valéria C. Tavares do AMNH-EUA/Mastozoologia UFMG.
A amostragem foi completada com sequências recuperadas dos bancos de dados do
GenBank.
127
Um total de 457 indivíduos das espécies de
Artibeus
acima indicadas foram
amostrados. O número de amostras para cada espécie bem como dados de
diversidade podem ser vistos na Tabela 1. Mapas com as localidades onde cada
espécie foi coletada podem ser vistos nas figuras 1, 2, 3, 4, 5 e 6.
2.2. Métodos moleculares
2.2.1. Extração do DNA
As extrações de DNA foram realizadas pelo método de Fenol/Clorofórmio (Sambrook
et al., 2001) com modificações, ou com a utilização de Kits de extração DNeasy®
(Qiagen) utilizando as recomendações do fabricante.
O DNA extraído foi visualizado em gel de agarose 0,8% (Sambrook et al., 2001),
principalmente para checar a sua integridade e pureza, assim como estimar sua
quantidade.
Uma parte do DNA extraído foi aliquotado para a utilização neste projeto, e o
restante foi depositado no Banco de DNA do Laboratório de Biodiversidade e
Evolução Molecular, ICB-UFMG (Santos et al., 2002; www.icb.ufmg.br/lbem/ddb)
2.2.2. Reação em cadeia da polimerase
O Cyt-b foi amplificado com iniciadores desenhados neste projeto, chamados de
L14121 e H15318 seguindo a numeração da seqüência completa da mitocôndria de
A. jamaicensis NC_002009 encontrada no GenBank. O primeiro se acopla no fim do
gene ND6 e o segundo no fim da alça-D da região controladora da replicação
mitocondrial, gerando um fragmento de aproximadamente 1250 pb.
128
Após padronizações, as reações de amplificação pela PCR foram feitas em um
volume final de 15 μL, contendo aproximadamente 40-80 ng de DNA genômico,
tampão da reação 1B (Phoneutria® - 1,5 mM de MgCl2, 10 mM Tris-HCl (pH 8,4), 50
mM KCl, 0,1% Triton X-100), 200 μM de dNTPs (Amersham-Biosciences®), 0,5 μM
de iniciadores e 1,25 U de Taq DNA polimerase (Phoneutria®).
Os produtos da PCR foram visualizados em gel de agarose 0,8% como descrito
anteriormente para a verificação e dosagem do produto amplificado.
2.2.3. Sequenciamento
Antes do seqüenciamento, os produtos da PCR foram purificados utilizando protocolo
de precipitação com PEG 8000 (Sambrook et al., 2001) para a eliminação do excesso
de iniciadores e dNTPs que podem atrapalhar a reação de seqüenciamento.
O seqüenciamento dos segmentos amplificados foi realizado no equipamento a laser
MegaBACE 1000® da Amersham-Biosciences, utilizando kits para seqüenciamento
DYEnamic ET® Terminator da mesma companhia e protocolo sugerido pelo
fabricante.
Os iniciadores utilizados no seqüenciamento foram os mesmos utilizados na PCR e
mais dois iniciadores internos (MVZ04 e L14881) para uma cobertura total do gene e
todas as amostras foram seqüenciadas no sentido direto e reverso, pelo menos duas
vezes para garantir a qualidade das seqüências.
2.2.4. Montagem e validação das seqüências
A qualidade das seqüências foi verificada no programa Phred v.0.20425 (Ewing et
al., 1998; Ewing & Green, 1998), utilizando o parâmetro phred=20 para a validação
129
das bases. Os fragmentos seqüenciados foram montados e alinhados no programa
Phrap v.0.990319 (Green, 1994), e visualizados e editados no programa Consed 12.0
(Gordon et al., 1998).
2.3. Análises dos Dados
Uma série de ferramentas para análises populacionais e filogeográficas
implementadas em vários programas como Arlequin 3.1 (Schneider, Roesli &
Excoffier, 2001), DNAsp 4.10 (Rozas et al., 2003) e MEGA 3.1 (Kumar, Tamura &
Nei, 2004) foram utilizadas.
Dentro de cada espécie, indivíduos que compartilhem uma história recente e/ou
localização geográfica são colocados em filogrupos. Os filogrupos são estimados,
baseado nas reconstruções da filogenia de cada espécie. Agrupamentos das
subespécies reconhecidas para cada espécie também foram utilizados para testar a
partição da variabilidade genética numa análise de variância molecular (AMOVA).
Cálculos de distância par a par utilizando distâncias corrigidas pelo modelo de
Tamura e Nei (estimado pelo método Modeltest – Posada & Crandal, 1998) foram
realizadas para medir a divergência genética entre os indivíduos, dentro e entre
filogrupos e foram realizadas nos programas Arlequin 3.1 e MEGA 3.1.
Parâmetros populacionais como estimadores de diversidade haplotípica (h),
diversidade nucleotídica (π) e sítios segregantes (s) foram estimados para cada
conjunto de dados (espécies e filogrupos). Para a interpretação dos estimadores de
diversidade π e s foi utilizado o teste-D de Tajima (Tajima, 1989a) e a estatística Fs
de Fu (Fu, 1997) para verificar tambem sinal de expansão populacional.
Análise de variância molecular (AMOVA; Excoffier, Smouse & Quattro, 1992) baseada
em estimativas do Φst, um análogo do Fst (como calculado por Hudson, Slatkin &
130
Maddison, 1992) foram utilizadas para verificar a partição da variabilidade genética
em diferentes tipos de agrupamento com o intuito de encontrar padrões de estrutura
populacional: sem agrupamentos, agrupando por localidades geográficas, agrupando
por filogrupos, agrupando por biomas/ecoregiões. O próprio Φst será utilizado para
estimar o fluxo gênico entre os agrupamentos.
O programa MEGA 3.1 (Kumar, Tamura & Nei, 2004) foi utilizado para cálculo da
divergência de sequências e de grupos.
Redes haplotípicas foram geradas no programa network NETWORK 4.1.1- (Bandelt,
Forster & Röhl, 1999).
3. Resultados
Um resumo dos índices da variabilidade genética encontrada pode ser visto na
Tabela 1.
