( PDF ) Estudos do vírus da hepatite B em pacientes sob tratamento antiviral e caracterização de seqüências nucleotídicas completas do genótipo G no Brasil

Download PDF

ads:

Estudo do vírus da hepatite B em pacientes sob

tratamento antiviral e caracterização de

sequências nucleotídicas completas do

genótipo G no Brasil.

Marcelle Bottecchia

Orientadora: Selma de Andrade Gomes

Laboratório de Virologia Molecular

Departamento de Virologia

Ministério da Saúde

Fundação Oswaldo Cruz

Instituto Oswaldo Cruz

ads:

Livros Grátis

http://www.livrosgratis.com.br

Milhares de livros grátis para download.

Estudos do vírus da hepatite B em pacientes sob

tratamento antiviral e caracterização de seqüências

nucleotídicas completas do genótipo G no Brasil.

Marcelle Bottecchia

Dissertação para obtenção do título de Doutora em Ciências no

curso de Biologia Celular e Molecular do Instituto Oswaldo Cruz

Orientadora: Selma de Andrade Gomes

Laboratório de Virologia Molecular

Departamento de Virologia

Rio de Janeiro – maio de 2007

Ministério da Saúde

Fundação Oswaldo Cruz

Instituto Oswaldo Cruz

ads:

Bottecchia, Marcelle

Estudos do vírus da hepatite B em pacientes sob tratamento antiviral e

caracterização de seqüências nucleotídicas completas do genótipo G no Brasil.

/ Marcelle Bottecchia – Rio de Janeiro: [s.n], 2007.

xvi, 131 páginas p.; il.

Tese de Doutorado em Biologia Celular e Molecular – Instituto Oswaldo

Cruz.

1. Hepatite B 2. Resistência à lamivudina 3. Entecavir 4. Genótipo G

Estudos do vírus da hepatite B em pacientes sob

tratamento antiviral e caracterização de seqüências

nucleotídicas completas do genótipo G no Brasil.

Banca examinadora:

Dr. Christian Maurice Gabriel Niel

Dr. Rodrigo Moraes Brindeiro

Dr. Carlos Eduardo Brandão

Suplentes:

Dra. Vanessa Salete de Paula

Dra. Elisabeth Lampe

Rio de Janeiro, maio de 2007

Ministério da Saúde

Fundação Oswaldo Cruz

Instituto Oswaldo Cruz

“Comprometa-se com suas metas e encare os obstáculos como

etapas para atingir o objetivo final” (Lair Ribeiro)

Agradecimentos:

Agradecer a todas as inúmeras pessoas que contribuíram para a

finalização dessa tese parece, a princípio, ser impossível. Não porque alguma

contribuição possa ser esquecida (embora essa possibilidade ainda exista),

mas porque elas se iniciaram antes mesmo da escolha do tema de trabalho,

auxiliando na minha formação acadêmica e na definição das características

que me levaram a preferir essa área de estudo. Por isso, à influência de certas

pessoas, embora importantes, são tão indiretas que se perdem, como se não

tivessem tanta importância. Muitas vezes essas contribuições são

conseqüências casuais da conveniência entre as pessoas, mas, como tenho

consciência de sua imensa ajuda, gostaria de começar agradecendo a toda

essa contribuição indireta, que com certeza não vou conseguir enumerar.

As contribuições mais diretas são obviamente mais passíveis de um

agradecimento direto. A todas elas os meus mais sinceros agradecimentos:

À Deus, pela vida e pela oportunidade de ajudar ao próximo;

À TESJ pela paz, tranqüilidade, pela força e por me ajudar a continuar trilhando

esse caminho;

Ao Dr. Alexandre Afranio Peixoto por ter me iniciado na pesquisa, por ter me

ensinado de que vale a pena correr atrás de um sonho, pela orientação

(mesmo não sendo atualmente meu orientador), pelo ombro amigo, pela

dedicação e pela pessoa maravilhosa que ele é;

À Dra. Selma de Andrade Gomes, pela oportunidade de desenvolver esse

trabalho;

Ao Dr. Christian Niel pela revisão desse trabalho;

Ao Dr. Rodrigo Brindeiro, pelas aulas de resistência à droga e pela amizade;

Aos Drs. Carlos Eduardo Brandão, Francisco Souto e Kycia do Ó pelas

amostras de soro dos pacientes;

Às minhas amigas Camila Mazzoni que mesmo de longe está me ajudando e

incentivando; Carla Gentile me dizendo que nenhum obstáculo é intransponível

e a Denise Dias por estar sempre me apoiando;

Às amigas Adriana Lucena, Carla Lúcia, Monique Rolim, Sylvie, Sheila Cheles,

Sabrina, Elisangela, Juliana e Maria de Lourdes, por todo apoio, incentivo e

amizade durante esses anos;

Aos amigos do laboratório de Virologia Molecular: Leonardo, Barbara, Monique,

Caroline, Francisco, Jorge, Michel, Ana Rita, Larissa, Guto e Natalia por

contribuírem para um bom ambiente de trabalho;

Ao Cleber pela ajuda nos testes sorológicos;

Às Dras. Clara Yoshida, Elba Lemos, Elisabeth Lampe e Ana Gaspar pelo

apoio num dos momentos mais difíceis dessa caminhada,

À Aliny, Carmen, Geralda, Cida, Lucy, Marcia Paschoal, Anna Carolina, Lívia,

Adilson, Vanessa, Ilton, Alan, Paulo e Rodrigo Côrtes por todo apoio e

incentivo;

À todos do Departamento de Virologia

À minha mãe, Adilson, vovó Tetê, tia Isabel, tio Roberto e todos os meus

amigos, porque contribuíram na iniciação, desenvolvimento e conclusão desse

trabalho. Embora a maioria entenda pouco (ou quase nada) desse estudo, sua

participação foi essencial na minha formação profissional e pessoal e por

conseqüência, na conclusão dessa tese. Pela paciência nas horas de estresse,

pela ajuda em todos os momentos e pela valiosa amizade;

Ao Alexandre Calazans, pela atenção, pelo ombro amigo, pelos anos passados

ao meu lado, por sempre estar me incentivando e me apoiando;

Aos pacientes, pois em sua colaboração (embora não consciente) esse estudo

não seria possível, e a quem dedico esse trabalho.

À FIOCRUZ e FAPERJ, pelo apoio financeiro, sem o qual esse trabalho não

seria realizado;

MUITO OBRIGADA!

RESUMO

A infecção causada pelo vírus da hepatite B (HBV) pode levar à doenças

hepáticas graves, tais como cirrose e carcinoma hepatocelular. Os genótipos

do HBV foram classificados de A-H. No Brasil, os genótipos A, D e F são os

mais prevalentes. Nesta tese observamos os genótipos mais difundidos no

Brasil, assim como relatamos o genótipo C, prevalente na Ásia e raro no Brasil,

o qual foi encontrado em um paciente de origem asiática. O genótipo G, nunca

detectado na América do Sul, é descrito pela primeira vez no Brasil em três

pacientes com mutações de resistência à lamivudina.

A lamivudina, um análogo de nucleosídeo, é utilizada para o tratamento da

infecção do HBV e HIV. No entanto, o seu uso prolongado está relacionado à

resistência. Nesta tese apresentamos os resultados do acompanhamento

molecular do HBV de um caso de falência hepática em um paciente que veio a

óbito durante tratamento com lamivudina, avaliamos as respostas bioquímica,

sorológica e molecular do HBV em 34 pacientes em tratamento com lamivudina

por tempo prolongado, assim como fazemos uma relação entre genótipos do

HBV e a frequência das mutações de resistência à lamivudina. Inicialmente, a

lamivudina apresentou uma resposta bioquímica e/ou virológica favorável. No

entanto, após 24 meses de tratamento, esse efeito não foi mantido, ocorrendo

resistência molecular e morte. No caso de falência hepática, além da dupla

mutação de resistência à lamivudina (rtL180M/rtM204V), três mutações (L109I,

F134L e I208T) que alteram o gene S e duas mutações (rtS117Y e rtV142A)

que alteram a polimerase viral foram observadas próximo ao óbito do paciente.

O entecavir, um análogo de guanosina, é indicado no tratamento da hepatite

B crônica em pacientes resistentes à lamivudina. Seis pacientes co-infectados

HIV/HBV, todos HBeAg positivos, foram acompanhados, com uma média de 52

semanas, no primeiro ensaio clínico com o entecavir, realizado no Brasil,

mantendo-se a lamivudina. Observou-se a normalização dos níveis de ALT em

todos os pacientes, assim como a soroconversão para anti-HBe em dois

pacientes, sendo que um desses pacientes tornou-se negativo para o DNA do

HBV.

ABSTRACT

Infection with hepatitis B virus (HBV) can cause chronic infections leading to

progressive liver disease, including cirrhosis and hepatocellular carcinoma.

Eight genotypes of HBV have been classified by the sequence divergence in

the entire genome exceeding 8% and named A to H. In Brazil, genotypes A, D

and F are the most prevalent. Here, we observed these three genotypes.

Genotype C, frequent in Asia and rare in Brazil, was detected in one patient

with Asian orign. Genotype G, which had never been detected in South

America, was observed in three patients with lamivudine resistance mutations.

Lamivudine is a nucleoside analogue that inhibits the reverse transcriptase

activity of both HIV and HBV. The major limitation in the use of lamivudine is the

selection of resistant mutations, which affect the HBV reverse transcriptase (rt).

In this work, we investigated mutations associated with lamivudine resistance in

a chronically HBV infected patient who died during lamivudine therapy,

analyzed biochemical, serological and molecular responses of HBV in 34

patients taking lamivudine for a long period, and correlated HBV genotypes with

lamivudine resistance mutations. The initial favorable effect of lamivudine was

not sustained after 24 months of treatment. Molecular resistance and death

were observed after this time. In the hepatic failure case, two rare polymerase

(rtS117Y and rtV142A) substitutions, accompanied with three HBsAg (L109I,

F134L and I208T) substitutions, were observed a short time before the death of

the patient, in addition to the double mutation rtL180M + rtM204V.

Entecavir is a guanosine analogue that is approved for the treatment of

chronic hepatitis B in patients with lamivudine resistance mutations. Six

patients, co-infected with HIV and HBV and positive for HBeAg, were followed

up for a median of 52 weeks in the first clinical trial with entecavir in Brazil.

Normalizations of ALT levels were observed in all patients. HBe seroconversion

were obtained in two patients, one of them becaming HBV DNA negative.

Sumário

1. Introdução 1

Artigos de Divulgação Científica

2. Objetivos 36

3. Resultados 37

4. Discussão 106

5. Conclusão 115

6. Referência Bibliográfica 117

Anexo 130

1. INTRODUÇÃO

1.1 Hepatites Virais

As hepatites virais são uma causa importante de morbilidade e

mortalidade e têm tido um grande impacto nas sociedades civilizadas do

nosso tempo.

Entende-se por hepatite os quadros que apresentam uma alteração difusa

no parênquina hepático, caracterizadas por uma lesão necroinflamatória dos

hepatócitos, de gravidade variável. Esse conceito, que é conhecido desde a

época de Hipócrates, só foi estudado mais cientificamente após os casos

ocorridos após a Segunda Guerra Mundial, mais precisamente após a

vacinação de trabalhadores do estaleiro de Bremen (Alemanha) contra a

varíola (vacina preparada com linfa humana). Dos trabalhadores vacinados,

15% se tornaram ictéricos, sendo evidente a associação desta enfermidade a

um agente de transmissão parenteral (Lurman, 1885).

No início do século XX, foram relatados surtos de hepatite de “período de

longa incubação” (50 a 180 dias), os quais foram observados em muitos países

e foram associados às transfusões de sangue, ao uso de medicação injetável

com seringas e agulhas não esterilizadas e à administração de vacina, como

por exemplo, o surto de hepatite/icterícia ocorrido entre os militares que foram

vacinados contra a febre amarela durante a Segunda Guerra Mundial

(Krugman, 1989).

MacCallum em 1947 designou os termos “vírus da hepatite A” (HAV) e

“vírus da hepatite B” (HBV) referindo-se aos supostos agentes etiológicos das

hepatites de período de curta incubação ou infecciosa (18 a 37 dias) e de

período de longa incubação ou soro-homóloga (50 a 180 dias),

respectivamente. Esta terminologia foi adotada pelo comitê das hepatites virais

da Organização Mundial de Saúde, e é utilizada até hoje.

Atualmente são conhecidos vários vírus hepatotrópicos humanos, sendo o

HBV, o primeiro deles ser identificado (1970), seguido pelo vírus da hepatite A

(HAV) (Feinstone et al. 1973), vírus da hepatite D (HDV) (Rizzeto et al. 1977),

vírus da hepatite E (HEV) (Balayan et al. 1983) e vírus da hepatite C (HCV)

(Choo et al. 1989). Outros novos agentes foram identificados em indivíduos

com hepatite pós-transfusional não A-E, porém uma relação causal entre

infecção por estes vírus e hepatopatias ainda não pôde ser confirmada. Dentre

eles, destacam-se o vírus da hepatite G (HGV) (Simons et al. 1995), vírus TT

(TTV) (Nishizawa et al. 1997), “TTV-like mini virus” (TLMV) (Takahashi et al.

2000) e SEN-V (Tanaka et al. 2001).

Diariamente, na clínica encontram-se casos de hepatites que não podem

ser atribuídos a nenhum dos vírus conhecidos e por isso é importante o estudo

dessa doença. Além disso, ainda existem várias hepatites relacionadas com

vírus capazes de produzir quadros definidos (citomegalovírus, vírus do herpes,

etc) assim como vírus considerados exóticos (arenavírus, vírus ebola, etc).

Existem ainda as hepatites cuja origem é atribuída a agentes nocivos não

virais, como por exemplo, a hepatite alcoólica que é causada pela ingestão em

excesso de bebidas alcoólicas, hepatite por drogas que é causada por alguns

medicamentos ou agentes químicos tóxicos para o fígado e as hepatites

autoimunes que são causadas pela agressão do nosso próprio sistema imune.

1.2 O vírus da hepatite B

A hepatite B é a mais perigosa das hepatites e uma das principais

doenças do mundo, estimando-se que existam aproximadamente 400

milhões de portadores crônicos do vírus. Esses portadores podem

desenvolver doenças hepáticas graves tais como a cirrose e carcinoma

hepatocelular. O vírus provoca hepatite aguda em um terço dos atingidos, e

um em cada mil infectados pode ser vítima de hepatite fulminante. Em 10%

dos casos a doença torna-se crônica, sendo esta situação mais freqüente

em homens (Beasley, 1988).

Blumberg et al. em 1965 examinaram milhares de amostras de soro de

diferentes áreas geográficas do mundo e descobriram que uma amostra de

soro de um aborígene da Austrália continha um antígeno que reagia

especificamente com um anticorpo presente no soro de um paciente hemofílico

dos Estados Unidos. Estudos posteriores revelaram que este “antígeno

Austrália” era relativamente raro na população da América do Norte e no oeste

europeu, porém era prevalente em algumas regiões africanas e asiáticas e

entre pacientes com leucemia, síndrome de Down e hepatite aguda (Blumberg

et al. 1967; Bayer et al. 1968). Em 1968 foi estabelecida a correlação entre o

antígeno Austrália (agora designado antígeno de superfície do vírus da hepatite

B ou HBsAg) e a infecção pelo vírus da hepatite B (Prince, 1968; Okochi &

Murakami, 1968). Posteriormente, a purificação do HBV foi realizada a partir

do soro de portadores do antígeno Austrália e a partícula completa (vírion) foi

detectada por microscopia eletrônica (Dane et al. 1970).

O HBV pertence à família Hepadnaviridae, a qual compreende um pequeno

número de vírus que compartilham várias características em comum, tais

como: o tamanho, ultraestrutura do vírion, organização genômica e um

mecanismo particular de replicação do DNA viral. A separação dessa família é

dada em dois gêneros: Orthohepadnavirus e Avihepadinavirus; este último

representando os vírus que infectam as aves (patos, garças, gansos e

cegonhas) e no primeiro, estão incluídos os vírus que infectam os mamíferos

(seres humanos, esquilos, marmotas e primatas não-humanos) (Kidd-

Ljunggren et al. 2002).

1.3 Epidemiologia da infecção pelo vírus hepatite B

De acordo com a OMS aproximadamente 400 milhões de pessoas estão

cronicamente infectadas pelo HBV no mundo. Estes portadores crônicos

servem como fonte de infecção para outros indivíduos (Zuckerman, 1999).

A infecção pelo HBV exibe altas prevalências para o HBsAg (8% a 15%) no

Sudeste asiático, China, Filipinas, África, bacia amazônica e Oriente Médio.

Prevalências intermediárias (2-7%) são observadas no leste europeu, Ásia

central, Japão, Israel e ex-União Soviética, enquanto que prevalências baixas

(<2%) são encontradas na América do Norte, Europa Ocidental, Austrália e sul

da América Latina (Margolis et al. 1991) (Figura 1).

Figura 1: Distribuição Mundial do HBV.

http://www.globalserve.net/~harlequin/HBV/epidem.htm

O Brasil é atualmente considerado uma área de endemicidade intermediária

para a infecção pelo HBV, porém observa-se taxas variáveis de prevalência em

diferentes regiões do país, sendo então divididas em sub-regiões, uma vez que

localidades vizinhas podem apresentar graus distintos de endemicidade (Figura

2).

> 8% - alta

2% - 7%

intermediária

< 2% - baixa

Distribuição Global da Infecção pelo HBV

Figura 2: Distribuição do HBV no Brasil (alterado de Souto et al. 1999).

1.4 Estrutura do vírus da hepatite B

O HBV possui um mecanismo único entre os vírus que infectam o

homem, o qual permite a produção de diferentes tipos de partículas virais.

Em preparações para microscopia eletrônica do soro de indivíduos

infectados podem ser observados três tipos de partículas: as completas

infecciosas, as incompletas esféricas e as incompletas filamentosas (Ganem

& Schneider, 2001) (Figura 3).

Partículas

subvirais

Partícula viral

completa

Figura 3: Micrografia eletrônica mostrando as partículas completas e subvirais

do HBV (http://web.uct.ac.za/depts/mmi/stannard/hepb.html).

A concentração da partícula viral completa no soro de pessoas infectadas

pode ultrapassar a 10

/mL e a partícula possui uma densidade de flutuação de

1,22 g/cm

em gradiente de equilíbrio de cloreto de césio. As partículas

incompletas são encontradas em excesso (em torno de 10

/ml) no soro de

indivíduos infectados.

Ambas as partículas subvirais, apresentam um diâmetro

de 22nm. Estas partículas apresentam uma densidade de aproximadamente

1,18 g/cm

em cloreto de césio. As partículas virais infecciosas são esféricas

com diâmetro de aproximadamente 42nm. Estes vírions apresentam um

envelope lipídico externo, composto pelas proteínas S (“small”), M (“middle”) e

L (“large”), o qual constitui o antígeno de superfície do HBV (HBsAg). O

nucleocapsídeo possui simetria icosaédrica e é constituído pela proteína do

core (HBcAg) e pelo genoma viral (Tiollais et al. 1985) (Figura 4).

Fig. 4: Estrutura do vírion (http://www.globalserve.net/~harlequin/HBV/hbvparts.htm)

O HBV não se replica em linhagens celulares, sendo necessária a utilização

de células primárias humanas. Porém a indisponibilidade de tais culturas

dificulta o cultivo do HBV (Galle et al. 1994). A utilização de modelos animais

em infecções experimentais é restrita, uma vez que o HBV infecta o homem e

primatas não humanos. Embora não sejam suscetíveis a infecção viral,

algumas linhagens humanas de hepatomas, tais como, HepG2, HuH6 e HuH7,

são permissívas a replicação do HBV quando transfectadas com o genoma

viral clonado (Sells et al. 1988).

1.5 Genoma Viral

O genoma do HBV é um dos menores entre os genomas virais que

infectam o homem. Este genoma é composto por uma molécula de DNA de fita

parcialmente dupla com 3.200 pb (Figura 5). Essa molécula possui uma

estrutura não usual, na qual as duas fitas de DNA não são perfeitamente

simétricas. A fita mais longa é complementar aos RNAs virais e possui

polaridade negativa (Gerlish & Robinson, 1980). Na fita de polaridade positiva,

que possui uma região de fita simples, a posição da extremidade 5’ terminal é

fixa, enquanto que a posição da extremidade 3’ terminal é variável. Assim, o

comprimento da fita positiva é variável, correspondendo entre 50-90% do

comprimento da fita complementar.

Figura 5: Modelo Esquemático do Genoma do HBV. O esquema mostra as quatro

fases de leitura aberta pre-S/S, pre-C/C, P e X, e as respectivas coordenadas do início

e final de cada região; os pontilhados indicam a região do genoma que possui fita

simples; a numeração do genoma foi baseada em uma cepa HBV de 3221 pares de

bases, iniciando a partir do sítio EcoRI.

Próxima as extremidades 5’ de ambas as fitas observa-se uma pequena

seqüência de 11 nucleotídeos, que são diretamente repetidas e por isso são

chamadas de direct repeats (DR1 e DR2). Essas seqüências são importantes

para a iniciação da replicação viral (Seeger et al. 1986; Will et al. 1987).

Todo o genoma do HBV é codificante, possuindo quatro fases de leitura

aberta conhecidas como pré- S/S, pré- C/C, P e X (Figura 5). Todos os genes

são codificados pela fita longa e possuem pelo menos uma região de

sobreposição a outro gene. A sobreposição dessas quatro fases de leitura

aumenta a capacidade de síntese protéica em aproximadamente 50% do

esperado para a totalidade do genoma do HBV (Ganem & Varmus, 1987).

A numeração dos pares de bases do genoma do HBV mais utilizada se

inicia em um sítio único para a endonuclease de restrição EcoRI, localizado na

região pré-S2 ou em sítios homólogos caso este sítio esteja ausente. No

entanto, outros métodos de numeração também são muito utilizados, e esses

são baseados no sítio de iniciação de proteína do core ou a partir da primeira

base do RNA pré-genômico (pgRNA) (Gomes, 2003).

Fase de Leitura Pré-S/S

O gene pré-S/S inclui as regiões pré-S1, pré-S2 e S, com três códons de

iniciação na mesma fase de leitura. A maior proteína que compõe o HBsAg é a

large (L), cujo códon de iniciação está localizado no início da região pré-S1 e é

codificada pelas regiões pré-S1, pré-S2 e S. A proteína de tamanho

intermediário conhecida como middle (M) é codificada pelas regiões pré-S2 e

S. A partir do códon de iniciação localizado no início da região S, que é a

menor proteína (small S) é sintetizada. Essas proteínas possuem o mesmo

códon de terminação, o qual se localiza no final da região S. Essas proteínas

podem se apresentar sob as formas glicosiladas e não glicosiladas (Seeger &

Mason, 2000).

Os três tipos de proteínas não são distribuídos uniformemente entre as

diferentes formas de partículas virais. Partículas subvirais de 22nm são

compostas predominantemente por proteínas S, apresentando quantidades

variáveis de proteína M e poucas ou nenhuma proteína L. Entretanto, as

partículas completas (vírions) são enriquecidas de proteínas L. Uma vez que

as proteínas L contém os sítios de ligação do HBV aos receptores específicos

nos hepatócitos (Neurath et al. 1986; Klingmuller & Schaller, 1993) este

enriquecimento de proteínas L poderia prevenir as partículas subvirais, que são

mais numerosas, de competir com os vírions pelos receptores presentes na

superfície celular (Ganem, 1996).

A proteína M também atua como elemento de ligação para a adsorção do

HBV. Esta proteína possui uma região de ligação com a albumina sérica

humana e esta ligação permite que o HBV penetre via receptores celulares de

albumina no citoplasma do hepatócito (Thung & Gerber, 1984; Dash et al.

1991). A proteína S, que é a principal proteína que forma o HBsAg, é capaz de

induzir resposta imunológia protetora (anti-HBs) contra o HBV, e é o antígeno

utilizado na formulação de vacinas (Grob, 1998). Mutações em epítopos

específicos, ocorrendo dentro do gene S, podem interferir na proteção vacinal,

na análise de resultados sorológicos, bem como prejudicar a terapia baseada

na utilização de anticorpos específicos para suprimir a infecção em indivíduos

transplantados (Blum, 1993; Wallace & Carman, 1994).

Fase de Leitura Pré-C/C

A região pré-C/C possui dois códons de iniciação na mesma fase de leitura.

O HBeAg é traduzido a partir de um único códon de iniciação da região pré-C.

É produzido um polipeptídeo precursor de 214 aminoácidos, sendo 29

aminoácidos pertencentes à região pré-C e os demais ao gene C. O produto é

enviado para o retículo endoplasmático rugoso onde é processado através da

clivagem nas suas extremidades, o que resulta na formação do HBeAg com

159 aminoácidos. O HBeAg é então secretado na circulação sanguínea, sendo

um indicador de replicação viral (Garcia et al. 1988; Nassal & Rieger, 1993). A

correlação entre a expressão do antígeno “e” e o estabelecimento da infecção

crônica em filhos de mães portadoras do HBV, demonstra que este antígeno

tem uma provável função de induzir tolerância imunológica, uma vez que este é

capaz de atravessar a placenta e atingir a circulação sanguínea do feto.

O códon de iniciação do HBcAg está localizado a 87 nucleotídeos após o

sítio de iniciação da região pré-C. O polipeptídeo do core possui 185

aminoácidos. O nucleocapsídeo viral é formado por 180 monômeros desta

proteína que espontaneamente se agrupam para formar uma partícula

icosaédrica (Nassal & Schaller, 1996). O HBcAg é ainda capaz de induzir a

produção de anticorpos (anti-HBc) independentemente de células T, tanto na

infecção natural pelo HBV quanto em animais imunizados (Milich & Mclachlam,

1986).

O HBeAg e o HBcAg são traduzidos a partir de dois RNAs distintos e

ambos possuem mais de uma unidade do genoma (RNAs genômico com 3.5

kb e RNAs pré-genômico). A sequência da região pré-C codifica para um

domínio hidrofóbico que é responsável pela translocação do HBeAg para o

retículo endoplasmático. Essa mudança de localização é fundamental para a

alteração da antigenicidade do HBeAg de forma que este não compartilha

homologia antigênica com o HBcAg, embora ambos possuam seqüências de

aminoácidos quase idênticas (Bruss & Gerlich, 1988).

Diversas mutações na região pré-C/C têm sido descritas por vários autores

(Carman et al. 1989; Fiordalisi et al. 1990; Maruyama et al. 2000; De Castro et

al. 2001). Uma das mutações mais freqüentes é a troca de uma guanina no

nucleotídeo 1896 por uma adenina, alterando o códon 28 da proteína HBeAg,

inicialmente UGG, em um códon de terminação (UAG) para a tradução

protéica. Com isso, não ocorre a expressão do HBeAg. Os genótipos B, C, D e

E apresentam uma uracila nesta posição, explicando assim, a alta prevalência

de mutantes A1896 na Ásia e no Mediterrâneo onde os três primeiros

genótipos são encontrados. A infecção pelo HBV mutante na região do pré-

core, incapaz de secretar HBeAg, tem sido associada com hepatite fulminante

(Sato et al. 1995), hepatite crônica severa (Brunetto et al. 1989) e também tem

sido descrita em pacientes assintomáticos (Okamoto et al. 1990).

O gene P

O gene P cobre aproximadamente três quartos do genoma e codifica uma

enzima com atividade de DNA polimerase transcripatse reversa e RNAse H. A

fase de leitura desse gene está decalada de um nucleotídeo em relação à fase

de leitura pré-S/S. Existem quatro domínios na polimerase viral: o domínio

aminoterminal, que atua como proteína terminal ou primase, o qual é

necessário para o início da síntese da fita de DNA de polaridade negativa; uma

região conhecida como espaçadora que aparentemente não possui nenhuma

função em particular; o domínio de transcriptase reversa e o domínio C-terminal

que possui uma atividade de RNAse H. Existe uma homologia entre a

polimerase viral e outras transcriptases reversas, em particular essas enzimas

compartilham o motivo YMDD (Tyr-Met-Asp-Asp), que é essencial para a

atividade de transcrição reversa (Toh et al. 1983; Batholomeusz et al. 1997).

O gene X

O gene X é o menor e codifica um peptídeo com aproximadamente 154

aminoácidos que somente pode ser detectado nos hepatócitos infectados. A

seqüência do gene X é conservada entre os hepadnavírus que infectam

mamíferos, mas está ausente nos vírus que infectam as aves. A função exata

desta proteína na infecção pelo HBV ainda não foi completamente definida,

mas acredita-se que este gene não seja necessário para a encapsidação e

replicação viral (Feitelson & Duan, 1997). O gene X é um gene regulador que

pode ativar a transcrição de certos genes virais e celulares (Henkler & Koshy,

1996).