Nenhuma das espécies analisadas apresentaram qualquer padrão de estruturação
geográfica em grande escala, porém algumas delas apresentaram padrões em
pequena escala geográfica, em alguns casos correlacionada com o bioma onde foram
encontradas. Resultados para cada espécie seguem abaixo
3.1.
Artibeus lituratus
Foram encontrados 122 haplótipos nos 169 indivíduos de
Artibeus lituratus
analisados. A diversidade haplotípica foi de h= 0,9908 e a diversidade nucleotídica
foi de π= 0,0140. O baixo valor de diversidade nucleotídica encontrado é
impresionante já que a amostragem cobre mais de 50 localidades, algumas distantes
mais de 7500 Km, o valor encontrado é baixo até para pequenos mamíferos não
voadores encontrados dentro de uma mesma localidade (Smith & Patton, 1991),
131
indicando um alto fluxo gênico comparável ao de algumas aves de grande dispersão
(Ditchfield & Burns, 1998).
Nenhum tipo de agrupamento filogeográfico pôde ser observado nem em escala
microgeográfica ou macrogeográfica (Figura 1). Análises de AMOVA não
apresentaram qualquer tipo de partição significativa, mesmo em termos de
biomas/ecoregiões.
A AMOVA apresentou que a variância genética entre os grupos de biomas/ecoregiões
divididos em Mata Atlantica, Cerrado, Amazônia e América Central, explicam apenas
4% da variação encontrada. O Φst estimado entre estes agrupamentos foi de 0,04
um valor extremamente baixo e que também corrobora a existencia de um grande
fluxo gênico na espécie.
Mais ainda alguns haplótipos em
A. lituratus
são compartilhados por localidades
incrivelmente distantes, como por exemplo o haplótipo Alit_13 é compartilhado entre
Mamanguape na Paraíba, Belo Horizonte em Minas Gerais e Cunha em São Paulo, e
mais impressionante ainda o haplótipo Alit_46 é compartilhado entre Guaratuba no
Paraná e Jundiaí em São Paulo e localidades tão distantes quanto Rodrigues Alves no
Acre, Porto-Trombetas no Pará e Santa Isabel do Rio Negro no Amazonas, distâncias
de mais de 3200 Km. Outros haplótipos como o Alit_50 e Alit_59 também
apresentam este tipo de padrão sendo compartilhados entre o Sul e Sudeste do País
com o Norte amazônico.
Como um último teste para se verificar a ausência de estrutura geográfica, 7
localidades foram arbitrariamente escolhidas com o intuito de se medir h e π como
estimadores de variabilidade genética e compará-la com os níveis encontrados na
escala continental. As localidades escolhidas foram Santa Isabel do Rio Negro no
Amazonas, Rodrigues Alves no Acre, Belo Horizonte e Marliéria (Parque Estadual do
132
Rio Doce) em Minas Gerais, Sete Barras em São Paulo, Guaratuba e Foz do Iguaçu
no Paraná. Estas localidades foram escolhidas por terem tido amostras maiores 7 –
11 indivíduos e por estarem geograficamente distantes e representar tanto
populações de áreas preservadas, quanto impactadas.
Os valores de diversidade haplotípica foram altos em todas as localidades e variaram
entre h= 1 em quatro localidades e h= 0,9722 no Parque Estadual do Rio Doce, os
valores da diversidade haplotípica foram muito baixos, variando entre π= 0,122 em
Guaratuba e π= 0,0154 em santa Isabel do Rio Negro. Este dado é muito importante
já que ele suporta a noção de que não existe estrutura geográfica alguma em
A.
lituratus
, uma vez que a variação genética local é essencialmente a mesma daquela
encontrada do México ao sul do Brasil.
Artibeus intermedius
é considerado por alguns autores como uma espécie distinta de
A. lituratus
e outros autores consideram-no como uma subespécie
A. lituratus
intermedius
. No capítulo anterior nós demonstramos que não existe suporte para a
existência de
A. intermedius
como espécie, uma vez que não existe monofilia
recíproca para os haplótipos de Citocromo b, e não existe nem monofilia do grupo
dentro da variação encontrada para
A. lituratus
o que também indica não se tratar
de uma subespécie típica. Estes dados são também corroborados por dados de
morfologia (Marques-Aguiar, 1994).
Para testar se a variância genética encontrada em
Artibeus
poderia estar
particionada entre as possíveis subespécies, fizemos uma AMOVA, considerando
como grupos distintos os
A. lituratus intermedius
que foram identificados como tais
nos bancos de dados do GenBank e dos museus onde os vouchers dos indivíduos
estão identificados e os
A. lituratus lituratus
restantes. A divisão em subespécies
explica apenas 6,8% da variação encontrada, e a média de divergência entre os dois
133
grupos é de 1,8%. Estes valores são ainda muito baixos para serem considerados
valores típicos de subespécies (Miththapala, Seidensticker & O'Brien 1996).
Nos testes para verificar expansão populacional, tanto o D de Tajima quanto o FS de
Fu foram significativos, com D= -1,69 e P = 0,018 e FS= -23,89 e P = 0,001. O
gráfico das distribuições de desencontros (Mismatch distributions) também apresenta
padrão de expansão populacional (dado não apresentado).
3.2.
Artibeus fimbriatus
Em
A. fimbriatus
37 haplótipos foram encontrados nos 46 indivíduos analisados, com
h= 0,9884 e π= 0,0149.
A. fimbriatus
é similar em tamanho e peso a
A. lituratus
, mas só é encontrado na
Mata Atlântica do sudeste do Brasil e matas úmidas no sul do Paraguai. Apesar de
geograficamente mais restrito do que
A. lituratus
,
A. fimbriatus
apresentou um
padrão filogeográfico muito similar ao de
A. lituratus
, com um grande número de
haplótipos e uma baixa diversidade entre eles.
A amostragem abrangeu praticamente toda a distribuição latitudinal da espécie na
Mata atlântica da Bahia ao Paraná (Figura 2). Existem haplótipos compartilhados
entre localidades distantes cerca de 1000 Km entre Minas Gerais, São Paulo e
Paraná, entretanto o número de haplótipos compartilhados foi menor que em
A.
lituratus.
Nenhuma estruturação geográfica foi encontrada, uma divisão entre Norte e Sul
explica apenas 9% da variabilidade observada.
Testes de expansão recente da população foram não significativos e a distribuição de
desencontros mostra um padrão típico de populações em equilíbrio.
134
3.3.
Artibeus planirostris
Artibeus planirostris
tem uma distribuição geográfica ampla cobrindo praticamente
toda a América do Sul (com exceção do chile do Uruguai, da maior parte da
Argentina e do Sul do Brasil) e ainda é considerado por alguns autores (Simmons,
2005) como uma subespécie de
A. jamaicensis
. No Capítulo 3 desta dissertação fica
evidente que
A. planirostris
e
A. jamaicensis
são espécies distintas, sem, nem ao
menos, possuírem um ancestral direto comum. Deste modo trataremos como A.
planirostris todos os indivíduos identificados como
A. jamaicensis
ou
A. planirostris
amostrados na América do Sul, uma vez que todos formam um grupo
reciprocamente monofilético.
Foram encontrados 111 haplótipos nos 146 indivíduos analisados em pelo menos 47
localidades na América do Sul. A diversidade haplotípica foi de h= 0,9855 e a
diversidade nucleotídica π= 0,0166, níveis semelhantes aos encontrados para
A.
lituratus
e
A. fimbriatus
.
Apenas dois haplótipos foram compartilhados a longa distâncias: o Apla_32 de alta
frequencia e é encontrado no Pantanal (Mato Grosso do sul), Cerrado (Piauí),
Caatinga (Bahia) e Mata Atlântica do Nordeste (Paraíba e Bahia) e o Apla_69
compartilhado entre São Luiz no Maranhão e Brasilândia em Minas Gerais.
Apesar da diversidade haplotípica e nucleotídica ser semelhante à de
A. lituratus
e
A.
fimbriatus
, uma AMOVA feita entre a divisão em biomas revela que 24,83% da
variância observada se deve a esta divisão. A rede haplotípica da Figura 3 apesar de
extremamente complicada, e com muitas recorrências, mostra com clareza, que
existe um agrupamento da maioria dos haplótipos da Mata Atlântica e um
agrupamento da maioria dos haplótipos do Cerrado, com uma enorme quantidade de
135
haplótipos amazônicos permeando estes agrupamentos e gerando agrupamentos
próprios. A Amazônia não é um ambiente homogêneo e algumas divisões internas
são esperadas. Uma redivisão da Amazônia em 3 áreas (Nordeste, Noroeste e Oeste)
aumenta a para 31,2% a variancia contida entre os grupos mostrando um pouco
mais de estruturação geográfica.
A última análise de AMOVA foi para testar se a divisão nas reconhecidas subespécies
de A. planirostris (Hollis, 2005). A divisão nas subespécies
A. planirostris fallax
,
A.
planirostris hecules
,
A. planirostris planirostris
e
A. planirostris trinitati
s foi feita com
base na distribuição geográfica das subespécies e explica apenas 9,3% da variação
encontrada, muito menos que a divisão em biomas.
Testes de expansão populacional foram significativos para o Cerrado (D=-1,94, P=
0,007), Mata Atlântica (D= -1,47 e P= 0,0470) e para a Amazônia, quando
considerada como conjunto (D= -1,78 e P=0,011). Distribuição de desencontros para
a espécie também mostra sinais de expansão populacional, semelhantes as de
A.
lituratus
.
3.4.
Artibeus obscurus
Artibeus obscurus
é considerado um morcego de médio porte, sendo menor que
A.
lituratus
,
A. planirostris
e
A. fimbriatus
, porém não tão pequeno quanto
A. cinereus
e
A. gnomus
(abaixo), sua área de vida parece ser menor do que a dos morcegos
anteriormente descritos e aparentemente ele possuí uma preferencia por ambientes
úmidos (Charles Handley, comunicação pessoal para A.D. Ditchfield).
Foram encontrados 37 haplótipos em 55 indivíduos, gerando uma diversidade
haplotípica de h= 0,9785. A diversidade nucleotídica foi de π= 0,0255 sendo mais
elevada do que a encontrada para os outros
Artibeus
vistos anteriormente.
136
Não foram encontrados haplótipos compartilhados em distâncias comparáveis aos
exemplos anteriores, sendo estes compartilhados apenas entre regiões próximas. O
mais distante compartilhamento é do haplótipo Aobs_19, compartilhado entre Sete
Barras em São Paulo e o Parque Estadual do Rio Doce em Minas Gerais.
A AMOVA mostrou forte estrutura geográfica, facilmente vista na rede haplotípica da
Figura 4. A divisão em biomas responde 54,9% da variabilidade genética encontrada,
mesmo considerando a Amazônia como um único ambiente. Redividindo a Amazônia
de forma semelhante a feita para
A. planirostris
, a variância (e consequentemente o
Φst) sobem para 63,68%.
3.5.
Artibeus cinereus
Artibeus cinereus
é um morcego de pequeno porte, pertencente ao subgênero
Dermanura
. Dos 30 indivíduos sequenciados foram encontrados 19 haplótipos. A
diversidade haplotípica foi de h= 0,9379 e a nucleotídica foi de π= 0,0058.
Devido a alta diversidade haplotípica e a baixíssima diversidade nucleotídica
apresentada, seria esperado a não existencia de subdivisão geográfica, entretanto,
como no caso de
A. planirostris
, a divisão em biomas apresenta uma leve partição da
variabilidade genética observada. Analise de AMOVA mostra que 21,3% da variação
se deve à divisão em biomas (Mata Atlântica, Cerrado e Amazônia). Apenas dois
haplótipos são compatilhados a grandes distâncias, Aci_9 entre Sergipe e o Espírito
Santo e Aci_10 entre Pernambuco,Sergipe, Bahia, Espírito Santo e norte do
Maranhão.
Dentro dos biomas não houve sinal de expansão populacional, na espécie como um
todo os testes de Tajima e Fu foram significativos (P= 0,006 e P=0,023
137
respectivamente), porém a distribuição de desencontros não parece unimodal como
esperado para populações em expansão.
3.6.