1.6 Replicação do HBV

Os mecanismos e os primeiros eventos de adesão e entrada nos

hepatócitos ainda não estão bem estabelecidos. Sabe-se que vários receptores

estão envolvidos nesse processo. Uma vez no citoplasma, o nucleocapsídeo é

transportado para o núcleo, aonde o genoma viral é liberado. O DNA viral de

fita dupla parcial é convertido em um DNA circular de fita dupla covalentemente

fechado (cccDNA) através da atuação da DNA polimerase (Bock et al. 1994). O

cccDNA é responsável pela perpetuação da infecção pelo HBV, uma vez que

essas moléculas servirão de moldes transcricionais para a produção de RNA

pré-genômico, o qual é essencial para a replicação viral e alguns RNA

mensageiros (RNAm) que serão necessários para tradução de proteínas virais.

Todo RNA viral é transportado para o citoplasma, onde sua tradução resultará

no envelope viral, core, proteínas da polimerase assim como os polipeptídeos

X e pré-core. Em seguida, os nucleocapsídeos são reunidos no citoplasma e,

durante esse processo, uma única molécula de RNA genômico é incorporada

na montagem do core viral. Uma vez que o RNA viral é encapsidado, a

transcrição reversa é iniciada. Tem sido demonstrado que o sinal de

encapsidação (ε), localizado na extremidade 5´, é necessário e suficiente para

ocorrer o empacotamento desse RNA. A síntese da dupla fita do DNA viral é

seqüencial. A primeira fita é feita a partir do molde de RNA encapsidado.

Durante ou após a síntese dessa fita, o RNA é degradado e a síntese da

segunda fita é iniciada, utilizando-se a primeira fita recém-sintetizada como

molde. Alguns nucleocapsídeos, contendo o genoma maduro, são

transportados de volta para o núcleo, onde seus DNAs genômicos podem ser

convertidos em cccDNA para manter um estoque intranuclear estável de

moldes transcricionais. A maioria, entretanto, passa pelo retículo

endoplasmático rugoso para adquirir o envelope lipoprotéico viral. Com o

envelope formado pelas proteínas de superfície L, M e S, os vírions presentes

nas vesículas do retículo endoplasmático rugoso são secretadas (Pollack &

Ganem 1993; Papatheodoridis et al. 2002; Ganem & Prince, 2004).

Figura 6: Ciclo de replicação do HBV (Ganem & Prince, 2004)

1.7 Variabilidade do HBV

Subtipos do HBsAg

Logo após a descoberta do antígeno de superfície da hepatite B (HBsAg),

sua heterogeneidade tornou-se aparente (Le Bouvier, 1971). Quatro

determinantes antigênicos foram distinguidos baseados em diferenças nas

partículas formadas pelo HBsAg small, são eles: d/y e w/r. A diferença entre

eles é gerada pela substituição de amoniácidos nas posições 122 e 160,

respectivamente (Okamoto et al. 1987). Todos os subtipos descritos possuem

em comum o determinante “a” (Le Bouvier, 1972).

De acordo com Couroucé et al. (1976) existem oito serotipos: adr, ayr,

ayw1, ayw2, ayw3, ayw4, adw2 e adw4. Pelo uso do determinante q+/q-, nove

subtipos do HBsAg puderam ser descritos.

Genótipos do HBV

Pela existência de vários subtipos do HBsAg que são diferenciados

somente por uma substituição de aminoácidos, Okamoto et al. (1988)

sugeriram que os subtipos poderiam ser um tipo de classificação das diferentes

linhagens do HBV dentro de subtipos genéticos. Os genótipos do HBV

divergem em 8% da seqüência nucleotídica do genoma completo. Não há uma

correlação direta entre os genótipos e subtipos, pois alguns subtipos podem ser

encontrados em mais de um genótipo diferente.

Atualmente o HBV é dividido em oito genótipos, designados de A-H. Os

genótipos do HBV apresentam uma distribuição geográfica característica nas

diferentes regiões do mundo (Norder et al. 1994; Okamoto et al. 1988, Stuyver

et al. 2000, Arauz-Ruiz et al. 2002) (Tabela 1). No Brasil, os genótipos mais

encontrados são os A, D e F.

Genótipo Subtipos Distribuição geográfica Referência

adw2, ayw1

Europa, Espanha, EUA, África

Central, India, Brasil

Araujo et al. 2004

adw2, ayw1

Asia Magnius & Norder, 1995

adw2

Asia, Australia, EUA, Brasil Magnius & Norder, 1995

D ayw2, ayw3 Mediterraneo, Turkia, Iran, India,

Espanha, Russia, EUA, Brasil

Magnius & Norder, 1995

E ayw4 Africa Magnius & Norder, 1995

adw4

Bolivia, Venezuela, Argentina,

Brasil, Polinesia, Alaska

Magnius & Norder, 1995

adw2

EUA, França, México, Alemanha,

Espanha

Stuyver et al. 2000

adw4

América do Sul e Central Arauz-Ruiz et al. 2002

Tabela 1: Distribuição geográfica dos genótipos do HBV

Extensivos estudos filogenéticos mostraram que os genótipos do HBV, com

exceção dos genótipos E e G, podem ser divididos em subgenótipos. Os

subgenótipos do HBV diferem em pelo menos 4% (Kramvis & Kew, 2005).

Segundo Huy et al. (2006), a ausência de subgenótipos do genótipo E pode ser

explicada pela sua origem recente. O genótipo G foi inicialmente identificado

nos Estados Unidos e França (Stuyver et al. 2000), mas a sua prevalência

geográfica permanece desconhecida (Lindh, 2005).

1.8 Mutações no genoma do HBV

A substituição de nucleotídeos pode ter importantes conseqüências na

patogênese, na imunoprofilaxia, na resistência aos fármacos e na persistência

vírica (Norder et al. 1992b).

Todos os vírus, em especial os de RNA, podem alterar o seu genoma

durante o processo de replicação, dando origem a novas estirpes,

estreitamente aparentadas com o vírus nativo mas suficientemente diferentes

para poderem ser consideradas novas variantes. Se a mutação afetar mais de

20% dos aminoácidos tem-se a origem de um novo genótipo, mas se as

mutações apenas implicarem em alterações de nucleotídeos, sendo esta

inferior a 10%, a espécie resultante designa-se por quasiespécies (Orito et al.

1989).

A taxa de mutação do HBV foi estimada ser entre 1,4 e 3,2 x 10

-5

substituições por sítio por ano. Esta taxa de mutação é mais alta do que a que

normalmente acontece nos vírus de DNA e é mais próxima a certos vírus de

RNA (Okamoto et al. 1987b). Orito et al. (1989) encontram uma taxa de

substituições sinônimas de aproximadamente 5 x 10

-5

por sítio por ano.

A taxa de substituições in vivo depende de vários fatores: relativos ao HBV

(genoma compacto e replicação por transcrição reversa), ao seu hospedeiro

(resposta imune) e a fatores externos (tratamentos antivirais) (Kidd-Ljunggren

et al. 2002).

O combate à infecção pelo HBV baseia-se na proteção imunológica

conferida pela vacina e na inibição terapêutica da replicação viral. Assim as

linhagens do HBV estão em permanente contato com estes fatores, que de um

lado, induzem a produção de anticorpos neutralizantes específicos para os

determinantes antigênicos do HBsAg, e que de outro lado, se utilizam de

análogos de nucleosídeos, como por exemplo a lamivudina, que interrompem a

síntese da fita de DNA durante a replicação do HBV. Estas medidas de controle

da infecção pelo HBV estão significativamente reduzindo a incidência da

infecção pelo HBV na população em geral, porém, uma série de linhagens

mutantes do HBV têm sido identificadas. Estes mutantes são capazes de

escapar da proteção neutralizante dos anticorpos anti-HBs induzidos pela

vacina ou são mutantes resistentes aos agentes antivirais. A infecção por estas

linhagens mutantes está associada a vários estágios de doenças no figado,

incluindo hepatite aguda e o desenvolvimento de carcinoma hepatocelular

(Chen & Oon, 1999).

1.9 Transmissão do vírus

O HBV é principalmente encontrado no sangue de indivíduos infectados. A

carga viral pode ser maior que dez bilhões de vírions por mililitro de sangue em

portadores com sorologia positiva para o HBeAg (antígeno indicador de

replicação do HBV). Além disso, o HBV pode ser detectado em outros fluidos

corporais, como na urina, saliva, fluido nasofaringeano, sêmen e fluido

menstrual (Alter et al. 1977; Davison et al. 1987). O HBV não foi ainda

detectado em fezes, provavelmente devido à inativação e degradação do vírion

na mucosa intestinal ou pela flora bacteriana (Grabow et al. 1975).

A transmissão do HBV ocorre pela exposição perinatal, através da relação

sexual, pela exposição a sangue ou derivados, pelo transplante de órgão ou

tecidos, através de seringas compartilhadas pelos usuários de drogas

endovenosas, por lesões de pele ou por picadas de agulhas. Nas áreas de alta

incidência de infecção pelo HBV, a disseminação ocorre principalmente na

infância, seja ao nascer (perinatal) ou nos primeiros anos de vida por

transmissão horizontal entre familiares (Margolis et al. 1991). Na exposição

perinatal, a transmissão de mãe para filho pode se fazer durante o parto pela

exposição do recém-nascido ao sangue ou líquido amniótico (onde está

presente o HBV), durante a passagem pelo canal vaginal, ou pela

amamentação. O próprio contato familiar continuado das crianças com mães

reativas para os antígenos HBsAg/HBeAg nos anos seguintes ao nascimento

levará ao risco considerável de aquisição do HBV, se estas não forem

vacinadas (Beasley & Hwang, 1987). Em áreas de baixa prevalência, a

infecção ocorre principalmente em indivíduos adultos, sendo a via de

transmissão dependente de padrões ambientais e comportamentais, tais como,

o compartilhamento de seringas ou agulhas na utilização de drogas injetáveis

(Alter, 1993; Oliveira et al. 1999), relações sexuais com múltiplos parceiros

(homossexuais ou heterossexuais) (Piot et al. 1990), profissionais de saúde

através de acidentes com materiais perfurocortantes contaminados com

sangue (Beltrami et al. 2000) e pacientes politransfundidos e/ou submetidos a

cirurgia ou outros procedimentos invasivos (Teles et al. 1998).

1.10 Quadro Clínico

Acredita-se que o HBV não exerça um efeito citopático direto sobre os

hepatócitos. A hepatite B pode, no entanto, variar desde uma doença aguda

autolimitada, até uma forma grave como a hepatite fulminante. Pode, ainda,

apresentar um curso crônico com evolução para cirrose hepática ou, como

acontece com os portadores sadios, cursará como patologia com baixíssima ou

mesmo nenhuma agressão ao hepatócito. Cerca de 90-95% dos pacientes

adultos infectados evoluem para a cura, e menos de 1% dos indivíduos

desenvolvem uma hepatite fulminante. Entretanto, crianças infectadas através

de transmissão perinatal, apresentam mais de 90% de chance de se tornarem

portadores crônicos (Alberti et al. 1983).

O período de incubação da hepatite B é de 50-180 dias, com média de 75

dias. Após este tempo, inicia-se o chamado período prodrômico (pré-ictérico),

que dura vários dias e se caracteriza pelo aparecimento de fraqueza, anorexia

e mal-estar geral. Nesta fase, os doentes podem sentir dores abdominais

difusas, náuseas, intolerância a vários alimentos, distúrbios gustativos,

desconforto abdominal e vômitos. A ocorrência de artrites, artralgias e mialgias

é freqüentemente referida nos casos de hepatite B, bem como a observação de

exantemas cutâneos rubeoliformes ou lembrando urticárias (McIntyre, 1990). O

exame físico pode revelar hepatomegalia dolorosa. O aparecimento de

icterícia, com colúria e hipocolia fecal (período ictérico), ocorre em somente

20% dos doentes, sendo a hepatite B uma doença assintomática no restante

dos casos. Quando aparece a icterícia, os sintomas gerais, como febre e

mialgias, diminuem de intensidade. Neste momento se elevarão os níveis

séricos das bilirrubinas, principalmente da fração direta. As transaminases

estarão muito elevadas no soro, expressando a ocorrência de lesões

hepatocíticas. Este quadro ictérico costuma durar cerca de 20 dias ou mais, e

pode, às vezes, provocar pruridos cutâneos. Os demais sinais observados nas

icterícias hepatocelulares, como hipocolia ou acolia fecal e colúria, tornam-se

bastante evidentes no período ictérico da hepatite B. Com a evolução da

doença, a hepatomegalia dolorosa e a esplenomegalia, se presentes, vão

diminuir aos poucos, bem como todos os sintomas dispépticos e aqueles

relacionados com a icterícia. Este período de convalescência dura, em média,

de 20 a 30 dias.

1.11 Patogênese

Pelo fato de o HBV não ser diretamente citopático, existem evidências

consideráveis de que a hepatite B se inicia por uma resposta imune-celular

dirigida contra antígenos virais específicos que levarão ao dano hepático.

Acredita-se que a participação dos dois componentes da resposta imune

(celular e humoral) sejam necessários para que ocorra a eliminação do vírus,

além da inativação viral intracelular produzida por citocinas liberadas pelas

células linfomononucleares, tais como interferon-gama e o fator de necrose

tumoral (TNF). Durante a fase aguda da hepatite viral, os hepatócitos

expressam na sua superfície um complexo formado por proteínas do core

(HBcAg) do HBV e proteínas de classe I do HLA. O linfócito T citotóxico

reconhece este complexo de proteínas do core/MHC classe I e ao atacar este

hepatócito infectado produz a lise hepatocítica. Sem dúvida a resposta das

células T às proteínas do HBV, que se expressam associadas a antígenos HLA

de classe I na superfície dos hepatócitos infectados, representa o maior

determinante da lise destes hepatócitos. Quando este mecanismo é totalmente

eficiente, leva à recuperação da infecção (Rapicetta et al. 2002). Esta lise

imunológica dos hepatócitos infectados é, portanto, a base histopatológica da

enfermidade aguda produzida pelo HBV. O indivíduo poderá desenvolver

hepatite B crônica porque não ocorre expressão da classe I do HLA, ou porque

o linfócito T citotóxico não é apropriadamente estimulado ou, ainda por algum

outro mecanismo desconhecido (Thomas, 1991).

O desenvolvimento do carcinoma hepatocelular parece se dar após a

integração do DNA do HBV no genoma do hospedeiro. Esta alteração

cromossômica, freqüentemente envolvendo o cromossomo 17, levará a

transformações celulares (Hino et al. 1986; Zhou et al. 1988), que produzirão,

após alguns anos, o carcinoma de células primárias do fígado. Através de

técnicas de biologia molecular, pôde-se inserir o gene que produz o antígeno X

do HBV em ratos, e os animais produziram este antígeno e desenvolveram

carcinoma hepatocelular mesmo na ausência de lesão hepatocítica. Estes fatos

apontam para a participação do HBV no desenvolvimento de neoplasias

hepáticas (Kim et al. 1991).

1.12 Prevenção e Tratamento

A prevenção da hepatite B visa reduzir os casos de hepatite, tanto aguda

quanto crônica e, consequentemente, as complicações desencadeadas pelo

agravamento desta infecção. Estes fatores dependem da seleção e controle de

doadores de sangue, sêmen, tecidos e da educação da população em relação

às formas de transmissão, através de programas de conscientização e

treinamento de profissionais de saúde. O modo mais eficaz de prevenir a

hepatite B é através das vacinas, incluindo programas de vacinação que

englobam crianças e adolescentes em todo mundo, além de adultos que

constituam uma população sob especial risco para esta infecção (Hollinger &

Liang, 2001). No Brasil, a vacina contra hepatite B foi implementada em 1992.

Atualmente, é oferecida a menores de 20 anos em todo país e a indivíduos sob

especial risco em qualquer faixa etária. A mesma faz parte do calendário

infantil de imunizações do Ministério da Saúde.

Os objetivos do tratamento de pacientes infectados pelo HBV são: reduzir o

nível de viremia e a melhora da disfunção hepática. Atualmente existem dois

tipos de tratamento para a infecção pelo HBV: os imuno terápicos (interferon) e

os antivirais. Pelo fato do HBV não codificar sua própria protease ou integrase

(como no HIV) e que o seu mecanismo primário é precariamente entendido, a

polimerase viral torna-se o alvo mais importante no desenvolvimento de

terapias anti-HBV. A polimerase do HBV é essencial para a replicação viral, e o

bloqueio de sua atividade irá interromper a replicação viral completamente

(Yoon et al. 1999; Lee et al. 2002).

Interferon

Por muitos anos, a administração do Interferon α (IFN- α; de 5 MU a 10 MU

três vezes por semana, via subcutânea, por, pelo menos, três meses) foi o

principal instrumento da terapia. Cerca de 30% dos pacientes que toleraram

esse regime tiveram a perda do HBeAg, o desenvolvimento de anticorpos anti-

HBe e o declínio dos níveis séricos das enzimas hepáticas. Com a

soroconversão para anti-HBe e a normalização dos níveis de ALT, geralmente,

a melhora é bem sucedida depois que a terapia é descontinuada (Wong et al.

1993). Segundo Ikeda et al.(1998), o tratamento com IFN- α em infecção

crônica pelo HBV em pacientes com cirrose tem sido usado para reduzir o risco

de carcinoma hepatocelular.

No entanto, os efeitos colaterais causados pelo tratamento com IFN- α

(febre, mialgias, trombocitopenia e depressão) o torna difícil para muitos

pacientes. Além do mais, em muitos pacientes ocorre uma lesão hepática

aguda durante o uso do medicamento, freqüentemente, um pouco antes ou

durante a diminuição do HBeAg. Esse fenômeno pode refletir a atividade

imunomoduladora do IFN- α, que, tentando impedir a replicação do HBV, pode

causar uma super-regulação dos antígenos do HLA I dos hepatócitos,

aumentando o reconhecimento de células infectadas pelas células T CD8+.

Pacientes com cirrose avançada e esplenomegalia geralmente apresentam

leucopenia e trombocitopenia a níveis basais, o que pode ser exacerbado pelo

medicamento (Ganem & Prince 2004).

Análogos de Nucleosídeos / Nucleotídeos

Na década de 90, a terapia contra o HBV teve um grande impacto pelo

sucesso das drogas que bloqueiam diretamente a replicação viral. Todas as

drogas desenvolvidas até o momento são análogas de nucleosídeo/nucleotídeo

que atuam na transciptase reversa viral (Tillmann et al. 2007) .

Lamivudina

A lamivudina (3TC), (-)enantiômero de 2’-dioxi-3’-tiocitidina, foi o primeiro

análogo de nucleosídeo com eficácia contra o HBV, sendo muito utilizada

também contra a infecção causada pelo HIV. Essa droga pode inibir a atividade

RNA e DNA dependente da DNA polimerase do HBV (Bessesen et al. 1999).

Atualmente a emergência da resistência à lamivudina já é bem reconhecida

(Honkoop et al. 1997; Lai et al. 1998; Dienstang et al. 1999; Liaw et al. 1999). A

incidência de mutantes no motivo YMDD foi de 16-32% após um ano em quatro

triagens clínicas para a hepatite B crônica (Atkins et al. 1998). Leung et al.

(1999) observaram mutações no motivo YMDD em 49% dos pacientes

submetidos a três anos de tratamento ininterrupto com lamivudina. Altas taxas

de resistência também foram observadas em pacientes co-infectados com HIV.

Benhamou et al. (1999) encontraram ruptura de viremia relacionada aos

“mutantes que escapam” no motivo YMDD em 53% dos pacientes após dois

anos de tratamento. Esse estudo indica que esses tipos de mutantes irão

ocorrer eventualmente na maioria dos pacientes durante a monoterapia com

lamivudina e que a emergência da resistência é acelerada pelos altos níveis de

replicação viral.

Adefovir e Adefovir Dipivoxil

Adefovir dipivoxil é uma pró-droga derivada do adefovir (Suzuki et al. 2004).

Adefovir é um potente antiviral que possui atividade contra várias famílias de

vírus, como por exemplo: retrovirus, hepadnavirus e herpes vírus (de Clercq et

al. 1986).

Inicialmente desenvolvida como um inibidor da transcriptase reversa do

HIV, a droga provou nefrotoxicidade nas doses que eram indicadas para uma

inibição efetiva da replicação do HIV. Entretanto, em baixas doses (10mg/dia)

tem demonstrado baixa nefrotoxicidade e mantém boa eficácia contra HBV em

pacientes HBeAg positivos, com uma redução média dos níveis séricos do

DNA do HBV de 3 a 4 log cópias/mililitro. A freqüência de soroconversão para

HBeAg é intensa e há um melhoramento histológico no fígado (Marcellin et al.

2003). A eficiência de inibição de replicação não só dos mutantes do HBV

resistentes à lamivudina in vitro, mas também in vivo é boa.

Já foram identificadas cepas mutantes, entretanto, a taxa de

desenvolvimento de resistência é baixa (Zhou & Littler, 2006). Após um

tratamento prolongado, a cepa mutante rtN236T na polimerase do HBV foi

isolada (Xiong et al. 1998; Angus et al. 2003). Adefovir possui uma atividade de

resgate em pacientes previamente tratados com lamivudina e que se tornaram

resistentes. Essa atividade possibilita a combinação das terapias em um único

tratamento (Zhou & Littler, 2006).

Entecavir

Entecavir é um novo análogo de nucleosídeo deoxyguanina, que inibe a

replicação do HBV de 65-1.600 vezes a mais que a lamivudina. Entretanto a

quantidade da droga que permite uma inibição da replicação viral em 50% de

células testadas (EC

) foram elevadas contra o mutante HBV, sugerindo que a

dose necessária para o tratamento de mutantes resistentes à lamivudina tem

de ser de 20-700 vezes mais alta do que a usada para o HBV selvagem (Ono

et al. 2001; Levine et al. 2002).

Em modelos animais, houve uma considerável redução do DNA viral do

soro, o que também pode ser observado com o cccDNA e com o antígeno do

core viral na biopsia do fígado. Em estudos clínicos, o entecavir revelou uma

excelente supressão da replicação viral sem efeitos colaterais significantes ou

evidência de toxicidade mitocondrial (Honkoop & de Man, 2003).

Por causa de seu potencial intrínseco, o entecavir pode reduzir a replicação

viral a níveis extremamente baixos, uma vez que o desenvolvimento de cepas

mutantes é substancialmente retardado. Entretanto, a emergência dessas

cepas mutantes ocorrem em toda terapia antiviral (Zhou & Littler, 2006).

As mutações de resistência ao entecavir só se desenvolvem em cepas que

contenham mutações pré-existentes, como por exemplo, as mutações de

resistência à lamivudina. As mutações relacionadas ao entecavir são: rtT184,

rtS202 e rtM250, as quais foram observadas em pacientes que passaram a

utilizar o entecavir como droga de resgate, indicando que a lamivudina pode

ser uma droga que pré-seleciona as mutações de resistência ao entecavir (Xu

& Chen, 2006).

Tenofovir

É um análogo de nucleotídeo relacionado ao adefovir, e foi aprovado

primeiramente para o tratamento da infecção causada pelo HIV (Brunelle et al.

2005).

Estudos clínicos comprovaram a eficácia do tenofovir na supressão da

replicação do HBV. A maioria dos estudos é baseada em análises

retrospectivas de pequenos grupos de pacientes co-infectados (HBV-HIV), os

quais receberam tenofovir para o tratamento da infecção causada pelo HIV

(Benhamou et al. 2006; Lacombe et al. 2005; Dore et al. 2004; Nunez et al.

2002). Sua atividade também foi demonstrada em pacientes monoinfectados

pelo HBV (Kuo et al. 2004; Van Bommel et al, 2006; Schildgen et al. 2006). A

maioria dos pacientes possuiam as mutações clássicas de resistência à

lamivudina. O tenofovir resultou em uma diminuição da carga viral em 4-6 log, e

de 30% a 100% dos pacientes tiveram o DNA do HBV indetectável por PCR a

partir da 24ª semana de tratamento. Testes in vivo da atividade antiviral do

tenofovir mostraram uma atuação similar tanto em pacientes co-infectados

(HBV-HIV) quanto em pacientes somente infecatdos pelo HBV (Wong & Lok,

2006).

Alguns análogos de nucleosídeo/nucleotídeo, como a emtricitabina,

telbivudina, clevudina e pradefovir (remofovir) estão em estudos clínicos. Essas

drogas têm demonstrado atividade promissora tanto in vivo quanto in vitro

(Tillmann, 2007).

Terapia Combinada

Alguns estudos avaliaram a eficácia da combinação do interferon α 2a ou

2b com a lamivudina assim como a combinação do interferon peguilado α 2a

ou 2b com lamivudina em comparação com a monoterapia de interferon

peguilado e/ou lamivudina. Foi concluído que não há diferença na eficácia do

combinado de interferon peguilado α 2a ou 2b com lamivudina entre o

tratamento com interferon peguilado sozinho durante 48 semanas. Em relação

ao declínio da carga viral, este foi maior no grupo de pacientes que se tratavam

com terapia combinada do que naqueles em monoterapia com lamivudina. A

taxa de resistência à lamivudina foi menor nos pacientes que se tratavam com

terapia combinada do que naqueles em monoterapia com lamivudina (Lau et al.

2005, Janssen et al. 2005).

Wursthorn et al. (2005) observaram uma maior redução nos níveis de

cccDNA quando o adefovir é combinado com o interferon peguilado do que na

monoterapia com adefovir.

Existem poucos estudos de terapia combinada com os novos análogos de

nucleosídeo/nucleotídeo. Seus resultados sugerem que o adefovir em

combinação com a emtricitabina é superior do que em monoterapia. A

combinação de tenofivir com emtricitabina parece ser promissora (Lau et al.

2004).

Lim et al. (2006) testaram emtricitabina em combinação com clevudina e

seus resultados mostraram uma superioridade da combinação em relação à

monoterapia com emtricitabina apesar das reduções nas cargas virais serem

inferiores aos dados obtidos em monoterapia de clevudina.

Vacinação

A vacina para hepatite B é composta principalmente pela proteína S do

envelope viral e tem mostrado eficácia, segurança e proteção a todos os

subtipos conhecidos do HBV. A primeira vacina foi licenciada no início da

década de 80 e era produzida a partir de plasma humano de portadores

crônicos do HBsAg (Szmuness et al. 1980). A possibilidade de transmissão de

outros agentes infecciosos também transportados pelo sangue motivou o

desenvolvimento da vacina recombinante que, produzida a partir da técnica de

DNA recombinante para a expressão do HBsAg em leveduras, tem

demonstrado uma boa imunogenicidade contra o HBV (Assad & Francis, 2000).

O esquema vacinal indicado para a vacina recombinante é de três doses

nos meses 0, 1 e 6 via intramuscular. A detecção de títulos de anticorpos anti-

HBs ≥10UI/L, aparecendo de um a dois meses após a última dose, confere

imunidade contra o HBV. Predisposição genética, indivíduos do sexo

masculino, tabagismo, obesidade, idade superior a 40 anos, tratamento

hemodialítico, infecções pelo HIV e HCV são alguns dos fatores que têm sido

atribuídos a uma não-resposta vacinal (Assad & Francis, 2000).

Artigos de Divulgação Científica

Artigo 1. Bottecchia M & Gomes SA. 2006. Aspectos Moleculares e Clínicos da

Vírus da Hepatite B. Âmbito Hospitalar. 179:67-72

Artigo 2. Bottecchia M & Gomes SA. 2007. Dados Relevantes da Co-Infecção

do Vírus da Hepatite B (HBV) e do Vírus da Imunodeficiência Humana

Adquirida (HIV). Âmbito Hospitalar 182:14-20.

2. Objetivos

2.1 Objetivo Geral

 Caracterizar isolados do vírus da hepatite B de amostras de pacientes com

hepatite B crônica submetidos ao tratamento com lamivudina e entecavir

quanto ao perfil molecular, definindo através do sequenciamento nucleotídico,

genótipos, variabilidade genômica de parte da região S, mutações de

resistência antiviral na polimerase viral (P) e níveis da carga viral.

2.2 Objetivos Específicos

7. Avaliar os fatores de resposta virológica associados à falência hepática durante o

acompanhamento do tratamento antiviral, de um paciente que veio a óbtido após

trinta e três meses de utilização de lamivudina;

8. Caracterizar as mutações de resistência à lamivudina do HBV e outras mutações

no gene de superfície (S) e na polimerase viral (P) associadas à falência

hepática deste paciente;

9. Determinar e relacionar os níveis de carga viral do HBV nas três amostras

seriadas deste paciente com a evolução clínica do paciente;

10. Avaliar a resposta bioquímica, sorológica e molecular do HBV, em um estudo de

segmento, aberto com 34 pacientes que iniciaram o tratamento da hepatite B

crônica com lamivudina, com média de acompanhamento de 26 meses;

11. Analisar a prevalência do DNA do HBV, caracterizar os genótipos, determinar as

mutações de resistência e as variações nas cargas virais em um estudo de

coorte transversal com 36 pacientes tratados com lamivudina por tempo

prolongado;

12. Avaliar se existe uma diferença na freqüência de mutações de resistência à

drogas em função do genótipo dos isolados do HBV e dados clínicos dos

pacientes;

13. Caracterizar molecularmente 52 isolados de HBV de amostras seriadas do

primeiro ensaio clínico brasileiro com o entecavir, de seis pacientes co-infectados

pelo HIV-1 e HBV;

14. Seqüenciar o genoma completo de três amostras de pacientes do Rio de Janeiro

com mutações de resistência à lamivudina que foram caracterizados como

genótipo G.