Artibeus gnomus
Artibeus gnomus
é um dos menores
Artibeus
em tamanho e peso, e também
pertence ao subgênero
Dermanura
. Até recentemente esta espécie só existia para a
Amazônia, porém recentemente (Gonçalves e Gregorin, 2004; Aguiar et al. 1995), foi
também reportada para o Cerrado e Mata Atlântica.
No Capítulo 3 desta dissertação discutimos a possibilidade da variedade de A.
gnomus encontrada no Cerrado (de Minas Gerais) pertencer a uma outra espécie ou
ser uma subespécie de
A. gnomus
. Tomando os 11 indivíduos sequenciados e
analisando como uma única espécie a diversidade haplotípica h= 0.9818 e a
nucleotídica é π= 0,0457.
A alta diversidade haplotípica parece ser uma constante em
Artibeus
(e em outros
morcegos, veja discussão), entretanto a alta diversidade nucleotídica é única e se
deve ao alto grau de divergência entre os espécimes do ‘tipo Cerrado’. A figura 6
mostra a rede haplotípica encontrada. Note que são necessárias 74 mutações para
conectar os haplótipos do Cerrado com os da Amazônia, excetuando o haplótipo
Agno_6, que se agrupa diretamente com o grupo do Cerrado (ver abaixo).
AMOVA realizada apenas entre os dois grupos mostra o impressionante valor de 71%
de variância sendo respondida por esta divisão. Este alto valor é esperado dado a
grande divergencia entre os haplótipos dos dois grupos. Quando dividimos a
Amazônia em 3 regiões (Figura 6 ) a variância entre os grupos aumenta para 88%,
mostrando que mesmo que os tipos Cerrado e Amazônia sejam espécies diferentes,
existe uma certa estruturação geográfica no
A. gnomus
amazônico. De fato, quando
138
analisamos apenas os indivíduos amazônicos (excluindo o haplótipo Agno_6), a
AMOVA revela que a divisão em grupos na amazônia explica 67,4% da variabilidade
encontradaem
A. gnomus
.
4. Discussão
Nós encontramos sempre altos níveis de diversidade haplotípica em todas as
espécies estudadas, enquanto os níveis de diversidade nucleotídica foram baixos
entre os haplótipos de
A. lituratus
,
A. planirostris
,
A. fimbriatus
,
A. cinereus
,
diversidade moderada/alta em
A. obscurus
e uma muito alta em
A. gnomus
. Padrão
semelhante ao encontrado por Ditchfield (2000) para
A. lituratus
e
A. obscurus
com
uma amostra mais restrita a Mata Atlântica e encontrado também em outras
espécies (Ditchfield, 2000; Carstens et al., 2004).
Baixos níveis de diversidade nucleotídica em grandes distâncias geográficas podem
sugerir coesão genética ou por fluxo gênico entre as populações ,ou por recente
expansão espacial sem tempo suficiente para diversificação entre populações.
Em
A. lituratus
, por exemplo, quando analisamos apenas 7 localidades com maior
número amostral a diversidade encontrada é a mesma da calculada para toda a
distribuição, ou seja em todas as localidades observamos alta diversidade haplotípica
e baixa nucleotídica, mostrando que este é um padrão geral para esta espécie. Isso
associado aos haplótipos encontrados compartilhados entre distâncias superiores a
3000 Km e a ausencia de estrutura geográfica em diferentes partições da AMOVA
sugerem alto fluxo gênico entre as populações.
Entretanto testes para rápida expansão populacional foram significativos o que
sugere que ambos os fatores possam ter influenciado a distribuição filogeográfica
atual de
A. lituratus
.
139
Artibeus lituratus
é uma espécie de hábitos alimentares muito generalista e possui
uma grande tolerância a hábitats diversos, sendo encontrado inclusive em ambientes
antropizados e cidades (dos Reis, 1989). Brosset e Charles Dominique (1990)
concluíram que a área de vida dos indivíduos desta espécie é de mais de 10 Km de
raio, sugerindo um grande potencial para dispersão.
Estas características corroboram os dados observados para
A. lituratus
, que, sendo
um grande dispersor, é capaz de transpor praticamente a maioria das barreiras
geográficas que impediriam o fluxo gênico em espécies mais exigentes.
Embora mais restrito em distribuição geográfica do que
A. lituratus
,
A. fimbriatus
apresenta um padrão filogeográfico semelhante. Porém a hipótese de expansão
populacional foi rejeitada nesta espécie e sua distribuição de desencontros apresenta
um típico perfil de uma população em equilíbrio. Embora não mostrado,
A. fimbriatus
também apresenta a variabilidade por localidade semelhante à variabilidade geral da
espécie, como em
A. lituratus
.
Apesar de pouco se saber sobre a história natural de
A. fimbriatus
, sabemos que ele
é restrito a Mata Atlântica Sul, sendo assim possivelmente mais exigente em termos
de hábitats do que
A. lituratus
, restringindo seu potencial para expansão. Sendo
filogeneticamente mais antigos (ver Capítulo 3), mais restritos em termos de
hábitats, é fácil imaginar sua população em equilíbrio, com alto fluxo gênico dentro
da sua distribuição limitada.
Em
A. planirostris
, embora os níveis de variabilidade haplotípica e nucleotídica sejam
semelhantes a
A. lituratus
e
A. fimbriatus
, uma certa estruturação geográfica foi
detectada. Cerca de 30% da variação pode ser explicada por uma divisão dos biomas
(incluindo 3 divisões na Amazônia), embora apenas na região Amazônica foi possível
encontrar um clado com haplótipos exclusivos.
140
A. planirostris
possuí grande variação em morfologia e é bastante generalista em
termos de hábitats e alimentação (Hollis, 2005). Fora da região amazônica ele é mais
comum em ambientes mais abertos, sendo mais comumente encontrado do que
A.
lituratus
no Cerrado, Pantanal e Caatinga. Na Mata Atlântica
A. lituratus
é muito mais
comum.
Não se sabe muito sobre a área de vida e padrões de dispersão em
A. planirostris
,
porém visto que a os níveis de divergência de sequência dos haplótipos são muito
baixos sria esperado algum tipo de fluxo gênico homogeneizando a espécie.
Por outro lado se tal fluxo existisse teríamos uma situação semelhante a encontrada
em
A. lituratus
, o que não é o caso. É provável que, no caso de
A. planirostris
, a
baixa diversidade de sequência seja consequência de rápida expansão das
populações. Padrões de expansão populacional foram detectados em todos os
biomas, mas principalmente no Cerrado.
Uma análise das conhecidas subespécies de
A. planirostris
em busca de um padrão
para explicar a variabilidade genética encontrada se mostrou infrutífera, explicando
pouco a variação observada (9,3%) em relação às subdivisões já apresentadas.
A. cinereus
é um morcego mais relacionado a áreas úmidas e foi registrado para o
território brasileiro em áreas de Mata Atlântica, Floresta Amazônica e no Cerrado
norte. Ele também apresentou o padrão típico de alta diversidade de haplótipos com
baixa divergência, que no caso de A. cinereus a divergência é baixíssima (π=
0,0058).
Como no caso de
A. planirostris
a AMOVA detectou uma leve estrutura geográfica,
cerca de 21% de divergência entre os biomas. Mas não houve sinal de expansão
populacional por bioma, como o encontrado em
A. planirostris
. Não existe também
sinais de separação entre Mata Atlântica norte e sul, como o encontrado em alguns
141
outros organismos e que apontariam possíveis refúgios florestais pleistocênicos
(Kinzey, 1982). O baixo número de localidades onde foram coletados
A. cinereus
,
principalmente na Amazônia, pode ser um fator que contribua para o excessivamente
baixo valor de divergência dos haplótipos, e torna difícil retirar conclusões para esta
espécie.
Em
Artibeus obscurus
nós encontramos uma marcante estruração geográfica em
termos de biomas e suas subdivisões. AMOVA revela que cerca de 63,7% da
variabilidade encontrada em
A. obscurus
possa ser devida a estas divisões.
Continuando no padrão típico dos morcegos,
A. obscurus
apresenta uma alta
diversidade haplotípica, porém, diferente dos seus congenéricos até agora
apresentados, a diversidade nucleotídica é relativamente maior, com π= 0,0255.
Estes dados sugerem a existencia de algum tipo de isolamento por distância ou
barreiras geográficas ao longo da distribuição, ou ainda algum evento histórico que
marcou esta divisão neste táxon.
O potencial para a existência de fragmentação florestal gerando refúgios no
Pleistoceno ou Plioceno (Kinzey, 1982; Haffer, 1997) levando a efeitos vicariantes e
posterior diversificação é presente em
A. obscurus
. Ecologicamente
A. obscurus
é
uma espécie exclusivamente florestal com nítida preferencia por ambientes úmidos.
Essa diferença faz com que o potencial para isolamento seja maior em
A. obscurus
do que em
A. lituratus
e
A. planirostris
, que sobrevivem bem em qualquer tipo de
ambiente.
Se aceitarmos um relógio molecular para o Cytochromo-b do DNA mitocondrial de
2% de divergencia por milhão de anos (Irwin et al, 1991), dados os que as
divergencias de sequencia entre os grupos variam de 2,5 a 3,9%, podemos inferir
142
que estas divisões ocorreram em torno de 1,25 a 1,9 milhões de anos atrás que são
datas plio-pleistocênicas.
Kinzey (1982) propôs alguns refugios explicando a distribuição de primatas com
ocorrencia para a Mata Atlântica no Brasil. Um refúgio seria correspondente às áreas
costais da Floresta Atlântica na Serra do Mar, na região de São Paulo e Rio de
Janeiro e o outro refúgio seria no nordeste, nas costas dos estados da Paraíba e
Pernambuco. Estes dois refúgios correspondem aos clados encontrados na Mata
Atlântica para
A. obscurus.
Propostas de refúgios aparecerem em literatura muitas vezes como pronunciamentos
e na maioria das vezes sem ser testadas apropriadamente. Testes mais rigorosos
usando mais amostragem e ainda marcadores de loci nucleares seriam necessários
para afirmar esta hipótese, entretanto achamos que
A. obscurus
é um bom
candidato a este tipo de estudo.
Em
Artibeus gnomus
os índices de divergência tanto haplotípica qunto nucleotídica
são muito elevados, o principal fato se dá a existencia dos haplótipos do Cerrado que
são extremamente divergentes dos Amazônicos típicos (Capítulo 3).
O maior problema aqui envolve a delimitação de espécies/ssubespécies. Apesar de
encontrados em todos os animais coletados no Cerrado, e serem muito divergentes
dos Amazônicos, um haplótipo semelhante aos do Cerrado foi encontrado em
Barcelos, no Amazonas. Isso gera um certo problema uma vez que podemos
imaginar que coletas ao longo do Cerrado até a Amazônia possam apresentar uma
continuidade dos haplótipos. Além disso os exemplares do Cerrado apresentam
marcantes diferenças morfológicas.
Neste caso ambas as explicações são possíveis, os indivíduos do Cerrado podem ser
uma outra espécie e que também se distribua até a Amazônia, sendo muito rara na
143
região (ou, devido a ausência de taxonomistas experientes pode estar passando
despercebida). Ou pode ser simplesmente uma subespécie com adaptações típicas
para o Cerrado e devido a deriva de linhagem (lineage sorting) alguns haplótipos
persistem em ambas populações. Em ambos os casos uma maior amostragem tanto
na Amazônia quanto no Cerrado são necessárias para maiores conclusões.
Excetuando este problema e concentrando apenas nos
A. gnomus
típicos da
Amazônia, ainda assim uma estruturação geográfica marcante é observada. Cerca de
67% da variação existem em 3 grupos de haplótipos marcados em 3 regiões
Amazônicas e separados por altos valores de Φst como em
A. obscurus
. Apesar da
baixa amostragem por região a divergência dos haplótipos é muito alta e vale
também notar que as divisões encontradas são as mesmas encontradas para
A.
obscurus
e
A. planirostris
, indicando potencial para a existência de barreiras
geográficas ou eventos históricos nestas regiões. A datação da divergência dos
grupos fica numa média de 2 milhões de anos atrás um pouco mais elevada do que a
de
A. obscurus
, entretanto devido à baixa amostragem estes resultados podem ser
ambíguos.