3. Resultados

Os resultados obtidos nesse estudo serão apresentados em anexo, sob a

forma de artigos publicados ou manuscritos submetidos à publicação em

revistas científicas indexadas e são listados a seguir na ordem em que serão

discutidos.

1. Bottecchia M, Ikuta N, Niel C, Araujo NM, do Ó KRM, Gomes SA. Hepatitis

B virus lamivudine resistant mutations associated with a case of fatal

hepatic failure. Artigo submetido para publicação.

2. Souto FJD, Pirajá ACS, Silva GS, Bottecchia M, Gomes SA. 2007.

Lamivudina por tempo prolongado no tratamento da hepatite B crônica no

estado de Mato Grosso. Rev. Soc. Bras. Med. Trop. 40(1):18-24.

3. Bottecchia M, Souto FJD, do Ó KRM, Brandão CE, Gomes SA. Hepatitis B

virus genotypes and resistance mutations in patients under long term

lamivudine therapy: Characterization of genotype G full-length in Brazil. Ar-

tigo em preparação.

4. Bottecchia M, Brandão CE, Gomes SA. Dynamics of hepatitis B virus

during entecavir therapy of lamivudine resistant variants in patients co-

infected with HIV-1. Artigo em preparação.

Manuscrito 1: Bottecchia M, Ikuta N, Niel C, Araujo NM, Do Ó KRM, Gomes

SA. Hepatitis B virus lamivudine resistant mutations associated with a case of

fatal hepatic failure. Artigo submetido para publicação.

Artigo 2: Souto FJD, Pirajá ACS, Silva GS, Bottecchia M, Gomes SA. 2007.

Lamivudina por tempo prolongado no tratamento da hepatite B crônica no

estado de Mato Grosso. Rev. Soc. Bras. Med. Trop. 40(1): 18-24.

Manuscrito 3: Bottecchia M, Souto FJD, do Ó KRM, Brandão CE, Gomes

SA. Hepatitis B virus genotypes and resistance mutations in patients under

long term lamivudine therapy: Characterization of genotype G full-length in

Brazil. Artigo em preparação.

Hepatitis B virus genotypes and resistance mutations in

patients under long term lamivudine therapy:

characterization of genotype G full- length sequences in

Brazil

Marcelle Bottecchia

, Francisco J. D. Souto

, Kycia M. R. Ó

1,3

, Carlos E.

Brandão

, Selma A. Gomes

1§

Laboratório de Virologia Molecular, Instituto Oswaldo Cruz, FIOCRUZ. Av.

Brasil 4365, 21045-900 Rio de Janeiro, RJ, Brasil

Núcleo de Estudos de Doenças Infecciosas e Tropicais, Faculdade de

Ciências Médicas, Universidade Federal de Mato Grosso, Av. Amarílio de

Almeida 215, 78010-060 Cuiabá, MT, Brasil

Hospital Alcides Carneiro, Fundação Municipal de Sáude de Petrópolis, Rua

Vigário Correas, 1345, 25720-320, Petrópolis, RJ, Brasil

Hospital Universitário Gaffrée e Guinle, Rua Mariz e Barros 775, 20270-004

Rio de Janeiro, RJ, Brasil.

Corresponding author

Email addresses:

MB: [email protected]

FJDS: [email protected]

KMRO: [email protected]

CEB: [email protected]

SAG: [email protected]

Abstract

Background

Hepatitis B virus (HBV) isolates have been classified into eight genotypes (A-H)

with distinct geographical distribution. Lamivudine is an oral nucleoside

analogue that inhibits HBV replication and has been used for the treatment of

chronic hepatitis B. However, the main limitation of lamivudine is the selection

of resistant mutations. Here, we analyzed the genotype distribution and the

frequency of lamivudine resistant mutations among 36 patients submitted to

lamivudine treatment for more than one year.

Results

Only four (11%) patients were HBV DNA negative. Among the HBV DNA

positive individuals, the following HBV genotype/subtype distribution was found:

A1 (n = 20), A2 (n = 4), C (n = 1), D (n = 3), F (n = 1), and G (n = 3). Lamivudine

resistance mutations was found in 20/32 (62%) of HBV DNA positive samples.

Similar values of HBV loads were found among patients with and without

lamivudine resistance mutations (means, 2.7 x10

and 6.9 x 10

copies/mL,

respectively). Fifteen patients showed the L180M/M204V lamivudine resistant

double mutation. The triple mutation rt173V/180M/204V, which act as a vaccine

escape mutant, was found in two individuals. Several patients had signs of

lamivudine resistance, including elevation of serum alanine aminotransferase

and rebound of HBV loads. Complete genomes of the three genotype G isolates

were sequenced. All three showed the double mutation L180M/ M204V.

Background

Hepatitis B virus (HBV) is an etiological agent of acute and chronic liver disease

prevalent throughout the world. Despite the introduction in the last decade of

HBV vaccination programs, infection with HBV remains an important human

disease, with an estimated 350 million people chronically infected, and over 2

billion people who have been infected with the virus. It is estimated that

between 1 and 2 million people die annually as a consequence of the infection

(Shepard et al. 2006; Wright, 2006).

Based on sequence divergence in the entire genome exceeding 8%, HBV is

now classified into eight genotypes (A to H) that are related to their

geographical origin reviewed by (Norder et al. 1994; Arauz-Ruiz et al. 2002;

Stuyver et al. 2000). Most genotypes are now divided into subgenotypes with

distinct virological and epidemiological properties. In addition, recombination

among HBV genotypes increases the variability of HBV (Schaefer, 2007).

Genotype A is present in Europe, India, Africa and Americas. Genotype A has

been recently subdivided into three subgroups or subgenotype (Aa/A1, Ae/A2

and A3). Isolates belonging to subgroup Aa/A1 have been identified in

populations and descendents of African countries (Araujo et al. 2004).

Subgenotype Ae/A2 has an European origin, whereas subgenotype A3 has

been identified in Central and West Africa (Kurbanov et al. 2005; Makuwa et al.

2006). Genotypes B and C are predominant in China, Japan and Southeast

Asia. Genotype D is widespread, predominating in the Mediterranean area and

in the Middle East region. Genotype E appears to derive from West Africa.

Genotype F is found in the aboriginal populations of the Central and South

America. Genotype G has been identified in Europe as well as in North and

Central Americas while genotype H has been described in Mexico and Central

America (Niesters, 1995; Schaefer 2005, 2007).

Genotype G has been first identified in France and USA (Stuyver et al. 2000)

and more recently it has been detected in Mexico (Sanchez et al. 2002). It

seems that genotype G prevails in restricted areas in the world, possibly

disseminating via particular routes of transmission (Kato et al. 2002b).

According with this, recently genotype G has been found in a relatively high

frequency (28%) in Mexico in men who have sex with men (Sanchez et al.

2007). Genotype G is usually coinfected with genotypes A (Kato et al. 2002b) or

alternatively in Central America with genotype H (Sanchez et al. 2007). HBV

genotype G is distinct from genomes of the other seven genotypes in that it

possesses an insertion of 36-nucleotide at the 5’ end of the C gene and

translational stop codons in the pre-C region (codons 2 and 28), preventing

HBeAg synthesis. Despite two stop codons in the precore region, very

frequently patients infected with genotype G were positive for hepatitis B e

antigen (HBeAg) in serum. This could be explained by the fact that genotype G

is frequently found as a coinfection with genotype A. This coinfection would

explain the presence of HBeAg in individuals infected with genotype G (Kato et

al. 2002a). In contrast to the majority of studies in which genotype G appeared

as coinfections with genotype A, in one study neither the hepatitis B e antigen

(HBeAg) nor anti-HBe was detectable in any of the samples. This authors

concluded that this was a case of monoinfection by genotype G (Chudy et al.

2006). This could suggest that HBeAg is dispensable for viral replication.

Genotype G has not been identified in several countries, despite large cohort

surveys of patients with HBV and seems to be an extremely rare genotype in

Japan (Kato et al. 2004).

In Brazil, genotypes A, D and F are the most prevalent (Niel et al. 1994; Araujo

et al. 2004). In previous studies conducted in Brazilian in general population

and in Afro-Brazilian populations it has been demonstrated that subgenotype A1

is the most frequently found subgenotype (Araujo et al. 2004; Motta-Castro et

al. 2005).

Lamivudine is an oral nucleoside analogue inhibiting the reverse transcriptase

activity of both HIV and HBV (Benhamou et al. 1996). This drug is widely used

in the treatment of HBV and as part of the treatment of HIV infection. A period of

one year of therapy in HBeAg positive patients has been associated with

HBeAg loss in 17–33% of patients and HBeAg seroconversion rates of 16–18%.

HBeAg seroconversion is the result of a profound suppression of viral

replication, since it has only been found in patients with a reduction in HBV DNA

to <10

copies/mL (Liaw, 2002).

The major limitation in the use of lamivudine is

the selection of resistant mutations that may arise and accumulate during

therapy. These mutations usually affect the YMDD motif located in the C

domain of the HBV reverse transcriptase (rt), by replacement of a methionine

residue at position 204 to either valine (rtM204V), that occurs usually in

occidental population or isoleucine (rtM204I) in oriental population (Farrel &

Teoh, 2006). The proportion of patients in whom YMDD variants are detectable

increases with time on lamivudine therapy, rising from around 15–25% after one

year of treatment to 70% by four years (Liaw. 2002). In addition, a second

lamivudine resistance mutation (rtL180M), located in the B domain of rt, was

identified (Ben-Ari et al. 2003). This second mutations is associated with

prolonged lamivudine treatment. Such double mutations have notably been

reported in studies performed with HIV-HBV co-infected patients. More than

90% of the HIV-HBV co-infected patients under lamivudine treatment display

the double resistant mutation rtL180M/rtM204V (Thibault et al. 1999).

Hepatitis B acute exacerbation may occur after the appearance of YMDD

mutants,accompanied by a rapid increase of viral load and serum

aminotransferase levels. Such exacerbations appear to be more severe than

those occurring during the natural course of wild type HBV chronic infection

(Liaw, 2002). At present, management of patients with lamivudine mutations

rests on addition or replacement with other antiviral agents as adefovir dipivoxil

or entecavir, which may effectively suppress the YMDD mutants (Lai, 2004;

Jacobson, 2006).

The aim of the present study was to investigate the prevalence of HBV DNA

and viral load variations in patients receiving lamivudine for a long period for

HBV treatment. To characterize the genotypes of HBV strains derived from this

patients and to determine the frequency and kind of lamivudine resistance

mutations. Furthermore the entire nucleotide sequences of three isolates

recovered from this work and genotyped as genotype G were characterized.

Results

Serological patterns and distribution of HBV genotypes in infected

patients under long term lamivudine treatment

Among 36 HBsAg positive patients who were under long-term lamivudine

treatment 18 were HBeAg positive, 14 were anti-HBeAg positive and four were

not tested. Eleven patients, all of them men, were co-infected with HIV. Among

them, nine were HBeAg positive and two were anti-HBe positive.

Only four patients (2 male, and 2 female) were tested negative for HBV DNA.

All four were HIV negative, 1 was HBeAg positive and 3 were anti-HBeAg

positive. Results of liver biopsy were available for 22/32 HBV DNA positive

patients (Table 1). Among them, all 15 HBV monoinfected patients had liver

diseases (12 with cirrhosis and three with mild to moderate chronic hepatitis).

However four HIV/HBV co-infected patients showed normal biopsy.

The genotype/subgenotype distribution of the 32 HBV isolates showed a

predominance of genotype A (subgenotype A1), in co-circulation with genotype

D, F and C, previously reported in Brazil. Of note, three isolates were found to

belong to genotype G (Table 1).

The deduced amino acid sequences in the polymerase region showed 20/32

(62%) HBV with lamivudine resistance mutations. Fifteen of them showed the

well known double rtL180M/rtM204V resistance mutation. Two other patients

(03-hgg and 08-hgg) showed an additional mutation (V519L), also related to

lamivudine resistance. The three remaining patients displayed a mutation

leading toYIDD motif (single mutation rtM204I in patient 05-hac and double

mutation rtL526I/rtM204Vin patients 01-ufmt and 11-hgg). The occurrence of

lamivudine resistant mutations was observed in all genotypes, with the

exception of the three samples belonging to genotype D. The following

frequency of lamivudine mutations was observed in function of genotype

distribution: Subgenotype A1, 12/20 (60%); A2, 3/4 (75%); C 1/1 (100%); D, 0/3

(0%) F2 1/1(100%); and G 3/3 (100%).

Patients infected with isolates carrying lamivudine resistance mutations had

HBV loads varying from 8 x 10

to 2 x 10

copies/mL (mean 2.9 x 10

, median 5

x 10

). Similar values, 7 x 10

to 4 x 10

copies/mL (mean 6.9 x 10

, median 4.5

x 10

), were found in patients under lamivudine treatment but without mutations.

Median values of virus load were significantly higher (p< 0.05) in patients with

HBeAg (2 x 10

copies/mL) than in patients with anti- HBe (1 x 10

copies/mL).

Failure to lamivudine treatment (phenotipic resistance) was evaluated by

medical staff based in clinical signs and laboratory tests, such as rapid increase

of serum alanine aminotransferase (ALT) levels and/or rebound of HBV load.

There was a good correlation between phenotypic resistance and detection of

lamivudine mutations. Twenty out of 24 (83%) patients showing phenotypic

resistance displayed lamivudine resistant mutations whereas 8/8 (100%) who

had no medical signs did not (Table 1).

Complete sequencing and phylogenetic analysis of full length genotype G

isolates

Of the 36 patients under study, three were infected with the rare HBV genotype

G (HBV/G). All three patients were men. Two of them, co-infected with HIV,

belonged to sexual behavior risk groups for HIV infection. One was homosexual

and the other bisexual. The third patient, HIV negative, reported sexual

relationships with men. The two HIV coinfected patients were HBeAg positive.

Sample 09-hgg has a very high title (234.77) of HBeAg, and was negative for

anti-HBe (not shown). Sample 05-hgg has a low title (2.87) of HBeAg, and anti-

HBe was detected at very low titles (0.96). Sample 06-hac was anti-HBe

positive. Genotype G has been usually found in patients coinfected with

genotypes A or alternatively with genotype H. Whether HBV/G isolates were

found associated with other HBV genotypes was then evaluated. This was done

by PCR-RFLP analysis of the pre-S/S gene. Restriction patterns of PCR

fragments (PS1-SR) of the isolate 9-hgg (with the highest title of HBeAg) were

compatible with a co-infection of genotype G at least with HBV subgenotype A2.

Figure1 shows a typical experiment. Digestion with EcoRI (possibility of one

restriction site in the amplicon), showed that 9-hgg isolate (Figure 1A, lane 3)

has two HBV populations. HBV molecules without Eco RI site (predicted for

HBV genotype G, lane 1, figure 1A) and molecules with Eco RI site (deduced

patter for most HBV genotype A, lane 2, figure 1A). Digestion of 9-hgg with

BamHI (Fig1 B, lane 4) showed a mixture of HBV fragments including the patter

displayed in lane 1 (fragment not digested), lane 2 (restriction products

predicted for genotype G) and lane 3 (restriction products predicted for

subgenotype A2). Restriction digests of the two other HBV/G isolates showed

the presence of additional, faint DNA bands, suggesting the occurrence of

coinfection with low titers of HBV genotype other than G.

Nucleotide sequences of the complete genomes of the three HBV/G isolates

were determined. All had 3248 bp. Phylogenetic analysis of the whole genome

sequences confirmed that isolates 09-hgg, 05-hgg and 06-hac belonged to

genotype G (Figure 2). This was observable when entire pre-S/S region (Figure

3), precore/core region and X gene were used for phylogenetic analysis. The

three HBV/G isolates, showed a 36 nt insertion at the 5’ end of the C gene, a 3-

nt deletion in the pre-S1 and stop codons at positions 2 and 28 of the pre-core

region characteristics of genotype G.

Figure 2 shows that the three G isolates from this study (HBV/G-Br) were

divergent from those described before and divergent between them. Even so,

the genetic distances observed among G isolates do not justify the division of

genotype G into two sugnenotypes. Table 2 shows that the three HBV/G-Br.

had mean sequence variation higher (1.9 ± 0.2%) than that observed within the

eight HBV/G isolates from other geographic regions (0.4 ± 0.1%). Such

divergence within HBV/G-Br isolates was is higher when pre-S/S region alone

was analyzed (2.3 ± 0.2%). Genotypes F and H were the two most genetically

distant from HBV/G-Br isolates whereas genotype E was the least distant (table

3).

Deduced amino acid sequence analysis of pre-S/S region showed that pre-S1

region was well conserved among all G isolates described until now. The three

G isolates belonged to serological subtype adw2 (aminoacid residues K

122

127

and K

160

). PreS2 and S regions of samples isolates 06-hac and 09-hgg

displayed several aminoacid variations,found in sequence consensus of

genotypes H and F sequences, whereas isolate 05-hgg showed aminoacid

variations enconutered in genotype A (Table 4). Two variations shared by all

HBV/G-Br isolates were observed (position 49 of pre-S2 and positions 195,

small S). This last one is due to lamivudine mutations at rtL180M position.

Discussion

Lamivudine resistance is due to aminoacid substitutions in the YMDD motif of

the rt domain of the HBV polymerase. The resistance occurs by replacement of

a methionine residue at position rt204 by either valine (rtM204V) or isoleucine

(rtM204I), accompanied or not by a substitution at position rt180 (Bartholomew

et al. 1997) and more rarely by a substitution at position rt173 (Cooley et al.

2003). The occurrence of the additional resistance mutations rtL180M and

rtV173L has been associated with prolonged lamivudine treatment (Yeh et al.

2000; Roque-Afonso et al. 2003). There is a general consensus that single

mutants in the YMDD motif (rtM204V/I) replicate substantially more slowly in

vitro than the wild type. The additional mutations (at positions rt180 and rt173)

may thus act as compensatory changes which partially restore the replication

fitness of the virus (Melegari et al. 1998). The triple mutation

rtV173L/rtL180M/rtM204V/I causes the concomitant amino acid substitutions

E164D and I195M in the small S protein. It has been shown that this triple

mutant has a reduced in vitro affinity to anti-HBs antibodies, similar to what

occurs the hepatitis B vaccine escape mutant G145R (Torresi, 2002; Roque-

Afonso et al. 2003). Here, most patients under prolonged lamivudine treatment

displayed HBV DNA in serum. Lamivudine resistant mutations were observed in

67% of sequences, while 33% did not display recognized resistance mutations.

In a previous study, performed with HIV infected patients with HBV occult

infection (HBsAg negative), patients without resistance mutations had a lower

mean viral load than patients with resistance mutations (Sucupira et al. 2006).

However, in the present study where all patients were HBsAg positive no

significant viral load were observed between those with and without lamivudine

resistance mutations. In another study involving HBsAg positive, HIV infected

patients almost 50% of patients who were HBV DNA positive did not display

lamivudine resistance mutations (Cooley et al. 2003). Furthermore, these

patients and those with resistance mutations had been under lamivudine

therapy for a similar period of time. In that study, it remains unclear why a high

proportion of HBV DNA positive patients did not develop lamivudine resistance.

Understanding the circumstances leading to circulation of HBV isolates in

relative high titles with or without lamivudine resistance after prolonged

utilization of lamivudine, may help to guide future therapies in such individuals.

Recent studies have suggested that the rate of resistance to lamivudine was

higher in patients infected with HBV genotype A than in those with genotype D

(Orito et al. 2006; Ramos et al. 2007). Here the prevalence of lamividine

resistant mutations was not associated with the genotype, although the three

genotype D isolates did not display lamivudine mutations. Large surveys should

be conducted to clarify the role of HBV genotype in the response of treatment.

In the present study, the rare genotype G was identified in three patients, all of

them displaying lamivudine resistance mutations. All patients infected with

HBV/G belonged to the risk group of homosexual men. In a previous study

conducted in Mexico, HBV/G was exclusively found in that risk group; in 4/25

(16%) of men who have sex with men . All complete sequences of genotype G

available in GenBank, were wild type for lamivudine mutations, in contrast all

sequences issued from the present work, displayed the double mutation L180M

+ M204V in polymerase gene related to lamivudine resistance. The dynamics of

co-infection of wild tye G for lamivudine mutations with other genotypes has

been recently studied in chimeric mice carrying human hepatocytes,

monoinfected or co-infected with genotype G (Sugiyama et al. 2007). The

authors concluded that genotype G may replicate in monoinfections in chimeric

mice at very low titles, and its replication increased markedly when genotype G

was coinfected with other genotypes. Genotype G could enhance fibrisis under

immunocompronised states. Here it is not clear why genotype G was only

detected in HBV molecules displaying lamivudine mutations. Dynamics of co-

infection with lamivudine mutated genomes of genotype G should clarify this

point lamivudine. Our hypothesis is that genotype G have been selected over

genotype A due to lamivudine resistance mutations.

Methods

Patients and serological studies

The study group consisted of 36 (7 female, 29 male; mean age, 47 years)

chroniclly HBV infected subjects who were submitted to long-term lamivudine

treatment (12 to 84 months mean 39, median 35 months) and who attended as

outpatients at three public (Gaffrée e Guinle, and Alceu Carneiro, Rio de

Janeiro; Núcleo DIP-UFMT, Mato Grosso) hospitals in Brazil, between 2002

and 2004. All these patients were HBsAg positive and anti-HBc positive. The

protocol used was approved by the Ethical Committee of Oswaldo Cruz

Foundation. Eleven patients were anti-HIV-1 positive by conventional

serological tests, and lamivudine was administered in these patients as part of

antiretroviral treatment. All HIV positive patients demonstrated clinical signs of

lamivudine resistance, evaluated by medical staff. HBV monoinfected patients

were random selected. When liver biopsy was done, histological diagnosis was

classified as normal liver, mild-moderate chronic hepatitis, and cirrhosis. Serum

samples from all patients were initially tested for anti-HBc, HBsAg and anti-HBs

in the hospitals. These samples were not available, and new blood samples

were collected from all 36 patients, retested for the presence of HBsAg, and

anti-HBc by enzyme-linked immunosorbent assay (Hepanostika Uni-form

Organon Teknika B.V, Boxtel, Holland) and further used for genomic studies.

Several HBsAg positive samples were submitted to HBeAg and anti-HBe

detection (Axsym System, Abott).

DNA extraction and conditions of PCR assays

DNA was extracted from serum samples using phenol/chloroform after

treatment of 250 µL of serum with 0.5mg/mL of proteinase K in the presence of

0.2M NaCl, 0.25% SDS, for 4h at 37ºC as reported previously (Niel et al. 1994).

After precipitation with ethanol, the pellet was dried and resuspended in 30 µL

of distilled water. Semi-nested and nested PCR assays were performed. PCR

primers are shown in table 5. First round of amplification was performed with 1

µL of extracted DNA and one unit of Taq DNA polymerase (Invitrogen, San

Diego, CA) in a final volume of 25 µL. After an initial DNA denaturation for 3 min

at 94ºC, amplification was for 35 cycles at 94ºC for 40 sec, 55ºC for 1 min and

72ºC for 2 min 30 sec, followed by a final elongation for 7 min at 72ºC. The

second round was performed with 1µL of first PCR product in a final volume of

50 µL under the following parameters: 95ºC for 30 sec, 52ºC for 40 sec, 72ºC

for 2 min for 30 cycles, followed by a final elongation for 7 min at 72ºC. Ten

microliters of amplification products were loaded on 1% agarose gels,

electrophoresed, stained with bromide and visualized under UV light.

Quantification of HBV DNA

HBV DNAs were quantified using the TaqMan technology, according to with

some modifications. A panel of reference sera with known numbers of HBV

DNA molecules, kindly supplied by Dr. Ikuta (Universidade Luterana, Canoas,

RS Brazil), was used for quantification by real time PCR. Amplification assays

were performed in a final volume of 25 µL of TaqMan universal MasterMix

(Applied BioSystems, Foster City, CA), containing 2 µL of extracted DNA, 1 µM

of each (sense, 5’-GGACCCCTGCTCGTGTTACA-3’, nucleotide position 184 to

203, and antisense, 5’-AGAGAAGTCCACCMCGAGTCTAGA-3’, nucleotide

position 273 to 249) primers, and 0.3 µM of probe (5’-FAM-

TGTTGACAARAATCCTCACAATACCRCAGA-TAMRA-3´, nucleotide positions

218-247). After an initial incubation step of 2 min at 50°C and 10 min at 95°C,

the PCR cycling program consisted of 50 cycles of 15 s at 95°C and 60 s at

60°C. Reactions were performed in a 7700 SDS system (Applied BioSystems,

Foster City, CA). The assay has a limit of detection of 10 copies/reaction or

about 100 copies/mL of serum.

Nucleotide Sequencing

Semi-nested PCR products, carrying partial S genomic region and obtained with

PS4 sense primer and S2 and S22 antisense primers (Table 5) were directly

sequenced. Complete nucleotide sequencing of three genotype F isolates were

determined by using PS1-S2, C5-PS3, S18-X3, X1-C3 and PC1-C2 PCR

products (Table 5). Amplification products (50 and nucleotide sequences were

determined using BigDye Terminator kit (Applied Biosystems) using the same

primers used for PCR amplification. Sequencing reactions were analyzed on an

ABI373 automated sequencer (Applied Biosystems). Bioinformatic analysis of

the sequences was performed applying the University of Wisconsin Genetic

Computer Group package. Neighbor-joining phylogenetic trees were drawn and

rearranged using the Mega program version 3 and representative sequences of

each HBVgenotype/subgenotype were selected after alignement of 884 full-

length (>3100 nt) sequences (Alan Kay, personal communication).

Genotyping by PCR-RFLP

A previous published PCR-RFLP genotyping method, based upon pre-S/S

genomic region (PS1-SR PCR products) was used to assess HBV coinfections

with genotype G and other isolates.

Authors' contributions

MB carried out cloning and sequencing of HBV DNA. FJDS, KMRO, CEB were

involved in clinical evaluation of the patient and supervised the antiretroviral

treatment. SAG conceived the study, participated in its design and coordination,

and wrote the manuscript. All authors read and approved the final manuscript.

Acknowledgements

The authors acknowledge Dr Christian Niel for the critical reading of the

manuscript. This work was supported by the Conselho Nacional de

Desenvolvimento Cientifico e Tecnologico (CNPq) and by the Fundação Carlos

Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ).

Legend of the figures

Figure 1- PCR-RFLP genotyping method. A- PCR products digested with

EcoRI. Products without the unique EcoRI site (lane 1). Digestion at the unique

EcoRI site at nt 0/3221 generates two fragments (lane 2). Sample 09-hgg (lane

3). B- PCR products digested with BamHI. Product without Bam H1 sites (lane

1), with Bam HI restriction site at nt position 491 (lane 2), with BamHI at nt

position 28 (lane 3), sample 09-hgg (lane 4).

Figure 2- Phylogenetic trees of the HBV genotypes/subgenotypes. Virus

isolates are indicated by their GenBank accession number, followed by

genotype and subgenotype designation. (A) Complete genomes. (B) Open

reading frame of the entire preS1/preS2/S regions. Nulceotide sequences have

been deposited in the Genbank under accession numbers EF464097 to

EF464099.

References

Araujo NM, Mello FC et al. 2004. High proportion of subgroup A’ (genotype A) among

Brazilian isolates of Hepatitis B virus. Arch. Virol. 149: 1383-1395.

Arauz-Ruiz P, Norder H, Robertson BH, Magnius LO. 2002. Genotype H: a new

Ameridian genotype of hepatitis B virus revealed in Central America. J Gen Virol

83:2059-2073.

Bartholomew MM, Jansen RW et al. 1997. Hepatitis B virus resistance to lamivudine

given for recurrent infection after orthopic liver transplantation. Lancet. 349: 20-22.

Ben-Ari Z, Mor E, Tur-Kaspa R. 2003. Experience with lamivudine therapy for hepatitis

B virus infection before and after liver transplantation, and review of the literature. J.

Intern. Med. 253(5): 544-552.

Benhamou Y, Katlama C, Lunel F et al. 1996. Effects of lamivudine on replication of

hepatitis B virus in HIV-infected men. Ann. Inter. Med. 125(9): 705-712.