5. Referencias Bibliográficas
Aguiar, L. M. S., M. Zortea & V. A. Taddei. 1995. New records of bats for the
Brazilian Atlantic Forest. Mammalia, 59(4): 667-671.
Bandelt, H-J., Forster, P. & Röhl, A. (1999). Median-joining networks for inferring
intraspecific phylogenies. Molecular Biology and Evolution 16: 37-48.
Brosset, A. & Charles-Dominique, P. 1990. The bats from French Guiana: A
taxonomic, faunistic and ecological approach. Mammalia 54(4): 509-560.
144
Carstens, B.C., Sullivan, J., Davalos, L.M., Larsen, P.A., Pedersen, S.C. 2004.
Exploring population genetic structure in three species of Lesser Antillean bats.
Molecular Ecology 13, 2557–2566.
Ditchfield, A.D. & Burns, K. (1998). DNA sequences reveal phylogeographic
similarities of neotropical bats and birds. Journal of Comparative Biology 3(2):165-
170.
Ditchfield, AD (2000). The comparative phylogeography of Neotropical mammals:
patterns of intraspecific mitochondrial DNA variation among bats contrasted to
nonvolant small mammals. Molecular Ecology 9: 1307 - 1318.
dos Reis S. F. 1989. Biologia reprodutiva de Artibeus lituratus (Olfers, 1818),
(Chiroptera: Phyllostomidae). Revista Brasileira de Biologia 49(2):369-372.
Ewing, B. & Green, P. 1998. Basecalling of automated sequencer traces using Phred
II. Error probabilities. Genome Research 8: 186-194.
Ewing, B.; Hillier, L.; Wendl, M. & Green, P. 1998. Basecalling of automated
sequencer traces using Phred I: Accuracy assesment. Genome Research 8: 175-185.
Excoffier, L.P., Smouse, E., Quattro, J.M. 1992. Analysis of molecular variance
inferred from metric distances among haplotypes: application to human
mitochondrial DNA restriction data. Genetics 131: 479-491.
FU, Y.-X. 1997. Statistical tests of neutrality of mutations against population growth,
hitchhiking and background selection. Genetics 147: 915-925.
Gonçalves, E., Gregorin, R. 2004. Quirópteros da Estação Ecológica Serra das Araras,
Mato Grosso, Brasil, com o primeiro registro de Artibeus gnomus e A. anderseni para
o Cerrado. Lundiana 5(2), 135-142.
145
Gordon, D.; Abajian, C. & Green, P. 1998. Consed: A graphical tool for sequence
finishing. Genome Research 8: 195-202.
Green, P. 1994.Phrap.www.genome.washington.edu/UWGC/analysistools/phrap.htm
Haffer, J. 1997. Alternative models of vertebrate speciation in Amazonia: An
overview. Biodiversity and Conservation 6: (3) 451-476
Holli, L. 2005.
Artibeus planirostris
. Mammalian Species 775, 1-6.
Hudson, R. R.; Slatkin, M. & Maddison, W. P. 1992. Estimation of levels of gene flow
from DNA sequences data. Genetics 132: 583-589.
Irwin, D. M.; T. D. Kocher; And A. C. Wilson. (1991). Evolution of the cytochrome b
gene of mammals. J. Mol. Evol. 32: 128-144.
Kinzey, W.G. 1982. Distribution of primates and forest refuges. Chapter 25: 455-482
in Prance, G.T. (ed.), Biological Diversification in the Tropics. Columbia Univ. Press,
New York.
Kumar, S.; Tamura, K. & Nei, M. 2004. MEGA3: Integrated software for Molecular
Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5:
150-163.
Marques-Aguiar, S.A. 1994. A systematic review of the large species of Artibeus
Leach, 1821 (Mammalia: Chiroptera), with some phylogenetic inferences. Boletim do
Museu Paraense Emílio Goeldi, Zoologia, 10: 3-83.
Miththapala, S., Seidensticker, J. & O'Brien, S.J. 1996. Phylogeographic Subspecies
Recognition in Leopards (Panthera pardus): Molecular Genetic Variation.
Conservation Genetics 10(4): 1115-1132.
146
Rozas, J., Sánchez-DelBarrio, J. C., Messeguer, X. and Rozas, R. 2003. DnaSP, DNA
polymorphism analyses by the coalescent and other methods. Bioinformatics 19:
2496-2497.
Sambrook, J.; Russell, D.W. & Sambrook, J. 2001. Molecular Cloning: A Laboratory
Manual. 3.Ed. CSHL press, New York USA.
Schneider, S.; Roesli, D. & Excoffier, L. 2001. Arlequin: A software for population
genetics data analysis.
Simmons, N.B., 2005. Order Chiroptera. In: Wilson, D.E., Reeder, D.M. (Eds.),
Mammal Species of the World, a Taxonomic and Geographic reference, Vol 1, third
ed. John Hopkins University Press, Washington, DC, pp. 312–529.
Slatkin, M. & Hudson, R.R. 1991. Pairwise comparisons of mitochondrial DNA
sequences in stable and exponentially growing populations. Genetics 129: 555-562.
Smith, M. F. & Patton, J. L. 1991. Variation in mitochondrial cytochrome b sequence
in South American akodontine rodents Muridae Sigmodontinae. Molecular Biology &
Evolution 8(1): 85-103.
Legendas, Tabelas e Figuras
Tabela 1: Número de indivíduos, localidades e haplótipos encontrados e valores de
diversidade haplotípica e nucleotídica para cada espécie estudada.
Figura 1. Mapa de distribuição das amostras utilizadas e rede haplotípica
para A. lituratus.
Figura 2. Mapa de distribuição das amostras utilizadas e rede haplotípica
para A. fimbriatus
147
Figura 3. Mapa de distribuição das amostras utilizadas e rede haplotípica
para A. planirostris
Figura 4. Mapa de distribuição das amostras utilizadas e rede haplotípica
para A. obscurus. * indica haplótipo compartilhado entre os grupos
macrogeográficos (biomas ou subdivisões destes)
Figura 5. Mapa de distribuição das amostras utilizadas e rede haplotípica
para A. cinereus
Figura 6. Mapa de distribuição das amostras utilizadas e rede haplotípica
para A. gnomus. * indica haplótipo compartilhado entre os grupos
macrogeográficos (biomas ou subdivisões destes)
148
Espécie
Número de
indivíduos
Número de
localidades
Número de
haplótipos
Diversidade haplotípica
(h)
diversidade nucleotídica
(π)
Artibeus cinereus
30 11 19 0.9379 0.0058
Artibeus fimbriatus
46 19 37 0.9884 0.0139
Artibeus gnomus
11 8 10 0.9818 0.0457
Artibeus lituratus
169 53 122 0.9908 0.0140
Artibeus obscurus
55 28 37 0.9785 0.0255
Artibeus planirostris
146 47 111 0.9855 0.0166
149
150
151
152
153
154
155
156
3. Considerações finais
Morcegos são um componente extremamente importante da
biodiversidade, tanto por abundância quanto pelos processos ecológicos
que participam, eles são os principais dispersores de sementes de plantas
pioneiras, responsáveis pela regeneração natural de florestas, são a
principal fonte de entrada de alimentos e material orgânico em cavernas
secas, e por isso responsáveis pela manutenção destes ambientes.
Apesar de muito estudados do ponto de vista ecológico, a evolução dos
morcegos ainda não é totalmente compreendida. Estudos recentes
(Teeling et al., 2005) começaram a elucidar as relações filogenéticas entre
as famílias de morcegos, correlacionando também biogeografia e registro
fóssil com dados moleculares para uma reconstrução plausível da
evolução destes animais, ainda que um pouco controversa.
Esforços para entender a sistemática e filogeografia dos gêneros também
começaram a incorporar dados biogeográficos e testes mais rigorosos
para hipóteses filogenéticas (Ditchfield, 2000; Hoffman & Baker, 2003;
Hoofer & Baker, 2006; Davalos, 2007).
Apesar disso nenhum trabalho havia se preocupado com a evolução
molecular relacionada à busca por seleção natural e adaptação ao nicho
alimentar em genes de morcegos. Nosso trabalho (Redondo et al., 2006)
foi o primeiro a tentar fazer este tipo de correlação, ainda que tal
correlação não fosse encontrada no segmento de gene estudado,
observamos que a α-amilase está sob forte pressão de seleção
purificadora.
157
Alguns dos testes de seleção em moleculas apontaram sítios
possivelmente sob seleção diversificadora, porém não encontramos
quaisquer evidencias de alterações fisico-químicas nestes aminoácidos.
Existe a possibilidade destes aminoácidos alterarem a conformação da
proteína por interação com aminoácidos que também se alteraram em
outra parte da molécula em algum segmento não estudado, a ampliação
deste estudo cobrindo todos os éxons da proteína poderia elucidar este
achado.
Este trabalho abre possibilidades para estudo de outros genes
relacionados a digestão/alimentação, como proteases, lipases e receptores
de paladar.
O uso deste segmento de gene para reconstruções filogenéticas em
morcegos só foi útil com a utilização da combinação de íntrons e éxons,
principalmente devido a marcantes diferenças moleculares em Sturnira
lilium, diferenças que também são vistas em outros genes estudados
(dados ainda não publicados). Aparentemente Sturnira é um ‘outlier’ em
Stenodermatinae e, talvez, a sistemática desta espécie deva ser revista.
Os outros dois trabalhos apresentados estão mais correlacionados entre si
e se enquadram mais nos estudos que vem sendo feitos para elucidar a
sistemática de grupos recentes, no caso o gênero Artibeus.
A maioria das espécies de Artibeus são extremamente citadas em
literatura, além de todas serem de grande importância ecológica. A
validade dos nomes é muito importante pois muitos estudos foram (e são)
publicados usando este taxon.
158
Como já citado no Capítulo 3, uma taxonomia problemática pode provocar
muita confusão, pois comportamentos específicos ou distribuição
geográfica descritos para uma espécie podem ser, na realidade, uma
mistura de padrões exibidos por mais de uma espécie levando a
conclusões errôneas.
Este trabalho consistiu em uma ampla análise molecular do gênero
Artibeus com uma alta amostragem geográfica e individual, e que revelou
padrões interessantes de diversidade.
Pelo menos quatro táxons merecem um estudo mais profundo, para três
deles análises preliminares morfológicas para complementar os achados
moleculares foram realizadas. Estudos detalhados destas três (possíveis)
novas espécies serão realizados nos próximos meses.
Os padrões encontrados mostram que os Andes tiveram um importante
papel na evolução dos Artibeus, já que tanto no subgênero Artibeus,
quanto no subgênero Dermanura existem clados nitidamente separados
pelos Andes, estes resultados são coerentes com o tempo de divergência
encontrado para estes clados. Obviamente a história é muito mais
complexa do que isso, uma vez que existem espécies que cruzam estas
bordas, como Artibeus lituratus.
Para tentar entender melhor estes padrões o estudo filogeográfico e
biogeográfico são de grande importância. Por exemplo Haffer (1969)
propôs a teoria dos refúgios pleistocênicos para tentar explicar a
diversidade nos trópicos e centros de endemismo através de retenção e
expansão das áreas florestais devido aos ciclos de glaciação. Esta hipótese
é facilmente modificada para refúgios no Plioceno (Haffer, 1997).
159
Mudanças climáticas globais com a glaciação é evidente no Mioceno, com
a expanção de áreas de campos e savanas (Fox, 2000) e continuou
durante o Plioceno (Birkenmajer,1979; Blazhchishin and Linkova, 1977;
Mercer and Sutter, 1982). Evidencias de refugios Pliocênicos causados por
oscilação climática pode ser visto em Tarkhnishvili et al (2000).
As datações moleculares encontradas são compatíveis com diversificação
no Mioceno para os grandes grupos (subgêneros e alguns clados
divergentes) e Plioceno para a maioria das espécies, e é no limite Plio-
Pleistoceno para as divergências dos grupos dentro das espécies em A.
obscurus e A.gnomus.