Chudy M, Schimidt M et al. 2006. Hepatitis B virus genotype G moninfection and its

transmission by blood components. Hepatology. 44(1): 99-107.

Cooley L, Ayres A et al. 2003. Prevalence and characterization of lamivudine-resistant

hepatitis B virus mutations in HIV-HBV co-infected individuals. AIDS. 17:1649-1657.

Farrel GC & Teoh NC. 2006. Management of chronic hepatitis B virus infection: a new

era of disease control. Intern. Med. J. 36(2): 100-113.

Jacobson IM. 2006. Therapeutic options for chronic hepatitis B: considerations and

controversies. Am. J. Gastroenterol. 101(1): S13-18.

Kato H, Orito E, Gish RG et al. 2002a. Hepatitis B e antigen in sera from individuals

infected with hepatitis B virus of genotype G. Hepatology. 35(4): 922-929.

Kato H, Orito E, Gish RG et al. 2002b. Characteristics of hepatitis B virus isolates of

genotype G and their phylogenetic differences from the other six genotypes (A through

F). J. Virol. 16(12): 6131-6137.

Kato H, Sugauchi F, Ozaka A et al. 2004. Hepatitis B virus genotype G is an extremely

rare in Japan. Hepatol. Res. 30(4): 199-203.

Kurbanov F, Tanaka Y, Fujiwara K et al. 2005. A new subtype (subgenotype) Ac (A3)

of hepatitis B virus and recombination between genotypes A and E in Cameroon. J.

Gen. Virol. 86(7): 2047-2056.

Lai CL. 2004. Therapeutic advances in chronic hepatitis B. J. Gastroenterol Hepatol.

19:S5-9.

Liaw YF. 2002. Management of YMDD mutations during lamivudine therapy in patients

with chronic hepatitis B. J. Gastroenterol Hepatol. 17(3): S333-337.

Makuwa M, Souquiere S, Telfer P et al. 2006. Identification of hepatitis B virus

subgenotype A3 in rural Gabon. J. Med. Virol. 18(9): 1175-1184.

Melegari M, Scaglioni PP, Wands JR. 1998. Hepatitis B virus mutants associated with

3TC and famciclovir administration are replication defective. Hepatology. 27: 628-633.

Motta-Castro AR, Martins RM, Yoshida CF et al. 2005. Hepatitis B vírus infection in

isolated Afro-Brazilian communities. J. Med. Virol. 77(2): 180-186.

Niel C, Moraes MTB et al.1994. Genetic diversity of hepatitis B virus strains isolated in

Rio de Janeiro. J Med Virol 44:180-186.

Niesters HG, Pas S, de Man RA. 2005. Detection of hepatitis B virus genotypes and

mutants: current status. J. Clin. Virol. 34(1): S4-8.

Norder H, Courouce-Pauty AM et al. 1994. Complete genomes, phylogenetic

relatedness and structural proteins of six strains of the hepatitis B virus, four of which

represent two new genotypes. Virology 198(2):489-503.

Orito E, Fujiwara K, Tanaka Y et al. 2006. A case-control study of response to

lamivudine therapy for 2years in japonese and chinese patients in chronically infected

with hepatitis B virus of genotypes Bj, Ba and C. Hepatol. Res. 35(2): 127-134.

Ramos B, Nunez M et al. 2007. Hepatitis B virus genotypes and lamivudine resistance

mutations in HIV/Hepatitis B Virus – Coinfected patients. J. Acquir. Immune. Defic.

Syndr.

Roque-Afonso AM, Ferey MP et al. 2003. Monitoring the emergence of hepatitis B virus

polymerase gene variants during lamivudine therapy in human immunodeficiency virus

coinfected patients: performance of CLIP sequencing and line probe assay. Antivir

Ther. 8(6): 627-634.

Sanchez LV, Maldonado M et al. 2002. Genotypes and S gene variability of Mexican

hepatitis B virus strains. J. Med. Virol. 68(1): 24-32.

Sanchez LV, Tanaka Y, Maldonado M et al. 2007. Difference of hepatitis B virus

genotype distribution in two groups of mexican patients with different risk factors. High

prevalence of genotype H and G. Intervirology. 50(1): 9-15.

Shaefer S. 2005. Hepatitis B virus: significance of genotypes. J. Viral Hepat. 12(2):

111-124.

Shaefer S. 2007. Hepatitis B virus taxonimy and hepatitis B vírus genotypes. World J.

Gastroenterol. 13(1):14-21.

Shepard CW, Simard EP, Finelli L et al. 2006. Hepatitis B virus infection: epidemiology

and vaccination. Epidemiomol Rev. 28:112-125.

Stuyver L, De Gendt S et al. 2000. A new genotype of hepatitis B virus: complete

genome and phylogenetic relatedness. J Gen Virol 81:67-74.

Sucupira MV, Mello FC, Santos EA et al. 2006. Patterns of hepatitis B virus infection in

Brazilian human imunnodeficiency virus infected patients: high prevalence of occult

infection and low frequency of lamivudine resistance mutations. Mem. Inst. Oswaldo

Cruz. 101(6): 655-660.

Sugiyama M, Tanaka Y, Sakamoto T et al. 2007. Early dynamics of hepatitis B virus in

chimeric mice carring human hepatocytes monoinfectaed or coinfectaed with genotype

G. Hepatology. 45(4): 929-937.

Thibault V, Benhamou Y, Seguert C et al. 1999. Hepatitis B virus (HBV) mutations

associated with resistance to lamivudine in patients coinfected with HBV and human

immunodeficiency virus. J. Clin. Microbiol. 37(9): 3013-3016.

Torresi L. 2002. The virological and clinical significance of mutations in the overlapping

envelope and polymerase genes of hepatitis B virus. J. Clin. Virol. 25: 97-106.

Wright TL. 2006. Introduction to chronic hepatitis B infection, Am. J. Gastroenterol. 101

(1):S1-6.

Yeh CT, Chien RN et al. 2000. Clearence of the original hepatitis B virus YMDD-motif

mutants with emergence of distinct lamivudine-resistant mutations during prolonged

lamivudine therapy. Hepatology. 31: 1318-1326.

M 1 2 3 M 1 2 3 4

Fig 1A Fig1 B

Figure 2 (A):

06hac

09hgg

05hgg

DQ207798-G

AB056515-G

AB056513-G

AB064312-G

AF160501-G

AB064310-G

AB064311-G

AB064313-G

AB205126-D2

AB104712-D1

AY233291-D3

AB048702-D4

AB205191-E

AB116092-A1

AB194951-A3

AY707087-A2

AY123424-C1

AF223955-C2

X75665-C3

M54923-B3

AY596111-B2

AB073835-B4

AB059659-H

AF223963-F1b

AY090459-F1a

AB166850-F4

AB036915-F3

AY311369-F2

100

0.000.020.040.06

Figure 2(B):

05hgg

06hac

09hgg

AB064311-G

AB064310-G

AB064313-G

AB056513-G

AF160501-G

AB064312-G

AB056515-G

DQ207798-G

AB205191-E

AB048702-D4

AY233291-D3

AB104712-D1

AB205126-D2

AY707087-A2

AB116092-A1

AB194951-A3

AB073835-B4

AY596111-B2

M54923-B3

X75665-C3

AF223955-C2

AY123424-C1

AB059659-H

AB166850-F4

AB036915-F3

AY311369-F2

AF223963-F1b

AY090459-F1a

100

0.000.010.020.030.040.050.060.07

Table 1: Demographic and virological characteristics of HBV infected patients.

*- genotype or subgenotype, MCH- mild-moderate chronic hepatitis

Table 2. Nucleotide

sequence divergence

within each HBV

genotype

Sequence

divergences

are expressed

in percents

Patient Sex Age HIV Liver

Biopsy

Lam

(months)

HBV

Load

Pheno

Typic

resistance

Geno

type

rtResistance

Mutations

05-hac M 58 No

Cirrhosis

34 8x10

Yes A1 M204I

01-hgg M 56 Yes

Cirrhosis

60 8x10

Yes A1 L180M/M204V

02-hgg M 50 Yes

Cirrhosis

84 1x10

Yes A1 L180M/M204V

04-hgg M 43 Yes

MCH

- 7x10

Yes A1 L180M/M204V

06-hgg M 34 Yes

Normal

72 1x10

Yes A1 L180M/M204V

07-hgg M 61 Yes

Normal

- 1x10

Yes A1 L180M/M204V

10-hgg M 46 Yes

42 nd Yes A1 L180M/M204V

11-hgg M 40 Yes

30 nd Yes A1 L180M/M204I

30-ufmt M 47 No

33 2x10

Yes A1 L180M/M204V

34-ufmt M 12 No

24 3x10

Yes A1 L180M/M204V

03-hgg M 35 Yes

72 9x10

Yes A1 Triple

08-hgg M 60 Yes

- 1x10

Yes A1 Triple

03-hac F 55 No

MCH

14 - Yes A1 No

04-hac M 60 No

Cirrhosis

71 - No A1 No

05-ufmt M 47 No

Cirrhosis

47 3x10

No A1 No

09-ufmt F 21 No

21 - No A1 No

20-ufmt M 28 No

Cirrhosis

13 7x10

No A1 No

26-ufmt M 56 No

Cirrhosis

26 6x10

Yes A1 No

27-ufmt M 53 No

30 4x10

No A1 No

29-ufmt M 37 No

Cirrhosis

23 3x10

No A1 No

02-hac F 54 No

MCH

44 Yes A2 L180M/M204V

32-ufmt M 53 No

Cirrhosis

59 3x10

Yes A2 L180M/M204V

42-ufmt M 33 No

Cirrhosis

48 1x10

Yes A2 L180M/M204V

41-ufmt M 76 No

Cirrhosis

34 1x10

No A2 No

23-ufmt F 25 No

51 2x10

Yes C L180M/M204V

39-ufmt F 25 No

12 4x10

Yes D1 No

13-ufmt M 68 No

Cirrhosis

40 - No D2 No

07-hac M 57 No

Cirrhosis

36 1x10

Yes D3 No

01-ufmt M 38 No

Cirrhosis

64 2x10

Yes F2 L180M/M204I

05-hgg M 55 Yes

Normal

- 5x10

Yes G L180M/M204V

06-hac M - No

MCH

- 3x10

Yes G L180M/M204V

09-hgg M 42 Yes

Normal

- 6x10

Yes G L180M/M204V

Genomic regions

Genotypes (subgenotypes)

(A1-A3)

(B2-B4)

(C1-C3)

(D1-D4)

(F1-F4)

(8 isolates)

(this work)

Entire genome 5.4 ± 0.3 4.6 ± 0.3 4.6 ± 0.3 3.4 ± 0.2 5.1 ± 0.3 0.4 ± 0.1 1.9 ± 0.2

Pre-S/S 4.6 ± 0.5 4.0 ± 0.5 3.6 ± 0.4 2.1 ± 0.3 3.1 ± 0.4 1.6 ± 0.2 2.3 ± 0.4

Table3. Nucleotide sequence divergence between the three HBV/G isolates from this work and isolates representative of all

HBV genotypes and subgenotypes

Sequence divergences are expressed in percents

Genomic regions

Genotypes (subgenotypes)

(A1-A3)

(B2-B4)

(C1-C3)

(D1-D4)

(1 isolate)

(F1-F4)

(8 isolates)

(1 isolate)

Entire genome 12.4 ± 0.6 13.7 ± 0.7 13.5 ± 0.6 12.4 ± 0.6 11.8 ± 0.5 15.5 ± 0.7 1.6 ± 0.2 16.5 ± 0.8

Pre-S/S 7.2 ± 0.8 8.9 ± 1.0 10.3 ± 1.0 9.3 ± 0.6 9.4 ± 0.9 13.2 ± 1.1 2.4 ± 0.4 12.9 ± 1.1

Pre- S2 Small S

______________________________________________________________ _____________________________

Isolate

Geno-

type

8 1

G A N K/T G I/T V N/S V T H I F R/K I D P F G F G V/

P L I T I

05 - D R - T L - - N - - S - T - T - - - - S L Q T I M

06 Q - - E T Q - - - L T - K T G - L - - E - - - - - M

09 Q - - E T A E A - L T - K T G - L V C E - - - - - M

F Q D R -/E T Q - A/- - L T - K T G T/

L V C - T/L - Q T T I

H Q D R E T Q - A - L T - K T - M L G - V P - Q T T I

D T D R - T - - - - -/P -/L - - - - -/L - G - - T L Q T T I

E T D R - T - - - - L - - - - - - - G - - A L Q T I I

B T D R - T - -/S A/- N A/S - -/L K T - - L G - -/E T L Q T T/I I

C T D R - T - - - - P/L - F - T/- - T/- - G - - A L/- Q T I I

A -/N D R/K - T -/L - A/- -/N - - S - T/- - T/- - G - - A/S L Q T I I

Table 5: Primers used to amplify the complete genome of HBV in nested PCR assay.

1-Sequencing of complete genome, 2- sequencing and RFLP of partial pre-S region

Round Set of

Primers

Primer Sequence (5’-3’ and nt position in HBV genome) Bp

First

P1– S2 P1- GAAAGCTTGAGCTCTTCTTTTTCACCTCTGCCTAATCA, 1821-841

S2- GGGTTTAAATGTATACCCAAAGA, 841-819

2241

Second PS1– S2 PS1- CCATATTCTTGGGAACAAGA, 2826-2845

S2- GGGTTTAAATGTATACCCAAAGA, 841-819

1236

Second C5 – PS3 C5 - AGACCACCAAATGCCCCTATC-, 2299-2319

PS3 -TCCTTGTTGGGATTGAAGTCCCA, 3002-2980

703

First

PS1 – X3 PS1-CCATATTCTTGGGAACAAGA-, 2826-2845

X3 - AGCAGCCATGGAAAGGAGGT-, 1383-1363

1753

Second S18 – X3 S18 -GGATGATGTGGTATTGGGGGCCA-, 743-765

X3 - AGCAGCCATGGAAAGGAGGT-, 1383-1363

648

First

S18 – C2 S18 -GGATGATGTGGTATTGGGGGCCA-, 743-765

C2 -CTAACATTGAGATTCCCGAGATTGAGA-, 2458-2432

1724

Second X1-C3 X1- ACCTCCTTTCCATGGCTGCT, 1363-1383

C3- TTGCCTGAGTGCAGTATGGT, 2056-2075

712

Second PC1-C2 PC1-GGCTGTAGGCATAAATTGGTCTG, 1781-1803

C2 –CTAACATTGAGATTCCCGAGATTGAGA, 2458-2432

667

First

PS1–

S2+S22

PS1- CCATATTCTTGGGAACAAGA, 2826-2845

S2- GGGTTTAAATGTATACCCAAAGA, 841-819

S22- GTATTTAAATGGATACCCACAGA, 841-819

1236

second PS1-SR PS1- CCATATTCTTGGGAACAAGA, 2826-2845

SR -CGAACCACTGAACAAATGGC-,704-685

1099

second

S4-

S2+S22

S4 -TGCTGCTATGCCTCATCTTCT-, 416-436

S2- GGGTTTAAATGTATACCCAAAGA, 841-819

425

Manuscrito 4. Bottecchia M, Brandão CE, Gomes SA. Dynamics of hepatitis

B vírus during entecavir therapy of lamivudine-resistant variants in patients

co-infected with HIV-1. Artigo em preparação.

Dynamics of hepatitis B virus during entecavir therapy of lamivudine-

resistant variants in patients co-infected with HIV-1

Summary: Six HIV positive patients, chronically infected with HBV and HBeAg

positive, were enrolled in the first clinical trial with entecavir in Brazil. The

patients, previously submitted to lamivudine treatment, maintained lamivudine

during the follow up with entecavir (mean time of 52 weeks, varying 40-64). All

of them presented clinical signs of lamivudine resistance like biochemical failure

and/or rebound of viral load. Nucleotide sequencing of the S/Pol region of

serum samples collected before the start of entecavir treatment showed that all

of them had lamivudine resistance mutations (rtV173L, rt180M, and rt204V). In

the beginning of entecavir treatment, HBV loads decreased in all patients (≥1

log). HBe seroconversion was obtained in two patients (after 32 weeks) and one

of them became HBV DNA negative (after 36 weeks). However three patients

had virological breakthrough in the last samples. Sequencing of S/Pol gene of

the 52 isolates from serum serial samples, showed that lamivudine resistance

mutations were maintained in all sequences. In addition, fluctuation of HBV

populations displaying rtT184L and rtS202I entecavir resistant mutations was

observed in two patients.

Entecavir (ETV) is a novel guanosine analogue with potent and selective

activity against HBV DNA polymerase (1). It was approved in 2005, by the US

Food and Drug Administration (FDA) and regulatory agencies of several

countries for the treatment of chronic hepatitis B in adults, based on the findings

of three pivotal phase III clinical trials; two in nucleoside-naïve patients and one

in lamivudine-refractory patients. In the two trials conducted in nucleoside-naïve

patients, entecavir 0.5 mg/day resulted in rates of 48 week histological

improvement, virological response, and alanine aminotransferase (ALT)

normalization higher than those obtained with lamivudine 100 mg/day

demonstrating a similar safety profile, in both HBeAg-positive and HBeAg-

negative patients (2, 3).

In lamivudine-refractory patients, switching from lamivudine to entecavir 1

mg/day provided superior 48 week histological improvement, virology response,

and ALT normalization with a comparable safety profile as lamivudine. The

selection of ETV doses for study in phase III clinical trials was based on a

prospective evaluation of data from in vitro, animal model, clinical

pharmacology, and clinical development studies (4).

In clinical trials, ETV is highly efficacious in treating nucleoside naïve and

lamivudine refractory patients (5, 6). A direct consequence of the potent viral

suppression associated with entecavir is the emergence of drug resistance.

Entecavir develops resistance only, and infrequently, when HBV contains pre-

existing lamivudine-associated substitutions (rtL180M and rtM204V). In this

case, entecavir resistance is caused by additional substitutions rtT184G,

rtS202I and/or rtM250V (7).

Six HBeAg positive, chronically HBV infected patients (all of them men with

mean age of 55 years and co-infected with HIV), previously submitted to

lamivudine treatment were enrolled in this study. All of them had been treated

with lamivudine for at least 3 years and presented clinical signs of lamivudine

resistance, including high levels of serum alanine aminotransferase (ALT) and

high HBV loads (> 10

copies/mL). During treatment with entecavir these

patients maintained their treatment with lamivudine. HBV DNA from serum

samples was extracted using phenol/chloroform method. Pre S/S HBV genome

region was amplified by a nested PCR assay. The S (nt 157-841) region

(overlapping with Pol gene) of all samples was directly sequenced. Samples

collected at the beginning of the treatment and serial samples were tested by

ELISA to measure HBeAg and anti-HBe (Abbott Laboratories Ltda). The HBV

load of some serial samples was also determined by the Real Time PCR (Taq

Man- Applied Biosystems).

Results show a decrease in viral loads in all patients (≥1 1og) and in one of

them HBV DNA became undetectable in week 36. In contrast, in week 40, the

viral loads of three patients increase. Viral loads of the two remaining patients

did not show variations. HBeAg seroconvertion occurred in 2 of the 3 patients

with low viral load and normalization of the ALT levels was observed in all

patients. (Figure 1).

Sequencing of S/Pol gene from serial samples showed that three patients

maintained double lamivudine resistance mutation (rtL180M/rtM204V), two

patients maintained the triple resistance (rtV173L/rtL180M/rtM204V) and the

remaining one changed from double mutation to triple mutation, but in the two

last samples the patient return to the double mutation. Three patients showed

two of the three mutations related to ETV resistance (rtT184L and rtS202I) only

in one and different samples. We do not detected two mutations related do ETV

resistance in the same sample neither in more than one sample.

Sequence analysis of the 52 isolates identified emerging changes that

occurred on ETV therapy (Table 1). In different sequencing from the one

sample (05ahgg) we could detected two differents populations. The explanation

for that is the use of two differents primers for the amplification of the fragment.

Phylogenetic analyses showed that five HBV isolates were classified into

genotype A1 (subgenotype Aa) and the remaining one was classified into

subgroup G (Figure 2).

To date, it is the first trial with entecavir in Brazil and in patients coinfected

HBV/HIV in a lamivudine resistant population. Patient eligibility for the study

required the persistence or recurrence of viremia on long-term lamivudine

treatment.

This 64 week course of entecavir therapy in patients coinfected HBV/HIV

demonstrated that the drug has good safety and tolerance profiles. It also

showed HBeAg seroconvertion in two patients, and in one of them serum HBV

DNA levels was further suppressed after 36 weeks of treatment. The

diminished efficacy demonstrated by continued lamivudine is consistent with

literature suggesting its relative lack of benefit in patients with lamivudine

resistant chronic hepatitis B (9). After 2 years of treatment, 81% of patients

receiving entecavir have a viral load below 300copies/mL versus only 39% of

patients receiving lamivudine and 31% seroconverted to anti-HBe (10).

Sequence analysis, in the beginning of the treatment, of the 52 isolates from

the six patients shows the double mutation related to lamivudine resistance

(rtL180M and rtM204V) in five patients and the triple mutation in one of them

(rtV173L, rtL180M and rtM204V). During the treatment, we observed the

emergence of the mutation rtV173L in two patients. The results obtained by

Tenney et al. (2004) showed that lamivudine resistance mutations confer some

level of cross-resistance to entecavir. Additional mutations are required for

entecavir resistance and the latter are not sufficient to confer entecavir

resistance when the lamivudine resistance mutations are absent. Several

patterns of mutations were shown to confer entecavir resistance: substitutions

rtT184G, rtS202I and/or rtM250V. We observed to kind of substitutions:

rtT184L and rtS202I in some isolates, in the middle of the treatment, but we

could not say if they are conferring resistance because they are not propagated

for the others isolates, they are not observed together and we would not able to

detect the mutation M250V.

In summary, this clinical trial demonstrated that the 64 weeks of entecavir

treatment resulted in a virologic, serologic and biochemical benefits in 50% of

patients with lamivudine resistant chronic hepatitis B coinfected with HIV.

Figure Legends

Figure 1: Fluctuation of HBeAg/Anti-HBe and HBV DNA levels before and

during entecavir therapy. Vertical violet bars: HBeAg levels; Vertical red bars:

Anti-HBe levels; continuous line: HBV DNA levels.

Table 1: Changes that ocurred during entecavir therapy.

Figure 2: Phylogenetic trees based on nucleotide sequences of the HBV S

region indicating the genotypes and the lamivudine and entecavir resistant

mutations.

REFERENCES:

1. Thomas H, Foster G, Platis D. Mechanisms of action of interferon and

nucleoside analogues. 2003. J. Hepatol. 39:S93-S98.

2. Yan JH, Bifano M, Olsen S et al. 2006. Entecavir Pharmacokinetics, safety

and tolerability alter multiple ascending doses in healthy subjects. J. Clin.

Pharmacol. 46: 1250-1258.

3. Chang TT, Gish RD De Man R et al. 2006. A comparison of entecavir and

lamivudine for HBeAg-positive chronic hepatitis B. N. Engl. J. Med. 354: 1001-

1010.

4. Lai CL, Shouval D, Lok A et al. 2006. Entecavir versus lamivudine for

patients with HBeAg-negative chronic hepatitis B. N. Engl. J. Med. 354: 1011-

1020.

5. De Hertog D, Clonno RL, Oslen S, Thomas N, Kreter B. 2002. Rational

dose identification of entecavir for chronic hepatitis B infection based on

prospective evaluation of in vitro, aminal model, clinical pharmacology and

human clinical trial data. Hepatology 36:637A.

6. Chang TT, Gish RG et al. 2005. A dose-ranging study of the efficacy and

tolerability of entecavir on lamivudine-refractory chronic hepatitis B patients.

Gastroenterol. 129: 1198-1209.

7. Tenney DJ, Levine SM et al. 2004. Clinical emergence of entecavir-

resistant hepatitis B virus requires additional substitutions in virus already

resistant to lamivudine. Antimicrob. Agents. Chemother. 48: 3498-3507.

8. Niel C, Moraes MTB et al. 1994. Genetic diversity os hepatitis B virus

strains isolated in Rio de Janeiro. J Med Virol 44:180-186.

9. Liaw YF, Chien RN et al. 2004. No benefit to continue lamivudine therapy

after emergence of YMDD mutations. Antivir Ther. 9: 257-262.

10. Gish R, Chang TT et al. 2005. Entecavir results in a substantial virology

and biochemical improvement and HBeAg seroconvertion through 96 weeks

of treatment in HBeAg (+) chronic hepatitis patients. Hepatol. 42(1):A181

[p267A].

01-hgg, subgenotype A1

0,00

50,00

100,00

150,00

200,00

250,00

300,00

1 2 3 4 5 6 7 8 9 10

serial samples

interval between: 1-2: 4weeks; 2-3: 4weeks; 3-4: 4weeks; 4-5: 16weeks; 5-6:

4weeks; 6-7: 8weeks; 7-8: 8weeks; 8-9: 8weeks; 9-10: 8weeks.

HBeAg

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

rtL180M/M204V

HBV DNA

Figure 1(A)

03-hgg, subgenotype A1

0,00

100,00

200,00

300,00

400,00

1 2 3 4 5 6 7 8 9

serial samples

interval between: 1-2: 4weeks; 2-3: 4weeks; 3-4: 4weeks; 4-5: 16weeks; 5-6:

4weeks; 6-7: 8weeks; 7-8: 8weeks; 8-9: 8weeks.

HBeAg

1,00E+02

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

rtV173L/rtL180M/M204V

HBV DNA

02-hgg, subgenotype A1

0,000

0,020

0,040

0,060

0,080

0,100

0,120

0,140

0,160

1 2 3 4 5 6 7 8 9 10

serial samples

interval between: 1-2: 4weeks; 2-3: 4weeks; 3-4: 4weeks; 4-5: 16weeks; 5-6:

4weeks; 6-7: 8weeks; 7-8: 8weeks; 8-9: 8weeks; 9-10: 8weeks.

HBeAg

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

rtL180M/M204V

HBV DNA

(B)

(C)

04-hgg, subgenotype A1

0,00

5,00

10,00

15,00

20,00

25,00

30,00

35,00

40,00

1 2 3 4 5 6 7

serial samples

interval between: 1-2: 4weeks; 2-3: 4weeks; 3-4: 4weeks; 4-5: 16weeks; 5-6:

4weeks; 6-7: 8weeks;

HBeAg

1,00E+02

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

rtL180M/M204V

HBV DNA

05-hgg, genotype G

0,000

1,000

2,000

3,000

4,000

1 2 3 4 5 6 7 8 9

serial samples

interval between: 1-2: 4weeks; 2-3: 4weeks; 3-4: 4weeks; 4-5: 16weeks; 5-6:

4weeks; 6-7: 8weeks; 7-8: 8weeks; 8-9: 8weeks;

HBeAg/Anti-HBe

1,00E+02

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

rtL180M/M204V

HBV DNA

08-hgg, subgenotype A1

0,00

100,00

200,00

300,00

400,00

500,00

1 2 3 4 5 6 7 8 9 10

serial samples

interval between: 1-2: 4weeks; 2-3: 4weeks; 3-4: 4weeks; 4-5: 16weeks; 5-6:

4weeks; 6-7: 8weeks; 7-8: 8weeks; 8-9: 8weeks; 9-10: 8weeks.

HBeAg

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

rtV173L/L180M/M204V

HBV DNA

(D)

(E)

(F)

Table 1: Mutations observed during the entecavir treatment.

Patient Sample Mutation (nt) Mutation (aa)

___________________________________________________

Gene S Polymerase

___________________________________________________

01hgg 0 – 5 T153A/A585G - /I195M L180M (LAM)/M204V(LAM)

01hgg 6 – 8 G492T E1645D V173L (LAM)

01hgg 9 T153A/A585G -/ I195M L180M (LAM)/M204V(LAM)

02hgg 0 and 4 T656C F219S -

02hgg 1 and 5 A676T I226F H234L

02hgg 6 and 8 T481C/A525C/A526T H161Y/F175L/- I169T/T184L/T184L (ETV)

02hgg 7 G299A/C432T/G534A C100Y/-/- -/-/ I187V

02hgg 9 T677A I226F H234Q

03hgg 1 – 2 T133C/C192T/C213T S45P/-/- I53T/-/-

03hgg 3 C213T - -

03hgg 6 C213T/T133A/A135T/C136A -/S45P/S45T/P46T -/I53N/T54Y/T54Y

C138T/C203T/ A246C P46T/I68T/- R55C/-/ I91L

04hgg 0 G580T S194A S202I (ETV)

04hgg 2 and 5 A676T/T677G I226C/ I226C H234L/ H234L

04hgg 3 A525C/C526T/T662G/C675A -/-/F221C/ Y225 stop T184L/T184L ETV)/L229F/H234N

05hgg 8 A676T/T679A/A682C I226F/-/- H234L/L235stop/N236T

08hgg 0 -9 - - -

4. Discussão

A infecção pelo HBV é um sério problema de saúde pública, com uma

estimativa de aproximadamente 400 milhões de pessoas infectadas no mundo

(Zuckerman, 1999).

É sabido que o alvo da terapia da infecção pelo HBV é conter a progressão

para cirrose e/ou a evolução para hepatocarcinoma. Nos últimos anos, foi feito

um grande progresso no tratamento da hepatite B crônica. Ao se escolher uma

terapia, deve-se levar em consideração as vantagens e desvantagens da

mesma, o que inclui eficácia, segurança, resistência e custo (Xu & Chen,

2006).

A lamivudina, primeiro análogo de nucleosídeo liberado pelo FDA, ainda é a

droga mais utilizada para o tratamento do HBV, mas com o tempo prolongado

de tratamento, tem-se uma alta taxa de resistência no motivo YMDD da

polimerase viral (cerca de 60% dos pacientes após três anos de tratamento;

Conjeevaram & Lok, 2003).

No primeiro manuscrito, intitulado “Hepatitis B virus lamivudine resistant

mutations associated with a case of fatal hepatic failure” é descrito o caso de

um paciente que faleceu devido à falência hepática após 33 meses de

tratamento com lamivudina. Em 2000, um paciente de 58 anos foi hospitalizado

devido a uma forte anemia associada aos sintomas de doenças hepáticas.

Durante a internação foram realizados testes sorológicos, os quais mostraram

que o paciente era positivo para HBsAg, anti-HBc e HBeAg e negativo para

anti-HBs, anti-HBe, anti-HCV e anti-HIV. Em agosto de 2001 o paciente iniciou

o tratamento da hepatite B crônica com lamivudina. Em 2004 o paciente veio a

óbito devido à falência hepática.

A resistência à lamivudina ocorre pela substituição de uma metionina por

uma valina ou isoleucina na posição 204 do domínio da transcriptase reversa

(rt) da polimerase viral. Essa substituição pode vir acompanhada ou não por

substituições nas posições rt173 (Torresi, 2002; Cooley et al. 2003) e rt180

(Bartholomew et al. 1997). A presença da mutação rtL180M é associada a um

tratamento prolongado com lamivudina (Yeh, 2000). Estudos in vitro sugerem

que uma simples mutação no motivo YMDD da polimerase viral (rtM204V/I) faz

com que o vírus se replique mais lentamente. A adição da mutação rtL180M

pode atuar como uma compensação para melhorar a capacidade de replicação

viral (Melegari, 1998).

Em nosso estudo, após 32 meses de tratamento com lamivudina, a

mutação rtL180M/rtM204V tornou-se dominante sob a mutação rtM204I,

inicialmente detectada. Na mesma amostra, três mutações raras, somadas às

clássicas mutações de resistência à lamivudina, foram observadas. Duas

dessas mutações (nt 481 e 555) não são sinônimas nem para a polimerase

(rtS117Y, rtV142A) nem para o antígeno de superfície (L109I,F134L), estando

localizadas no determinante antigênico “a”. É conhecido que alterações nesse

determinante podem levar a alterações na secreção do HBsAg e/ou detecção

do HBsAg (Schaefer, 2005).

Três estudos relacionam mutações adicionais às de resistência à

lamivudina com falência hepática. Wang et al. (2002) observaram a mutação

L426I (rtL80I) em associação à rtM204I três meses antes do falecimento de um

paciente, o que ocorreu com 13 meses de tratamento. Ayres et al. (2003)

descrevem as mutações rtA222T e rtL336V (associadas ao antígeno de

superfície I195M e M213I) juntamente com a dupla mutação de resistência à

lamivudina (rtL180M/rtM204I). Zhang et al. (2006) descrevem o caso de um

paciente que foi tratado com lamivudina por quatro meses e cessou o mesmo

sem orientação médica. Após o recomeço do tratamento, o paciente tornou-se

HBeAg negativo e anti-HBs. Entretanto, ele permanecia positivo para o DNA do

HBV. No sequenciamento da amostra, foi observada a mutação G145R

(mutante de escape) assim como vários códons de parada na região

codificante do HBsAg.

Os dados encontrados no presente estudo juntamente com os encontrados

na literatura, sugerem uma correlação entre falência hepática e ocorrência de

mutações adicionais às rtL180M/rtM204I na polimerase viral apesar de cada

estudo relatar diferentes mutações adicionais às de resistência à lamivudina.

Todavia, como não há uma homogeneidade nas mutações encontradas em

nosso estudo e na literatura, não podemos afirmar categoricamente se

realmente essas mutações estão envolvidas na falência hepática.

O segundo artigo intitulado “Lamivudina por tempo prolongado no

tratamento da hepatite B crônica no estado de Mato Grosso” foi um estudo de

segmento, aberto com duração de 6 anos (1999-2005) e com tempo médio de

acompanhamento dos pacientes de 26 meses. Foram avaliadas as

modificações clínicas, bioquímicas e sorológicas de 34 pacientes com hepatite

B crônica, em tratamento com lamivudina. Todos os pacientes desse estudo

eram HBsAg positivos e apresentavam algum tipo de atividade necro-

inflamatória. Dos 20 pacientes que fizeram testes para avaliação da carga viral,

estas foram superiores a 10

cópias/mL no início do tratamento.

A genotipagem de 18 dos 34 pacientes em estudo (53%) corroborou

estudos anteriores (Niel et al. 1994, Araujo et al. 2004) onde os genótipos mais

encontrados no Brasil são o A, D e F. O genótipo A foi encontrado em 12 dos

pacientes. Curiosamente foi encontrado um paciente com o genótipo C, o que

provavelmente é explicado pela origem asiática do paciente (Wang et al. 2002,

Sitnik et al. 2004). O genótipo F foi encontrado em 3 pacientes e o genótipo D

só foi encontrado em 2 pacientes). Em estudos anteriores (Souto et al. 1998a;

1998b) foi observada uma alta incidência (em torno de 70%) do genótipo D no

Mato Grosso. Uma possível explicação para a diferença de prevalência do

genótipo D entre os estudos é a origem dos pacientes do presente estudo,

onde apenas 26% dos pacientes são da região Sul do país (região de alta

prevalência do genótipo D, ver a seguir) enquanto que nos estudos anteriores,

a grande maioria era originária do Sul do país e residia na porção amazônica

de Mato Grosso. Em um trabalho desenvolvido em nosso laboratório (tese de

mestrado de Francisco Campello do Amaral Mello, 2005) observou-se que a

distribuição dos genótipos A e D pelo Brasil parece seguir um gradiente da

região Sudeste, passando pela região Centro-Oeste, até a região Sul. Desta

forma, uma alta incidência de genótipo A é observada na região Sudeste. Ao

Sul do país, observa-se a inversão dessa situação, onde o genótipo D é

encontrado em maior incidência devido a forte imigração européia nesta região

(Gaspar & Yoshida,1987 e Carrilho et al. 2004). Os fluxos migratórios internos

poderiam ser a explicação para a prevalência dos genótipos observada nos

estados que formam a região Centro-Oeste do Brasil. Nos estados de Goiás,

Mato Grosso e Mato Grosso do Sul observou-se uma equivalência na presença

dos genótipos A e D, o que indica uma formação da população desta região por

fluxos oriundos das regiões Nordeste e Sudeste (onde se encontra uma alta

incidência do genótipo A) e da região Sul (com alta incidência do genótipo D).

Dos 34 pacientes estudados, 24 (71%) eram HBeAg positivos no início do

tratamento. Destes 24 pacientes, 13 (54%) tornaram-se HBeAg negativos e 5

(20,8%) soroconverteram de HBeAg para anti-HBe, corroborando os dados

obtidos por Liaw et al. (2000). Entre os 10 pacientes (29%) HBeAg negativos, 8

pacientes (80%) apresentaram uma resposta bioquímica favorável ao

tratamento, o que é sugerido por Tassopoulos et al. (1999), Santantonio et al.

(2000) e Jang et al. (2006).

De acordo com análises clínicas e bioquímicas, 15 pacientes (44%) não

responderam ao tratamento, corroborando os dados encontrados na literatura

(Conjeevaram & Lok 2003; Ganem et al. 2004). Destes 15 pacientes, 6 (18%)

possuem mutações de resistência à lamivudina, comprovando a falha

terapêutica. Todos esses 6 pacientes não respondedores, eram HBeAg

positivos no início do tratamento e destes, 3 pacientes (50%) tornaram-se

HBeAg negativos.

No terceiro manuscrito, intitulado “Hepatitis B virus genotypes and

resistance mutations in patients under long term lamivudine therapy:

Charatcterization of genotype G full-lenght in Brazil.” é feita uma relação entre

os genótipos do HBV e as mutações de resistência à lamivudina, assim como é

descrito pela primeira vez no Brasil o genótipo G em três pacientes.

Este é um estudo de coorte transversal, com amostras coletadas nos anos

de 1999-2006, de pacientes que haviam sido tratados com lamivudina com

média de 48 meses. Trinta e seis pacientes (19 oriundos do Mato Grosso e 17

oriundos do Rio de Janeiro) em tratamento para a hepatite B com lamivudina

por longos períodos, foram analisados. Entre estes pacientes, trinta e dois

(89%) eram positivos para o DNA do HBV e desses, 20 (62%) desenvolveram

mutações de resistência à lamivudina, corroborando os resultados descritos por

Conjeevaram & Lok (2003) que observaram que cerca de 60% dos pacientes

que desenvolveram mutações no motivo YMDD da polimerase viral estavam

em tratamento há pelo menos três anos.

Os quinze pacientes oriundos do Mato Grosso (que são positivos para o

DNA do HBV) também fazem parte da casuística do segundo artigo. A tabela

do anexo apresenta a correspondência das denominações dos pacientes entre

os dois manuscritos.

Existe uma diferença em relação ao genótipo de HBV isolado do paciente 5

do segundo artigo, denominado paciente 29 ufmt no presente manuscrito. Isso

se deve a uma divergência no resultado do RFLP e da análise filogenética.

A literatura ressalta a relação entre genótipos do HBV e resposta ao

interferon. Melhores respostas ao tratamento antiviral foram observadas nos

pacientes infectados pelos genótipos A ou B quando comparados aos

genótipos D e C, respectivamente (Zhang et al. 1996, Orito et al. 2001,

Sanchez-Tapias et al. 2003). Em relação aos análogos de nucleosídeos/

nucleotídeos, alguns autores relatam uma maior freqüência de mutações no

genótipo A do que no genótipo D (Kobayashi et al. 2006, Orito et al. 2006,

Ramos et al. 2007). Os estudos conduzidos com análogos de nucleosídeos/

nucleotídeos, estudaram as mutações nas regiões do core e promotor do core

do HBV (Okamoto et al. 1994, Du et al. 2007; Ma et al. 2007; Ramos et al.

2007). Essas regiões são mais estudadas pelo fato de serem relacionadas ao

fenótipo HBeAg negativo, pois mutações nas posições 1896 (G/A) e 1899 (C/A)

formam um códon de parada, impedindo a produção do HBeAg, mas o DNA do

HBV é detectado nos pacientes. Mutações na região pré-core estão associadas

a uma evolução mais severa da hepatite B (Sitnik et al. 2004).

No terceiro manuscrito aqui apresentado, dentre os 20 pacientes com

mutações de resistência à lamivudina, o genótipo mais difundido é o genótipo A

(subgenótipo A1), o qual foi encontrado nestes casos de mutações em 15

(75%) pacientes. As mutações foram encontradas em todos os genótipos A, C,

F e G com exceção do genótipo D.

Dos pacientes que desenvolveram mutações de resistência à lamivudina,

17 (85%) desenvolveram a clássica dupla mutação (rtL180M e rtM204V/I), 2

(10%) pacientes desenvolveram a tripla mutação (rtV173L, rtL180M e rtM204V)

e apenas 1 (5%) paciente possui uma mutação de resistência (rtM204I).

O HBV é atualmente classificado em oito genótipos (A-H) baseado numa

divergência nucleotídica superior a 8% em todo o genoma (Okamoto et al.

1988). Os genótipos e subtipos do HBV apresentam uma distribuição

geográfica característica nas diferentes regiões do mundo. No Brasil, os

genótipos mais encontrados são o A, D e F (Niel et al. 1994, Araújo et al.

2004). O genótipo G é muito raro e só foi encontrado nos Estados Unidos,

França, México, Alemanha, Japão e Espanha (Stuyer et al. 2000; Sanchez et

al. 2002; Vieth et al. 2002; Shibayama et al. 2005; Ramos et al. 2007). Em

todos esses estudos, esse genótipo foi encontrado em co-infecção com o

genótipo A, sendo que os pacientes alemão e japonês eram co-infectados

HBV-HIV. Chudy et al. (2006) descreveram mais um caso de infecção pelo

genótipo G, com a diferença de que não havia co-infecção por nenhum outro

genótipo do HBV.

Assim como o protótipo do genótipo G (AF160501, Stuyver et al. 2000), as

três amostras brasileiras possuem 3.248 pb, dois códons de parada na região

pré-C nas posições 2 (TAA ao invés de CAA) e 28 (TAG ao invés de TGG),

uma inserção de 36pb no gene C e uma deleção de 1 aa na região pré-S1.

Esse genótipo foi encontrado em três pacientes do Rio de Janeiro, todos

homossexuais, em tratamento da hepatite B crônica e com sinais clínicos e

moleculares de resistência à lamivudina. Dois dos pacientes são co-infectados

HBV-HIV e atualmente fazem o tratamento da hepatite B com entecavir. Já o

paciente que continua o tratamento com lamivudina é mono-infectado pelo

HBV.

Além de serem os primeiros pacientes brasileiros infectados pelo genótipo

G descritos na literatura, o que eles possuem em comum são as clássicas

mutações de resistência à lamivudina. Dois dos pacientes (co-infectados HBV-

HIV) possuem a dupla mutação no motivo YMDD da polimerase viral (rtL180M

e rtM204V) e o terceiro paciente possui a tripla mutação (rtV173L, rtL180M e

rtM204V). A primeira mutação de resistência à lamivudina a emergir é a

rtM204V/I e posteriormente emergem as rtL180M e rtV173L, sendo que esta

última é rara. Ambas mutações são associadas ao prolongado tratamento com

lamivudina (Yeh et al. 2000; Torresi, 2002). Mutações adicionais à rtM204V/I

aumentam a capacidade replicativa do vírus mutante (Melegari et al. 1998). A

tripla mutação provoca uma substituição dos aminoácidos E164D e I195M na

proteína S, assim como ela reduz a afinidade in vitro aos anticorpos anti-HBs,

similar aos vírus de escape vacinal G154R (Roque-Afonso et al. 2003).

Todos os casos descritos na literatura de infecção pelo genótipo G são em

pacientes HBeAg negativos, já que uma das principais características desse

genótipo são dois códons de parada na região do pré-core, o que impossibilita

a produção do HBeAg. Dois pacientes aqui estudados são HBeAg positivos

(pacientes co-infectados HBV-HIV). Uma possível explicação para a

observação desse marcador no soro desses pacientes é a co-infecção por

outros genótipos do HBV.

Para elucidar essa questão foi realizada a genotipagem do DNA do HBV

através da técnica de RFLP (Araujo et al. 2004), na qual foi possível observar

uma mistura de populações pertencentes ao genótipo G e ao genótipo A.

Em um estudo, onde camundongos com hepatócitos humanos foram

infectados por três genótipos do HBV (monoinfecção A, C e G; coinfecção

HBV/A com HBV/G e HBV/C com HBV/G), Sugiyama et al. (2007) observaram

que a replicação do genótipo G é mais lenta e dependente da co-infecção por

outros genótipos do HBV, sendo que a coinfecção com o genótipo A é mais

vantajosa. Eles também observaram que o genótipo G rapidamente se torna

predominante ao outro genótipo e infecções pelo genótipo G podem induzir à

esteatose e fibrose hepática, mas isso só foi observado nos casos de co-

infecção por outros genótipos.

O genótipo C foi observado infectando um paciente oriundo do Mato

Grosso. Esse genótipo é difundido na Ásia e sua primeira descrição no Brasil,

foi em uma amostra do Rio de Janeiro (Sitnik et al. 2004). Uma possível

explicação para a ocorrência do genótipo C nesta cidade é que o paciente

infectado é de origem asiática.

No quarto manuscrito, intitulado “Dynamics of hepatitis B vírus during

entecavir therapy of lamivudine-resistant variants in patients co-infected with

HIV-1”, foram analisados seis pacientes co-infectados HBV/HIV, resistentes à

lamivudina, em tratamento para a hepatite B crônica com entecavir. Este é o

primeiro estudo de ensaio clínico realizado no Brasil, com amostras coletadas

entre os anos de 2003 e 2005, com média de 52 semanas de tratamento com

entecavir. Seis pacientes, homens, com média de idade de 55 anos, HBeAg

positivos e cronicamente infectados pelo HBV e co-infectados pelo HIV foram

analisados. Os seis pacientes já haviam tratado a hepatite B crônica com

lamivudina por pelo menos três anos e tornaram-se resistentes. Na primeira

amostra de soro de cada paciente, anterior ao início do tratamento com

entecavir, todos os seis pacientes apresentavam as clássicas mutações de

resistência à lamivudina (rtL180M e rtM204V), altos níveis de ALT e de carga

viral (> 10

cópias/mL). Todos os pacientes continuaram sendo tratados com

lamivudina tanto para o HBV quanto para o HIV.

Entecavir é um análogo de guanosina com uma potente atividade inibidora

da polimerase do HBV (Yan et al. 2006). Ele foi liberado pelo FDA em 2005

para o tratamento da hepatite B crônica, em adultos com evidências de

replicação viral e elevados níveis de ALT. Em pacientes com mutações de

resistência à lamivudina, 1 mg/dia de entecavir induz a uma redução

significante nos níveis de carga viral e provoca melhoras histológicas (Chang et

al. 2005). Chang et al. (2006) associaram ao entecavir uma melhora

histológica, virológica e bioquímica num estudo envolvendo 715 pacientes

HBeAg positivos que não tinham sido tratados previamente com nenhum

análogo de nucleosídeo/nucleotídeo.

Em nosso estudo foi observada, inicialmente, uma queda na carga viral de

todos os pacientes (≤ 1log). Na última amostra de soro de três (50%) pacientes,

a carga viral aumentou abruptamente, revelando que os mesmos não são

respondedores ao tratamento com entecavir. As cargas virais dos outros 3

(50%) pacientes se mantiveram baixas. de Man et al. (2001) observaram uma

maior redução dos níveis de carga viral em pacientes que foram tratados com 1

mg/dia do que naqueles que foram tratados com 0.5 mg/dia. Gish et al. (2005a)

observaram que após dois anos de tratamento com entecavir, 81% dos

pacientes tiveram quedas nos níveis de cargas virais.

Dois dos três pacientes que mantiveram baixos os níveis de carga viral,

soroconverteram de HBeAg para anti-HBe. Sherman et al. (2006) observaram

uma taxa de soroconversão de 8% após 48 semanas de tratamento, mas

concluem que uma longa terapia com entecavir deva resultar em uma taxa

maior de soroconversão. Um desses dois pacientes que soroconverteram,

tornou-se negativo para o DNA do HBV na 48ª semana de tratamento. Esse

dado corrobora os dados obtidos por Collono et al. (2005) que observaram que

em 79% dos pacientes, o DNA do HBV se tornou indetectável.

Análise do seqüenciamento do gene S/Pol dos 52 isolados obtidos das

amostras seriadas, evidenciou a manutenção das mutações de resistência à

lamivudina em todos os isolados (rtL180M e rtM204V). Tenney et al. (2004)

demonstraram, através de estudos clínicos e experimentos in vitro, que a

resistência ao entecavir só é desenvolvida, e infreqüentemente, quando as

mutações de resistência à lamivudina estão presentes e são associadas às

mutações rtT184G, rtS202I e/ou rtM250V (resistência cruzada). Villet et al.

(2007) observaram a mutação rtS202G em adição à dupla mutação de

resistência à lamivudina e sugerem que a mutação rtS202G foi essencial para

o desenvolvimento de resistência ao entecavir. Em nosso estudo, observamos

a mutação rtT184L na anti-penúltima e última amostra do paciente 02hgg e na

terceira amostra do paciente 04hgg. Já a mutação rtS202I foi observada na

amostra anterior ao início do tratamento do paciente 04hgg e a mutação

rtS202N foi observada nas terceira e quarta amostras do paciente 02hgg e na

amostra anterior ao início do tratamento do paciente 08hgg. Nenhuma das

mutações se acumularam ou se mantiveram ao longo do tratamento.

5. Conclusões

1. Pode existir uma correlação entre hepatite fatal e a ocorrência de

mutações adicionais às de resistências a lamivudina próximo ao óbito do

paciente. Todavia, não podemos provar que uma mutação em uma

determinada posição seja determinante nesse fenômeno;

2. O monitoramento, a detecção e a caracterização das mutações

moleculares de resistência, que normalmente ocorrem meses antes da

detecção fenotípica de resistência aos antivirais, podem dar ao clínico

um tempo considerável para a reavaliação da droga a ser utilizada no

tratamento, possibilitando uma melhor sobrevida do paciente;

3. O tratamento com lamivudina apresentou uma resposta inicial favorável

na maioria dos pacientes, os quais apresentaram uma melhora

bioquímica e/ou virológica;

4. A freqüência de mutações de resistência à lamivudina em pacientes em

tratamento por pelo menos 9 meses é semelhante ao encontrado na

literatura (62,5%);

5. Conforme estudos anteriores, o genótipo A (subtipo A1) é o mais

difundido no Brasil;

6. Foi identificado pela primeira vez em Mato Grosso um paciente

infectado pelo genótipo C;

7. Foi realizado pela primeira vez no Brasil, o seqüenciamento do genoma

completo do genótipo G;

8. Em nossos estudos, as mutações de resistência à lamivudina não estão

associadas aos genótipos do HBV;

9. Devido ao seu baixo custo e grande tolerabilidade é possível que a

lamivudina continue tendo relevância no arsenal terapêutico contra o

HBV e HIV nos próximos anos apesar das novas medicações para o

HBV. Torna-se urgente encontrar soluções que minimizem os efeitos

negativos nos pacientes infectados pelo HBV e sob tratamento com

lamivudina afim de prevenir a disseminação destes vírus encontrados

em cargas virais elevadas, com mutações de resistência ou não, alguns

inclusive com perfil de escape vacinal;

10. O sequenciamento nucleotídico, é uma técnica sofisticada que não

poder ser utilizada amplamente em laboratórios de rotina e a baixo

custo. É necessário que o Brasil invista no desenvolvimento de testes

rápidos como “line probe assay” para o monitoramento dos pacientes em

tratamento com lamivudina, permitindo a reavaliação da conduta

terapêutica do paciente;

11. O entecavir induziu uma melhora histológica, bioquímica e virológica

favorável em pacientes resistentes à lamivudina, apesar do aumento nas

cargas virais observado em três pacientes;

12. Não foram observadas mutações de resistência ao entecavir em 64

semanas de estudo.

6. Referências Bibliográficas

Alberti A, Tremolada F, Fattovich G, Bortolotti F, Realdi G 1983. Virus

replication and liver disease in chronic hepatitis B virus infection. Dig Dis Sci 28:

962-966.

Alter HJ, Purcell RH et al. 1977. Transmission of hepatitis B to chimpanzees by

hepatitis B surface antigen-positive saliva and semen. Infect Immun 16: 928-

933.

Alter MJ 1993. Community acquired viral hepatitis B and C in United States.

Gut 34: S17-S19.

Angus P, Vaughan R et al. 2003. Resistance to adefovir dipivoxil therapy

associated with the selection of a novel mutation in the HBV polymerase.

Gastroenterology. 125: 292-297.

Araujo NM, Mello FC et al. 2004. High proportion of subgroup A’ (genotype A)

among Brazilian isolates of Hepatitis B virus. Arch. Virol. 149: 1383-1395.

Arauz-Ruiz P, Norder H, Robertson BH, Magnius LO. 2002. Genotype H: a

new Ameridian genotype of hepatitis B virus revealed in Central America. J Gen

Virol 83: 2059-2073.

Assad S & Francis A. 2000. Over a decade of experience with a yeast

recombinant hepatitis B vaccine. Vaccine. 18: 57-67.

Atkins M, Hunt CM et al. 1998. Clinical significance of YMDD mutant hepatitis B

virus (HBV) in a large cohort of lamivudine treated hepatitis B patients.

Hepatology. 28: 319A.

Ayres A, Bartolomeusz A et al. 2003. Lamivudine and Famciclovir resistant

hepatitis B virus associated with fatal hepatic failure. J. Clin. Virol. 27: 111-116.

Balayan MS, Andjaparadze AG et al. 1983. Evidence for a virus in non-A, non-B

hepatitis transmitted via fecal- oral route. Intervirology 20: 23- 31.

Bartholomew MM, Jansen RW et al. 1997. Hepatitis B virus resistance to

lamivudine given for recurrent infection after orthopic liver transplantation.

Lancet. 349: 20-22.

Batholomeusz A, Groene LC et al. 1997. Clinical experience with famiclovir

against hepatitis B virus. Intervirology. 40(5-6): 337-342.

Bayer ME, Blumberg BS, Werner B. 1968. Particles associated with Australian

antigen in the sera of patients with leukemia, Down’s syndrome and hepatitis.

Nature 218: 1057-1059.

Beasley RP, Hwang LY. 1987. Postnatal infectivity of hepatitis B surface

antigen-carrier mothers. J Infect Dis 147: 185-190.

Beasley RP, Hwang LY. 1988. Postnatal infectivity of hepatitis B surface

antigen-carrier mothers. J Infect Dis 147: 185-190.

Beltrami EM, Williams IT, Shapiro CN, Chamberland ME 2000. Risk and

management of blood-borne infections in health care workers. Clin Microbiol

Rev 13: 385-407.

Benhamou Y, Bochet M et al. 1999. Long-term incidence of hepatitis B virus

resistance to lamivudine in human immunodeficiency virus-infected patients.

Hepatology. 30: 1302-1306.

Benhamou Y, Fleury H et al. 2006. Anti-hepatitis B virus efficacy to tenofovir

disopoxil fumarate in HIV-infected pacientes. Hepatology. 43: 548-555.

Bessesen M, Ives D et al. 1999. Chronic active hepatitis B exacerbations in

human immunodeficiency virus-infected patients following development of

resistance to or withdrawal of lamivudine. Clin. Infect. Dis. 28: 1032-1035.

Blum HE. 1993. Hepatitis B virus: significance of naturally occurring mutants.

Intervirology 35: 40-50.

Blumberg BS, Gerstley BJS, Hungford DA, London WT, Sutnick AI. 1967.

Serum antigen (Australia antigen) in Down’s syndrome, leukemia and hepatitis.

Ann Int Med 66: 924-931.

Bock CT, Schranz P et al. 1994. Hepatitis B virus genome is organized into

nucleosomes in the nucleus of the infected cell. Virus Genes. 8: 215-229.

Brunelle MN, Jacquard AC et al. 2005. Susceptibility to antivirals of a human

HBV strain with mutations conferring resistance to both lamivudine and

adefovir. Hepatology. 41: 1391-1398.

Brunetto M, Stemmler M et al. 1989. Identification of HBV variants which cannot

produce pre-C-derived HBeAg and may be responsible for severe hepatitis. Ital

J Gastroenterol 21: 151-154.

Bruss V & Gerlich WH. 1988. Formation of transmenbraneous hepatitis B e-

antigen by cotranslational in vitro processing of the viral precore protein.

Virology. 163: 268-275.

Carman WF, Jacyna MR et al. 1989. Mutation preventing formation of hepatitis

B virus e antigen in patients with chronic hepatitis B infection. Lancet ii: 588-

591.

Carrilho FJ, Moraes CR et al. 2004. Hepatitis B virus infection in Haemodialysis

Centres from Santa Catarina State, Southern Brazil. Predective risk factors for

infection and molecular epidemiology. BMC Publ. Health. 27: 4-13.

Chang TT, Gish RG et al. 2005. A dose-raging study of the efficacy and

tolerability of entecavir in lamivudine-refractory chronic hepatitis B patients.

Gastroenterology 129: 1198-1209.

Chang TT, Gish RG et al. 2006. A comparision of entecavir and lamivudine for

HBeAg positive chronic hepatitis B. New. Engl. J. Med 354(10): 1001-1010.

Chen WN & Onn CJ. 1999. Human hepatitis B virus mutants: significance of

molecular changes. FEBS Lett 453(3): 237-242.

Choo QL, Kuo G, Weiner AJ, et al. 1989. Isolation of a cDNA clone derived from

a blood-borne non-A, non-B viral hepatitis genome. Science 244: 359- 362.

Chudy M, Schimidt M et al. 2006. Hepatitis B virus genotupe G moninfection

and its transmission by blood components. Hepatology 44(1): 99-107.

Collono RJ, Rose R et al. 2005. Entecavir two year resistance update: no

resistance observed in nucleoside naive patients and low frequency resistance

emergence in lamivudine refractory patients. Hepatology 42(1): A962 [p573A].

Cooley L, Ayres A et al. 2003. Prevalence and characterization of lamivudine-

resistant hepatitis B virus mutations in HIV-HBV co-infected individuals. AIDS.

17: 1649-1657.

Conjeevaram HS, Lok AS. 2003. Management of chronic hepatitis B. J.

Hepatol. 38: S90-S103.

Couroucé AM, Holland PV, Muller JY et al. 1976. HBs antigen subtypes:

Proceedings of the International Workshop on HBs antigen subtypes. Biblioteca

Haematologica. 42: 1-158.

Dane DS, Cameron CH, Briggs M. 1970. Virus-like particles in serum of patients

with Australian-antigen-associated hepatitis. Lancet i: 695-698.

Dash S, Rao KVS et al. 1991. Significance of natural polymerized albumin and

its receptor on hepatitis B infection of hepatocytes. Hepatology 13: 134-142.

Davison F, Alexander GJM et al. 1987. Detection of hepatits B virus DNA in

spermatozoa, urine, saliva, and leucocytes of chronic HBsAg carriers. J Hepatol

4: 37-44.

De Castro L, Niel C, Gomes SA. 2001. Low frequency of mutations in the core

promoter and precore regions of hepatitis B virus in anti-HBe positive Brazilian

carriers. BMC Microbiol 1: 10.

De Clercq E, Holy A et al. 1986. A novel selective broad-spectrum anti-DNA

virus agent. Nature. 323: 464-467.

De Man RA, Wolters LM et al. 2001. Safety and efficacy of oral entecavir given

for 28 days in patients with chronic hepatitis B virus infection. Hepatology.

34(3): 578-582.

Dienstang JL, Schiff ER et al. 1999. Lamivudine as initial treatment for chronic

hepatitis B in the United States. N.Engl.J.Med. 341: 1256-1263.

Dore GJ, Cooper DA et al. 2004. Efficacy of tenofovir disopoxil fumarate in

antiviral therapy-naïve and –experienced patients coinfected with HIV-1 and

hepatitis B virus. J. Infect. Dis. 189: 1185-1192.

Du H, Li T et al. 2007. Correlation of hepatitis B virus (HBV) genotypes and

mutants in basal core promoter/precore with clinical features of chronic HBV

infection. Liver Int. 27(2): 240-246.

Feinstone SM, Kapikian AZ, Pueceli RH. 1973. Hepatitis A: detection by

immune alectron microscopy of a virus like antigen associated with acute

illness. Science 182: 1026- 1028.

Feitelson MA, Duan LX. 1997. Hepatitis B virus X antigen in the pathogenesis of

chronic infections and the development of hepatocellular carcinoma. Am. J.

Pathol. 150(4): 1141-1157.

Fiordalisi G, Cariani E et al. 1990. High genomic variability in the pre-C region

of hepatitis B virus in anti-HBe, DNA-HBV positive chronic hepatitis. J Med Virol

31: 297-300.

Galle PR, Hagelstein J et al. 1994. In vitro experimental infection of primary

human hepatocytes with hepatitis B virus. Gastroenterology 106: 664-673.

Ganem D, Varmus HE. 1987. The molecular biology of hepatitis B viruses. Ann

Rev Biochem 56: 651-693.

Ganem D. 1996. Hepadnaviridae and their replication. In: Fields BN, Knipe DM,

Howley PM. Fields Virology. Philadelphia: Lippincott – Raven 2703 -2737.

Ganem D & Schneider RJ. 2001. Hepadnaviridae and their replication. In:

Knipe DM & Howley PM, eds. Fields of Virology 4

ed. Philadelphia: Lippincott-

Raven. 2703-2737.

Ganem D, Prince AM. 2004. Mechanisms of disease: Hepatitis B virus

infection- natural history and clinical consequences. N Engl J Med. 350(11):

1118-1129. Review.

Garcia P, Ou J, Rutter WJ, Walter P. 1988. Targeting of precore protein of

hepatitis B virus to the endoplasmic reticulum membrane: after signal peptide

cleavage translocation can be aborted and the product released into the

cytoplasm. J Cell Biol 106: 1093-1104.

Gaspar AMC, Yoshida CFT. 1987. Geographic distribution of HBsAg subtypes

in Brazil. Mem Inst Oswaldo Cruz 82: 253-258.

Gerlish WH, Robinson WS. 1980. Hepatitis B virus contains protein attached to

the 5’ terminus of its complete DNA strand. Cell 21: 801-809.

Gish R, Chang TT et al. 2005a. Entecavir results in a substantial virologic and

biochemical improvement and HBeAg seroconvertion through 96 weeks of

treatment in HBeAg (+) chronic hepatitis patients. Hepatology. 42(1): A181

[p267A].

Gomes SA. 2003. Genoma Viral In: Tratado de Hepatites Virais. Roberto

Focaccia ed. Atheneu.

Grob PJ. 1998. Hepatitis B: virus, pathogenesis and treatment. Vaccine 16:

S11-S16.

Grabow WOK, Prozesky OW, Applebaum PC and Lecatsas G 1975. Absence

of hepatitis B antigens from feces and sewage as a result of enzymatic

destruction. J Infect Dis 131: 658-664.

Henkler FF & Koshy R. 1996. Hepatitis B virus transcriptional activators:

mechanisms and possible role in oncogenesis. J. Viral. Hepatol. 3(3): 109-121.

Hino O, Shows T, Rogler CE. 1986. Hepatitis B virus integration site in

hepatocellular carcinoma at translocation. Proc Natl Acad Sci USA 83: 8338-

8342.

Hollinger FB & Liang TJ. 2001. Hepadnaviridae and their replication. In: Knipe

DM & Howley PM, eds. Fields of Virology 4

ed. Philadelphia: Lippincott-

Raven.

Honkoop P, Niesters HG et al. 1997. Lamivudine resistance in

immunocompetent chronic hepatitis B. Incidence and patterns. J. Hepatol. 26:

1393-1395.

Honkoop P, de Man RA. 2003. Entecavir: a potente new antiviral drug for

hepatitis B. Expert. Opin. Investig. Drugs 12(4): 683-688.

Huy TT, Ishikawa K et al. 2006. Characteristics of hepatitis B virus in Ghana:

full length genome sequences indicate the endemicity of genotype E in West

Africa. J. Med. Virol. 78: 178-184.

Ikeda K, Saitoh S et al. 1998. Interferon decreases hepatocellular

carcinogenesis in patients with cirrhosis caused by the hepatitis B virus: a pilot

study. Cancer 82: 827- 835.

Jang JW, Bae SH et al. 2006. Early virological response predicts outcome

during extended lamivudine retreatment in patients with chronic hepatitis B who

relapsed after inicial HBeAg responses. J. Gastroenterol. Hepatol. 21: 384-391.

Janssen HL, van zonneveld M, Senturk H et al. 2005. Pegylated interferon

alpha-2b alone or in combination with lamivudine for HBeAg positive chronic

hepatitis B: a randomised trial. Lancet. 365: 123-129.

Kidd-Ljunggren K, Miyakawa Yuzo, Kidd AH. 2002. Genetic variability in

hepatitis B viruses. J Gen Virol 83: 1267-1280.

Kim CM, Koike K et al. 1991. HBx gene of hepatitis B virus induces liver cancer

in transgenic mice. Nature. 351(6324): 317-320.

Klingmuller U, Schaller H. 1993. Hepadnavirus infection requires interaction

between the viral pre-S domain and a specific hepatocellular receptor. J Virol

67: 7414-7422.

Kobayashi M, Suzuki F, Akuta N et al. 2006. Response to long-term lamivudine

treatment in patients with hepatitis B virus genotypes A, B and C. J. Med. Virol.

78(10): 1276-1283.

Krugman S. 1989. Hepatitis B: Historical aspects. Am J Infect Control 17: 165-

167.

Kuo A, Dienstag JL et al. 2004. Tenofovir disopoxil fumarate for the treatment of

lamivudine resistant hepatitis B. Clin. Gastroenterol Hepatol. 2: 226-272.

Lacombe K, Gozlan J et al. 2005. Long term hepatitis B virus dynamics in HIV-

hepatitis B virus co-infected patients treated with tenofovir disopoxil fumarate.

AIDS. 19: 907-915.

Lai CL, Chien RN et al. 1998. A one-year trial of lamivudine for chronic hepatitis

B. Asia Hepatitis Lamivudine Group. N.Engl.J.Med. 339: 61-68.

Lau GK, Cooksley H, Ribeiro RM et al. 2004. Ransomised, double-blind study

comparing adefovir dipivoxil (ADV) plus emtricitabine (FTC) combination

therapy versus ADV alone in HBeAg (+) chronic hepatitis B: Efficacy and

mechanisms of treatment response. Hepatology. 40: 272A.

Lau GK, Piratvvisuth T, Luo KX et al. 2005. Pegainterferon Alpha-2a,

lamivudine, and the combination for HBeAg positive chronic hepatitis B. N.

Engl. J. Med. 352: 2682-2695.

Le Bouvier GL. 1971. The heterogeneity of Australia antigen. J. Infct. Dis.

123(6): 671-675.

Le Bouvier GL. 1972. Seroanalysis by immune diffusion: the subtypes of type B

hepatitis virus. In: Vyras GN, Perkins A, Achimid R, eds. Hepatitis and Blood

transfusion. New York, NY: Grune and Stratton. 97-110.

Lee J, Shim HS et al. 2002. 2,5-Pyridinecar-boxylicacis derivates as non-

nucleosidic reverse transcriptase inhibitors of hepatitis B virus. Bioorg. Med.

Chem. Lett. 12: 2715.

Leung N, Lai C et al. 1999. Three years lamivudine therapy in chronic HBV. J.

Hepatol. 30: 59.

Levine S, Hernandez D et al. 2002. Efficacies of Entecavir against Lamivudine-

resistant hepatitis B virus replication and recombinat polymerases in vitro.

Antimicrob. Agents. Chemother. 46(8): 2525-2532.

Liaw YF, Chien RN et al. 1999. Acute exacerbation and hepatitis B virus

clearance after emergence of a YMDD motif mutation during lamivudine

therapy. Hepetology. 30(2): 567-572.

Liaw YF, Leung NWY et al. 2000. Effects of extended lamivudine therapy in

Asian patients with chronic hepatitis B. Gastroenterology. 119: 172-180.

Lim SG, Krastev Z, Ng TM et al. 2006. Randomised, double-blind study of

emtricitabine (FTC) plus clevudine versus FTC alone in treatment of chronos

hepatitis B. Antimicrob. Agents Chemother. 50: 16482-1648.

Lindh M. HBV genotype G – an odd genotype of unknown origin. J. Clin. Virol.

34: 315-316.

Lurman A. 1885. Eine icterusepidemic. Berl Klin Wochenschr 22: 20-23.

Ma JG, Wang LW et al. 2007. relationship between HBV genotypes and anti-

viral therapeutic efficacy of interferon-alpha. Hepatobil. Pancretat Dis Int 6(2):

166-170.

Magnius LO & Norder H 1995. Subtypes, genotypes and molecular

epidemiology of the hepatitis B virus as reflected by sequence variability of the

S-gene. Intervirology 38(2): 24-34.

Marcellin P, Chang T-T et al. 2003. Adefovir dipivoxil for the treatment of

hepatitis B e antigen- positive chronic hepatitis B. N Engl J Med 348: 808- 816.

Margolis HS, Alter MJ, Hadler SC 1991. Hepatitis B: evolving epidemiology and

implications for control. Sem Liver Dis 11: 84-92.

Maruyama T, Mitsui H et al. 2000. Emergence of the precore mutant late in

chronic hepatitis B infection correlates with the severity of liver injury and

mutations in the core region. Am J Gastroenterol 85: 2894-2904.

McIntyre N. 1990. Clinical presentation of acute viral hepatitis. Br Med Bull 46:

535-547.

Melegari M, Scaglioni PP, Wands JR. 1998. Hepatitis B virus mutants

associated with 3TC and famciclovir administration are replication defective.

Hepatology. 27: 628-633.

Mello FCA. 2005. Caracterização Molecular e Genotipagem de cepas do vírus

da hepatite B circuçantes no Brasil: Filogenia dos isolados do genótipo F. Tese

de Mestrado do Curso de Biologia Celular e Molecular do Instituto Oswaldo

Cruz.

Milich DR, McLachlan A. 1986. The nucleocapsid of hepatitis B virus is both a

T-cell- independent and T-cell-dependent antigen. Science 234: 1398-1401.

Nassal M, Rieger A. 1993. An intramolecular disulfide bridge between Cys-7

and Cys-61 determines the structure of the secretory core gene product (e

antigen) of hepatitis B virus. J Virol 67: 4307-4315.

Neurath AR, Kent SBH, Strick N, Parker K. 1986. Identification and chemical

synthesis of a host cell receptor binding site on hepatitis B virus. Cell 46: 429-

436.

Niel C, Moraes MTB et al. 1994. Genetic diversity os hepatitis B virus strains

isolated in Rio de Janeiro. J Med Virol 44: 180-186.

Nishizawa T, Okamoto H et al. 1997. A novel DNA virus (TTV) associated with

elevated transaminase levels in post transfusion hepatitis of unknown etiology.

Biochem Biophys Res Commun 241: 92-97.

Norder H, Hammas B et al. 1992b. Comparison of the amino acid sequence of

nine different serotypes of hepatitis B surface antigen and genomic

classification of the corresponding hepatitis B virus strain. J. Gen. Virol. 73(5):

1201-1208.

Norder H, Courouce-Pauty AM et al. 1994. Complete genomes, phylogenetic

relatedness and structural proteins of six strains of the hepatitis B virus, four of

which represent two new genotypes. Virology 198(2): 489-503.

Nunez M, Perez-Olmeda M et al. 2002. Activity of tenofovir on hepatitis B virus

replication in HIV-co-infected patients failing or partially responding to

lamivudine. AIDS. 16: 2352-2354.

Okamoto H, Imal M, Tsuda F et al. 1987a. Point mutation in the s gene of

hepatitis B virus for a d/y or w/r subtypes change in two blood donors carrying a

surface antigen of compound subtype adry or adwr. J. Virol. 61: 3030-3034.

Okamoto H, Imai M et al. 1987b. Genomic heterogeneity of hepatitis B virus in a

54-year-old woman who contracted the infection through materno-fetal

transmission. Jpn J Exp Med 57: 231-236.

Okamoto H, Tsuda F et al. 1988. Typing hepatitis B virus by homology in

nucleotide sequence: comparison of surface antigen subtypes. J. Gen. Virol.

69: 2575-2583.

Okamoto H, Yotsumoto S et al. 1990. Hepatitis B viruses with pre-C region

defects prevail in persistently infected hosts along with seroconversion to the

antibody against e antigen. J Virol 64: 1298-1303.

Okamoto H, Tsuda F et al. 1994. Hepatitis B virus with mutations in the core

promoter for an e antigen-negative phenotype in carriers with antibody to e

antigen.

J Virol. 68(12): 8102-8110.

Okochi K, Murakami S. 1968. Observations on Australian antigen in Japanese.

Vox Sang 15: 374-385.

Oliveira MLA, Bastos FI et al. 1999. Prevalence and risk factors for HBV, HCV

and HDV infections among injecting drug users from Rio de Janeiro, Brazil.

Braz J Med Biol Res 32: 1107-1114.

Ono SK, Kato N et al. 2001. The polymerase L528M mutation cooperates with a

nucleotide biding-site mutations, increasing hepatitis B virus replication and

drug resistance. J. Clin. Invest. 107: 449-455.

Orito E, Mizokami M et al. 1989 Host-independent evolution and a genetic

classification of the hepadnavirus family based on nucleotide sequence. PNAS.

86: 7059-7062.

Orito E, Mizokami M et al. 2001. A case-control study for clinical and molecular

biological differences between hepatitis B viruses of genotypes B and C.

Hepatology. 33: 218-223.

Orito E, Fujiwara K, Tanaka Y et al. 2006. A case-control study of response to

lamivudine therapy for 2years in japonese and chinese patients in chronically

infected with hepatitis B virus of genotypes Bj, Ba and C. Hepatol. Res. 35(2):

127-134.

Papatheodoridis GV, Dimou E, Papadimitropoulos V. 2002. Nucleoside

analogues for chronic hepatitis B: antiviral efficacy and viral resistance. Am. J.

Gastroenterol. 97(7): 1620-1628.

Piot P, Goilav C, Kegels E. 1990. Hepatitis B: transmission by sexual contact

and needle sharing. Vaccine 8 (Suppl): S37-40; discussion S41-43.

Pollack JR & Ganem D. 1993. An RNA stem-loop structure directs hepatitis B

virus genomic RNA encapsidation. J. Virol. 67(6): 3254-32263.

Rapicetta M, Ferrari C, Levrero M. 2002. Viral determinants and host immune

responses in the pathogenesis of HBV infection. J Med Virol 67: 454-457.

Prince AM. 1968. An antigen detected in the blood during the incubation period

of serum hepatitis. Proc Natl Acad Sci USA 60: 814-821.

Ramos B, Nunez M et al. 2007. Hepatitis B virus genotypes and lamivudine

resistance mutations in HIV/Hepatitis BVirus –Coinfected patients. J. Acquir.

Immune. Defic. Syndr.

Rizzeto M, Canesse MG et al. 1977. Immunnofluorescence detection of a new

antigen/ antibody system (delta/ antidelta) associated with hepatitis B virus in

liver and serum of HBsAg carriers. Gut 18: 998- 1003.

Roque-Afonso AM, Ferey MP et al. 2003. Monitoring the emergence of hepatitis

B virus polymerase gene variants during lamivudine therapy in human

immunodeficiency virus coinfected patients: performance of CLIP sequencing

and line probe assay. Antivir Ther. 8(6): 627-634.

Sanchez LV, Maldonado M et al. 2002. Genotypes and S gene variability of

Mexican hepatitis B virus strains. J. Med. Virol. 68(1): 24-32.

Sanchez-Tapias JM, Costa J et al. 2003. Influence of hepatitis B virus genotype

on the long term outome of chronic hepatitis B in western patients.

Gastroenterology. 125: 1559-1560.

Sato S, Suzuki K et al. 1995. Hepatitis B virus strains with mutations in the core

promoter in patients with fulminant hepatitis. Ann Intern Med 122: 241-248.

Santantonio T, Mazzola M et al. 2000. Long-term follow-up of patients with anti-

HBe/HBV DNA positive chronic hepatitis B treated for 12 months with

lamivudine. J. Hepatol. 32: 300-306.

Schaefer S. 2005. Hepatitis B virus: significance of genotypes. J. Viral Hep. 12:

111-124.

Schildgen O, Sirma H et al. 2006. Variant of hepatitis B virus with primary

resistance to adefovir. N. Engl. J. Med. 354: 1807-1812.

Seeger C, Ganem D et al. 1986. Biochemical and genetic evidence for the

hepatitis B virus replication strategy. Science. 25,232(4749): 477-484.

Seeger C, Mason W. 2000. Hepatitis B virus biology. Microbiol Mol Biol Rev 64:

51-68.

Sells MA, Zelent AZ et al. 1988. Replicative intermediates of hepatitis B virus in

HepG2 cells that produce infectious virions. J Virol 62: 2836-2844.

Sherman M, Yurdayin C et al. 2006. Entecavir for treatment of lamivudine

refractory, HBeAg positive chronic hepatitis B. Gastroenterology. 130: 2039-

2049.

Shibayama T, Masuda G et al. 2005. Characterization of seven genotypes (A to

E, G and H) of hepatitis B virus recovered from Japanese patients infected with

human immunodeficiency virus type 1. J Med Virol.76(1): 24-32.

Simons JN, Leary TP, Dawson GP. 1995. Isolation of a novel virus-like

sequence associated with human hepatitis. Nature Med 1: 564- 569.

Sitnik R, Pinho JRR et al. 2004. Hepatitis B virus genotypes and precore and

core mutants in Brazilian patients. J. Clin. Microbiol. 42(6): 2455-2460.

Souto FJD, Fontes CJE et al. 1998a. Outbreak of hepatitis B vírus in recent

arrivals to the Brazilian amazon. J. Med. Virol. 56: 4-9.

Souto FJD, Fontes CJE et al. 1998b. Hepatitis B virus infection in immigrants to

the southern Brazilian amazon. Transc. Royal Soc. Trop. Med. Hyg. 92: 282-

284.

Souto FJD. 1999. Distribuição da hepatite B no Brasil: atualização do mapa

epiemiológico e proposições para seu controle. Gastroenterol Endosc Dig 18:

143-150.

Sugiyama M, Tanaka Y, Sakamoto T et al. 2007. Early dynamics of hepatitis B

virus in chimeric mice carring human hepatocytes monoinfectaed or coinfectaed

with genotype G. Hepatoogyl. 45(4): 929-937.

Stuyver L, De Gendt S et al. 2000. A new genotype of hepatitis B virus:

complete genome and phylogenetic relatedness. J Gen Virol 81: 67-74.

Suzuki N, Koizumi K et al. 2004. Structural basis of thespecificity, catalysis and

regulation of human uridine-cytidine kinase. Structre. 12: 751-764.

Szmuness W, Stevens CE et al. 1980.A Hepatitis B vaccine – Demonstration of

efficacy in a controlled clinical trial in a high- risk population in the United

States. N Engl J Med 303: 833- 841.

Takahashi K, Iwasa Y, Hijikata M, Mishiro S. 2000. Identification of a new

human DNA virus (TTV- like mini virus, TLMV) intermediately related to TT virus

and chicken anemia virus. Arch Virol 145: 979- 993.

Tanaka Y, Primi P et al. 2001. Genomic and molecular evolutionary analysis of

a newly identified infectious agent (SEN virus) and relationship to TT virus

family. J Infect Dis 183: 359- 367.

Tapassoulous NC, Volpes R et al. 1999. Efficay of lamivudine in patients with

hepatitis B e antigen-negative/hepatitis B vírus DNA-positive (precore mutant)

chronic hepatitis B. Hepatology. 29: 889-896.

Teles SA, Martins RMB et al. 1998. Hepatitis B virus infection profile in Central

Brazilian hemodialysis population. Rev Inst Med Trop São Paulo 40: 281-286.

Tenney DJ, Levine SM et al. 2004. Clinical emergence of entecavir resistant

hepatitis B virus requires additional substitutions in virus already resistant to

lamivudine. Antimicrob. Agents. Chemother. 48: 3498-3807.

Thomas H. 1991. Pathogenesis of chronic active hepatitis B. J Gastroenterol

Hepatol 6 (1): 4-6.

Thung SN, Gerber MA. 1984. Polyalbumin receptors: their role in attachment of

hepatitis B virus to hepatocyter. Sem Liver Dis 4: 69-75.

Tillmann HL. 2007. Antiviral therapy and resistance with hepatitis B virus

infection. World J Gastroenterol. 13(1): 125-140.

Tiollais P, Pourcel et al. 1985. The hepatitis B virus. Nature. 317(6037): 489-

495.

Toh H, Hayashida H, Miyata T. 1983. Sequence homology between retroviral

reverse transcriptase and putative polymerases of hepatitis B virus and

cauliflower mosaic virus. Nature 305: 827-829.

Torresi L. 2002. The virological and clinical significance of mutations in the

overlapping envelope and polymerase genes of hepatitis B virus. J. Clin. Virol.

25: 97-106.

Van Bommel F, Zollner B et al. 2006. Tenofovir for patients with lamivudine-

resistant hepatitis B virus (HBV) infection and high DNA level during adefovir

therapy. Hepatology. 44: 318-325.

Vieth S, Manegold C et al. 2002. Sequence and phylogenetic analysis of

hepatitis B virus genotype G isolated in German. Virus Genes. 24(2): 153-156.

Villet S, Ollivet A et al. 2007. Stepwise process for the development of entecavir

resistance in a chronic hepatitis B virus infected patient. J. Hepatol. 46: 531-

538.

Wallace LA, Carman WF. 1994. Clinical implications of hepatitis B virus

envelope protein variation. Int J Clin Lab Res 24: 80-85.

Wang JH, Lu SN et al. 2002. Fatal hepatic failure after emergence of the

hepatitis B virus mutant during lamivudine therapy in a patient with liver

cirrhosis. Scand. J. Gastroenterol. 37: 366-369.

Will H, Reiser W et al. 1987. Replication strategy of human hepatitis B virus. J.

Virol. 61(3): 904-911.

Wong DK, Cheung AM et al. 1993. Effect of alpha-interferon treatment in

patients with hepatitis B e antigen-positive chronic hepatitis B. Ameta-analysis.

Ann. Intern. Med. 119: 312-232.

Wong SN & Lok AS. 2006. Tenofovir disopoxil fumarate: Role in Hepatitis B

Treatment. Hepatology 44: 309313.

Wursthorn K, Buggisch P, Zöllner B et al. 2005. Combination Therapy of

PegIntrferon-2b and adefovirdipivoxil in chronic hepatitis B leads to a strong

suppression of cccDNA and high rates of HBe and HBs seroconvertion. J.

Hepatol. 42(2): S32.

Xiong X, Flores C, et al. 1998. Mutation in Hepatitis B DNA polymerase

associated with resistance to lamivudine do not confer resistance to adefovir in

vitro. Hepatology. 28: 1669-1673.

Xu XW, Chen YG. 2006. Current therapy with nucleoside/nucleotide analogs for

patients with chronic hepatitis B. Hepatobil Pancr Dis Int 5(3): 350-359.

Yan JH, Bifano M et al. 2006. Entecavir Pharmacokinetics, safety and

tolerability alter multiple ascending doses in healthy subjects. J. Clin.

Pharmacol. 46: 1250-1258.

Yeh CT, Chien RN et al. 2000. Clearence of the original hepatitis B virus

YMDD-motif mutants with emergence of distinct lamivudine-resistant mutations

during prolonged lamivudine therapy. Hepatol. 31: 1318-1326.

Yoon SJ, Kim JW et al. 1999. HBV polymerase processes for preparation and

use for screening antiviral agents thereof. US5.968-781.

Zhang X, Zoulim F et al. 1996. Analysis of hepatitis B virus genotypes and pre-

core region variability during interferon treatment of HBe antigen negative

chronic hepatitis B. J. Med. Virol. 48: 8-16.

Zhang JM, Wang XY et al. 2006. Fatal liver failure with the emergence of

hepatitis B surface antigen variants with multiple stop mutations after

discontinuation of lamivudine therapy. J. Med. Virol. 78: 324-328.

Zhou YZ, Slagle BL et al. 1988. Structural analysis of a hepatitis B virus

genome integrated into chromossome 17p of human hepatocellular carcinoma.

J Virol 62: 4224-4231.

Zhou XX, Littler E. 2006. Nucleoside Analogs as Anti-HBV Agents. Cur Top

Med Chem. 6: 851-865.

Zuckerman A. 1999. More than one third of world´s population has been

infected with hepatitis B virus. Br Med J 318: 1213A.

ANEXO

Correspondência das denominações dos pacientes estudados no segundo e

no terceiro manuscritos.

Segundo manuscrito Terceiro manuscrito

1 24 ufmt

2 01 ufmt

3 05 ufmt

5 29 ufmt

7 32 ufmt

12 23 ufmt

13 30 ufmt

15 26 ufmt

16 27 ufmt

19 42 ufmt

21 09 ufmt

23 39 ufmt

29 41 ufmt

31 13 ufmt

34 20 ufmt

Âmbito Hospitalar

Ano XIX • nº 181 • Nov.Dez/2006 • 5

HBV. Em relação ao HIV, o entecavir e o

adefovir possuem uma baixa probabili-

dade de induzirem resistência e podem

ser utilizados na mesma terapia combi-

nada. Outra opção de tratamento para

pacientes co-infectados com a função

imune preservada, é a terapia combina-

da para a hepatite B com tenofovir e la-

mivudina ou emtricitabina (Shire &

Sherman, 2005).

A terapia de escolha tem sido a lami-

vudina que é oralmente administrada. No

entanto as taxas de resistência à lamivu-

dina em monoterapia são de 50% após 2

anos de tratamento e de 90% após 4

anos, sugerindo que a lamivudina deve

ser utilizada agora em terapia combina-

da com análogos mais modernos (Benha-

mou et al. 1999). As taxas de resistência

ao tenofovir são baixas, no entanto mais

dados são necessários para saber quando

esse medicamento deve ser utilizado em

monoterapia para o tratamento da hepa-

tite B. Um estudo recente com dois gru-

pos de pacientes co-infectados HBV-HIV

(um com pacientes virgens de tratamen-

to para a lamivudina e o outro que já ha-

viam utilizado esse medicamento) reve-

lou que a terapia combinada de tenofo-

vir e lamivudina como parte do trata-

mento anti-retroviral foi superior na su-

pressão do DNA do HBV quando os mes-

mos medicamentos eram utilizados sozi-

nhos, não fazendo parte da terapia com-

binada. É recomendado testes de quanti-

ficação do DNA do HBV e do HIV em pa-

cientes co-infectados que estão em tra-

tamento antiviral a cada três meses. De-

ve-se suspeitar clinicamente de resistên-

cia do HBV se a carga viral do paciente

for superior a 1-log na base 10. A resis-

tência do HBV à todas as terapias podem

ser confirmadas através de genotipagem

e/ou seqüenciamento do gene da poli-

merase do HBV. Mutações relacionadas

ao IFN ainda não foram identificada

(Levy & Grant, 2006).

CONCLUSÃO

A co-infecção HBV-HIV é comum

mundialmente. Vários análogos de nu-

cleos(t)ídeos são utilizados como parte

da terapia anti-retroviral combinada. Os

anti-retrovirais devem ser selecionados

e monitorados para minimizar o risco de

desenvolvimento de resistência tanto

para o HBV quanto para o HIV. Dadas as

rápidas taxas de mutações na polimera-

se do HBV e a freqüência com que estas

ocorrem, o uso da terapia combinada é

mais benéfico para os pacientes.

REFERÊNCIAS BIBLIOGRÁFICAS

1. Benhamou Y, Bochet M, Thibault V, et al. 1999.

Long term incidence of hepatitis B virus resistance

to lamivudine in human immunodeficiency virus in-

fected patients. Hepatol 30:1302–6.

2. Benhamou J, Thibault V, Vig P, et al. 2006. Safety

and efficacy of adefovir dipivoxil in patients infec-

ted with lamivudine resistant hepatitis B and HIV-

1. J Hepatol 44:62–7.

3. Bodsworth NJ, Cooper D, Donovan B. 1991. The

influence of human immunodeficiency virus type 1

infection on the development of the hepatitis B vi-

rus carrier state. J Infect Dis 163:1138–40.

4. Brechot C, Gozuazik D, Murakami Y, Paterlini-Bre-

chot P. 2001. Molecular bases for the develop-

ment of hepatitis B virus (HBV)-related hepatocel-

lular carcinoma (HCC). Semin Cancer Biol.

10(3):211-31

5. Carman WF. 1997. The clinical significance of sur-

face antigen variants of hepatitis B virus. J Viral

Hepat. 4(1):11-20.

6. Di Martino V, Thevenot T, Colin JF, et al. 2004. In-

fluence of HIV infection on the response to interfe-

ron therapy and the long-term outcome of chronic

hepatitis B. Gastroenterol 123:1812–22.

7. Drake A, Mijch A, Sasadeusz J. 2004. Immune re-

constitution hepatitis in HIV and hepatitis B coin-

fection, despite lamivudine therapy as part of

HAART. Clin Infect Dis 39:129–32.

8. EASL International Consensus Conference on He-

patitis B. 13–14 September, 2002: Geneva, Swit-

zerland. Consensus statement (long version). J

Hepatol 39:S3–S25.

9. Gilson RJ, Hawkins AE, Beecham MR et al. 1997.

Interactions between HIV and hepatitis B virus in

homosexual men: effects on the natural history of

infection. AIDS 11:597–606.

10. Grob P, Jilg W et al. 2000. Serological pattern "an-

ti-HBc alone": report on a workshop. J Med Virol.

62(4):450-5.

11. Hofer M, Joller-Jemelka HI, Grob PJ, Luthy R,

Opravil M. 1998. Frequent chronic hepatitis B virus

infection in HIV-infected patients positive for anti-

body to hepatitis B core antigen only. Swiss HIV

Cohort Study. Eur J Clin Microbiol Infect Dis.

17(1):6-13.

12. Hoff J, Bani-Sadr F, Gassin M, Raffi F. 2001. Eva-

luation of chronic hepatitis B virus infection in coin-

fected patiens receiving lamivudine as a compo-

nent of anti–human immunodeficiency virus regi-

mens. Clin Infect Dis 32:963–9.

13. Levy V & Grant RM. 2006. Anti-retroviral Therapy

for Hepatitis B Virus– HIV–Coinfected Patients:

Promises and Pitfalls. Clin Infect Dis. 43(7):904-10

14. Liang YR, Cheng RX, Shen M, Guo YX, Su XS.

1990. A further study on capillary-like bile ductules

proliferation in chronic active hepatitis.Chin Med J

(Engl). 103(8):623-8.

15. Lok AS, McMahon B. 2001. Chronic hepatitis B.

Hepatol 34: 1225–41.

16. Lok A, McMahon B. 2004. Chronic hepatitis B: up-

date of recommendations. Hepatol 39:857–61.

17. McMahon B. 2006. Selecting appropriate manage-

ment strategies for chronic hepatitis B: who to tre-

at. Am J Gastroenterol 101:S7–12.

18. Mphahlele MJ, Lukhwareni A, Burnett MJ et al.

2006. High risk of occult hepatitis B virus infection

in HIV-positive patients from South Africa. J Clin

Virol 35(1): 14-20.

19. Neau D, Winnock M, Jouvencel A-C et al. 2005.

Occult hepatitis B virus infection in HIV-infected

patients with isolated antibodies to hepatitis B core

antigen: Acquitane cohort, 2002–2003. Clin Infect

Dis 40:750–3.

20. Nunez M, Puoti M, Camino N, Soriano V. 2003.

Treatment of chronic hepatitis B in human immu-

nodeficiency virus–infected patients: present and

future. Clin Infect Dis 37:1678–85.

21. Pogany K, Zaaijer HL, Prins JM, Wit FW, Lange

JMA, Beld MGHM. 2005. Occult hepatitis B virus

infection before and 1 year after start of HAART in

HIV type 1-positive patients. AIDS Res Hum Re-

troviruses 21:922–6.

22. Pol S, Lebray P, Vallet-Pichard A. 2004. HIV infec-

tion and hepatic enzyme abnormalities: intricacies

of the pathogenic mechanisms. Clin Infect Dis

38:S65–72.

23. Puoti M, Airoldi M, Bruno R, Zanini B, Spinetti A,

Pezzoli C, Patroni A, Castelli F, Sacchi P, Filice G

et al. 2002. Hepatitis B virus co-infection in human

immunodeficiency virus-infected subjects. AIDS

Rev. 4(1):27-35.

24. Ratziu V, Thibault V, Benhamou Y, Poynard T.

2006. Successful rescue therapy with tenofovir in

a patient with hepatic decompensation and adefo-

vir resistant HBV mutant. Comp Hepatol 5:1.

25. Realdi G, Fattovich G, Hadziyannis S, et al. 1994.

Survival and prognostic factors in 366 patients with

compensated cirrhosis type B: a multicenter study.

The Investigators of the European Concerted Acti-

on on Viral Hepatitis (EUROHEP). J Hepatol

21:656–66.

26. Santos EA, Sucupira MV, Arabe J, Gomes SA.

2004. Hepatitis B virus variants in an HIV-HBV co-

infected patient at different periods of anti-retroviral

treatment with and without lamivudine. BMC Infect.

Dis. 4:29.

27. Santos EA, Yoshida CF et al. 2003. Frequent oc-

cult hepatitis B virus infection in patients infected

with human immunodeficiency virus type 1.Eur J

Clin Microbiol Infect Dis. 22(2):92-8.

28. Shire NJ & Sherman KE. 2005. Management of

HBV/HIC Co-infected Patients. Seminar. Liver.

Dis. 25(1): 48-57

29. Soriano V, Puoti M, Bonacini M, et al. 2005. Care

of patients with chronic hepatitis B and HIV co-in-

fection: recommendations from an HIV/HBV inter-

national panel. AIDS 19:221–40.

30. Sucupira MV, Mello FCA, Santos EA, Niel C, Rol-

la VC, Arabe J, Gomes SA. 2006. Patterns of he-

patitis B virus infection in Brazilian human immu-

nodeficiency virus infected patients: high revalen-

ce of occult infection and low frequency of lamivu-

dine resistant mutations.

31. Thio C, Seaberg E, Skolasky R Jr et al. 2002. HIV-

1, hepatitis B virus, and risk of liver related morta-

lity in the Multicenter Cohort Study (MACS). Lan-

cet 360:1921–6.

INFECTOLOGIA

Endereço para correspondência:

[email protected]

Âmbito Hospitalar

Ano XIX • nº 181 • Nov.Dez/2006 • 4

Emtricitabina: muito similar à lami-

vudina. A dosagem efetiva em indiví-

duos com hepatite B, ou em indivíduos

co-infectados HBV-HIV, é de 200

mg/dia. A resistência à emticitabina,

apesar dos mutantes YMDD, parece ser

mais demorada do que resistência à la-

mivudina (Soriano et al. 2005).

Entecavir: é um análogo de nucleosí-

deo que causa uma rápida supressão do

DNA do HBV, mas não possui nenhuma

atividade contra o HIV. Em indivíduos

co-infectados, a dosagem de 1.0

mg/dia é recomendada para o início do

tratamento. A resistência ao entecavir é

resultado da acumulação de múltiplas

trocas na polimerase do HBV, incluindo

as relacionadas à lamivudina. O enteca-

vir é uma opção para o tratamento de

indivíduos co-infectados que requerem

o tratamento da hepatite B, mas que

não requerem tratamento anti-retroviral

combinado para o HIV. O entecavir po-

de ser útil no tratamento de indivíduos

co-infectados com mutações YMDD

(Levy & Grant, 2006).

Adefovir: é um nucleotídeo inibidor

da transcriptase reversa, com uma dosa-

gem de 10 mg/dia para o tratamento da

hepatite B. É ativo em pacientes que

possuem as mutações de resistência à

lamivudina, independente de serem

HBeAg negativos ou positivos. Não há

relatos de mutações nos códons da

transcriptase reversa do HIV (K65R e

K70E) após um ano de tratamento.

Quando adicionado à lamivudina para o

tratamento de indivíduos co-infecta-

dos, o DNA do HBV torna-se indetectá-

vel em 25% dos pacientes e em 45% dos

pacientes os níveis de DNA do HBV

caem para <1000 cópias/mL (Benhamou

et al. 2006).

Tenofovir: é um nucleotídeo inibidor

da transcriptase reversa com atividade

contra alguns mutantes de HIV e muta-

ções de resistência à lamivudina e ao

adefovir para o HBV. O tenofovir está li-

cenciado nos EUA e na Europa para o

tratamento da hepatite B. Pelo fato do

adefovir e do tenofovir possuírem uma

toxicidade renal e estruturas similares,

esses medicamentos não podem ser uti-

lizados em combinação.

O tenofovir possui uma atividade

comparável ao adefovir contra o HBV em

indivíduos co-infectados com HBV-HIV.

Pacientes que receberam tenofovir em

adição a lamivudina tiveram uma dimi-

nuição nos níveis de DNA do HBV e ob-

tiveram uma redução na resistência à la-

mivudina, quando comparados com pa-

cientes que apenas se trataram com la-

mivudina. Um outro estudo sugere que o

tenofovir possui atividade contra linha-

gens com mutações de resistência à la-

mivudina em pacientes co-infectados

que receberam terapia anti-retroviral

combinada. Nesse mesmo estudo, 30%

dos pacientes HBeAg positivos e 82%

dos pacientes HBeAg negativos ficaram

com níveis indetectáveis do DNA do HBV

durante a terapia combinada de tenofo-

vir e lamivudina (Ratziu et al. 2006).

TRATAMENTO DA HEPATITE B

NA CO-INFECÇÃO HIV-HBV

A decisão de tratar a hepatite B em

indivíduos co-infectados pelo HIV é ba-

seada na necessidade de combinação

da terapia anti-retroviral para o HIV, a

severidade da doença hepática, o tipo

de resposta ao tratamento e a poten-

ciais eventos adversos (Lok & McMa-

hon, 2004). Indivíduos co-infectados e

com replicação ativa do HBV (indiví-

duos positivos para o HBsAg e para o

DNA do HBV) e altos níveis de ALT (~

12 vezes acima do normal) devem ser

indicadas para o tratamento. No con-

texto da infecção pelo HIV, a hepatite

B progride mais rapidamente para a cir-

rose, com uma resposta menor ao tra-

tamento (Nunez et al. 2003). O trata-

mento da infecção pelo HIV é priorida-

de nos casos de co-infecção. Os benefí-

cios do tratamento da hepatite B são

os mesmos tanto para a mono quanto

para a co-infecção, tais como: normali-

zação dos níveis de ALT e supressão ou

diminuição dos níveis do DNA do HBV.

Inicialmente, todos os indivíduos com

infecção crônica pelo HBV devem ter os

dados sorológicos do HbeAg/Anti-HBe

e os níveis de DNA do HBV medidos pa-

ra a classificação do estágio da infec-

ção (McMahon, 2006). O nível da carga

viral reflete a replicação viral e é im-

portante para o diagnóstico, prognósti-

co e monitoramento do tratamento. A

erradicação do HBV não é tão simples

pois as terapias disponíveis não elimi-

nam a forma replicativa do genoma vi-

ral no fígado (cccDNA). Em indivíduos

positivos para o HBeAg (monoinfecta-

dos), a soroconversão para o anti-HBe

é duradoura e está relacionada a uma

resposta viral sustentada após o final

do tratamento. Uma biópsia hepática

deve ser realizada antes do início da

terapia anti-retroviral combinada, prin-

cipalmente em pacientes co-infectados

pois o avanço para fibrose hepática é

mais comum em pacientes com esse

perfil (Drake et al. 2004).

Os benefícios do tratamento do HBV

em indivíduos co-infectados HBV-HIV

não incluem a supressão do DNA do

HBV, mas visam a prevenção de muta-

ções em ambas transcriptases reversas,

mutações estas que são associadas à re-

sistência medicamentosa. Para os pa-

cientes co-infectados que ainda não ne-

cessitam de terapia anti-retroviral com-

binada, mas que necessitam de trata-

mento para a hepatite B, os medica-

mentos mais indicados são o interferon

(IFN) peguilado e a lamivudina, mas pa-

ra o caso resistência a esses medica-

mentos, duas terapias são indicadas:

entecavir e adefovir.

O tratamento com IFN não tem mui-

ta relação à resistência medicamentosa,

mas é somente indicado para um peque-

no grupo com o seguinte perfil: altos

níveis de CD4+, indivíduos HBeAg posi-

tivos, níveis elevados de ALT e baixos

níveis de DNA do HBV. O entecavir e a

lamivudina compartilham algumas mu-

tações de resistência na polimerase do

INFECTOLOGIA

Âmbito Hospitalar

Ano XIX • nº 181 • Nov.Dez/2006 • 3

DROGAS DISPONÍVEIS PARA

O TRATAMENTO DA HEPATITE B

Apesar do HBV ser composto por uma

dupla fita de DNA, sua replicação se dá

através de um intermediário de RNA, o

que requer uma polimerase/transcriptase

reversa. Para minimizar a seleção de mu-

tações de resistência aos medicamentos,

os mesmos têm de ser cuidadosamente

administrados e acompanhados pelo mé-

dico. Cinco drogas foram aprovadas para

o tratamento da hepatite B pelo FDA

(Food and Drug Administration-USA):

IFN-a-2b (em 1992), lamivudina (em

1998), adefovir dipivoxil (em 2002), en-

tecavir (em março de 2005) e IFN-a-2a

peguilado (em maio de 2005). A lamivu-

dina tem sido até o presente a droga

mais utilizada. Devido ao surgimento de

mutações no motivo YMDD da polimera-

se viral, que se acumulam com o tempo

de tratamento com a lamivudina, outras

drogas têm sido desenvolvidas. Estas no-

vas drogas como adefovir e tenofovir e

geralmente associadas à lamivudina, es-

tão sendo utilizadas também na terapia

de resgate dos mutantes de lamivudina.

Apesar do tenofovir e da emtricita-

bina não terem sido licenciados pelo

FDA para o tratamento da hepatite B

crônica, ambas terapias possuem uma

alta atividade contra o HBV (tabela 1).

Interferon: disponível na forma pe-

guilado (o que permite uma única dosa-

gem por semana), possui um efeito

maior em pacientes positivos para o

HBeAg com altos níveis de ALT e baixos

níveis de DNA do HBV. Seu uso é limita-

do por conta dos seus efeitos colaterais

e pelo fato de ser contra indicado para

pacientes com cirrose. A elevação das

enzimas hepáticas é maior em pacientes

co-infectados com HIV do que em pa-

cientes monoinfecados pelo HBV. Alguns

estudos utilizando IFN em pacientes co-

infectados HBV-HIV foram conduzidos e

a resposta desses pacientes ao tratamen-

to, quando comparados com o grupo de

monoinfectados pelo HBV, pode ter sido

mediada pela imunosupressão do HIV. O

mesmo estudo observou que indivíduos

co-infectados, com baixos níveis de

CD4+, respondem menos ao IFN e há um

aumento na taxa de reativação da infec-

ção pelo HBV. Já em indivíduos com al-

tos níveis de CD4+, ATL e baixos níveis

de DNA do HBV, o IFN pode ser candida-

to a iniciar o tratamento já que ele pode

evitar uma toxicidade anti-retroviral as-

sim como a resistência aos análogos de

núcleos(t)ídeo (Di Martino et al. 2002).

Lamivudina: é um análogo de nucleo-

sídeo que inibe ambas transcriptases re-

versas (HBV e HIV). Apesar da dose apro-

vada ter sido de 100 mg/dia para indiví-

duos infectados pelo HBV, ela pode ser

administrada numa dose de 150 mg duas

vezes ao dia ou em uma dose de 300

mg/dia como parte do tratamento de in-

divíduos co-infectados HBV-HIV para

prevenir o surgimento de mutações de

resistência ao HIV (Levy & Grant, 2006).

A soroconversão para anti-HBe ocorre

entre 22%-29% dos pacientes co-infecta-

dos que foram tratados com lamivudina,

enquanto os níveis de DNA do HBV se tor-

nam indetectáveis em 40%-87% em indi-

víduos do mesmo grupo. Em ambos os ví-

rus (HBV e HIV), a monoterapia seleciona

linhagens com mutações de resistência

no motivo YMDD no gene da polimerase.

A continuação do tratamento após a

emergência das mutações ainda pode ser

benéfica, entretanto podem haver danos

histopatológicos (Hoff et al. 2001).

INFECTOLOGIA

TABELA 1. Resumo das drogas utilizadas em terapias antivirais

Droga

Taxa de Resposta Atividade

Resistência

Mutações de Aprovadas

ao HBV Contra o HIV Resistência pelo FDA

Referência

Em co-infecção HVB-HIV: 15%

Interferon - α de soroconversão para anti-HBe e Não Não Não aplicável Sim 31

7% com DNA do HBV indetectável

DNA do HBV indetectável no YMDD, V173L,

Lamivudina primeiro ano de tratamento e Sim Sim L180M e Sim 32, 33

soroconversão para anti-HBe M204I/V

Diminuição da carga viral em 3,4

Emtricitabina log10 e manutenção após Sim Sim M204I/V Não 9, 34

48 semanas de tratamento

Em pacientes co-infectados com V173L, L180M,

Entecavir mutação YMDD diminui a carga viral Não Sim A184G, S202I, Sim 35

do HBV em 3,66 log10 M204I/V, M250V

Adefovir

Perda do HBeAg em 3% dos pacientes

Pouca Sim A181V, N236T Sim 36

e diminuição do DNA do HBV

Tenofovir — Sim Sim A194T Não 37

* numeração dos aminoácidos de acordo com o início da região conservada da transcripitase reversa do domínio da polimerase viral

Âmbito Hospitalar

Ano XIX • nº 181 • Nov.Dez/2006 • 2

pessoas co-infectadas possuem taxas

mais elevadas de morbidade relaciona-

das ao hepatocarcinoma que indivíduos

monoinfectados.

Em um estudo multicêntrico de

coorte, foram analisados 5.293 homens

co-infectados pelo HBV-HIV e foi obser-

vado que eles eram 19 vezes mais sus-

ceptíveis a morrerem de uma doença do

fígado do que os monoinfectados pelo

HBV e 18 vezes mais susceptíveis do

que infectados somente pelo HIV. Em

homens co-infectados, a taxa de morta-

lidade atribuída a doenças hepáticas foi

maior para indivíduos com níveis de cé-

lulas CD4+ <100 cells/mm

e para aque-

les que consomem álcool (Thio et al.

2002). O consumo de álcool (proporcio-

nal à quantidade e a duração do consu-

mo) juntamente com a infecção pelo

HBV produzem um efeito aditivo em ter-

mos de progressão à hepatite fulminan-

te, doença hepática crônica e carcino-

ma hepatocelular (Soriano et al. 2005).

O aumento do risco da toxicidade alcoó-

lica em indivíduos co-infectados pode

ser o resultado de uma esteatose hepá-

tica associada ao consumo de álcool

e/ou tratamento com anti-retrovital

que possua uma toxicidade mitocon-

drial. A influência desses co-fatores po-

de ser reduzidas pela ausência do con-

sumo de álcool e por terapias menos tó-

xicas (Pol et al. 2004). Outros fatores

associados à progressão da doença he-

pática são idade avançada, elevados ní-

veis de ALT e DNA do HBV (Realdi et al.

1994). Durante o estágio inicial de in-

fecção crônica pelo HBV, os níveis séri-

cos de DNA do HBV são altos e o HBe-

Ag está presente. Na maioria dos pa-

cientes que sofrem soroconversão para

anti-HBe, o nível de DNA do HBV dimi-

nui <10

cópias/mL, os níveis de ALT

normalizam e a inflamação hepática di-

minui. A maioria dos pacientes que so-

frem soroconversão para o anti-HBe são

negativos para o HBeAg, positivos para

o HBsAg e possuem níveis indetectáveis

de DNA do HBV (EASL; 2003). Isso por-

que a co-infecção com o HIV reduz a

freqüência de soroconversão espontâ-

nea tanto do HBeAg quanto do HBsAg,

e a prevalência de indivíduos HBeAg

negativos com hepatite B crônica é me-

nor em pacientes co-infectados HBV-

HIV (Soriano et al. 2005).

Em um estudo realizado pela nossa

equipe entre os anos de 1998-2000

(Santos et al. 2004), com 170 pacientes

infectados pelo HIV-1 da cidade do Rio

de Janeiro, observou-se altas prevalên-

cias de anticorpos anti-HBc (67%) e do

HBsAg (8%) neste grupo de pacientes.

A comparação com um grupo de pacien-

tes HIV positivos estudados entre 2000

e 2001, com os pacientes positivos pa-

ra o anti-HBc deste trabalho inicial,

mostrou que a proporção de pacientes

positivos para o HBsAg é significativa-

mente maior no estudo mais recente

(27% vs. 12%, p < 0.05). Se isto cons-

titui uma tendência, deve ser confirma-

do em estudos futuros. No trabalho

mais recente, a proporção de mulheres

co-infectadas aumentou de 10% para

27%, refletindo o espalhamento da in-

fecção entre as mulheres. Outra modifi-

cação importante foi a porcentagem de

inclusão da lamivudina na terapia anti-

viral (70% vs. 34%) (Sucupira et al.

2006, no prelo).

INFECÇÃO OCULTA PELO HBV

A infecção oculta para o HBV é defi-

nida pela presença do DNA do HBV no

soro dos pacientes sem a detecção do

HBsAg. A prevalência de infecção ocul-

ta pelo HBV em pacientes infectados

pelo HIV-1 varia em diferentes localida-

des mundiais de <1% a 89.5% (Neau et

al. 2005). Em estudos recentes realiza-

dos no Brasil com doadores de sangue

negativos para o HBsAg e morando no

Sul do Brasil (região de baixa prevalên-

cia para a infecção pelo HBV), uma ta-

xa baixa de infecção oculta (3.3%) en-

tre os paciente positivos para o anti-

HBc foi observada. No entanto, a hepa-

tite oculta tem sido detectada cada vez

em proporções maiores nos pacientes

positivos para o HIV em diferentes par-

tes do mundo (Hofer et al. 1998; Grob

et al. 2000). Recentemente observamos

uma proporção de 19% do DNA do HBV

entre pacientes negativos para o

HBsAg, positivos para o anti-HBc e in-

fectados pelo HIV (Sucupira et al. 2006,

no prelo). Esta proporção é semelhante

a encontrada previamente no Brasil

(20%; Santos et al. 2003), e África do

Sul (22%; Mphahlele et al. 2006).

Várias explicações para a presença

do DNA do HBV em indivíduos negati-

vos para o HBsAg foram propostas, co-

mo por exemplo a de que o DNA do

HBV estaria a níveis muito baixos (Bre-

chot et al. 2001), variações genéticas

no gene S (Carman, 1997) e a presen-

ça de complexos imunes nos quais o

HBsAg poderia se esconder (Liang et

al. 1990). A infecção oculta pelo HBV

também pode estar relacionada ao pe-

ríodo de janela imunológica da infec-

ção aguda pelo HBV, pelos limites de

detecção do HBsAg quando o nível de

antigenia do HBs é baixo, por uma co-

infecção com o vírus da hepatite C

(HCV) ou por um período de imunossu-

pressão, dentre outros (Grob et al.

2000). Recentemente foi sugerido que

a infecção pelo HIV pode ser um fator

de risco para casos de hepatite B ocul-

ta (Mphahlele et al. 2006).

A relevância clínica da infecção

oculta pelo HBV em pacientes infecta-

dos pelo HIV continua incerta. Um estu-

do recente, não relacionou um risco

maior de elevação das enzimas na infec-

ção oculta pelo HBV em co-infecção

com o HIV após o início da terapia an-

ti-retroviral combinada (Pogany et al.

2005). Um grupo de pacientes com he-

patite B crônica com detecção do DNA

do HBV e níveis indetectáveis de HBeAg

foi estudado. Esses pacientes tendem a

ter uma inflamação hepática mais seve-

ra tendendo à cirrose. Os resultados dis-

cordantes do estudo (DNA do HBV posi-

tivo e HBeAg negativo) são devido aos

mutantes pré-core ou core do HBV que

são incapazes de produzir HBeAg (Lok &

McMahon, 2001).

INFECTOLOGIA

Âmbito Hospitalar

Ano XIX • nº 181 • Nov.Dez/2006 • 1

INFECTOLOGIA

O vírus da hepatite B (HBV) e o ví-

rus da imunodeficiência humana adqui-

rida (HIV) compartilham as mesmas ro-

tas de transmissão e, portanto a co-in-

fecção é um evento comum que ocorre

em taxas elevadas nas localidades mun-

diais aonde a co-circulação destes dois

vírus é elevada (figura1). Devido ao mo-

do de transmissão compartilhado, a

prevalência do HBV é maior entre os pa-

cientes infectados pelo HIV do que en-

tre pacientes não infectados pelo HIV

(Hofer et al. 1998; Puoti et al. 2002). A

infecção pelo HIV modifica o curso da

infecção pelo HBV (mas o inverso não

ocorre, ou seja o HBV não modifica a

história natural do HIV), aumentando

sua cronicidade, prolongando o tempo

de viremia e aumentando a morbidade

relacionada ao hepatocarcinoma.

EPIDEMIOLOGIA E

HISTÓRIA NATURAL DO HBV

NA CO-INFECÇÃO HBV-HIV

Ambas infecções, tanto pelo HBV

quanto pelo HIV, são doenças sexual-

mente transmissíveis. Nos Estados Uni-

dos e Europa, mais de 50% dos indiví-

duos infectados pelo HIV são homens

homossexuais. Entre estes, de 7% a

10% possuem infecção crônica pelo

HBV (definido pela presença do antíge-

no de superfície do HBV, HBsAg, no so-

ro por pelo menos 6 meses) (Levy &

Grant, 2006).

Ambas as infecções podem ser mais

problemáticas em regiões com prevalên-

cia alta ou intermediária para o HBV (fi-

gura 1) aonde haja co-circulação do

HIV. Esse é o caso da África, onde en-

contramos uma prevalência que varia de

5% a 39% de infecção pelo HIV em

adultos e a taxa de prevalência para o

HBsAg é maior que 8%.

Adultos infectados pelo HIV que de-

senvolvem hepatite B aguda são menos

propensos a eliminar o HBV quando com-

parados com adultos não infectados pe-

lo HIV (23% dos adultos co-infectados

HBV-HIV desenvolvem hepatite B crôni-

ca, comparado com 4% dos monoinfec-

tados HBV) (Bodsworth et al. 1991).

Há uma diminuição do “clearance”

do HBV em pacientes infectados pelo

HIV com baixos níveis de células CD4+,

quando comparados com pacientes com

altos níveis de células CD4+, no mo-

mento da infecção pelo HBV. Pacientes

co-infectados e sem tratamento pos-

suem altos níveis de DNA do HBV e uma

longa duração da viremia, mas possuem

baixos valores de transaminases, quan-

do comparados com pacientes monoin-

fectados pelo HBV.

O prolongado período de replicação

do HBV pode aumentar a transmissão

vertical e horizontal do HBV em áreas

com uma alta prevalência para a co-in-

fecção (Gilson et al. 1997). Apesar da

sua aparente fase de imunotolerância,

DADOS RELEVANTES DA

CO-INFECÇÃO DO VÍRUS DA

HEPATITE B (HBV) E DO VÍRUS

DA IMUNODEFICIÊNCIA

HUMANA ADQUIRIDA (HIV)

Marcelle Bottecchia

, Selma A. Gomes

Figura 1 - Distribuição geográfica da

infecção pelo HBV (em cima) e pelo

HIV (abaixo). (Levy & Grant, 2006).

1 – Doutoranda em Biologia Celular e Molecular no Instituto Oswaldo Cruz – Fiocruz/RJ

2 – Pesquisadora Titular do Instituto Oswaldo Cruz – Fiocruz/RJ. Pós-Doutorado na França

- 1 -

Lamivudine resistance and other mutations in the

polymerase and surface antigen genes of hepatitis

B virus associated with a fatal hepatic failure case

Marcelle Bottecchia,* Nilo Ikuta,† Christian Niel,* Natalia M. Araujo,*

Kycia M. R. Ó,

*,‡

and Selma A. Gomes*

*Departamento de Virologia, Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro,

RJ, Brazil,

†

Laboratório de Diagnóstico Molecular, Universidade Luterana do

Brasil, Canoas, RS, Brazil, and

‡

Fundação Municipal de Sáude de Petrópolis,

Petrópolis, RJ, Brazil

Short title: HBV lamivudine resistance mutations

Correspondence

Dr Selma A. Gomes, Departamento de Virologia, Instituto Oswaldo Cruz,

FIOCRUZ, Av. Brasil 4365, 21045-900 Rio de Janeiro, RJ, Brazil.

Email: selma@ioc.fiocruz.br

The sequences reported in this paper have been deposited

into GenBank under

the following accession numbers: EF034149 to EF034151.

- 2 -

Abstract

Background and Aim: Resistance to lamivudine therapy of chronic hepatitis B

virus (HBV) infection occurs by mutation in the YMDD motif of the reverse

transcriptase (rt) domain (rtM204V/I) of the virus polymerase and is usually

accompanied by rtL180M mutation. Here we investigated virological factors

associated with hepatic failure in a 58-year old male, chronically HBV infected

patient who died after 33 months of lamivudine therapy.

Methods: Nucleotide sequencing was performed from one sample collected

before and two samples collected during lamivudine therapy.

Results: A peak of ALT/AST levels occurred after 19 months of lamivudine

treatment, associated with the rtM204I mutation. After 32 months, the rtM204V

mutation was predominant, accompanied by the lamivudine resistant rtL180M

mutation. Furthermore, two rare polymerase (rtS117Y and rtV142A) and three

HBsAg (L109I, F134L and I208T) substitutions were observed. At that time, the

patient was hospitalized with hepatic decompensation, followed by hepatic failure,

and died one month later. HBV DNA was detected at any time at moderate levels

(8.3 x 10

to 2.6 x 10

copies/ml).

Conclusion: The results suggest that substitutions in polymerase (rtS117Y,

rtV142A) and surface antigen (L109I, F134L and I208T), associated with

lamivudine resistant mutations at positions 180 and 204, were involved in this case

of fatal hepatitis B.

Key words

hepatitis B virus, lamivudine, mutations, polymerase, surface antigen

- 3 -

Introduction

Hepatitis B virus (HBV) is an etiologic agent of acute and chronic hepatitis, with an

estimated 350 million chronic carriers around the world. Eight genotypes (A-H)

have been described, based on full-length genomic divergence of more than 8%

between them. HBV genotypes have a distinct geographical distribution (for review

see

). Genotype A has been divided into two subgenotypes; one of them, from

African origin, was originally designated A’

and renamed A1

or Aa

. In this latter

nomenclature, the other subgenotype, from European origin, has been designated

Ae.

Lamivudine is an oral nucleoside analogue inhibiting the reverse transcriptase

(rt) activity of HBV and commonly used in the treatment of chronic HBV infections.

A period of one year of therapy in HBeAg positive patients has been associated

with HBeAg loss in 17–33% of patients and HBeAg seroconversion rates of 16–

18%.

HBeAg seroconversion is the result of a profound suppression of viral

replication, since it has only been found in patients with a reduction in HBV DNA to

<10

copies/mL.

5-7

The major limitation in the use of lamivudine is the selection of

resistant mutations that may arise and accumulate during therapy. These

mutations usually affect the YMDD motif located in the C domain of the HBV rt, by

replacement of a methionine residue at position 204 to either valine (rtM204V) or

isoleucine (rtM204I).

8-10

In addition, a second lamivudine resistance mutation

(rtL180M), located in the B domain of rt, was identified.

6,11

The proportion of

patients in whom YMDD variants are detectable increases with time on lamivudine

therapy, rising from around 15–25% after one year of treatment to 70% by four

- 4 -

years.

5,12

Hepatitis B acute exacerbation may occur after the appearance of YMDD

mutants,

accompanied by a rapid increase of viral load and serum

aminotransferase levels.

Because severe hepatitis may occur, patients should be

carefully followed once the YMDD mutant emerges.

Although viral clearance with

or without emergence of distinct lamivudine resistant mutants may occur after

hepatitis B exacerbations, 20% of these are complicated with decompensation or

even fatality. Such exacerbations appear to be more severe than those occuring

during the natural course of wild type HBV chronic infection.

At present,

management of patients with lamivudine mutations rests on addition or

replacement with other antiviral agents as adefovir dipivoxil or entecavir, which

may effectively suppress the YMDD mutants.

9,15,16

Whether the type of lamivudine resistant mutation (YIDD or YVDD) may

influence the clinical outcome of chronic hepatitis B has been poorly investigated.

The frequency, relationships with genotypes, and clinical significance of the two

distinct substitutions have been studied in Asian populations, where genotypes B

and C co-circulate. In a study conducted with 142 Chinese patients treated with

lamivudine for 2-4 years, no significant difference in the YMDD mutation rate

(about 55%) was observed between patients infected with HBV genotypes B and

C. However, there was a significant difference in the type of mutation between

these two genotypes: YVDD was more frequent in genotype B, whereas YIDD was

more common in genotype C.

In another study with 60 Japonese patients

infected with genotype C isolates and receiving long term lamivudine therapy,

YIDD was more common than YVDD. Patients infected with both YIDD and YVDD

quasispecies or with YIDD alone had a worse prognostic than those showing only

- 5 -

the YVDD motif.

Some other studies have described the dynamics of HBV

quasispecies resistant to lamivudine.

6,14,19-21

It has been observed recently that the

in vivo replicative advantage conferred by rtM204V and rtM204I substitutions

varied substantially from one patient to another and from one time point to another

in a given patient. Thus, the in vivo replication of HBV variants appears to be

driven by multiple forces including immune response of the host.

The aim of the present study was to investigate mutations associated with

lamivudine resistance in a chronically HBV infected patient, who died of hepatic

failure after 33 months of lamivudine therapy.

- 6 -

Methods

Patient characteristics and serological markers

A 58 year-old male patient was hospitalized in January 2000 for a few days in a

public hospital in Petropolis, Brazil, due to a severe anemia. At the time of

hospitalization, the patient had clinical signs of hepatic insufficiency. Serological

tests showed that the patient was positive for HBsAg, anti-HBc, and HBeAg, and

negative for anti-HBs, anti-HBe, anti-HCV and anti-HIV. After this period of

hospitalization, the patient was accompanied as an outpatient by the medical staff

of the hospital. Lamivudine treatment started in August 2001. In March 2004, the

patient was hospitalized again and died of hepatic failure in April 2004 .

From January 2000 to April 2004, more than 20 blood samples were collected

for biochemical and hematological tests. Three of them, collected in September

2000, November 2003, and April 2004 (a few days before the death of the patient)

were available for HBV DNA analysis.

DNA extraction, PCR amplification and nucleotide sequencing

Viral DNA was extracted from serum by using the phenol-chloroform method after

treatment with proteinase K, as described previously.

HBV pre-S/S genomic

region was amplified by PCR using sense primer PS1 (5'-CCATATTCTTGGGAA

CAAGA-3', nt 2826-2845) and a mix of antisense primers S2 (5’-GGGTTTAAATG

- 7 -

TATACCCAAAGA-3’, nt 841-819) and S22 (5'- GTATTTAAATGGATACCCACAG

A-3’, nt 841-819), able to amplify all HBV genotypes. PCR assays were performed

under the following conditions: 94

C, 30 s; 52

C, 1 min; 72

C, 2 min; 35 cycles,

followed by a final elongation of 7 min at 72

C. Amplification products (50 µL) were

loaded on a 2% agarose gel, electrophoresed, stained with ethidium bromide, and

visualized under UV light. DNA bands were extracted from the agarose gels, and

nucleotide sequences were determined using BigDye Terminator kit (Applied

Biosystems, Foster City, CA) with the same primers used for PCR amplification as

well as specific internal HBV primers. Sequencing reactions were analyzed on an

ABI373 automated sequencer (Applied Biosystems). The sequences reported in

this paper have been deposited

into GenBank under the following accession

numbers: EF034149 to EF034151.

Phylogenetic analysis

Nucleotide sequences were aligned using PILEUP, a program belonging to the

University of Wisconsin Sequence Analysis Genetic Computer Group (GCG)

package (Madison, WI). A phylogenetic tree was generated by neighbour-joining

analysis of genetic distances, using the Mega software package.

- 8 -

Quantification of HBV DNA

HBV DNA was quantified by real time PCR (TaqMan technology), using a panel of

reference sera containing given numbers of HBV DNA molecules, in the conditions

described previously,

with some modifications. Amplification assays were

performed in a final volume of 25 Tl of TaqMan universal MasterMix (Applied

Biosystems), containing 2 Tl of extracted DNA, 1 TM of sense (5’-GGACCCCTGC

TCGTGTTACA-3’, nt position 184 to 203) and antisense (5’-AGAGAAGTCCACC

MCGAGTCTAGA-3’, nt position 273 to 249) primers designed in the S region, and

0.3 TM of probe (5’-FAM-TGTTGACAARAATCCTCACAATACCRCAGA-TAMRA-

3´, nt position 218-247). After initial incubation steps of 2 min at 50°C and 10 min

at 95 °C, PCR assays consisted of 50 step cycles of 15 s at 95 °C and 60 s at 60

°C. Reactions were performed in a 7700 sequence detection system (Applied

Biosystems). The detection limit of the assay was 10 copies/reaction,

corresponding to about 100 copies/ml of serum.

- 9 -

Results

Markers of HBV infection

Chronic hepatitis B infection was diagnosticated in a 58 year-old man in January

2000, when he was hospitalized due to a severe anemia associated with

symptoms of liver disease. All the blood samples collected between 2000 and

2004, when the patient died, were positive for HBsAg, HBeAg and anti-HBc.

Clinical evolution of the patient between January 2000 to April 2001 was

compatible with a chronic hepatopathy, associated with splenomegaly, leucopenia,

and thrombocytopenia. Before lamivudine treatment, which started in August

2001, aspartate aminotransferase (AST) and alanine aminotransferase (ALT)

levels varied from 68 to 108 IU/mL and from 44 to 112 IU/mL, respectively.

AST/ALT ratio varied from 1 to 1.5. Platelet counts varied from 49,000/mm

76,000/mm

. AST/ALT ratio > 1 and platelet counts < 150,000/mm

are features

that have been associated with severe fibrosis or cirrhosis (stages 3 and 4).

25,26

Two weeks after starting lamivudine treatment, AST and ALT lowered to normal

levels (Fig. 1), while platelet counts increased from 57,000/mm

to a maximum

value of 112,000/mm

(not shown). The patient felt well during several months.

However, at the beginning of 2003, AST and ALT levels raised to maximum values

of 299 IU/mL and 244 IU/mL, respectively. In the following months, despite a

decrease of AST and ALT levels to 87-128 IU/mL and 48-77 IU/mL, respectively

(Fig. 1), the clinical state of the patient worsened and he was hospitalized in March

2004 with hepatic decompensation, ascite, and symptoms of encephalopathy

- 10 -

(prostration). One month later, the patient died of embolia with lost of hepatic and

renal functions.

HBV mutations and viral load

Nucleotide sequences of PCR products (pre-S/S region) of HBVs derived from

samples collected in September 2000, November 2003 and April 2004, were

determined. Phylogenetic analysis showed that the viral isolate belonged to

genotype A, subgenotype Aa. As can be seen on the phylogenetic tree (Fig. 2),

the sequences derived from the patient were separated in two branches. The

nucleotide sequences derived from the samples collected in 2000 and 2003

(before and during lamivudine therapy, respectively) were located in a branch,

whereas the HBV sequence of the sample collected few days before the patient

died (April 2004), was supported by another branch. This reflected an

accumulation of mutations during the six last months of life of the patient.

Table 1 shows the main amino acid changes observed in the surface antigen

and the rt domain of the viral polymerase. Three substitutions (small S protein

A159V, S193L and S204N, underlined in Table 1) were observed in all three

samples. They corresponded to molecular signature motifs, characteristics of the

HBV population infecting the patient, and were synonymous for the DNA

polymerase. The sequences derived from the samples collected in 2003 and 2004,

during lamivudine treatment, showed two and five additional mutations,

respectively. The 2003 sequence displayed (i) a (C to G) substitution at nt 481 that

affected both the S protein (L109V) and the rt domain of the polymerase

- 11 -

(rtS117C), and (ii) a (G to C) change at nt 743, leading to the appearance of the

lamivudine resistance YIDD motif. In 2004, this motif was replaced by the YVDD

motif, due to a (A to G) substitution at nucleotide 741 (which also causes a

substitution Ile to Met at position 195 of the small S protein). This change was

accompanied by the other well-known lamivudine resistant mutation rtL180M. In

addition, three rare substitutions (at nt 481, 555 and 779) were detected in 2004,

affecting the S protein (L109I, F134L and I208T). The two first (nt 481 and 555)

originated changes within the major hydrophilic region of HBsAg, and were also

non synonymous for the polymerase, causing the rtS117Y and rtV142A amino

acid substitutions, respectively (Table 1).

Variations of HBV load through time are shown in Fig. 1. In 2000, the title was

2.6 x 10

copies/mL. The two samples collected during lamivudine administration

showed lower titles. However, viral load (2 x 10

copies/mL) of the last sample

(2004) was slightly higher than that (8.3 x 10

copies/mL) of the sample collected

in 2003.

- 12 -

Discussion

Lamivudine resistance is usually due to aminoacid substitutions in the YMDD motif

of the rt domain of the HBV polymerase. The resistance occurs by replacement of

a methionine residue at position rt204 by either valine (rtM204V) or isoleucine

(rtM204I), accompanied or not by substitutions at position rt180

and rt173.

10,28

The presence of the rtL180M mutation has been associated with prolonged

lamivudine treatment.

There is a general consensus that single mutants in the

YMDD motif (rtM204V/I) replicate substantially more slowly in vitro than the wild

type. The addition of the mutation at position rt180 may thus act as a

compensatory change which partially restores the replication fitness of the virus.

Here, in agreement with this observation, the double mutated (rtL180M/rtM204I)

virus became the dominant species over time, and showed slightly higher titles

than the YIDD single variant does.

Few studies have reported the infection of a single individual with both rtM204I

and rtM204V lamivudine resistant mutants. In a detailed study of the dynamics of

HBV resistance to lamivudine conducted with four patients, it was suggested to be

impossible to predict which variant will overcome the other.

The in vivo

replication of HBV variants would be driven by multiple forces, including the

fluctuating environment in which these variants replicate during lamivudine

administration, potentially favoring one variant population over another in a given

patient, regardless of their intrinsic replication capacity.

Other studies, however,

have suggested that the genotype of the virus may influence the dominance of one

variant (YIDD or YVDD) over the other. In Asian populations, where genotypes B

- 13 -

and C co-circulate, large surveys have demonstrated that the variant YIDD was

the predominant one after lamivudine resistance emerged.

17,30

In Brazil, where

subgenotype Aa represents more than 50% of the isolates,

YVDD mutant has

been observed more frequently (unpublished results). In this study, where the HBV

isolate was from subgenotype Aa, the mutation rtM204V became predominant, by

substitution of rtM204I, and was associated with the other common lamivudine

resistance mutation rtL180M. In the sample collected in 2004, a few days before

the death of the patient, three additional, rare mutations were observed, two of

them (at nt positions 481 and 555) being non synonymous for both surface antigen

and polymerase. Three studies have recently described mutations associated with

lamivudine resistance in fatal hepatic failure cases. In the first one, mutations

rtA222T and rtL336V, associated with surface antigen I195M and M213I

mutations, were reported in addition to the double rtL180M, rtM204V mutation.

the second one, a mutation reported as L426I, corresponding to rtL80I in the

current terminology, was observed in combination with rtM204I after 10 months of

lamivudine treatment, three months before the patient died.

In the third study,

that described a fatal liver failure case, the patient was treated with lamivudine for

four months, and ceased the treatment without consulting. After restarting

lamivudine, the patient became HBsAg negative and developed anti-HBs

antibodies. However, HBV DNA reappeared. Nucleotide sequencing revealed the

presence of the classical G145R escape mutant as well as several stop codons

within the HBsAg coding region.

These studies, together with the data presented

here, indicate that a correlation may exist between fatal liver failure and

occurrence of mutations other than those occurring at positions 204 and 180 of the

- 14 -

HBV polymerase. However, as a distinct pattern of mutations was observed in

each report, no general conclusions can be drawn at this time.

DNA data banks were screened for mutations at nt 481, 555 and 779, present

in the sample collected in 2004. Mutations at nt 481 and 555 are located in the

antigenic determinant a. The first one, leading to L109I (small S protein) and

rtS117Y amino acid substitutions (Table 1), was found in only four sequences

(GenBank accession numbers AB221841, S50225, AY653783 and DQ080020),

two of them derived from HBsAg negative patients. Mutation at nt 555 was found

in five sequences (AF415217, AY859896, AB116076, AM073929, AM073767),

one of them from a HBsAg negative patient. Although the patient examined in this

study remained HBsAg positive, it cannot be excluded that mutations at nt 481 and

555 are associated with the HBsAg negative phenotype, since a mixture of HBV

populations are likely to coexist. In vitro studies would be necessary to elucidate

this point.

In conclusion, an HBV isolate from subgenotype Aa, showing two rare

mutations in the rt domain of the polymerase together with the well-known

(rtL180M, rtM204V) lamivudine resistance mutations, appeared as the

predominant quasispecies in a patient who died of hepatic failure after 33 months

of lamivudine treatment. Monitoring the accumulation of mutations within the

genome of drug resistant HBV mutants during antiviral therapy appears to be

necessary in the clinical management of patients with chronic hepatitis B.

Understanding the circumstances leading to the appearance of such HBV strains

may help to guide future therapies.

- 15 -

Acknowledgements

This work was supported by the Conselho Nacional de Desenvolvimento Cientifico

e Tecnologico (CNPq) and by the Fundação Carlos Chagas Filho de Amparo à

Pesquisa do Estado do Rio de Janeiro (FAPERJ).

- 16 -

References

1 Schaefer S. Hepatitis B virus: significance of genotypes. J. Viral Hepat.

2005; 12: 111-24.

2 Bowyer SM, van Staden L, Kew MC, Sim JG. A unique segment of the

hepatitis B virus group A genotype identified in isolates from South Africa. J.

Gen. Virol. 1997; 78 : 1719-29.

3 Kimbi GC, Kramvis A, Kew MC. Distinctive sequence characteristics of

subgenotype A1 isolates of hepatitis B virus from South Africa. J. Gen. Virol.

2004; 85: 1211-20.

4 Hasegawa I, Tanaka Y, Kramvis A, Kato T et al. Novel hepatitis B virus

genotype a subtyping assay that distinguishes subtype Aa from Ae and its

application in epidemiological studies. J. Virol. 2004; 78: 7575-81.

5 Liaw YF. Management of patients with chronic hepatitis B. J. Gastroenterol.

Hepatol. 2002; 17: 406-8.

6 Ben-Ari Z, Daudi N, Klein A et al. Genotypic and phenotypic resistance:

longitudinal and sequential analysis of hepatitis B virus polymerase

mutations in patients with lamivudine resistance after liver transplantation.

Am. J. Gastroenterol. 2003; 98: 151-9.

7 Gauthier J, Bourne EJ, Lutz MW et al. Quantitation of hepatitis B viremia

and emergence of YMDD variants in patients with chronic hepatitis B

treated with lamivudine. J. Infect. Dis. 1999; 180: 1757-62.

8 Farrell GC, Teoh NC. Management of chronic hepatitis B virus infection: a

new era of disease control. Intern. Med. J. 2006; 36: 100-13.

9 Lai CL. Therapeutic advances in chronic hepatitis B. J. Gastroenterol.

Hepatol. 2004; 19 Suppl: S5-9.

10. Torresi J. The virological and clinical significance of mutations in the

overlapping envelope and polymerase genes of hepatitis B virus. J. Clin.

Virol. 2002; 25: 97-106.

11. Yeh CT, Chien RN, Chu CM, Liaw YF. Clearance of the original hepatitis B

virus YMDD-motif mutants with emergence of distinct lamivudine-resistant

mutants during prolonged lamivudine therapy. Hepatology 2000; 31: 1318-

26.

- 17 -

12. Jardi R, Buti M, Rodriguez-Frias F et al. Rapid detection of lamivudine-

resistant hepatitis B virus polymerase gene variants. J. Virol. Methods 1999;

83: 181-7.

13. Liaw YF, Chien RN, Yeh CT, Tsai SL, Chu CM. Acute exacerbation and

hepatitis B virus clearance after emergence of YMDD motif mutation during

lamivudine therapy. Hepatology 1999; 30: 567-72.

14. Pallier C, Castera L, Soulier A et al. Dynamics of hepatitis B virus resistance

to lamivudine. J. Virol. 2006; 80: 643-53.

15. Durantel D, Brunelle MN, Gros E et al. Resistance of human hepatitis B

virus to reverse transcriptase inhibitors: from genotypic to phenotypic

testing. J. Clin. Virol. 2005; 34 Suppl 1: S34-43.

16. Jacobson IM. Therapeutic options for chronic hepatitis B: considerations

and controversies. Am. J. Gastroenterol. 2006; 101 Suppl 1: S13-8.

17. Li D, Gu HX, Zhang SY, Zhong ZH, Zhuang M, Hattori T. YMDD mutations

and genotypes of hepatitis B virus in northern China. Jpn. J. Infect. Dis.

2006; 59: 42-5.

18. Akuta N, Suzuki F, Kobayashi M et al. Virological and biochemical relapse

after discontinuation of lamivudine monotherapy for chronic hepatitis B in

Japan: comparison with breakthrough hepatitis during long-term treatment.

Intervirology 2005; 48: 174-82.

19. Lok AS, Zoulim F, Locarnini S et al. Monitoring drug resistance in chronic

hepatitis B virus (HBV)-infected patients during lamivudine therapy:

evaluation of performance of INNO-LiPA HBV DR assay. J. Clin. Microbiol.

2002; 40: 3729-34.

20. Pas SD, de Man RA, Fries E, Osterhaus AD, Niesters HG. The dynamics of

mutations in the YMDD motif of the hepatitis B virus polymerase gene

during and after lamivudine treatment as determined by reverse

hybridisation. J. Clin. Virol. 2002; 25: 63-71.

21. Stuyver L, Van Geyt C, De Gendt S et al. Line probe assay for monitoring

drug resistance in hepatitis B virus-infected patients during antiviral therapy.

J. Clin. Microbiol. 2000; 38: 702-7.

22. Niel C, Moraes MT, Gaspar AM, Yoshida CF, Gomes SA. Genetic diversity

of hepatitis B virus strains isolated in Rio de Janeiro, Brazil. J. Med. Virol.

1994; 44: 180-6.

23. Kumar S, Tamura K, Nei M. MEGA3: Integrated software for Molecular

Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform.

2004; 5: 150-63.

- 18 -

24. Pas SD, Niesters HG. Detection of HBV DNA using real time analysis. J.

Clin. Virol. 2002; 25: 93-4.

25. Giannini E, Botta F, Testa E et al. The 1-year and 3-month prognostic utility

of the AST/ALT ratio and model for end-stage liver disease score in patients

with viral liver cirrhosis. Am. J. Gastroenterol. 2002; 97: 2855-60.

26. Pohl A, Behling C, Oliver D, Kilani M, Monson P, Hassanein T. Serum

aminotransferase levels and platelet counts as predictors of degree of

fibrosis in chronic hepatitis C virus infection. Am. J. Gastroenterol. 2001; 96:

3142-6.

27. Bartholomew MM, Jansen RW, Jeffers LJ et al. Hepatitis-B-virus resistance

to lamivudine given for recurrent infection after orthotopic liver

transplantation. Lancet 1997; 349: 20-2.

28. Cooley L, Ayres A, Bartholomeusz A et al. Prevalence and characterization

of lamivudine-resistant hepatitis B virus mutations in HIV-HBV co-infected

individuals. AIDS 2003; 17: 1649-57.

29. Melegari M, Scaglioni PP, Wands JR. Hepatitis B virus mutants associated

with 3TC and famciclovir administration are replication defective.

Hepatology 1998; 27: 628-33.

30. Akuta N, Suzuki F, Kobayashi M et al. Virological and biochemical relapse

according to YMDD motif mutant type during long-term lamivudine

monotherapy. J. Med. Virol. 2003; 71: 504-10.

31. Araujo NM, Mello FC, Yoshida CF, Niel C, Gomes SA. High proportion of

subgroup A' (genotype A) among Brazilian isolates of Hepatitis B virus.

Arch. Virol. 2004; 149: 1383-95.

32. Ayres A, Bartholomeusz A, Lau G, Lam KC, Lee JY, Locarnini S.

Lamivudine and Famciclovir resistant hepatitis B virus associated with fatal

hepatic failure. J. Clin. Virol. 2003; 27: 111-6.

33. Wang JH, Lu SN, Lee CM, Lee JF, Chou YP. Fatal hepatic failure after

emergence of the hepatitis B virus mutant during lamivudine therapy in a

patient with liver cirrhosis. Scand. J. Gastroenterol. 2002; 37: 366-9.

34. Zhang JM, Wang XY, Huang YX et al. Fatal liver failure with the emergence

of hepatitis B surface antigen variants with multiple stop mutations after

discontinuation of lamivudine therapy. J. Med. Virol. 2006; 78: 324-8.

- 19 -

Figure Legends

Figure 1 Fluctuation of aminotransferase and HBV DNA levels before and during

lamivudine therapy. Vertical bars: HBV DNA levels; continuous line: ALT levels;

discontinuous line: AST levels.

Figure 2 Phylogenetic tree based on the nucleotide sequences of the entire HBV

pre-S/S region (nt positions 2854 to 833). Isolates from this work were named

2000, 2003 and 2004 (year of isolation). The other sequences are representative

of the different genotypes and designated by their GenBank accession numbers.

Horizontal bar: genetic distance scale.

- 20 -

Figure 1

100

150

200

250

300

350

09/2000

03/2001

08/2001

11/2001

03/2003

11/2003

04/2004

ALT/AST (IU/mL)

Start of lamivudine

treatment

HBV DNA (copies/mL)

Month and year

- 21 -

Figure 2

2000

2003

2004

M57663

U55220

J02201

X51970

AY206386

V00867

AF100308

M54923

AF160501

X75664

U55227

AF043594

Z35716

AY090457

X69798

0.02

- 22 -

Table 1 Amino acid replacements in the surface antigen (small S protein) and the rt domain of polymerase of three HBV isolates,

by comparison with the consensus sequence of genotype A, subgenotype Aa.

Small S protein Polymerase (rt domain)

Isolate

481

C[G[A

aa 109

555

T[C

aa 134

632

C[T

aa 159

734

C[T

aa 193

741

A[G

aa 195

767

G[A

aa 204

779

T[C

aa 208

481

C[G[A

rt 117

555

T[C

rt 142

668

T[A

rt 180

743 G[C (2003)

741 A[G (2004)

rt 204

2000

L F V L I N I S V L M

2003

V F V L I N I C V L

2004

I L V L M N T Y A

Consensus Aa

L F A S I S I S V L M

Underlined aminoacids: molecular signature motifs, characteristics of the HBV population; solid boxes, previously described

lamivudine resistant mutations.

Livros Grátis
( http://www.livrosgratis.com.br )
 
Milhares de Livros para Download:
 
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas

Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
 
 