No caso dos grandes Artibeus é tentador pensar que a elevação dos Andes
(no médio-Mioceno) separa A. fraterculus, A. inopinatus e A. hirsutus dos
outros grandes Artibeus, e que A.fimbriatus que é um habitante de
florestas e endêmico (cuja distribuição é compatível com o refúgio no sul
da MataAtlântica proposto por Kinzey, 1982 para o Plio-Pleistoceno) é
basal em relação aos outros Artibeus restantes, sendo possível que
adaptações para ambientes mais abertos tenham propiciado a existência
de espécies mais generalistas que viriam a espalhar e se distribuir no
restante do continente.
A grande amostragem associado ao uso de técnicas de filogeografia e
filogenia são as maiores forças deste trabalho
O desenvolvimento de novas técnicas e métodos estatísticos, tanto para
dados morfológicos qunato para dados moleculares, para a utilização em
taxonomia e sistemática são de grande importância atualmente e o
160
desenvolvimento destas ferrementas devem ser feitos e validados num
esforço conjunto multidisciplinar.
4. Referencias Bibliográficas
Simmons, N.B., 2005. Order Chiroptera. In: Wilson, D.E., Reeder, D.M.
(Eds.), Mammal Species of the World, a Taxonomic and Geographic
reference, Vol 1, third ed. John Hopkins University Press, Washington, DC,
pp. 312–529.
Ditchfield, AD (2000). The comparative phylogeography of Neotropical
mammals: patterns of intraspecific mitochondrial DNA variation among
bats contrasted to nonvolant small mammals. Molecular Ecology 9: 1307 -
1318.
Charles-dominique, P. 1986. Inter-relations between frugivorous
vertebrates and pioneer plants: Cecropia, birds and bats in French
Guyana. In: Frugivorous and Seed Dispersal (A. Estrada and T.H. Fleming
eds.). p. 119-136. Dr. W.Junk, The Hague, The Neatherlands.
Ferarezzi, H. & Gimenez, E.A. 1996. Systematic patterns and the evolution
of feeding habits in Chiroptera (Archonta: Mammalia). Journal of
Comparative Biology 1(3-4): 75-94.
Fleming, T. H. 1993. Plant-visiting bats. American Scientist. 81(5): 460-
467
Nowak, R.N. 1997. Walker's Mammals of the World on line 5.1. Johns
Hopkins University Press, London. Http://www.jhu.edu/books/walker.
161
Fonseca, G.A.B.; Herrmann, G.; Leite. Y.L.R; Mittermeier, R.A; Rylands,
A.B. & Patton, J.L. 1996. Lista Anotada dos Mamíferos do Brasil.
Occasional Papers in Conservation Biology n4. Conservation International.
Owen, R.D. 1987. Phylogenetic analyses of the bat subfamily
Sternodermatinae (Mammalia: Chyroptera). Special Publications, The
Museum Texas Tech University26: 1-65.
Teeling, EC, Springer, MS, Madsen, O, Bates, P, O’brien, SJ & Murphy, WJ.
2005. A molecular phylogeny for bats illuminates biogeography and fossil
record. Science 307: 580-584.
Van Den Bussche, RA., Baker, RJ., Wichman, HA. & Hamilton, MJ. 1993.
Molecular phylogenetics of Stenodermatini bat genera: Congruence of
data from nuclear and mitochondrial DNA. Molecular Biology and Evolution
10: 944-959.
Owen, R. D. 1991. The systematic status of Dermanura concolor (Peters,
1865) (Chiroptera: Phyllostomidae), with description of a new genus.
Bulletin of the American Museum of Natural History, 206: 18-25.
Lim, B. K.; Engstrom, M. D.; Lee, T. E.; Patton, J. C. & Bickham, J. W.
2004. Molecular differentiation of large species of fruit-eating bats
(Artibeus) and phylogenetic relationships based on the cytochrome b
gene. Acta Chiropterologica 6(1): 1-12.
Jones, Arroyo-Cabrales & Owen, R. D. 1988. Revised checklist of bats of
Mexico to Central America. Occasional Papers of the Museum of Texas
Tech University 60: 1-6.
162
Guerrero, J.A.; de Luna, E. & González, D. 2004. Taxonomic status of
Artibeus jamaicensis triomylus inferred from molecular and morphometric
data. Journal of Mammalogy 85(5): 866-874.
Hoffman FG & Baker RJ. 2003. Comparative phylogeography of short-
tailed bats (Carollia: Phyllostomidae). Molecular Ecology 12: 3403-3414.
Haffer, J. 1997. Alternative models of vertebrate speciation in Amazonia:
An overview. Biodiversity and Conservation 6: (3) 451-476.
Haffer, J. 1969. Speciation in Amazonian forest birds. Science 165:131-
137.
Tavares, V.C., Gregorin, R., Peracchi, A.L. 2007. A diversidade de
morcegos no Brasil. In: Pacheco, S.M., Esberard, C.E.L, Marques, R.V.
(Eds) Morcegos do Brasil: Biologia, Sistemática, Ecologia e Conservação.
Planta, Londrina, PR. In press.
Redondo, RAF. & Santos, FR. 2006. Evolutionary studies on alpha-amylase
gene segment in bats and other mammals. Genetica 126: 199-213.
Kinzey, W.G. 1982. Distribution of primates and forest refuges. Chapter
25: 455-482 in Prance, G.T. (ed.), Biological Diversification in the Tropics.
Columbia Univ. Press, New York.
Fox, D. L. 2000. Growth increments in Gomphotherium tusks and
implications for late Miocene climate change in North America.
Palaeogeography Palaeoclimatology Palaeoecology. 156(3-4): 327-348
Birkenmajer K. 1979. Discovery Of Pliocene Glaciation On King-George-
Island, South Shetland Islands (West Antarctica). Bulletin Pol. Acad. Sci.-
Earth. 27(1-2): 59-67
163
Blazhchishin Ai, Linkova Ti. 1977. Pliocene Glaciation Of Barents Sea
Shelf. Doklady Akademii Nauk Sssr 236: (3) 696-699
Mercer Jh, Sutter Jf. (1982). Late Miocene Earliest Pliocene Glaciation In
Southern Argentina – Implications For Global Icesheet History.
Palaeogeogr Palaeocl 38(3-4): 185-206.
164
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo