Download PDF
ads:
Universidade Federal do Rio Grande do Sul
Centro de Biotecnologia
Programa de Pós-graduação em Biologia Celular e Molecular
AVALIAÇÃO DA EXPRESSÃO GÊNICA DIFERENCIAL ENTRE FOLHAS E
TECIDOS VASCULARES DE EUCALYPTUS GRANDIS
MARINA TAGLIARO JAHNS
Dissertação submetida ao Programa
de Pós- Graduação em Biologia
Celular e Molecular do Centro de
Biotecnologia da UFRGS como
requisito parcial para obtenção do
grau de Mestre.
Orientador: Giancarlo Pasquali
Co-orientador: Tarso Benigno Ledur Kist
Porto Alegre
Março de 2008
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
INSTITUIÇÃO E FONTES FINANCIADORAS
Este trabalho foi desenvolvido no Laboratório de Biologia Molecular
Vegetal do Centro Biotecnologia da Universidade Federal do Rio Grande
do Sul (UFRGS).
Fontes financiadoras deste trabalho: financiamento a projeto de
pesquisa - Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq/MCT); bolsa de mestrado - Coordenação de Aperfeiçoamento de
Pessoal de Nível Superior (CAPES); Projeto GENOLYPTUS.
Financiamento do Projeto GENOLYPTUS: Fundo Setorial Verde-
Amarelo do Ministério da Ciência e Tecnologia (MCT) e as empresas de
celulose e papel (1) Aracruz Celulose S.A., (2) Grupo Raiz, (3) Ferro-Gusa
Carajás S.A., (4) Celulose Nipo-Brasileira S.A. – CENIBRA, (5)
International Paper do Brasil Ltda., (6) Jarí Celulose S.A., (7) Klabin S.A.,
(8) Lwarcel Celulose e Papel LTDA., (9) Veracel Celulose S.A., (10)
Votorantim Celulose e Papel S.A., (11) Zanini Florestal S.A., (12) Suzano-
Bahia Sul Papel e Celulose S.A. e (13) Vallourec & Mannesmann do Brasil
S.A.
2
ads:
“Não basta saber, é preferível saber aplicar. Não é o bastante querer, é preciso
saber querer."
Johann Wolfgang von Goethe
3
AGRADECIMENTO
A todas as pessoas que participaram da minha vida e tornaram esse
trabalho possível.
4
Sumário
RESUMO ...................................................................................................... 6
ABSTRACT ................................................................................................... 8
CAPÍTULO I ............................................................................................... 10
1-INTRODUÇÃO E OBJETIVOS .................................................................. 10
2-REVISÃO BIBLIOGRÁFICA ..................................................................... 14
2.1. A Indústria de Celulose e Papel & o Eucalipto ............................ 14
2.2. Eucalyptus grandis ...................................................................... 16
2.3. A Gênese da Madeira ................................................................... 17
2.4. Genômica Funcional .................................................................... 20
2.5. Genes Xilema-Específicos e a Engenharia Genética .................... 22
CAPÍTULO II ............................................................................................. 28
Differential expression in Eucalyptus grandis ........................................... 28
Abstract ................................................................................................ 30
Background .......................................................................................... 32
Results and Discussion ....................................................................... 35
Conclusion ........................................................................................... 55
Methods ............................................................................................... 55
References ........................................................................................... 59
CAPÍTULO III ............................................................................................. 81
O PROJETO GENOLYPTUS E OS EXPERIMENTOS DE MICROARRANJOS
DE DNA: CONSIDERAÇÕES EXTRAS, RESULTADOS E DISCUSSÃO ...... 81
Da coleta de amostras ao envio dos RNAs para os ensaios de
microarranjo de DNA .......................................................................... 81
Do experimento de microarranjo ao processamento dos dados brutos
............................................................................................................. 84
Das análises preliminares aos resultados finais .................................. 85
CONSIDERAÇÕES FINAIS ........................................................................ 99
REFERÊNCIAS BIBLIOGRÁFICAS (Capítulos I e III) ................................ 99
5
RESUMO
No presente trabalho está descrita a análise de experimentos de
microarranjos de DNA realizados pelos pesquisadores do Projeto
GENOLYPTUS em conjunto com a empresa NimbleGen Systems Inc.
(Reykjavik, Iceland), assim como a validação dos resultados gerados por
essa análise, com a finalidade de encontrar genes diferencialmente
expressos entre folhas e xilema de E. grandis para futuro estudo.
O processo de análise dos microarranjos de DNA envolveu a busca
por um software com programas estatísticos adequados ao estudo de
grande quantidade de dados com mínima probabilidade de erro. A
comprovação dos resultados gerados pelo software escolhido foi realizada
com o uso da técnica da reação em cadeia da DNA-polimerase
quantitativa (em tempo real) precedida de transcrição reversa (qRT-PCR).
Alguns dos genes mais diferencialmente expressos foram selecionados
para esta etapa, juntamente com alguns genes com expressão não tão
alta. Os genes mais expressos nas folhas que foram escolhidos codificam
para; (i) uma proteína semelhante à metalotioneína do tipo 3 (MT-3); (ii)
uma glicolato-oxidase; (iii) uma catalase; (iv) uma fosforribulocinase
precursora de cloroplasto (PRK); (v) um fator de transcrição MYB do tipo
MYB142 e, (vi) uma proteína tipo “dedo-de-zinco”. Os genes mais
expressos no xilema escolhidos foram os que codificam (i e ii) duas
proteínas expressas em Arabidopsis thaliana; (iii) uma proteína hipotética
expressa em Nicotiana benthamiana; (iv) uma descarboxilase de UDP-
glicuronato do tipo 2, (v) uma quitinase do tipo ELP; (vi) uma celulose-
sintase tipo 3; (vii) um fator de transcrição MYB; (viii) uma cafeoil-CoA-3-
O-metiltransferase (CCoAOMT) e; (ix) uma proteína rica em prolina
híbrida do tipo 2 (HyPRP2).
6
Os resultados das qRT-PCRs demonstraram que o experimento de
microarranjo e seus resultados foram consistentes e válidos, embora os
primeiros tenham demonstrado valores de expressão freqüentemente
mais altos. Acreditamos que tanto a análise dos microarranjos de DNA
quanto a equivalência das amostras (duplicatas) biológicas estudadas
foram totalmente sustentadas pelos resultados da qRT-PCR, pois foram
robustas o suficiente para estimar um grande número de genes
simultaneamente e indicar aqueles mais importantes como candidatos
para futuras análises.
7
ABSTRACT
In the present work it is described the analysis of DNA microarray
experiments developed by GENOLYPTUS researchers together with
Nimblegen Systems Inc. (Reykjavik, Iceland), as well as the validation of
the generated results with the aim to find differentially expressed genes
between leaves and xylem tissue of E. grandis for further study.
The DNA microarray analysis process comprised the search for
software containing statistical programs satisfactory for studying an
enormous amount of data with a very low false discovery rate. The
confirmation of the generated data by the chosen software was made with
the use of quantitative (real-time) reverse-transcription followed by
polymerase chain reaction (qRT-PCR). Some of the most differentially
expressed genes were selected for this step, along with some genes with
average expression. Leaf chosen genes were those that codify (i) a
metallothionein-like protein type 3 (MT-3), (ii) a glycolate oxidase, (iii) a
catalase, (iv) a precursor phosphoribulokinase (PRK) from chloroplast, (v)
a MYB transcription factor (MYB142), and (vi) a CONSTANS-LIKE 16 zinc-
finger protein. Xylem chosen genes were those codifying (i and ii) two
expressed proteins from Arabidopsis thaliana, (iii) a hypothetic protein
expressed in Nicotiana benthamiana, (iv) a putative UDP-glucuronate
decarboxylase type 2, (v) a chitinase type ELP (ectopic deposition of lignin
in pith), (vi) a cellulose synthase type 3, (vii) a MYB transcription factor,
(viii) a caffeoyl-CoA 3-O-methyltransferase (CCoAOMT), and (ix) a hybrid
proline-rich protein type 2 (HyPRP2).
Our qRT-PCR results proved the full consistency and validation of the
microarray experiments, although the relative expression ratios of the
first were often higher. We believe that our microarray analysis as well as
the equivalence of biological samples (duplicates) were fully supported by
8
the qRT-PCR findings since they were robust enough to evaluate a
massive number of genes and able to point out important candidate
genes.
9
CAPÍTULO I
1- INTRODUÇÃO E OBJETIVOS
O Brasil ocupa o primeiro lugar em área plantada para exploração
comercial de espécies arbóreas do gênero Eucalyptus no mundo. Em
nosso país, o principal uso da madeira do eucalipto está na indústria de
celulose e papel e, em segundo lugar, na produção de carvão vegetal para
a indústria siderúrgica. O eucalipto também fornece matéria-prima para a
produção de aglomerados, chapas, fibras, móveis, mel e óleo para a
obtenção de compostos aromáticos, além de proteger o solo contra
erosão, captar dióxido de carbono, gerar energia a partir da lenha e
carvão e gerar taninos para o curtimento do couro (Sociedade Brasileira
de Silvicultura, 2006). As empresas brasileiras de celulose e papel têm o
eucalipto como fonte de matéria-prima e possuem uma das maiores
produtividades florestais do mundo, suprindo, de forma eficiente, a
demanda de matéria-prima com o fornecimento de produtos de qualidade
internacional.
As empresas e os cientistas brasileiros ocupam posição de destaque
internacional no que se refere à pesquisa e ao desenvolvimento em
genética, melhoramento, marcadores moleculares e clonagem de
Eucalyptus. É, portanto, natural que o Brasil viesse a sediar um projeto de
grande envergadura para o estudo do genoma de Eucalyptus. No ano de
2002, a partir da reunião de 12 grandes empresas do setor de papel e
celulose e dez instituições de pesquisa brasileiras, foi criado o projeto
denominado “GENOLYPTUS – Rede Brasileira de Pesquisa do Genoma de
Eucalyptus” no âmbito do Ministério da Ciência e Tecnologia, com
recursos do Fundo Setorial Verde-Amarelo e das próprias empresas
participantes.
10
O objetivo central do Projeto GENOLYPTUS inclui o descobrimento, o
seqüenciamento, o mapeamento e a determinação da função de genes de
importância econômica de espécies de Eucalyptus, visando a incorporação
de tecnologias de genética genômica nos programas de melhoramento e
produção florestal em busca de plantas de Eucalyptus mais produtivas,
mais resistentes a moléstias e pragas e mais tolerantes a estresses
abióticos. O projeto GENOLYPTUS foi organizado em oito subprojetos que
englobam desde a instalação de uma rede experimental a campo e
implementação de tecnologias para a avaliação da qualidade da madeira,
passando pela construção de mapas genéticos e físicos para o
mapeamento de locos controladores de características quantitativas (do
inglês, quantitative trait loci ou QTLs), além da investigação da base
genética e identificação de genes que conferem resistência a doenças em
Eucalyptus.
O subprojeto intitulado “Seqüenciamento do Transcriptoma de
Eucalyptus" teve como metas a construção de bibliotecas de expressão de
Eucalyptus, a obtenção de pelo menos 30.000 seqüências gênicas únicas
ou de 150.000 ESTs válidas, e a organização e manutenção dos estoques
de clones de cDNA. Como conclusão, 13 bibliotecas de expressão foram
construídas: (1) xilema de E. grandis; (2) xilema de E. globulus; (3) xilema
de E. pellita; (4) xilema de E. urophylla; (5) mistura de xilemas de nove
espécies e híbridos; (6) mistura de floemas de nove espécies e híbridos;
(7) folhas maduras de E. grandis; (8) folhas jovens de E. grandis; (9)
folhas jovens de E. grandis infectadas a campo pelo fungo Puccinia; (10)
plântulas in vitro de E. grandis e (11) mistura de plântulas de E. grandis
submetidas a 20 diferentes tratamentos; (12) raízes de diferentes espécies
e híbridos de Eucalyptus; e (13) flores de E. grandis. Um total de 96.493
ESTs válidas foram depositadas nas centrais de bioinformática do Projeto
GENOLYPTUS, incluindo 21.905 seqüências únicas.
11
Dentro do projeto GENOLYPTUS também se enquadra o sub-projeto
intitulado: “Gênese da Madeira em Eucalyptus: Genes, Funções,
Regulação e Expressão Transgênica”, no qual esta Dissertação insere-se.
Trata-se de uma avaliação experimental dos clones de cDNA produzidos e
seqüenciados com o objetivo de transformá-los em conhecimento
científico e, também, produtos biotecnológicos para aplicação imediata no
melhoramento genético de Eucalyptus e outros vegetais por meio da
transgênese. Este estudo está direcionado, principalmente, aos genes
cujas expressões afetem, direta ou indiretamente, a formação da madeira.
Para esta finalidade, foram planejados e analisados experimentos de
microarranjos de DNA.
Recentemente, foi aprovado o projeto para o seqüenciamento na
íntegra do genoma do eucalipto junto ao Joint Genome Institute (JGI),
ligado ao Departamento de Energia do governo dos EUA (USDOE). O
projeto foi organizado por pesquisadores dos EUA, Brasil e África do Sul,
e conta com participantes da Austrália, Portugal, França e Suécia. Todo o
trabalho computacional de anotação e de montagem do genoma será
realizado nos EUA e os dados serão públicos. A espécie selecionada foi E.
grandis, chamado de eucalipto tropical, por ser a espécie que melhor
adapta-se ao clima e solo brasileiros e a mais cultivada no mundo. Esta
conquista é de extrema importância para o Brasil e para o
aperfeiçoamento das tecnologias de genômica para os programas de
melhoramento silviculturais.
Nesse contexto, o desenvolvimento do presente trabalho teve como
principal objetivo identificar genes diferencialmente expressos em tecido
vascular e folhas de E. grandis a partir da análise de microarranjos de
DNA realizados em conjunto com a empresa NimbleGen Systems Inc.
(Reykjavik, Iceland) para 21.442 ESTs do Projeto GENOLYPTUS. Além da
possível descoberta de genes responsáveis por eventos fundamentais da
12
diferenciação celular e do desenvolvimento dos tecidos foliares e
vasculares, a identificação de genes órgão- ou tecido-específicos poderá
permitir o futuro isolamento de suas seqüências promotoras para uso no
direcionamento da expressão transgênica em plantas.
Os objetivos específicos propostos foram:
• Analisar microarranjos de DNA utilizando ferramentas de
bioinformática;
• Selecionar os genes mais diferencialmente expressos em tecido
vascular e folhas de E. grandis;
• Analisar o padrão de expressão dos genes selecionados pela
técnica de qRT-PCR;
• Comparar o nível de expressão dos genes em relação às duas
técnicas utilizadas.
13
2- REVISÃO BIBLIOGRÁFICA
2.1. A Indústria de Celulose e Papel & o Eucalipto
O setor de florestas plantadas ocupa atualmente lugar de destaque
entre os diferentes segmentos industriais nacionais no que se refere à
geração de renda, arrecadação de tributos, mão-de-obra empregada e
geração de divisas. A disponibilidade de madeira de plantio, mais barata e
homogênea que a das florestas naturais, é uma alternativa eficiente para
a demanda de biomassa lenhosa, diminuindo a devastação das florestas
nativas. Uma grande quantidade de madeira é manufaturada para gerar
combustível, fibras (para produção de pasta de celulose e diversos tipos
de papel) e madeira para serrarias (indústria de construção civil e
moveleria).
O uso das Florestas Plantadas representa 4% do Produto Interno
Bruto do Brasil, sendo que desses, 35% corresponde ao setor de papel e
celulose (ABRAF, 2007). O Brasil é o sétimo maior produtor de celulose
mundial, ocupando o primeiro lugar quando se trata de celulose de fibra
curta de mercado. Ocupa o 11º lugar como produtor de papel mundial
segundo dados da Associação Brasileira de Celulose e Papel - Bracelpa
(BRACELPA, 2006). O Setor Florestal Brasileiro contribui com 8,4% das
exportações do país (Sociedade Brasileira de Silvicultura, 2006). Os
principais mercados para exportação da celulose brasileira têm sido a
Europa (49%), a Ásia (30%) e a América do Norte (19%). No segmento de
papel, os principais mercados são a América Latina (55%), a Europa
(17%), a América do Norte (16%), a Ásia (7%) e a África (5%). Grande
parte desse sucesso deve-se à qualidade da madeira que cresce nas
florestas plantadas (IPEF, 2004).
O setor brasileiro de celulose e papel é constituído por 220
empresas, localizadas em 16 estados, sendo 35 empresas exportadoras
14
habituais. As indústrias nacionais do setor aplicaram US$ 12 bilhões nos
últimos 10 anos para ampliar a capacidade produtiva, expandindo a
produção nacional de celulose de fibra curta de mercado de 1,4 para
cerca de 10,1 milhões de toneladas anuais. O segmento de celulose e
papel utiliza madeira exclusivamente de florestas plantadas e teve em
2005 um faturamento de U$ 8,9 bilhões (Sociedade Brasileira de
Silvicultura, 2006).
O Brasil possui área total absoluta de 851 milhões de hectares (ha),
sendo 477,7 milhões desse total correspondentes a florestas naturais e 5,6
milhões a florestas plantadas. O país conta, ainda, com 61,8 milhões de ha
de unidades federais de conservação sob regime de proteção integral
(45,5%) e de uso sustentável (54,5%). Assim, as florestas plantadas
ocupam apenas 0,65% do território nacional e 1% do solo agropecuário.
Dos 5,6 milhões de ha de florestas plantadas, 3,4 milhões de ha estão
ocupados com eucalipto, 1,8 milhões de ha com Pinus e 326 mil ha com
outras espécies, como acácia-negra, gmelina, álamo, seringueira, teca e
araucária (BRACELPA, 2006; Sociedade Brasileira de Silvicultura, 2006).
A silvicultura teve início no Brasil no início do século passado, com o
estabelecimento dos plantios florestais com espécies exóticas para
substituição da madeira das florestas nativas de difícil reposição. As
principais espécies exóticas foram os eucaliptos, introduzidos pela
Companhia Paulista de Estrada de Ferro em 1904, e as coníferas (Pinus),
pela Companhia Melhoramentos de São Paulo em 1922 (ABRAF, 2007).
O gênero Eucalyptus (família Myrtaceae) inclui mais de 700
espécies descritas que, somadas a diversos híbridos naturais e artificiais,
totalizam mais de 1.500 formas distintas com grande variabilidade
genética. Proveniente da Austrália, Nova Guiné, Indonésia e Filipinas, o
Eucalyptus é o gênero arbóreo de mais ampla distribuição no planeta
(Neilson, 2000; revisado em Poke et al., 2005; Revista da Madeira, 2007).
15
O gênero foi introduzido no país em 1904 e, desde então, seu plantio
passou por diversas etapas de adaptação ao ambiente, melhoramento da
qualidade da madeira e sustentabilidade. Hoje, buscam-se características
de produtividade, qualidade e eficiência combinadas à menor geração de
impactos ambientais e melhor qualidade de vida dos trabalhadores e das
comunidades das regiões dos plantios (ABRAF, 2006).
As principais espécies de Eucalyptus cultivadas atualmente no
Brasil são o E. grandis, E. citriodora, E. camaldulensis, E. saligna, E.
urophilla, entre outras. Além disto, foram desenvolvidos cruzamentos
entre estas e muitas outras espécies, derivando-se delas diversos híbridos,
como é o caso do Eucalyptus urograndis (E. urophilla x E. grandis). Entre
as centenas de espécies e híbridos existentes, E. grandis é uma das
espécies de maior importância comercial, utilizada como base principal
em vários programas de melhoramento genético ao redor do mundo,
principalmente por suas características de rápido crescimento e alta
densidade da madeira (Neilson, 2000; FAO, 2007).
2.2. Eucalyptus grandis
O E. grandis é a espécie de eucalipto mais plantada fora da
Austrália. Lá, possui ocorrência natural de forma descontínua e
fragmentada numa longa faixa costeira (de Newcastle até Atherton). O
clima na área é de temperado-quente a subtropical-moderado, com
invernos suaves e chuvas abundantes e bem distribuídas. (IPEF, 2004).
No Brasil, E. grandis é a espécie mais importante de Eucalyptus
utilizada na produção de papel e pasta de celulose, especialmente na
forma do híbrido E. urophylla x E. grandis (mais conhecido entre os
técnicos florestais como “Urograndis”), mas também na forma de outros
híbridos. E. grandis apresenta um bom desenvolvimento em regiões de
clima tropical e subtropical, além de conter um ótimo teor de celulose na
16
madeira (em torno de 48%) e possuir um bom crescimento volumétrico
(Colodette et al., 2004; revisado em Poke et al., 2005). Estudos realizados
em 1983 por Brito et al. no Instituto de Pesquisas e Estudos Florestais
(IPEF) e no Departamento de Silvicultura da Escola Superior de
Agronomia Luiz de Queiroz (ESALQ/USP) demonstraram que o E. grandis
é uma das espécies de eucalipto que possui o maior volume cilíndrico
médio, com cerca de 1.105 m
3
/ha. Porém, possui elevados índices de
lignina na madeira (24% de lignina total; Pereira et al., 2000; Colodette et
al., 2004).
No presente ano de 2008, em virtude de sua importância
econômica, tamanho reduzido do seu genoma e valor silvicultural de seus
híbridos, o E. grandis foi eleito a espécie vegetal arbórea a ter seu
genoma completamente seqüenciado pelo JGI do USDOE. Os
coordenadores e principais responsáveis pelo projeto de seqüenciamento
são o Dr. Gerald. A. Tuskan (JGI, Walnut Creek, California, EUA), Dr.
Alexander Myburg (Universidade de Pretória, Pretória, África do Sul) e Dr.
Dario Grattapaglia (Embrapa Recursos Genéticos e Biotecnologia,
Brasília, DF), coordenador geral do Projeto GENOLYPTUS. Assim, o E.
grandis tornar-se-á em breve a terceira espécie arbórea com seu genoma
definido e o natural modelo para as futuras pesquisas científicas em
Eucalyptus. As duas outras espécies arbóreas cujos genomas foram
totalmente seqüenciados são o álamo (Populus trichocarpa; revisado em
Brunner et al., 2004; Tuskan et al., 2006) e a videira (Vitis vinifera; Jaillon
et al., 2007; Velasco et al., 2007).
2.3. A Gênese da Madeira
Há considerável interesse na identificação de marcadores genéticos
que caracterizem os principais eventos da formação da madeira, pois
esses são considerados fatores-chave na determinação das suas principais
17
características, influenciando seu desempenho, qualidade e valor
industrial (Paux et al., 2005). A madeira é composta por traqueídeos,
vasos e fibras que estão envolvidos no transporte de água e no suporte
mecânico da árvore (Whetten et al., 2001). As propriedades da madeira
variam muito entre as espécies e entre indivíduos/genótipos da mesma
espécie. A variabilidade ocorre tanto entre diferentes tecidos (proporção
de diferentes tipos celulares) bem como em nível celular: tamanho, forma,
estrutura da parede celular, textura e composição química (Paux et al.,
2005).
Pouco se sabe sobre os processos celulares, moleculares e do
desenvolvimento que estão por trás da formação da madeira (xilogênese).
A xilogênese representa um exemplo de diferenciação celular complexo.
Este processo é controlado por uma grande variedade de fatores, tanto
exógenos (fotoperíodo e temperatura) quanto endógenos (fito-hormônios)
e também pela interação entre eles. A madeira (xilema secundário) é
formada por uma sucessão de cinco principais eventos que incluem: (i)
divisão celular; (ii) expansão celular (alongação e alargamento radial); (iii)
espessamento da parede celular; (iv) lignificação; e (v) morte celular
programada. Todos estes estágios são controlados pela expressão
coordenada de numerosos genes com funções regulatórias e estruturais,
sendo a maioria ainda desconhecida (Hertzberg et al., 2001; Plomion et
al., 2001; Yang et al., 2004). O estudo de genes e mecanismos
responsáveis pela formação da parede secundária, pela biossíntese de
lignina e celulose e pela xilogênese teve grande progresso nos últimos
anos (Beers & Zhao, 2001; Boudet et al., 2003; Ohashi-Ito et al., 2003; Oh
et al., 2003; Paux et al., 2004; Prassinos et al., 2005).
A formação da madeira é um processo que se origina a partir do
crescimento secundário das plantas, com a atividade do câmbio vascular.
O sistema vascular secundário compreende o floema secundário (casca), o
18
câmbio vascular (câmbio) e o xilema secundário (lenho) e é um sistema
dinâmico de quatro dimensões. O câmbio é uma bainha de tecido
meristemático que circunda o tronco e a raiz da árvore. O câmbio
mantém-se por divisões celulares repetidas e produz linhagens celulares
radiais, dando origem às células do xilema secundário em direção ao seu
interior e às células do floema secundário em direção ao seu exterior.
Quando uma célula se distancia do câmbio, ela diferencia-se até tornar-se
uma célula madura. Assim, é possível reconhecer os estágios de
diferenciação de uma célula individual partindo do ponto final voltando ao
ponto inicial do câmbio. Essa característica do sistema vascular
secundário torna-o ideal para o estudo de diferenciação celular. O
crescimento do câmbio vascular aumenta o diâmetro e a circunferência da
árvore. O controle do crescimento e diferenciação do câmbio é
acompanhado por mudanças na expressão de genes importantes
envolvidos com o desenvolvimento (Chaffey, 1999).
A ação dos genes e das proteínas presentes no xilema secundário
em diferenciação irá determinar as propriedades da madeira. A
composição e a morfologia da parede celular secundária das células do
xilema são os principais fatores responsáveis pela qualidade da madeira
(Whetten et al., 2001). A diferenciação do xilema secundário envolve
mudanças seqüenciais na parede celular. Isto inclui a expansão da parede
celular primária e a acomodação da parede celular secundária lignificada,
seguida pela digestão de componentes da parede (Bourquin et al., 2002;
Matsui et al., 2005). Após a célula ter parado de crescer, a parede do
xilema é engrossada com depósitos de celulose e depois é fortalecido pela
impregnação com polissacarídeos da matriz da parece celular secundária
e lignina. As paredes resultantes fornecem os elementos traqueais com
força suficiente para resistir à pressão negativa dentro dos vasos, assim
como para suportar o peso do próprio tronco (revisado em Ye, 2002). A
19
formação da parede celular secundária é comandada pela expressão
coordenada de vários genes, envolvidos especificamente na síntese e
deposição de polissacarídeos, ligninas, pectinas e proteínas de parede
celular (Plomion et al., 2001; Whetten et al., 2001; Yang et al., 2004).
Assim, as principais características da madeira irão variar de acordo com
o tamanho, a forma e a organização das células no xilema, bem como a
estrutura e a composição química da parede celular secundária.
A lignina é o maior componente da madeira depois da celulose e
causa um impacto negativo no processo de polpação química. Neste, as
ligninas são dissolvidas para liberar o material fibroso constituído
basicamente de holocelulose (celulose e hemiceluloses). A dissolução das
ligninas na polpação depende do tipo de ligações e dos grupos funcionais
presentes em sua estrutura. Em geral, madeiras com maior teor de
celulose e menor de hemiceluloses deverão resultar em maior rendimento
de polpação. Tendo em vista que o objetivo da polpação é a remoção
seletiva das ligninas e a liberação da porção fibrosa da madeira, as
madeiras com baixos teores de ligninas e de extrativos propiciam melhor
desempenho da polpação em termos de rendimento e consumo de
produtos químicos utilizados neste processo (Colodette et al., 2004).
Quando as ligninas são removidas, essas propriedades também irão
determinar a resistência, a densidade da polpa e a qualidade dos produtos
de papel (Whetten et al., 2001).
2.4. Genômica Funcional
Os primeiros estudos de genômica funcional realizados em plantas
basearam-se na planta-modelo Arabidopsis thaliana (Schena et al., 1995;
Girke et al., 2000; White et al., 2000; Schaffer et al., 2001).
Recentemente, houve um aumento do interesse na genômica funcional
aplicada a plantas de alto interesse comercial, como o arroz (Yamamoto &
20
Sasaki, 1997; Yazaki et al., 2004; Rafalski, 2007), tomate (Emmanuel &
Levy, 2002; Alba et al., 2005), cana-de-açúcar (Vettore et al., 2003;
Calsa & Figueira, 2007), uva (Goes da Silva et al., 2005; Waters et al.,
2006), pêssego (Abbott et al., 2002; Trainotti et al., 2006), milho
(Lawrence et al., 2004; Haberer et al., 2005) e Pinus (Whetten et al.,
2001).
A genômica funcional oferece os meios para a identificação de um
grande número de genes envolvidos na parede celular do xilema e pode
oferecer uma visão compreensiva desses genes. Atualmente, está
disponível a tecnologia de microarranjos como uma técnica poderosa para
tais fins. Com a ajuda desta tecnologia, é possível monitorar o perfil de
expressão de centenas de milhares de genes que atuam durante a
lignificação e a biossíntese da parede celular secundária (Oh et al. 2003;
Ko et al., 2004). Com o sistema de análise de agrupamentos (clusters)
para dados de expressão gerados por análises de microarranjos, aumenta-
se o número de genes correlacionados com a síntese da parede celular
secundária (Persson et al., 2005). Elementos traqueais diferenciados de
células mesofílicas isoladas de Zinnia elegans tornaram-se conhecidos
como um sistema modelo para o estudo da regulação gênica durante a
diferenciação do xilema (Fukuda, 1997). No sistema de Z. elegans a
formação da parede secundária única aos elementos traqueais é induzida
por alterações no balanço hormonal. Demura et al. (2002) executaram
amplas análises de microarranjos de expressão gênica nesse sistema de
diferenciação de células e identificaram muitos genes candidatos
envolvidos na formação da parede secundária. Muitos dos genes
relacionados à gênese da madeira estão sendo descobertos pelo uso de
técnicas de genômica funcional em larga escala em espécies como
Eucalyptus (Paux et al., 2004; Paux et al., 2005; Foucart et al., 2006),
Populus (Hertzberg et. al, 2001; Israelsson et al., 2003; Schrader et al.,
21
2004; Aspeborg et al., 2005; Prassinos et al., 2005; Andersson-Gunnera et
al., 2006), Pinus (Allona et al., 1998; Whetten et al., 2001; Lorenz & Dean,
2002; Yang et al., 2004) e até Robinia pseudoacacia (Falsa Acácia; Yang et
al., 2003).
Entretanto, mesmo com o advento de vários projetos de
seqüenciamento e de genômica funcional, os mecanismos moleculares que
levam ao crescimento secundário das plantas ainda precisam ser
investigados. Mesmo que as principais vias estruturais já tenham sido
descritas, pouco se sabe a respeito da regulação deste processo, tanto em
nível celular e molecular quanto do desenvolvimento (Schrader et al.,
2004; Li et al., 2006; Groover & Robischon, 2006).
As comparações entre genes expressos em diferentes tecidos da
mesma planta e nos mesmos tecidos de diferentes espécies podem
fornecer noções sobre os processos do desenvolvimento e explicações de
por que algumas espécies possuem propriedades mais favoráveis como
maior densidade da madeira ou maior rendimento de polpação (Poke et
al., 2005). Adicionalmente, a identificação de genes com expressão órgão
ou tecido-específica poderia permitir o isolamento de seqüências
regulatórias de DNA (promotores) responsáveis por tais padrões de
expressão. Estas seqüências promotoras, assim, consistem importantes
ferramentas da engenharia genética vegetal de forma a melhor modular a
expressão de transgenes em plantas. Tendo estas noções em mente,
microarranjos de DNA foram realizados pelos pesquisadores do Projeto
GENOLYPTUS com a finalidade de estudar mais profundamente as
diferenças entre tecidos e espécies de Eucalyptus.
2.5. Genes Xilema-Específicos e a Engenharia Genética
Uma das principais vantagens da genômica funcional é fornecer
conhecimento para a aplicação no melhoramento genético de plantas. Os
22
resultados deste e de outros trabalhos envolvendo análise de dados de
microarranjos de DNA em diferentes tecidos ou espécies de Eucalyptus
fornecerão genes xilema-específicos candidatos a estudos de engenharia
genética.
Há um grande interesse em alterar a expressão de genes específicos
à síntese de vasos do xilema utilizando as ferramentas da engenharia
genética. Vários estudos envolvendo a regulação da quantidade e da
qualidade dos componentes de ligninas já foram realizados. Enzimas
envolvidas na lignificação têm sido clonadas de diversas espécies de
árvores e, em alguns casos, a expressão desses genes tem sido alterada,
resultando na modificação ou redução dos níveis de lignina (Grima-Pettanti
& Goffner, 1999; revisado em Chiang, 2006). Muitas outras propriedades da
madeira e genes envolvidos na codificação de enzimas estruturais ou fatores
de transcrição também estão sendo alterados ou são potenciais alvos para a
engenharia genética (revisado em Groover, 2005; revisado em Chiang,
2006).
Promotores constitutivos e não-específicos como os codificadores
do RNA 35S do Vírus do Mosaico da Couve-flor (CaMV-35S; Lawton et al.,
1987) e da nopalina-sintase (NOS) de Agrobacterium tumefaciens (An et
al., 1986) são amplamente utilizados em estudos visando a super-
expressão gênica em plantas. Porém, a expressão do gene ocorre na
maioria dos tecidos (Gittins et al., 2003), sem regulação temporal e
espacial, provocando um crescimento anormal da planta (Lu et al., 2004).
O uso de promotores com expressão específica permite o controle da
expressão de genes exógenos em plantas transgênicas em tecidos
específicos e num momento específico. Promotores de expressão
específica têm sido estudados intensivamente nos últimos anos devido a
sua importância na expressão de genes, desenvolvimento e crescimento
de plantas transgênicas. O uso de promotores específicos torna
23
necessário conhecer elementos regulatórios xilema-específicos (Lu et al.
2003).
Li et al. (1999) isolaram um gene de cafeoil-coenzima A 3-O-
metiltransferase (CCoAOMT) de Pinus taeda expresso especificamente no
xilema secundário. Esta enzima catalisa a metilação de precursores
monoméricos hidroxilados de lignina e, portanto, está envolvida nas vias
de biossíntese de lignina e é de interesse para o melhoramento da
produção de polpa de madeira de árvores coníferas por engenharia
genética (Whetten et al., 1998). A disponibilidade desse promotor de
CCoAOMT de Pinus permitiria sua aplicação na expressão de genes de
angiospermas xilema-específicos para o direcionamento da expressão
transgênica de genes de interesse em gimnospermas. O uso de inibição
antisenso de CCoAOMT sob o controle do promotor do gene da
CCoAOMT em Pinus transgênico poderia ajudar na diminuição da
lignificação ou alterar a composição das ligninas de forma a facilitar o
processo de polpação.
Lu et al. (2003) utilizaram o promotor de um gene codificador de
proteínas ricas em glicinas (SjGRP1.8) de Sopho japonica L. para dirigir a
expressão do gene codificador da 4-coumarato:CoA ligase (4CL1) em
tabaco transgênico. O promotor GRP1.8 clonado possui expressão
específica em tecidos vasculares. A enzima 4CL1 é componente-chave na
via biossintética de monolignóis. Neste sistema, a atividade da enzima
4CL1 aumentou de uma a duas vezes no xilema e não foi observado
aumento nas folhas de tabaco transgênico. Em relação às plantas
controle, houve um aumento no conteúdo de ligninas de 25% no tronco,
não ocorrendo aumento nas folhas das plantas transgênicas. Em 2004, Lu
et al. utilizaram novamente o gene 4CL1, mas desta vez fusionado aos
promotores Pto4CL1 (clonado de Populus tomentosa) e CaMV-35S, para
avaliar a expressão quantitativa e qualitativa em tabaco transgênico. O
24
promotor Pto4CL1 induziu a expressão do gene 4CL1 no xilema. A
indução positiva da expressão do gene 4CL1 (tanto pelo promotor 35S
quanto pelo Pto4CL1) causou um aumento no conteúdo de ligninas de
25% no tronco das plantas transgênicas de tabaco em relação às plantas-
controle. Não houve aumento no conteúdo de ligninas nas folhas das
plantas transgênicas com o emprego do promotor de Pto4CL1, enquanto
nas plantas transgênicas contendo a construção CaMV-35S-Pto4CL1,
houve aumento de 20% também nas folhas.
As proteínas GRP constituem uma classe de proteínas simples
estruturadas em plantas contendo domínios ricos em glicina, que variam
de 20% a 70% no conteúdo de glicina (Liu et al., 2003). Estudos de
hibridização in situ e imunolocalização da expressão de GRPs indicaram
que elas podem ser altamente tecido- ou órgão-específicas, sendo, na
maioria dos casos, específicas aos tecidos vasculares (Keller et al., 1988;
Cheng et al., 1996) ou raiz-específicas (Bergeron et al., 1994; Matsuyama
et al., 1999). A localização das GRPs sugeriu um papel como componente
estrutural de matrizes extracelulares (Cassab, 1998). Um estudo do
promotor de um gene GRP de arroz (Oryza sativa L.) denominado Osgrp-2
foi realizado por Liu et al. (2003). Neste estudo, o gene codificador da β-
glicuronidase (GUS) de Escherichia coli foi utilizado como gene-repórter
fusionado ao promotor Osgrp-2. As seqüências responsáveis pela
atividade do promotor e pela capacidade de conferir expressão vascular-
específica foram identificadas por meio da análise de plantas de tabaco
transgênicas utilizando análises de deleção 5’ e deleções internas do
promotor. Como resultado, pode-se verificar que o promotor pode ser
dividido em três partes relevantes à sua atividade transcricional: uma
região distal 5’, uma região proximal 5’ - ambas com função regulatória
positiva - e, entre elas, uma região regulatória negativa. A atividade
vascular-específica foi atribuída à região proximal 5’, mais precisamente a
25
uma seqüência de 99 pares de bases (pb) que parece ter dupla função,
isto é, sendo responsável por aumentar a expressão em tecidos vasculares
e suprimir a expressão em outros tecidos. A busca por elementos cis desta
seqüência em bancos de dados revelou um CCAAT-box nesta região, que é
um sítio de ligação para fatores de transcrição da classe MYB, e que
foram descritos como envolvidos na expressão específica a tecidos
meristemáticos e condutores associados a feixes vasculares em tabaco
transgênico (Wissenbach et al., 1993).
Modular a síntese de celulose poderá ter um impacto direto em
vários aspectos do desenvolvimento e do crescimento de uma planta. Um
profundo entendimento dos processos de biossíntese de celulose é de
extrema importância para futuros experimentos que possuem como alvo o
melhoramento genético da produção de celulose em plantas importantes
economicamente (Doblin et al., 2002). As endoglicanases KORRIGAN
(KOR) parecem ter um importante papel na biossíntese de celulose em
Arabidopsis (Joshi et al., 2004), sendo necessárias para a formação da
parede nas células das plantas em crescimento e sendo mais expressas
durante o desenvolvimento do xilema. Bhandari et al. (2006) estudaram
um clone de cDNA de KOR do xilema de Populus tremuloides (PtrKOR) e
verificaram que o gene é positivamente regulado no xilema e apresenta
resposta a estresses juntamente com três outros genes (PtrCesA1,
PtrCesA2 e PtrCesA3) codificadores de celulose-sintases (CesA)
associadas à parede celular secundária de Populus. A utilização da
engenharia genética para alterar os níveis de expressão de KOR (com
alteração coordenada ou não dos níveis de CesA) poderá resultar em
plantas transgênicas que produzam fibras e madeira de melhor qualidade.
A caracterização dos elementos regulatórios xilema-específicos é um
importante passo antes da aplicação de técnicas de transgênese. Os
elementos flanqueadores a montante e a jusante de dois genes de Pinus
26
com expressão preferencial no xilema foram estudados por No et al. (2000).
Os genes PtX3H6 e PtX14A9 codificam componentes do núcleo protéico de
arabinogalactano-proteínas (AGPs), um grupo de proteoglicanas ou
glicoproteínas envolvidas no desenvolvimento da planta e que
freqüentemente exibem expressão tecido-específica (Nothnagel, 1997). As
seqüências flanqueadoras 3’ e 5’ foram testadas em combinação com o
promotor CaMV-35S e o terminador NOS em tabaco e álamo transgênicos. A
conclusão foi de que tanto a seqüência 3’ quanto a seqüência 5’ dos dois
genes são necessárias para a expressão correta de ambos. No entanto, as
seqüências 3’ possuem diferentes funções para cada gene. Em PtX3H6, esta
região atua como inibidor enquanto em PtX14A9, ela atua como ativador,
aumentando os níveis de expressão do gene de forma tecido-específica.
Deve-se levar em consideração que mesmo em angiospermas, a expressão
de um gene-repórter não é sempre igual a da espécie da qual o promotor foi
obtido (Stalberg et al., 1998)
Muitos genes utilizados na transgênese para a melhoria da madeira
já foram identificados e muitos ainda o serão a partir dos projetos genoma
de árvores. O uso de A. thaliana como modelo genético foi combinado com
sua habilidade em produzir tecidos lenhosos para o isolamento de genes
expressos em tecidos vasculares (Beers & Zhao, 2001). No trabalho de
Beers e Zhao (2001), foram encontrados três genes xilema-específicos:
XCP1, XCP2 e XSP1. Enquanto os genes XCP1 e XCP2 parecem codificar
cisteíno-proteases semelhantes à papaína, XSP1 parece codificar uma
serino-protease semelhante à subtilisina. Novos promotores que atuam
especificamente em tecidos vasculares podem ser identificados a partir de
cDNAs por intermédio de seqüências anotadas dos genomas de
Arabidopsis (Kubo et al., 2005; Persson et al., 2005; Zhao et al., 2005),
Populus (Brunner et al., 2004) e Pinus (Yang et al., 2004). Assim, surge
27
uma importante fonte de genes e promotores úteis para a modificação da
madeira em espécies de árvores economicamente importantes.
Atualmente observa-se um grande esforço das empresas e
instituições de pesquisa direcionado ao melhoramento da madeira com a
finalidade de se obter um maior rendimento a partir de menor quantidade
de matéria–prima. A aplicação segura e cuidadosa da biotecnologia
(cultivo assistido por marcadores, engenharia genética e propagação in
vitro) nas práticas florestais deve ajudar a desenvolver árvores
geneticamente superiores em um período de apenas algumas décadas
(Plomion et al., 2001).
CAPÍTULO II
Differential expression in Eucalyptus grandis
(Trabalho a ser submetido ao periódico BMC Genomics)
Marina Tagliaro Jahns
1
, Fernanda Macedo Bastolla
1
, Giancarlo Pasquali
1,*
28
1
Programa de Pós-graduação em Biologia Celular e Molecular, Centro de
Biotecnologia, Universidade Federal do Rio Grande do Sul (UFRGS), Porto
Alegre, RS, Brazil;
* Corresponding author.
Giancarlo Pasquali
1,*
, [email protected]
C.P. 15.005, CEP 91501-970. Tel.: +55 51 3308 9410
29
Abstract
Paper and pulp applications depend on the wood quality and the
industrial process. For these main reasons, there is a need to increase
Eucalyptus genomic resources in order to select candidate genes involved
in the genetic control of wood properties. Researchers of the Brazilian
Research Network on the Eucalyptus Genome (The Genolyptus Project)
are engaged in the discovery, sequencing and mapping of economically
important genes and the determination of their activities in different
species of Eucalyptus, aiming the incorporation of new genomic
technologies into the advanced eucalypt breeding programs and forest
production. As part of the Genolyptus Project we have designed and
analyzed DNA microarrays in order to identify differentially expressed
genes between leaf and xylem tissues of E. grandis. This study was made
with the objective to standardize the analysis of DNA microarrays aiming
a future focused study on Eucalyptus wood properties. Quantitative
reverse-transcription polymerase chain reaction
(qRT-PCR) results proved the full validation of the microarray experiment,
as well as its analysis. Results obtained by qRT-PCR were consistent with
the microarray results for the genes analyzed, although the relative
expression ratios of the first were often higher. Similar discrepancies
between methods were reported previously, suggesting that ratios
calculated using DNA arrays are often underestimated. We believe that
our microarray analysis and biological sampling were fully supported by
the qRT-PCR findings because it was robust enough to evaluate a massive
number of genes and to point out important candidate genes.
30
Keywords: Eucalyptus grandis, microarray analysis, differential
expression, qRT-PCR.
31
Background
The Planted Forest sector is, today, one of the most important for
the Brazilian national economy extensively contributing to income
generation, tribute collection, employment and generation of currencies.
The use of planted forests represents 4% of the Gross Domestic Product of
Brazil, in which 35% corresponds to the pulp and paper sector [1]. Brazil
is the seventh major pulp and paper producer worldwide, occupying the
first place considering short-fiber cellulose, totally derived from
Eucalyptus. Considering paper as final product, Brazil is the eleventh
worldwide producer [2].
The total area of Brazilian planted forests corresponds to 5.3 million
hectares (ha), in which 3.5 million ha account for Eucalyptus forests and
1.8 million ha account for Pinus. .Brazil has 220 paper and pulp
enterprises located in 16 Federative States. In Brazil, 100% of cellulose
pulp & paper are derived from planted forests, mostly eucalypts or pines.
Exported wood-derived products reached figures of US$ 4.0 billion in
2006. In the same year, Brazilian pulp production reached 11.1 million
tons and the paper production was 8.8 million tons. Eucalypt forests are
located mainly in the Southeast region, primarily in the States of Minas
Gerais and São Paulo, as well as Bahia in the Northeast region [1].
The genus Eucalyptus (Myrtaceae family) includes more than 500
described species from Australia, New Guinea, Indonesia and Philippines.
It is the most widely dispersed arboreal genus in the planet, mainly used
for industrial plantations, and it was introduced in Brazil in 1904 [3].
Since then its cultivation went through many environmental adaptation
steps, improvement of the wood quality and sustainability. Eucalyptus
species are among the world’s main sources of biomass and represent the
32
principal hardwood trees used for making paper pulp [4]. The main
reason for the good acceptance of the Brazilian production is the high
quality of the wood used. Characteristics like productivity, quality and
efficiency were combined with the lower generation of environmental
impacts and better life quality of the employees and the communities from
the planting area [1].
The most cultivated Eucalyptus species in Brazil nowadays are E.
grandis, E. citriodora, E. camaldulensis, E. saligna and E. urophilla.
Moreover, crossings between species were developed resulting in many
hybrids like “E. urograndis” (E. urophilla x E. grandis), the most exploited
Eucalyptus hybrid in Brazil. Amongst hundreds of species and hybrids, E.
grandis is one of the main species used in many genetic improvement
programs around the world, primarily because of its fast growth and high
wood density [3, 5]. E. grandis is suitable for genomic analysis because it
has a small genome (approximately 630 Mbp) and genetic maps and
mapped QTLs are available [6, 7].
Wood quality and the industrial process will mostly define the paper
and pulp applications and due to them many large efforts aiming to
increase Eucalyptus genomic resources are being developed in order to
select candidate genes involved in the genetic control of wood properties.
Brazilian enterprises and scientists are internationally recognized for the
genetic research and development, genetic improvement, molecular
markers and Eucalyptus cloning. For this reason, The Genolyptus Project
was created in 2002 by a group of researchers from 10 Brazilian research
institutes. The project is named the Brazilian Research Network on the
Eucalyptus Genome and it is supported by the Brazilian Ministry of
Science and Technology and 12 paper and pulp enterprises of the private
sector. Some of the main goals of this project are focused in the discovery,
sequencing and mapping of economically important genes and the
33
determination of their activities in different species of Eucalyptus, aiming
the incorporation of new genomic technologies into the advanced eucalypt
breeding programs and forest production.
The subproject "Sequencing of the Eucalyptus Transcriptome”
entitles the sequencing effort to achieve 150,000 expressed sequence tags
(EST) from different expression libraries. The objective was the
identification of all 30,000 estimated eucalypt genes, with special
emphasis on those involved in wood formation. More than 13 libraries
were constructed from different organs, tissues and whole seedlings
submitted to several treatments derived from four Eucalyptus species.
Approximately 96,500 ESTs were produced, analyzed and arranged into
34,000 clusters based on sequence homology. The putative functions of
sequenced clones were attributed automatically by BLAST search. ESTs
were grouped according to their putative biological function and those
with “no hit”, “unknown function” or “hypothetical/putative function”
represented 60 percent of the total.
The so called “Woodgenes Project” or “The Genesis of Wood in
Eucalyptus: Genes, Functions, Regulation and Transgenic Expression”,
started in January 2005 and its main focus is the exploration of the cDNA
clone collection generated in the Genolyptus Project. Special emphasis is
driven to cDNAs involved in the poorly understood wood formation
process, aiming the incorporation of new genomic technologies into the
advanced eucalypt breeding programs and forest production. To this end,
DNA microarrays were planned, ordered and analyzed.
The information about the process of wood formation is still limited,
despite the great importance of such material. The systematic analysis of
genes involved in wood formation in Eucalyptus provides valuable insights
into the molecular mechanisms involved in secondary xylem
34
differentiation as well as new candidate-genes for wood quality
improvement [8].
Robotics and bioinformatics have provided a way to monitor the
expression of thousands of genes throughout the construction and use of
DNA microarrays [9]. Many genes related to xylogenesis have been
discovered with the use of such tools during the analysis of large-scale
gene expression in Eucalyptus [10, 8, 4], Populus [11-16], Pinus [17-20]
and Robinia pseudoacacia [21]. As part of the Genolyptus Project we have
designed and analyzed DNA microarrays in order to identify differentially
expressed genes between leaves and xylem of E. grandis. This study was
proposed with the objective to standardize the analysis of DNA
microarrays aiming a future focused study of the Eucalyptus wood
properties.
Results and Discussion
In order to pinpoint the most differentially expressed genes between
leaf blades and vascular (xylem) tissues from E. grandis adult trees, a
total number of nine 50mer-oligoprobes covering the length of each one of
the 21,442 unique sequences derived from the Genolyptus EST collection
were synthesized “on-chip” in duplicate, randomly distributed in the two
blocks of each slide. Therefore, four identical chips were produced at
NimbleGen Scientific Inc. with a total number of 385,956 features each.
Total RNA samples derived from leaf blades and xylem tissues were
obtained from two 4-years-old E. grandis clones, i.e., two genetically
identical trees generated from one single matrix-tree. Complementary
cDNAs were synthesized from the two samples of leaf RNA and the two
samples of xylem RNA at Nimblegen Scientific Inc. with Cy3 as
fluorescent marker. After hybridization, washings, data collection and pre-
35
analysis, DNA microarray data were analyzed in order to verify the
consistency provided by Nimblegen. For this purpose, a simple t-test was
used comparing various sample groups (data not shown). The reliability of
the data was proved, meaning that the microarrays showed very low
variation between blocks from the same slide and between replicates. In
summary, all four microarrays exhibited great reproducibility and
robustness.
The second analysis was performed in order to determine the most
differentially expressed genes between leaves and xylem of E. grandis,
using the SAM algorithm. The SAM algorithm is part of the MeV package
(freely available from the TIGR webpage) and is an alternative to Student
t test aiming differential expression. The method is based in the ratio of
the change in the gene expression between two conditions and the
standart error of the measurements. SAM identifies differentially
expressed genes by the use of sets of t tests gene-specific. Those genes
with values higher than the cutoff point are considered as potentially
significant. The percentage of those genes random identified is called
“false discovery rate” (FDR). The algorithm creates an interactive graphic
where are the observed values versus the expected values (based on the
permutation data or d-values). The cutoff point can be adjusted to identify
lower or higher set of genes, according to the delta value. FDRs are
calculated to each set of data. The delta value can be handily adjusted in
the graphic and it means the vertical distance (in graphic units) from the
solid line that represents the inclination degree (when the observed is
equal to the expected) to each one of the two parallel dotted lines that
represent the area in which genes are consider differentially expressed. It
is also possible to use the fold change criterion, which will determine the
number of times that a single gene is more or less expressed in relation to
another [22].
36
Considering an at least 5-fold change differential expression
calculated by the SAM algorithm, 153 genes were overexpressed in leaves
and 149 genes were much highly expressed in xylem (Figure 1). In Table 1
is shown the frequency of the differentially expressed genes in each tissue
analyzed in accordance to their fold change in expression.
Fold change Number of genes
overexpressed in leaves
Number of genes
overexpressed in xylem
500-100 39 10
100-10 102 118
10-5 12 21
Total 153 149
Table 1. Number of genes from E. grandis overexpressed in leaves and
xylem for each fold change classification. Most genes were classified
within the group of 10- to 100-fold increase in expression.
37
Figure 1. Graphical representation generated by the SAM algorithm. In
the “x” axis are the expected values and in the “y” axis are the observed
values. The black solid line represents those values that did not differ
between observed and expected. In green are shown all 153 up-regulated
genes in the leaves and in red are shown all 149 up-regulated genes in the
xylem.
Fifteen genes from the total differentially expressed genes were chosen
for validation of microarrays and further study. Their putative identities
were attributed by BLASTx and primers for qRT-PCR were designed
according to Table 2.
Abbreviation Identity (BLASTx)
Amplic
on
(bp)
Forward/Reverse
qRT-PCR Primers
MT3
Metallothionein-like protein type 3
(MT-3) [Carica papaya (papaya)] 6e-26
108
5'
TTCAAACTCGATCACCATGT
C/
TCAGTCTCCACGAAGTCAG
C
GO
glycolate oxidase
[Mesembryanthemum crystallinum]
0.0
123
5'
CAGAAGATGGCTCATCCTG
A/
AGGTCCAGTGGAAGCAACT
T
CAT catalase [Prunus persica] 0.0 125
5'
AGCCTGGAGAGAGATACCG
A/
CCAGTATGAAATCCAGACG
CT
PRK
Phosphoribulokinase, chloroplast
precursor (PRK)
[Mesembryanthemum crystallinum]
0.0
132
5'
ACCTTCATGAGGAGGCTGA
C/
GTCCAGGGAATGGTAGTCG
T
MYB142
MYB transcription factor MYB142
[Glycine max] 3e-25
124
5'
GGCATTGGCTCAATATGAC
A/
GTGCTTGACGTCCTCGATTA
CO
zinc finger protein CONSTANS-LIKE 16,
putative [Arabidopsis thaliana] 5e-26
125
5'
CTACGGCGAAGCTGGAGT/
CCTCGTACCGGATCTTCTTG
HyPRP2 HyPRP2 [Gossypium hirsutum] 9e-24 121
5'
ACGCACACAAACGCACTAA
T/
AAGAAGAGGAGGTTGAGG
CA
38
UNK1
unknown protein [Arabidopsis
thaliana] 5e-11
120
5'
GGGTGGTGGCTGTATTACC
T/
AGACAGCTCGCCCAAGTC
UNK2
unknown protein [Arabidopsis
thaliana] 3e-110
147
5'
CATGCAATTTCCTCGTGTTC
/
CGTGGTATGACTCCAGCAT
C
UNK3
hypothetical protein [Nicotiana
benthamiana] 4e-13
109
5'
GGCGAAGACGTACTTTCTC
A/
TCGGACTGGACTACAACAC
AA
UDP-gluc 2
putative UDP-glucuronate
decarboxylase 2 [Nicotiana tabacum]
1e-175
146
5'
GATGATGGCCGTGTTGTTA
G/
TGATCTCCATCCATCAGTCG
ELP
ELP (ECTOPIC DEPOSITION OF LIGNIN
IN PITH); chitinase [Arabidopsis
thaliana] 1e-20
131
5'
GTCGCTTCTGGTGGCAGT/
CCTTGGTGCACAACTTCTT
G
CeSA3
cellulose synthase 3 [Eucalyptus
grandis] 0.0
124
5'
CAGTGACATCCAAAGCGTC
T/
ATTCCGGCAACTACTCCAA
C
MYB
MYB transcription factor [Eucalyptus
gunnii] 7e-150
107
5'
CTGCACAGCCTTCTTGGTA
A/
AGCTTCCTCCTTATGTGCGT
CCOAMT
caffeoyl-CoA 3-O-methyltransferase
[Linum usitatissimum] 3e-15
134
5'
TCCTTATGATCAGGGTTCAT
TCT/
AAACAGCAACATAATTTGG
CA
Table 2. List of selected genes according to the SAM analysis of
microarray results with their respective abbreviations. The identity values
attributed by BLASTx are represented by their E-values. Primer
sequences designed through GenScript Corporation’s Real-Time PCR
Primer Design software are also represented, as well as the expected
amplicon lengths for each sequence.
The candidate genes selected with the microarray analysis had their
expression profiles evaluated in silico through the SAM graph analysis
(Figure 2 and Supplemental Figure 1) and by qRT-PCR. Previously we
evaluated the specificity of all primers designed for qRT-PCR by BLASTn
against the Genolyptus EST sequence collection. Every qRT-PCR primer
39
showed only one match, and that was to its specific target-sequence
(results not shown).
The melting-curve analysis obtained after 40 cycles of amplification
was also used to validate the specificity of the primers. The dissociation
curves allowed us to detect PCR unspecific products and primer dimmers
and also let us to optimize the concentration of primers to be used in each
reaction. The reaction specificity was assumed as ideal when only one
single amplification peak was observed. The occurrence of more than one
peak, on the other hand, would reveal the presence of unspecific
products, and would require optimizations. As results from the
dissociation curve analysis, we did not observed amplification products
for PRK or HyPRP2 and, for this reason, they were excluded from the
analysis. Quantitative RT-PCRs resulted in more than one amplification
product when primers designed for ELP and Zn-Finger sequences were
evaluated, proving their unspecificity. Therefore, these two candidate
genes were also excluded from the analysis. For all other 11 primer pairs,
just one amplification peak was observed in the dissociation curve
analysis, what evidenced their high specificity to the candidate genes
selected under our qRT-PCR conditions (Supplemental Figure 2).
The expression level of the 11 candidate genes selected from the
previous microarray analysis were determined in six tissue (two leaf and
four xylem) samples from 4-year-old field-grown E. grandis trees. These
samples were collected from the same two trees used in the microarray
analysis added by two more identical clones. After performing the qRT-
analysis, we compared the data obtained for the 11 selected genes with
the data from the microarray analysis, as shown in Figure 3. The results
were consistent with the microarray results for the genes analyzed,
except for the sequence putatively encoding the MYB transcription factor.
40
A discussion concerning all 11 differentially expressed genes is presented
as follows.
Figure 2. SAM algorithm-derived color expression pattern of 15
differentially expressed genes selected for further qRT-PCR analysis.
Every line in this figure represents one single gene that has low (blue) to
high (yellow) expression in leaves (left) and xylem (right). Egr_cA,
Eucalyptus grandis; r1, clone 1; r2, clone 2; L, leaf; X, xylem; b1, block 1
(slide); b2, block 2.
41
Figure 3. Comparison of data obtained for 11 selected genes by
microarray and qRT-PCR analysis. The 2
-∆∆CT
mean values and the
microarray results for each gene are represented in a log
10
scale. To
normalize the calculation we used the 2
-∆∆CT
mean values from E. grandis
xylem clones for the reference genes encoding ribonucleoprotein L23A,
At2g28390 and EuC12 [22].
Genes up-regulated in the leaves
Type 3 metallothionein-like genes
Metallothioneins (MTs) are defined as low-molecular-weight (4–8
kDa) and cysteine (Cys)-rich proteins that can bind metals via thiol groups
of their Cys residues [23]. The term MT-like is used for those putative MT
sequences or proteins which protein-metal characterization was not
established [24]. MT genes have been found in both animal and plant
kingdoms, and the deduced amino acid sequences of plant MT-like
42
proteins were classified into four types in relation to the arrangement of
Cys residues [25]. Plant MT-like genes are strongly believed to play a role
in metal ion metabolism or detoxification and it has been demonstrated
that Arabidopsis MT genes were induced by Cd, Cu and Zn treatment
[26]. Besides detoxification, MTs could take part in regulation of gene
expression and cell metabolism by donating/accepting Zn ion to/from Zn-
dependent DNA binding proteins or metalloenzymes [27]. Thus, they
could be involved in normal processes of growth and differentiation. MT
has a putative role in redox homeostasis. It has been shown that yeast and
mammalian MTs can functionally substitute superoxide-dismutases (SOD)
and provide oxidative stress protection in yeast [28]. In addition, direct
antioxidative role of MT as a scavenger of hydroxyl radicals or hydrogen
peroxide was suggested [29]. Its up-regulation in E. grandis leaf blades
when compared to xylem could be explained by the fact that the leaf is a
photosynthetic organ more susceptible to the generation of reactive
oxygen species (ROS). MT3 could also be involved in the protection from
photo-oxidative stress in leaf. This presumption is supported by the fact
that A. thaliana MT1 mRNA was up-regulated during light stress [30]. The
high constitutive MT3 expression in buckwheat leaf was noticed
previously [31]. Since MT is ubiquitous in virtually all living organisms
and active within different tissues and organ systems of higher
eukaryotes, proving its single primary role may not be possible. MTs
constitutively expressed may play a background role in homeostatic
mechanisms, whereas highly induced MT levels could be an adaptive
response to various environmental stresses [31].
Catalase
Catalase is a central component of the enzymatic antioxidant system
to control ROS and is found in a wide range of organisms from aerobic
43
bacteria to higher plants and animals [32, 33]. Plant catalases are
encoded by a small gene family, usually three isoenzyme encoding genes
in a single species, as previously described in maize [34], tobacco [35,
36], Arabidopsis [37], rice [38], and E. grandis [33]. This enzyme is a
tetrameric iron porphyrin that catalyses the dismutation of hydrogen
peroxide to water and oxygen and is preferentially present in
peroxisomes. Photorespiration in C3 plants is an important source of
hydrogen peroxide and this production is mainly counteracted by
peroxisomal catalase, although other antioxidative enzymes are active in
the leaf peroxisome [39].
Glycolate oxidase
Glycolate oxidase (GO), along with hydroxypyruvate reductase
(HPR) and serine glyoxylate aminotransferase (SGAT) are members of the
glycolate pathway. The glycolate pathway is a central part of the
photorespiratory carbon metabolism in higher plants and it englobes the
production of glycolate in chloroplasts during photosynthesis and its
metabolism in peroxisomes [40]. These enzymes are localized in leaf
peroxisomes [41] and in this organelle, GO is the first enzyme of the
pathway, producing glyoxylate and hydrogen peroxide from glycolate and
oxygen. GO is a flavoprotein which transfers electrons to molecular
oxygen to form hydrogen peroxide. In addition to glycolate, this oxidase
can oxidize L-lactate but not D-lactate, and it is insensitive to cyanide
[42]. Glycolate is synthesized also by green algae [40]. It has been shown
that the expression of photorespiratory enzymes such as GO and HPR is
induced during greening in the light [43, 44]. Both the amount of mRNA
and the efficiency of protein synthesis are increased during greening. In
the study of Yamaguchi and Nishimura [45], transgenic tobacco plants
with decreased GO activity by co-suppression were obtained. These
44
authors analyzed the relationship between GO amount and the degree of
photoinhibition using those transformants, and determined the amount of
GO that was required to maintain normal photosynthesis under different
light conditions. Results suggested that photosynthesis was susceptible to
photoinhibition with the reduction of GO activity levels to values below
the threshold and that higher activities of GO are required under higher
irradiation.
Phosphoribulokinase
Phosphoribulokinase (PRK) plays a critical role in regulating the
flow of sugar through the Calvin cycle. PRK is unique to Calvin cycle,
where it catalyses the irreversible formation of ribulose-1,5-bisphosphate
using ribulose-5-phosphate as substrate. It is believed to be one of the key
enzymes that are responsible for controlling the balance between
assimilatory and regenerative stages [46]. It is encoded by the nuclear
genome and synthesized in the cytosol as a precursor protein with an N-
terminal transit peptide that directs the enzyme to the chloroplast. The
activity of PRK is regulated by light, NADP/NADPH ratio, thioredoxin and
Mg
2+
ion levels [47, 48, 49]. PRK may also be regulated by the reversible
dissociation of the PRK/CP12/GAPDH complex [50]. PRK expression is
also regulated by light under the control of the circadian clock and down-
regulated during senescence [48, 51]. A. thaliana PRKis encoded by a
single gene and Calvin cycle PRK transcripts are especially abundant in
Arabidopsis leaves [50]. That seems to be also the case in E. grandis.
Zinc finger protein CONSTANS-LIKE 16
Putterill et al. [52] isolated the CONSTANS (CO) gene of the model
dicot Arabidopsis. CO has an important role in the photoperiod pathway
which is one of four regulatory pathways controlling the timing of
45
flowering. It is known that the photoperiod pathway mediates light and
temporal information from the environment into regulation of flowering
time. Light is perceived by phytochromes (PHY) A to E and cryptochromes
(CRY) 1 and 2, while the duration of day and night is measured by the
circadian clock [53, 54]. CO acts between the circadian clock and genes
controlling meristem identity [55, 56]. In Arabidopsis, CO belongs to a
family of 17 putative transcription factors defined by two conserved
domains [52, 57]. The first is a zinc finger region near the amino terminus
that resembles B-boxes, which regulate protein-protein interactions in
several animal transcription factors [58]. The second is a region of 43
amino acids near the C-terminus termed the CCT (CO, CO-like, TOC1)
domain [57]. Studies using green fluorescent protein (GFP) fusions
showed that the CCT domain is involved in nuclear localization of the CO
protein. Previous analysis of CO-like genes in Arabidopsis showed that the
family is subdivided into three broad groups. The first group comprised
CO and COL1 to COL5 (two B-box genes), the second comprised COL6 to
COL8 and COL16 (one B-box genes), and the third comprised COL9 to
COL15 (one CO-like B-box and one more diverged zinc finger domain).
Arabidopsis COL16 genes (Group II) have been shown to harbor a single
intron located between the B-box and the CCT domains [57].
The overexpression of the gene coding for a CO protein in the leaf is
consistent with the fact that leaf is an organ perceiving photoperiod,
where the CO protein is responsible for sensing the day length signal.
MYB 142
MYB proteins are a superfamily of transcription factors that play
regulatory roles in developmental processes and defense responses in
plants. In the past decade, the R2R3-MYB genes have been extensively
46
studied. They were reported to be involved in many physiological and
biochemical processes such as the regulation of secondary metabolism
[59], the control of cell morphogenesis [60], the regulation of meristem
formation and floral and seed development [61], and the control of cell
cycle [62]. Some MYB proteins were also involved in various defense and
stress responses [63] and in light and hormone signaling pathways [64,
65]. The work from Yanhui et al. [66] allowed the identification of 198
genes in the MYB superfamily from an analysis of the complete
Arabidopsis genome sequence. Among them, 126 were R2R3-MYB, five
were R1R2R3-MYB, 64 were MYB-related, and three were atypical MYB
genes. These genes were shown to be expressed in a wide variety of
tissues. In view of that, the occurrence of a MYB transcription factor in
the leaf of E. grandis is predictable. In line with this information, Liang et
al. [67] demonstrated the localization of a MYB transcription factor,
AtMYB61, uniquely in guard cells of Arabidopsis. The results of this work
support the hypothesis that AtMYB61, acting as a transcriptional
regulator of stomatal function, is both necessary and sufficient to
decrease stomatal aperture.
Genes up-regulated in the xylem
Putative UDP-glucuronate decarboxylase 2
UDP-glucuronate decarboxylase (UDP-GD) catalyses the conversion
of UDP-glucuronate to UDP-xylose, which is an important sugar donor in
the synthesis of hemicellulose and glycoproteins [68]. The UDP-GD genes
have been reported in rat of the mammalian [69] and in typical dicot
plants such as the pea [70] and Arabidopsis [71].
Extractability and recovery of cellulose from cell walls influences
many industrial processes and also the utilization of biomass for energy
purposes. UDP-GD produces UDP-xylose, the precursor for xylans and it
47
could affect the cellulose extractability when is down-regulated on cell
wall structure in transgenic plants. Besides the influence of lignins on
chemical processing, the importance of xylans was first realized by the
pulping industry when it became apparent that delignification during the
pulping process was influenced by the hemicelluloses present [72].
Bindschedler et al. [73] proved that the expression of the UDP-GD gene in
an antisense orientation resulted in a consistent lower xylose and higher
glucose content in the wall polysaccharides and promoted consequent
changes to pulping properties. In addition, the pulp yield was lower and
the pulp viscosity slightly higher due to the lower delignification.
Concerning cellulose, the degree of polymerization was similar for all the
pulps produced from control or transgenic lines. Even though
hemicellulose mutants have been identified in Arabidopsis, this was the
first example of the consequences of directed manipulation of xylans in
woody plants to test for modifications in pulping properties.
MYB transcription factor
As mentioned before, plant MYB proteins were classified into three
major groups: R2R3-MYB, R1R2R3-MYB, and a heterogeneous group
collectively referred to as MYB-related proteins, which usually but not
always contain a single MYB repeat [74-76]. The modulation of the
expression of several MYB proteins leads to the regulation of the complex
pathway of the phenylpropanoid metabolism and the accumulation of
various end-products in specific cells, tissues or organs [77, 78], since
several MYB proteins have been shown to be involved in the regulation of
this metabolism [79, 80].
Many plant MYB transcription factors have been studied, like Pinus
taeda PtMYB4, poplar PttMYB21a [81, 82], and Eucalyptus gunnii
EgMYB2 [83]. A fourth subgroup was proposed and included AmMYB308
48
from Antirrhinum majus, ZmMYB31 and ZmMYB42 from maize, AtMYB32
and AtMYB4 from Arabidopsis, all of them involved in the repression of
phenylpropanoid and/or monolignol biosynthesis genes [59, 84-86].
Fornale et al. reported in 2006 [86] the down-regulation of the maize and
A. thaliana COMT gene by two new maize R2R3-MYB transcription
factors, ZmMYB31 and ZmMYB42. The work also showed that ZmMYB31
and ZmMYB42 differentially regulate other structural genes of the lignin
pathway, such as At4CL1, AtC4H, At4CCoAOMT1 and At4CAD6 resulting,
in both cases, in a reduction of the total lignin content of the transgenic
A. thaliana plants. Goicoechea et al. [83] reported the cloning and
functional characterization of a R2R3MYB gene from E. gunnii named
EgMYB2, which is able to bind the regulatory regions of genes encoding
cinnamoyl-CoA reductase (CCR) and cinnamyl alcohol dehydrogenase
(CAD2), the two most studied genes of the lignin biosynthetic pathway.
EgMYB2 was described to be preferentially expressed in differentiating
xylem tissue. The results reported strongly suggest that EgMYB2 is a
positive regulator of secondary cell wall formation and lignin biosynthesis.
On the other and, Legay et al. [87] reported the cloning and
characterization of EgMYB1, a R2R3 MYB transcription factor
preferentially expressed in Eucalyptus xylem tissues which binds, in vitro,
the cis-regulatory regions of the E. gunnii CCR and CAD2. EgMYB1 was
also described to act as a transcriptional repressor of these genes in vivo.
EgMYB1 is preferentially expressed in the secondary xylem of stems and
roots of Eucalyptus trees, and the corresponding protein is localized in
the nucleus. EgMYB1 binds specifically the MBSIIG sites located in the
promoters of lignin biosynthetic genes, and represses the transcription of
these genes in planta. The work from Legay et al. [87] was the first to
describe a MYB transcription factor highly and preferentially expressed in
the xylem tissue of a woody angiosperm.
49
In Eucalyptus xylem, the presence of both a transcriptional activator
(EgMYB2) and a repressor (EgMYB1) suggests that a balanced expression
of these proteins competing for the same promoters could provide a
mechanism for fine spatial and temporal control of lignin deposition, by
forming either a repressing or an activating regulatory complex [87].
CCOAMT caffeoyl-CoA 3-O-methyltransferase
It is believed that two structurally distinct O-methyltransferases
(OMT) are responsible for the methylation of lignin precursors. The
caffeic acid 3-O-methyltransferase (COMT) methylates caffeic acid and 5-
hydroxyferulic acid [88] whereas caffeoyl CoA 3-O-methyltranferase
(CCoMT) methylates caffeoyl-CoA and 5-hydroxyferuloyl-CoA [89]. In
dicotyledonous angiosperms, both COMT and CCoMT are bi-specific [90].
CCoAOMT plays an important role in lignin biosynthesis. This
enzyme was initially characterized in cell suspensions of parsley and
carrot challenged with a fungal elicitor [91, 92] and therefore was
believed to play a role in disease resistance. Immunolocalization, tissue
printing studies, and promoter β-glucuronidase (GUS) fusion analysis in
various plant species have shown that the expression of the CCoAOMT
gene is highly correlated with the lignifying tissues [93, 61]. CCoAOMT is
encoded by two genes in poplar (Populus trichocarpa). In 2000, Chen et
al. [94] described the expression pattern conferred by the two CCoAOMT
promoters when fused to the gusA-coding sequence in transgenic poplar
(Populus tremula X Populus alba). They demonstrated that both genes
were expressed similarly in xylem and differently in phloem. The two
CCoAOMT promoters directed reporter-gene expression in lignifying cells
and in cells closely associated with lignifying cells, both during normal
development and upon stress conditions known to influence lignin
deposition (wounding, pathogen attack, and mechanical bending). Thus, it
50
is expected to find an increased CCoAOMT gene expression in E. grandis
xylem tissue when comparing it to leaf blades.
Hybrid Proline-Rich Proteins
Hybrid proline-rich proteins (HyPRPs) are proteins that contain a
signal peptide followed by an N-terminal proline-rich domain that
presents different repetitive motives and a second hydrophobic C-terminal
domain [95]. Such domain does not contain repetitive elements but
presents a series of invariable Cys residues in a conserved distribution
pattern. These proteins have been named either hybrid proline-rich
proteins or hybrid glycine-rich proteins (HyGRPs). The HyPRPs may have
different repetition patterns in their Pro-rich domain. However, when the
second hydrophobic domain is analyzed, the HyPRPs can be subdivided in
two different groups (A and B), according to the Cys residue positions in
the peptide sequence [95].
The expression pattern of plant genes encoding HyPRPs is quite
diverse. In rice, it has been shown that the expression of a gene which
encodes a HyPRP occurs in the vascular and cortical tissues of the root
cap and the elongation zone of the root. Though, the expression in leaves
occurs mainly in vascular and mesophyll cells [96]. In contrast, it has been
observed in maize that the expression of a gene that encodes for HyPRP is
restricted to developing cortical cells. Blanco-Portales et al. [97] have
cloned and characterized a strawberry HyPRP gene (Fahyprp). The gene
expression analysis, in situ hybridization, immunolocalization and
histochemical experiments suggested that the Fahyprp gene is related to
the fruit ripening process and possibly involved in the anchoring of
polyphenols (lignin and condensed tannins) to cell membranes. A role in
transporting molecules from or towards the vascular tissues has been
proposed for this protein [98]. It has been described that Pro-rich proteins
51
and hydroxy-Pro-rich proteins are preferentially located in xylem cells
under a process of lignification. A putative role for these proteins as
anchoring sites for lignin polymer through the interaction with the
phenolic groups constituting the lignin was proposed [99]. Then, the
overexpression of a gene encoding a HyPRP in the E. grandis xylem would
it be reasonable. Even though different physiological functions have been
suggested for HyPRP proteins in higher plants, including their
involvement in developmental processes and responses to different stress,
so far no specific function for this class of proteins has been concluded.
Cellulose Synthase 3
Cellulose is a linear homopolymer of β(1-4)-linked glucose residues.
The coordinated synthesis of glucose chains is orchestrated by specific
plasma membrane-bound cellulose synthase complexes (CelS). The CelS is
postulated to be composed of approximately 36 cellulose synthase (CESA)
subunits. The CelS synthesizes 36 glucose chains in close proximity before
they are further organized into microfibrils that are associated with other
cell wall polymers. The 36 glucose chains in a microfibril are stabilized by
intra- and inter-hydrogen bonding which confer great stability on
microfibrils. Several elementary microfibrils come together to form
macrofibrils. Many CESA isoforms appear to be involved in the cellulose
biosynthetic process and at least three types of CESA isoforms appear to
be necessary for the functional organization of CelS in higher plants
[100]. Persson et al., [101] presented evidence that the primary CelS
complex in Arabidopsis requires three unique types of components,
CESA1-, CESA3-, and CESA6-related, for activity. The work in Arabidopsis
also showed that the CESA6-related CESAs are partially functionally
redundant. This requirement is similar to the secondary CESA complex, in
which CESA4, -7, and -8 are necessary [102].
52
Recently, six cDNAs encoding CESAs of E. grandis were reported
and named EgCesA1 to 6 [103]. Experiments of qRT-PCR indicated that
transcripts of EgCesA1 to 3 were abundant in tissues enriched with cells
laying down secondary cell walls (xylem) but were weakly expressed in
tissues undergoing primary growth (unfolding leaves). Expression of
EgCesA4 and EgCesA5 was up-regulated in tissues rich in rapidly dividing
cells undergoing primary wall synthesis, whereas EgCesA6 was weakly
expressed in all tissues analyzed. These results suggest that Eucalyptus,
like other higher plants, expresses two contrasting groups of apparently
co-regulated CESAs involved in either primary or secondary cell wall
biosynthesis.
Chitinase and Ectopic Deposition of Lignin in Pith
Plant chitinases are a group of enzymes that presumably hydrolyze
chitin, a biopolymer of N-acethylglucosamine (GlcNAc) in a β-1,4 linkage.
Only a few of them have been proved to possess chitinase activities.
Chitinases that are expressed in a tissue-specific manner and are not
induced by pathogens or stress may have roles in normal plant growth
and development. Most of the reported chitinases have been identified
based on their sequence similarity to known chitinases. Plant chitinases
are grouped into six different classes based on sequence similarity to
tobacco chitinases [104]. The two most common classes of chitinases are
class I and class II, which differ in the presence (class I) or absence (class
II) of a conserved N-terminal Cys-rich lectin domain. All classes of
chitinases possess some conserved amino acid residues in the catalytic
domain [105]. In 2000, Zhong et al. [106] isolated and characterized an
Arabidopsis ectopic deposition of lignin in pith (elp1) mutant with
alteration of lignin deposition patterns. In this elp1 mutant stems, lignin is
deposited ectopically in patches of parenchyma cells in the pith that are
53
not lignified in the wild-type. The ectopic deposition of lignin in the pith of
the elp1 mutant was identified by histological staining of lignin, and it
correlated with increased klason lignin content and ectopic expression of
CCoAOMT, an enzyme involved in monolignol biosynthesis. In another
article from 2002 [107], the same group showed that the elp1 gene
encodes a chitinase-like gene in Arabidopsis (AtCTL1) and that some pith
cells in the elp1 mutant had aberrant shapes of cells with incomplete cell
walls. The mutant also overproduced ethylene, causing growth alterations
in both dark- and light-grown seedlings. With these results, the authors
provided direct evidence that this chitinase-like protein plays a role in
normal plant growth and development in Arabidopsis. Such possibility
may be the case for the observed chitinase-like gene in E. grandis.
Correlation between qRT-PCR and microarray experiments
Point out a handful of potentially interesting genes with microarray
experiments and confirm those candidates by realtime RT-PCR analysis is
a widely used strategy. There are several works showing the correlation
between microarray experiments and quantitative RT-PCR analysis.
Gachon et al. [108] reviewed the relevance of real-time PCR in plant
studies. As an illustration, they cited the case of Rider et al. [109] that
randomly picked 12 candidates among a pool of 185 genes previously
identified by AffimetrixTM microarray experiments as being up-regulated
in the seeds of the Arabidopsis pickel mutant compared with wild-type
seeds. They confirmed the up-regulation for only 10 of those genes by
real-time RT-PCR experiments.
The data from Dallas et al. [110] demonstrate that similar
microarray scores for different genes do not necessarily mean that similar
qRT-PCR scores will be obtained. For example, they discovered genes
54
which yielded similar average log2 RMA scores on the microarray analysis
but the average log2 qRT-PCR scores for the same genes were
substantially different. The finding that genes with similar microarray
expression scores were unlikely to have similar qRT-PCR results
presumably reflects the different hybridization kinetics of the probe sets
for each gene. The results from this work indicates that the direction of
change of gene expression levels (i.e. either up or down regulation)
between subsets of interest is accurately predicted by comparison of
average microarray expression scores, although the fact that they found
13–16% of non-concordance between the two techniques.
Conclusion
Our results obtained by qRT-PCR were consistent with the
microarray results for the majority of the genes analyzed, although the
relative expression ratios of the first were often higher. Similar
discrepancies between the methods were reported previously, suggesting
that the ratios calculated using DNA arrays are often underestimated
[111, 10]. We believe that our microarray analysis and biological samples
were fully supported by the qRT-PCR findings: it was robust enough to
evaluate a massive number of genes and to point out important candidate
genes for further analysis.
Methods
Plant Material and Tissue Harvesting
Mature leaves and stem scrapings were harvested from 4-year-
old field-grown E. grandis trees (Hortoflorestal Barbanegra, Aracruz
Celulose S.A., Barra do Ribeiro, RS, Brazil). In order to minimize the
proportion of primary xylem mainly located in the main veins of leaves,
55
only leaf blades without the central vein of young and mature leaves
were used for this study. To obtain the differentiating xylem tissue, we
proceeded as described in Paux et al. [10]: the bark was removed and
scrapings were taken from the exposed xylogenic tissue to avoid
contamination with phloem tissue. Tissue samples were immediately
frozen in liquid nitrogen after harvesting and stored at -80 °C. For the
microarray experiments, leaf and xylem samples were harvested from
two clones derived from one matrix. For qRT-PCR, mature leaves and
xylem scrapings were collected from three clones of one E. grandis
matrix.
Total RNA Extraction
Total RNA was extracted from 1 g of either xylem or leaves using
PureLink Plant RNA Reagent Kit (Invitrogen) according to the
instructions of the manufacturer. RNA purity and quality were checked
by both agarose gel electrophoresis and spectrophotometry
measurements at 260 and 280 nm. Polyadenylated RNA was
subsequently purified from total RNA using the Oligotex mRNA Mini
kit (Qiagen). The concentration of isolated mRNA was determined
using spectroscopic measurements at 260 nm.
Microarray
Microarray experiments were carried out by NimbleGen Systems
for 21,442 of the 21,905 ESTs of clusters and singletons proceeding
from the Genolyptus Sequencing Project. Nine oligonucleotides of 50
bp were designed and synthesized to each sequence consensus. The
oligonucleotides were distributed throughout the sequence and had
close melting temperatures (Tm). The nine probes were duplicated
adding up 385,856 features per chip and a total of 4 identical chips
56
were produced according to the company protocols. Complementary
DNAs (cDNAs) labeled with Cy3 were synthesized and hybridizations,
washing, scanning, data collection and initial data normalization were
performed according to NimbleGen protocols.
Microarray Data Analysis
Gene expression data were analyzed by NimbleGen following
quartile normalization and Robust Multi-Array Analysis (RMA) which
consists of the following stages: elimination of background
fluorescence, normalization and data transformation [112].
Statistical Analysis
Data were analyzed using the Significance Analysis of
Microarrays (SAM) procedure, a validated statistical technique for
identifying differentially expressed genes using microarrays [113]
available on the Institute for Genomic Research (TIGR) [114].
Gene Selection for Validation
Candidate genes were selected according to the microarray
analysis using SAM with the following parameters: number of
permutations, 70; SO parameters, Tusher et al. [113] method; q values,
not calculated; imputation method, K-nearest neighbors imputer;
number of neighbors, 10; delta value, 9.15, and false discovery rate
0%. We also analyzed the sequences by BLASTx and discarded the
without hits on X database. We therefore, sorted only sequences with
higher homology and primers were projected in the most conserved
regions.
Primer Design
57
Primers were designed using the software created by GenScript
Corporation’s Real-Time PCR Primer Design [115]. The primers were
designed in order to be as specific as possible for the selected genes.
This was done by grouping and comparing the sequences and then
designing the primers on regions with major similarity. Only those that
resulted in amplicons with more than 100 pb and optimal Tm at 60°C
had been selected. Initially all primers were tested by qRT-PCR and
amplification specificity was verified by dissociation curves analysis
using ABI Prism 7500 Dissociation Curve Analysis Software (Applied
Biosystems). Primer sequences are given in Table 2.
Reverse Transcription
Each mRNA sample (300 ng) was reverse transcribed to cDNA
with 200 units of M-MLV RT (Promega) and their respective reagents
using 10 pmol of oligo-dT
30(V)
(SMART CDS II A, RW Genes/Clontech),
0.5 mM each deoxynucleoside trisphosphate (dNTPs) in a final volume
of 10 μl. Reactions were initially incubated at 70 ◦C for 5 min followed
by 40 ◦C for 60 min.
qRT-PCR
The cDNAs were diluted 1:50 with nuclease-free water. Aliquots
of the same cDNA sample were used with all primers set for qRT-PCR.
Each PCR was performed in quadruplicate and no-template controls
were included. Quantitative RT-PCRs were performed in the ABI Prism
7500 Sequence Detection System (Applied Biosystems) in a 96-well
reaction plate using the parameters recommended by the
manufacturer (5 min. at 94 °C; 40 cycles of 94 °C for 15 sec, 60 °C for
10 sec, 72 °C for 15 sec and 60 °C for 35 sec). Reactions were done in
20 μl volumes containing 4 pmol of each primer, 0.5 mM of dNTPs,
58
0.05 µL of Platinum Taq (Invitrogen) and its reagents, 1X SYBR Green
(Applied Biosystems) and 10 µL of 1:50 cDNAs. Specificity of the
amplifications was verified by melting curve analysis at the end of the
PCR run using the ABI Prism Dissociation Curve Analysis Software and
the threshold cycle (C
T
) was determined for each primer using the ABI
Prism 7500 Sequence Detection System (Applied Biosystems).
Analysis of Gene Expression
To analyze gene expression we used the 2
-
∆∆
CT
method which is
used to calculate relative changes in gene expression determined from
qRT-PCR experiments [116]. In this manner, the degree of relative
expression was calculated from the efficiencies of the reactions and the
deviation of the C
T
of the sample-target versus the control. As
reference genes, we used primers specific for the ribonucleoprotein
L23A, At2g28390 and EuC12 genes [22].
References
1. ABRAF: Anuário estatístico da ABRAF: ano base 2006.
[http://www.abraflor.org.br/estatisticas/anuario-ABRAF-2007.pdf]
2. BRACELPA: Associação Brasileira de Celulose e Papel:
Relatório anual de desempenho 2006
[http://www.bracelpa.org.br/bra/estatisticas/]
3. Neilson D: The global Eucalyptus resource and some solid
wood-panel product developmental issues. IUFRO Conference
2000, Lauceston, Austrália.
4. Foucart C, Paux E, Ladouce N, San-Clemente H, Grima-Pettenati J,
Sivadon P: Transcript profiling of a xylem vs phloem cDNA
subtractive library identifies new genes expressed during
xylogenesis in Eucalyptus. New Phytol 2006, 170:739–752.
59
5. FAO: Food and Agriculture Organization: Forest products and
services. [http://www.fao.org/forestry/index.jsp]
6. Grattapaglia D, Bradshaw Jr HD: Nuclear DNA content of
commercially important Eucalyptus species and hybrids. Can J
For Res 1994, 24:1074–1078.
7. Myburg AA, Griffin AR, Sederoff RR, Whetten RW: Comparative
genetic linkage maps of Eucalyptus grandis, Eucalyptus
globulus and their F1 hybrid based on a double pseudo-
backcross mapping approach. Theor Appl Genet 2003, 107:1028-
1042.
8. Paux E, Carocha V, Marques C, Sousa AM, Borralho N, Sivadon P,
Grima-Pettenati J: Transcript profiling of Eucalyptus xylem
genes during tension wood formation. New Phytol 2005,
167:89-100.
9. Schena M, Shalon D, Davis RW, Brown PO: Quantitative
monitoring of gene expression patterns with a
complementary DNA microarray. Science 1995, 270(5235):467-
470.
10.Paux E, Tamasloukht M, Ladouce N, Sivadon P, Grima-Pettenati J:
Identification of genes preferentially expressed during wood
formation in Eucalyptus. Plant Mol Biol 2004, 55:263–280.
11.Hertzberg M, Aspeborg H, Schrader J, Andersson A, Erlandsson R,
Blomqvist K, Bhalerao R, Uhlén M, Teeri TT, Lundeberg J, Sundberg
B, Nilsson P, Sandberg G: A transcriptional roadmap to wood
formation. P Natl Acad Sci USA 2001, 98(25):14732–14737.
12.Israelsson M, Eriksson ME, Hertzberg M, Aspeborg H, Nilsson P,
Moritz T: Changes in gene expression in the wood-forming
tissue of transgenic hybrid aspen with increased secondary
growth. Plant Mol Biol 2003, 52:893–903.
13.Schrader J, Nilsson J, Mellerowicz E, Berglund A, Nilsson P,
Hertzberg M, Sandberga G: A high-resolution transcript profile
across the wood-forming meristem of poplar identifies
potential regulators of cambial stem cell identity. The Plant
Cell 2004, 16:2278–2292.
60
14.Aspeborg H, Schrader J, Coutinho PM, Stam M, Kallas A, Djerbi S,
Nilsson P, Denman S, Amini B, Sterky F, Master E, Sandberg G,
Mellerowicz E, Sundberg B, Henrissat B, Teeri TT: Carbohydrate-
active enzymes involved in the secondary cell wall biogenesis
in hybrid aspen. Plant Physiol 2005, 137:983–997.
15.Prassinos C, Ko J, Yang J, Han K: Transcriptome profiling of
vertical stem segments provides insights into the genetic
regulation of secondary growth in hybrid aspen trees. Plant
Cell Physiol 2005, 46(8):1213–1225.
16.Andersson-Gunneras S, Mellerowicz EJ, Love J, Segerman B, Ohmiya
Y, Coutinho PM, Nilsson P, Henrissat B, Moritz T, Sundberg B:
Biosynthesis of cellulose-enriched tension wood in Populus:
global analysis of transcripts and metabolites identifies
biochemical and developmental regulators in secondary wall
biosynthesis. The Plant J 2006, 45:144–165.
17.Allona I, Quinn M, Shoop E, Swope K, St.Cyr S, Carlis J, Riedl J,
Retzel E, Campbell MM, Sederoff R, Whetten RW: Analysis of
xylem formation in pine by cDNA sequencing. P Natl Acad Sci
USA 1998, 95:9693-9698.
18.Whetten R, Sun Y, Zhang Y, Sederoff R: Functional genomics and
cell wall biosynthesis in loblolly pine. Plant Mol Biol 2001,
47:275–291.
19.Lorenz WW & Dean JFD: SAGE profiling and demonstration of
differential gene expression along the axial developmental
gradient of lignifying xylem in loblolly pine (Pinus taeda).
Tree Physiol 2002, 22:301–310.
20.Yang S, Zyl L, No E, Loopstra CA: Microarray analysis of genes
preferentially expressed in differentiating xylem of loblolly
pine (Pinus taeda). Plant Sci 2004, 166:1185–1195.
21.Yang J, Park S, Kamdem DP, Keathley DE, Retzel E, Paule C, Kapur V,
Han K: Novel gene expression profiles define the metabolic
and physiological processes characteristic of wood and its
extractive formation in a hardwood tree species, Robinia
pseudoacacia. Plant Mol Biol 2003, 52:935–956.
61
22.Bastolla FM: Seleção e avaliação de genes de referência para
estudos de expressão gênica em Eucalyptus. MSc thesis.
Universidade Federal do Rio Grande do Sul, Centro de
Biotecnologia; 2007.
23.Kägi JH, Schaffer A: Biochemistry of metallothionein.
Biochemistry 1988, 27:8509–8515.
24.Rauser EW: Structure and function of metal chelators
produced by plants. Cell Biochem Biophys 1999, 31:19–48.
25.Cobbett C, Goldsbrough P: Phytochelatins and metallothioneins:
roles in heavy metal detoxification and homeostasis. Annu.
Rev Plant Biol 2002, 53:159–182.
26.Zhou J, Goldsbrough PB: Structure, organization and expression
of the metallothionein gene family in Arabidopsis. Mol Gen
Genet 1995, 248:318–328.
27.Vallee BL: The function of metallothionein. Neurochem Int 1995,
27:23–33.
28.Tamai KT, Gralla EB, Ellerby LM, Valentine JS, Thiele DJ: Yeast and
mammalian metallothioneins functionally substitute for yeast
copper-zinc superoxide dismutase. Proc Natl Acad Sci 1993,
90:8013–8017.
29.Quesada AR, Byrnes RW, Krezoski SO, Petering DH: Direct
reaction of H2O2 with sulfhydryl groups in HL-60 cells: Zn-
metallothionein and other sites. Arch Biochem Biophys 1996,
334(2):241–250.
30.Dunaeva M, Adamska I: Identification of genes expressed in
response to light stress in leaves of Arabidopsis thaliana
using RNA differential display. Eur J Biochem 2001, 268:5521–
5529.
31.Brkljačić JM, Samardžić JT, Timotijević GS, Maksimović VR:
Expression analysis of buckwheat (Fagopyrum esculentum
Moench) Metallothionein-like gene (MT3) under different
stress and physiological conditions. J. Plant Physiol 2004,
161:741–746.
62
32.Vandenabeele S, Vanderauwera S, Vuylsteke M, Rombauts S,
Langebartels C, Seidlitz HK, Zabeau M, Van Montagu M, Inzé D, Van
Breusegem F: Catalase deficiency drastically affects gene
expression induced by high light in Arabidopsis thaliana. The
Plant J 2004, 39:45-58.
33.Teixeira FK, Menezes-Benavente L, Galvão VC, Margis-Pinheiro M:
Multigene families encode the major enzymes of antioxidant
metabolism in Eucalyptus grandis L. Gen and Mol Biol 2005,
28:529-538.
34.Scandalios JG: Subunit dissociation and recombination of
catalase isozymes. Proc Natl Acad Sci USA 1965, 53:1035-1040.
35.Havir AE, McHale NA: Biochemical and developmental
characterization of multiple forms of catalase in tobacco
leaves. Plant Physiol 1987, 84:450-455.
36.Willekens H, Langebartels C, Tiré C, Van Montagu M, InzéDand Van
Camp W: Differential expression of catalase genes in
Nicotiana plumbaginifolia (L.). Proc Natl Acad Sci USA 1994,
91:10450-10454.
37.Frugoli JA, Zhong HN, Nuccio ML, McCourt P, McPeek MA, Thomas
TL, McClung CR: Catalase is encoded by a small multigene
family in Arabidopsis thaliana (L.) Heynh. Plant Physiol 1996,
112:327-336.
38.Iwamoto M, Maekawa M, Sato A, Higo H, Higo K: Evolutionary
relationship of plant catalase genes inferred from exon-intron
structures: Isozymes divergence after the separation of
monocots and dicots. Theor App Genet 1998, 97:9-19.
39.Corpas FJ, Barroso JB, del Río LA: Peroxisomes as a source of
reactive oxygen species and nitric oxide signal molecules in
plant cells. Trends Plant Sci 2000, 6:145-150.
40.Tolbert NE: Microbodies-peroxisomes and glyoxysomes. Annu.
Rev. Plant Physiol 1971, 22:45-74.
41.Tolbert NE, Oeser A, Kisaki T, Hageman RH, Yamazaxi RK:
Peroxisomes from spinach leaves containing enzymes related
to glycolate metabolism. J. Biol. Chem 1968, 243:5179-5184.
63
42.Frederick SE, Gruber PJ, Tolbert NE: The Occurrence of
glycolate dehydrogenase and glycolate oxidase in green
plants. Plant Physiol 1973, 52:318-323.
43.Mano S, Hayashi M, Nishimura M: Light regulates alternative
splicing of hydroxypyruvate reductase in pumpkin. Plant J
1999, 17:309–320.
44.Tsugeki R, Hara-Nishimura I, Mori H, Nishimura M: Cloning and
sequencing of cDNA for glycolate oxidase from pumpkin
cotyledons and northern blot analysis. Plant Cell Physiol 1993,
34:51–57.
45.Yamaguchi K, Nishimura M: Reduction to below threshold levels
of glycolate oxidase activities in transgenic tobacco enhances
photoinhibition during irradiation. Plant Cell Physiol 2000,
41(12):1397–1406.
46.Raines CA, Lloyd JC, Dyer T: New insights into the structure and
function of sedoheptulose-1,7-bisphosphatase; an important
but neglected Calvin cycle enzyme. J Exp Bot 1999, 50:1–8.
47.Brandes HK, Larimer FW, Hartman FC: The molecular pathway
for the regulation of phosphoribulokinase by thioredoxin F. J
Biol Chem 1996, 271:3333–3335.
48.Raines CA, Longstaff M, Lloyd JC, Dyer TA: Complete coding
sequence of phosphoribulokinase: developmental and
lightdependent expression of the mRNA. Mol Gen Genet 1989,
220:43–48.
49.Wedel N, Soll J: Evolutionarily conserved light regulation of
Calvin cycle activity by NADPH-mediated reversible
phosphoribulokinase/ CP12/ glyceraldehyde-3-phosphate
dehydrogenase complex dissociation. Proc Natl Acad Sci USA
1998, 95:9699–9704.
50.Marri L, Sparla F, Pupillo P, Trost P: Co-ordinated gene
expression of photosynthetic glyceraldehyde-3-phosphate
dehydrogenase, phosphoribulokinase, and CP12 in
Arabidopsis thaliana. J Exp Bot 2005, 56(409):73–80.
51.Lemaire SD, Stein M, Issakidis-Bourguette M, Keryer E, Benoit V,
Pineau B, Gerard-Hirne C, Miginiac-Maslow M, Jacquot JP: The
64
complex regulation of ferredoxin/thioredoxinrelated genes by
light and the circadian clock. Planta 1999, 209:221–229.
52.Putterill J, Robson F, Lee K, Simon R, Coupland G: The CONSTANS
gene of Arabidopsis promotes flowering and encodes a
protein showing similarities to zinc finger transcription
factors. Cell 1995, 80:847–858.
53.Mouradov A, Cremer F, Coupland G: Control of flowering time:
interacting pathways as a basis for diversity. Plant Cell 2002,
Suppl S111–S130.
54.Simpson GG, Dean C: Arabidopsis, the rosetta stone of
flowering time. Science 2002, 296:285–289.
55.Samach A, Onouchi H, Gold SE, Ditta GS, Schwarz-Sommer Z,
Yanofsky MF, Coupland G: Distinct roles of CONSTANS target
genes in reproductive development of Arabidopsis. Science
2000, 288:1613–1616.
56.Suárez-López P, Wheatley K, Robson F, Onouchi H, Valverde F,
Coupland G: CONSTANS mediates between the circadian clock
and the control of flowering in Arabidopsis. Nature 2001,
410:1116–1119.
57.Robson F, Costa MMR, Hepworth SR, Vizir I, Pineiro M, Reeves PH,
Putterill J, Coupland G: Functional importance of conserved
domains in the flowering-time gene CONSTANS demonstrated
by analysis of mutant alleles and transgenic plants. Plant J
2001, 28:619–631.
58.Borden KLB: RING fingers and B-boxes: Zinc-binding protein-
protein interaction domains. Biochem Cell Biol 1998, 76:351–
358.
59.Tamagnone L, Merida A, Parr A, Mackay S, Culianez-Macia FA,
Roberts K, Martin C: The AmMYB308 and AmMYB330
transcription factors from antirrhinum regulate
phenylpropanoid and lignin biosynthesis in transgenic
tobacco. Plant Cell 1998, 10:135–154.
60.Payne CT, Clement J, Arnold D, Lioyd A: Heterologous MYB genes
distinct from GL1 enhance trichome production when
65
overexpressed in Nicotiana tabacum. Development 1999,
126:671–682.
61.Li L, Osakabe Y, Joshi CP, Chiang VL: Secondary xylem-specific
expression of caffeoyl-coenzyme A 3-Omethyltransferase plays
an important role in the methylation pathway associated with
lignin biosynthesis in loblolly pine. Plant Mol Biol 1999, 40:555–
565.
62.Araki S, Ito M, Soyano T, Nishihama R, Machida Y: Mitotic cyclins
stimulate the activity of c-Myb-like factors for transactivation
of G2/M phase-specific genes in tobacco. J Biol Chem 2004,
279:32979–88.
63.Nagaoka S, Takano T: Salt tolerance-related protein STO binds
to a Myb transcription factor homologue and confers salt
tolerance in Arabidopsis. J Exp Bot 2003, 54:2231–2237.
64.Wang ZY, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM: A
Myb-related transcription factor is involved in the
phytochrome regulation of an Arabidopsis
Lhcb gene. Plant Cell 1997, 9:491–507.
65.Newman LJ, Perazza DE, Juda L, Campbell MM: Involvement of
the R2R3-MYB, AtMYB61, in the ectopic lignification and
dark-photomorphogenic components of the det3 mutant
phenotype. Plant J 2004, 37:239–50.
66.Yanhui C, Xiaoyuan Y, Kun H, Meihua L, Jigang L, Zhaofeng G,
Zhiqiang L, Yunfei Z, Xiaoxiao W, Xiaoming Q, Yunping S, Li Z,
Xiaohui D, Jingchu L, Xing-Wang D, Zhangliang C, Hongya G, Li-Jia
Q: The MYB transcription factor superfamily of Arabidopsis:
expression analysis and phylogenetic comparison with the
rice MYB family. Plant Mol Biol 2006, 60:107–124.
67.Liang Y-K, Dubos C, Dodd IC, Holroyd GH, Hetherington AM,
Campbell MM: AtMYB61, an R2R3-MYB transcription factor
controlling stomatal aperture in Arabidopsis thaliana. Curr
Biol 2005, 15:1201–1206.
68.Suzuki K, Suzuki Y, Kitamura S: Cloning and expression of a
UDP-glucuronic acid decarboxylase gene in rice. J Exp Bot
2003, 54(389):1997-1999.
66
69.Moriarity JL, Hurt JH, Resnick AC, Storm PB, Laroy W, Schnaar RL,
Snyder SH: UDP-glucuronate decarboxylase, a key enzyme in
proteoglycan synthesis. J Biol Chem 2002, 277:16968-16975.
70.Kobayashi M, Nakagawa H, Suda I, Miyagawa I, Matoh T:
Purification of UDP-D-glucuronate carboxy-lyase (UDP-D-
xylose synthase) from pea seedlings. Plant Cell Physiol 2002,
43:1259-1265.
71.Harper AD, Bar-Peled M: Biosynthesis of UDP-xylose. Cloning
and characterization of a novel Arabidopsis gene family, UXS,
encoding soluble and putative membrane-bound UDP-
glucuronic acid decarboxylase isoforms. Plant Physiol 2002,
130:2188-2198.
72.Viikari L, Kantelinen A, Sundquist J, Linko M: Xylanases in
bleaching – from an idea to the industry. FEMS Microbiol Rev
1994, 13:335–350.
73.Bindschedler LV, Tuerck J, Maunders M, Ruel K, Petit-Conil M,
Danoun S, Boudet AM, Joseleau JP, Bolwell GP: Modification of
hemicellulose content by antisense down-regulation of UDP-
glucuronate decarboxylase in tobacco and its consequences
for cellulose extractability. Phytochemistry 2007, 68:2635–2648.
74.Rosinski JA, Atchley WR: Molecular evolution of the Myb family
of transcription factors: evidence for polyphyletic origin. J Mol
Evol 1998, 46:74–83.
75.Jin H, Martin C: Multifunctionality and diversity within the
plant MYB-gene family. Plant Mol Biol 1999, 41:577–585.
76.Stracke R, Werber M, Weisshaar B: The R2R3- MYB gene family
in Arabidopsis thaliana. Curr Opin Plant Biol 2001, 4:447–456.
77.Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B:
Differential combinatorial interactions of cis-acting elements
recognized by R2R3-MYB, BZIP, and BHLH factors control
light-responsive and tissue-specific activation of
phenylpropanoid biosynthesis genes. Plant Mol Biol 2005,
57:155–171.
78.Stracke R, Ishihara H, Huep G, Barsch A, Mehrtens F, Niehaus K,
Weisshaar B: Differential regulation of closely related R2R3-
67
MYB transcription factors controls flavonol accumulation in
different parts of the Arabidopsis thaliana seedling. Plant J
2007, 50:60–677.
79.Borevitz JO, Xia Y, Blount J, Dixon RA, Lamb C: Activation tagging
identifies a conserved MYB regulator of phenylpropanoid
biosynthesis. Plant Cell 2000, 12:2383–2394.
80.Deluc L, Barrieu F, Marchive C, Lauvergeat V, Decendit A, Richard
T, Carde JP, Merillon JM, Hamdi S: Characterization of a
grapevine R2R3-MYB transcription factor that regulates the
phenylpropanoid pathway. Plant Physiol 2006, 140:499–511.
81.Patzlaff A, McInnis S, Courtenay A, Surman C, Newman LJ, Smith C,
Bevan MW, Mansfield S, Whetten RW, Sederoff RR, Campbell MM:
Characterisation of a pine MYB that regulates lignification.
Plant J 2003, 36(6):743-754.
82.Karpinska B, Karlsson M, Srivastava M, Stenberg A, Schrader J,
Sterky F, Bhalerao R, Wingsle G: MYB transcription factors are
differentially expressed and regulated during secondary
vascular tissue development in hybrid aspen. Plant Mol Biol
2004, 56(2):255-270.
83.Goicoechea M, Lacombe E, Legay S, Mihaljevic S, Rech P, Jauneau
A, Lapierre C, Pollet B, Verhaegen D, Chaubet-Gigot N, Grima-
Pettenati J: EgMYB2, a new transcriptional activator from
Eucalyptus xylem, regulates secondary cell wall formation
and lignin biosynthesis. The Plant J 2005, 43:553–567.
84.Jin H, Cominelli E, Bailey P, Parr A, Mehrtens F, Jones J, Tonelli C,
Weisshaar B, Martin C: Transcriptional repression by AtMYB4
controls production of UV-protecting sunscreens in
Arabidopsis. EMBO J 2000, 19:6150–6161.
85.Preston J, Wheeler J, Heazlewood J, Li SF, Parish RW: AtMYB32 is
required for normal pollen development in Arabidopsis
thaliana. Plant J 2004, 40:979–995.
86.Fornale S, Sonbol FM, Maes T, Capellades M, Puigdomènech P,
Rigau J, Caparrós-Ruiz D: Down-regulation of the maize and
Arabidopsis thaliana caffeic acid O-methyl-transferase genes
by two new maize R2R3-MYB transcription factors. Plant Mol
Biol 2006, 62:809–823.
68
87.Legay S, Lacombe E, Goicoechea M, Brière C, Séguin S, Mackay J,
Grima-Pettenati J: Molecular characterization of EgMYB1, a
putative transcriptional repressor of the lignin biosynthetic
pathway. Plant Sci 2007, 173:542–549.
88.Zubieta C, Kota P, Ferrer J, Dixon RA, Noel JP: Structural basis for
the modulation of lignin monomer methylation by caffeic
acid/5-hydroxyferulic acid 3/5-O-methyltransferase. Plant Cell
2002, 14:1265-1277.
89.Ye Z-H, Kneusel RE, Matern U, Varner JE: An alternation
methylation pathway in lignin biosynthesis in Zinnia. Plant
Cell 1994, 6:1427-1439.
90.Ma QH, Xu Y: Characterization of a caffeic acid 3-O-
methyltransferase from wheat and its function in lignin
biosynthesis. Biochimie 2007, xx:1e10.
91.Pakusch A-E, Kneusel RE, Matern U: S-Adenosyl-lmethionine:
Trans-caffeoyl-coenzyme A 3-O-methyltransferase from
elicitor-treated parsley cell suspension cultures. Arch Biochem
Biophys 1989, 271:488–494.
92.Kühnl T, Koch U, Heller W, Wellmann E: Elicitor induced S-
adenosyl-l-methionine:caffeoyl-CoA 3-Omethyltransferase
from carrot cell suspension cultures. Plant Sci 1989, 60:21–25.
93.Ye Z-H: Association of caffeoyl coenzyme A 3-
Omethyltransferase expression with lignifying tissues in
several dicot plants. Plant Physiol 1997, 115:1341–1350.
94.Chen C, Meyermans H, Burggraeve B, De Rycke RM, Inoue K, De
Vleesschauwer V, Steenackers M, Van Montagu MC, Engler GJ,
Boerjan WA: Cell-specific and conditional expression of
caffeoyl-coenzyme A-3-O-methyltransferase in Poplar. Plant
Physiol 2000, 123:853–867.
95.Josè M, Puigdomènech, P: Hybrid-Proline rich and related
proteins. Current Topic in Mol. Genet 1994, 2:109–126.
96.Xu Y, Buchholz WG, DeRose RT, Hall TC: Characterization of a
rice gene family encoding root-specific proteins. Plant Mol Biol
1995, 27:237–248.
69
97.Blanco-Portales R, López-Raé JA, Bellido ML, Moyano E, Dorado G,
González-Reyes JA, Caballero JL, Munõz-Blanco J: A strawberry
fruit-specific and ripening-related gene codes for a HyPRP
protein involved in polyphenol anchoring. Plant Mol Biol 2004,
55:763–780.
98.John I, Wang H, Held BM, Wurtele E, Colbert JT: An mRNA that
specifically accumulates in maize roots delineates a novel
subset of developing cortical cells. Plant Mol Biol 1992, 20:821–
831.
99.Casab GJ: Plant cell wall proteins. Ann. Rev. Physiol. Plant Mol
Biol 1998, 49:281–309.
100.Festucci-Buselli RA, Otoni WC, Joshi CP: Structure,
organization, and functions of cellulose synthase complexes
in higher plants. Braz J Plant Physiol 2007, 19(1):1-13.
101.Persson S, Paredez A, Carroll A, Palsdottir H, Doblin M, Poindexter
P, Khitrov N, Auer M, Somerville CR: Genetic evidence for three
unique components in primary cell-wall cellulose synthase
complexes in Arabidopsis. Proc Natl Acad Sci USA 2007,
104(39):15566–15571.
102.Taylor NG, Howells RM, Huttly AK, Vickers K, Turner SR:
Interactions among three distinct CesA proteins essential for
cellulose synthesis. Proc Natl Acad Sci USA 2003, 100(3):1450-
1455.
103.Ranik M, Myburg AA: Six new cellulose synthase genes from
Eucalyptus are associated with primary and secondary cell
wall biosynthesis. Tree Physiol 2006, 26:545-556.
104.Meins F, Fritig B, Linthorst HJM, Mikkelsen JD, Neuhaus J-M,
Ryals J: Plant chitinase genes. Plant Mol Biol Rep 1994, 12:22–28.
105. Levorson J, Chlan CA: Plant chitinase consensus sequences.
Plant Mol Biol Rep 1997, 15:122–133.
106.Zhong R, Ripperger A, Ye Z-H: Ectopic deposition of lignin in
the pith of stems of two Arabidopsis mutants. Plant Physiol
2000, 123:59–69.
70
107.Zhong R, Kays SJ, Schroeder BP, Ye Z-H: Mutation of a
chitinase-like gene causes ectopic deposition of lignin,
aberrant cell shapes, and overproduction of ethylene. The
Plant Cell 2002, 14:165–179.
108.Gachon C, Mingam A, Charrier B: Real-time PCR: what
relevance to plant studies? J Exp Bot 2004, 55(402):1445-1454.
109.Rider SD, Henderson JT, Jerome RE, Edenberg HJ, Romero-
Severson J, Ogas J: Coordinate repression of regulators of
embryonic identity by PICKLE during germination in
Arabidopsis. Plant J 2003, 35:33–43.
110.Dallas PB, Gottardo NG, Firth MJ, Beesley AH, Hoffmann K, Terry
PA, Freitas JR, Boag JM, Cummings AJ, Kees UR: Gene expression
levels assessed by oligonucleotide microarray analysis and
quantitative real-time RT-PCR – how well do they correlate?
BMC Genomics 2005, 6:59.
111.Yuen T, Wurmbach E, Pfeffer RL, Ebersole BJ, Sealfon SC:
Accuracy and calibration of commercial oligonucleotide and
custom cDNA microarrays. Nucl Acids Res 2002, 30:e48.
112.Irizarry RA, Hobbs B, Collin F, Beazer-BarclayYD, Antonellis KJ,
Scherf U, Speed TP: Exploration, normalization, and summaries
of high density oligonucleotide array probe level data.
Biostatistics 2003, 4:249–264.
113.Tusher VG, Tibshirani R, Chu G: Significance analysis of
microarrays applied to the ionizing radiation response. Proc
Natl Acad Sci USA 2001, 98(9):5116–5121.
114.TIGR. [http://www.tm4.org/mev]
115.GenScript Corporation’s Real-Time PCR Primer Design
[http://www.genscript.com/ssl-bin/app/primer]
116.Livak KJ, Schmittgen TD: Analysis of relative gene expression
data using Real-Time quantitative PCR and the 2-ΔΔCT
method. Methods 2001, 25:402–408.
71
Supplemental Figure 1.
Graph representation of selected genes relative expression profile by in
silico analysis according to the SAM algorithm. The potentially codified
protein names are indicated in the legend. Axis “y” represents the relative
expression in log2. Axis “x” represents the analyzed samples, where:
Egr-cA - Eucalyptus grandis
r1 - clone 1
r2 - clone 2
L - leaves
X - xylem
b1 - block 1 (slide)
b2 - block 2 (slide)
72
73
74
Supplemental Figure 2.
The dissociation curves from qRT-PCR amplification of primers designed
were obtained after 40 cycles of amplification. The reaction specificity is
observed by the presence of a single amplification peak. The occurrence
of more than one peak, on the other hand, reveals the presence of
unspecific products, and requires reaction optimization. The potentially
codified protein names are indicated above each figure. The peaks
correspond to each one of the six cDNAs from the tissues samples. A
negative control was used in each reaction (line without peak).
Metallothionein-like protein type 3 (MT3)
75
putative UDP-glucuronate decarboxylase 2 (UDP-gluc 2)
unknown protein 2 (UNK2)
76
glycolate oxidase (GO)
catalase (CAT)
77
unknown protein 1 (UNK1)
hypothetical protein (UNK3)
78
MYB transcription factor 142 (MYB142)
caffeoyl-CoA 3-O-methyltransferase (CCOAMT)
79
cellulose synthase 3 (CeSA3)
MYB transcription factor (MYB)
80
CAPÍTULO III
O PROJETO GENOLYPTUS E OS EXPERIMENTOS DE
MICROARRANJOS DE DNA: CONSIDERAÇÕES EXTRAS,
RESULTADOS E DISCUSSÃO
A idéia de realizar experimentos de microarranjos de DNA, assim
como a definição dos objetivos, projeção dos experimentos e seleção do
material biológico apropriado para testar as hipóteses de interesse
(diferenças de expressão gênica entre tecido vascular de E. grandis e E.
globulus e entre folhas e xilemas de E. grandis) foram realizados por
membros do Projeto Genolyptus. Como descrito no Capítulo II, os ensaios
de síntese de sondas oligonucleotídicas, marcação de cDNAs,
hibridizações, lavagens, coleta de dados e análises preliminares foram
desenvolvidos pela empresa NimbleGen Systems Inc. Os dados brutos
foram, então, enviados ao grupo Genolyptus para a realização de análises
mais refinadas e, finalmente, para a seleção de genes-candidatos. Neste
Capítulo III estão descritas, de forma mais completa e justificada, as
etapas realizadas desde a coleta de amostras biológicas até a seleção de
genes-candidatos, apresentando-se os respectivos resultados e discussões
pertinentes. A descrição técnica de “Materiais & Métodos” utilizados
estão apresentados no Capítulo II.
Da coleta de amostras ao envio dos RNAs para os ensaios de
microarranjo de DNA
As amostras coletadas para os experimentos de microarranjo de
DNA estão enumeradas na Tabela 1. As extrações de RNA foram
realizadas com o kit PureLink Plant RNA Reagent (Invitrogen) de acordo
com o protocolo “Miniprep” fornecido pelo fabricante. A análise da
81
qualidade e da quantidade dos RNAs foi realizada por leitura em
espectrofotômetro nos comprimentos de onda de 260 nm e de 280 nm. Os
resultados (Tabela 2) confirmaram os baixos índices de polissacarídeos,
compostos fenólicos e proteínas contaminantes, comprovados pelas
razões das absorbâncias Abs
260
/Abs
280
superiores a 1,8 (Ausubel et al.,
1997). Na Figura 1 está representada a comprovação de que as amostras
de RNA encontravam-se íntegras e em quantidades apropriadas, como
pode ser observado pela localização e intensidade das bandas referentes
aos rRNAs 28S e 18S, considerados bons indicadores da baixíssima ou
ausente degradação das amostras (Ausubel et al., 1997).
82
NOME DA
AMOSTRA
TECIDO CLONE
GR-XY-A1
Xilema A1
GR-XY-A2
A2
GR-XY-B1
B1
GR-XY-B2
B2
GR-ML-A1
Folhas
Maduras
B1
GR-ML-A2
B2
Figura 1. Imagem do resultado da eletroforese em gel de agarose a 1,5%
em tampão TAE 1X corado com 0,01 mg/L de brometo de etídio. Foram
aplicadas no gel amostras de 5 µL (derivados de volumes totais de 330 µL)
de RNA total extraído de folhas maduras de dois clones de E. grandis (G1 e
G2); xilemas de quatro clones de E. grandis (G3-G6). Como marcador de
tamanhos de fragmentos de DNA foi utilizado o GeneRuler 1 kb DNA Ladder
(Fermentas).
Tabela 1. Identidade das amostras biológicas coletadas para os ensaios
de microarranjos de DNA do Projeto Genolyptus.
As amostras de RNA foram enviadas para a empresa NimbleGen,
onde os microarranjos de DNA foram confeccionados. Para verificar a
qualidade das amostras de RNA, técnicos da empresa as submeteram à
análise com o equipamento Bioanalyzer (Agilent Technologies Inc.)
baseado em eletroforese capilar. O resultado está representado na Figura
2. As múltiplas bandas de RNA foliar diferentes dos rRNAs 28S e 18S
visualizadas nas canaletas 1 e 2 representam rRNAs de cloroplastos, 16S
e 23S (Patterson & Smillie, 1971; Smart et al., 1999; Tattersall et al.,
2005; Wang et al., 2005).
Amostras
de RNA
Abs
260
Abs
280
260/280 Concentraçã
o (ng/µL)
20 µg
(µL)
G1 0.053 0.000 ----------- 212 94.339
G2 0.077 0.013 5.923 308 64.935
G3 0.117 0.036 3.250 468 42.735
G4 0.130 0.043 3.023 520 38.461
G5 0.211 0.081 2.604 844 23.693
G6 0.181 0.062 2.919 724 27.624
Tabela 2. Resultados das avaliações espectrofotométricas das amostras
de RNA total preparadas para ensaios de hibridização de microarranjos
de DNA.
83
Do experimento de microarranjo ao processamento dos dados
brutos
As etapas subseqüentes do experimento de microarranjo foram
realizadas na empresa NimbleGen. Estas incluíram: síntese de cDNAs com
marcação com o grupo fluoróforo Cy3, hibridizações, lavagens, scanning,
coleta de dados e normalizações preliminares dos dados, conforme
metodologias da empresa.
Em relação à arquitetura dos microarranjos, cada gene foi avaliado
por um conjunto de nove sondas, em duplicata, as quais apresentaram
distintas constantes de afinidade pelo alvo e, conseqüentemente,
diferentes níveis de intensidade do sinal. Para que a medida final de
intensidade representasse uma quantificação dos níveis de mRNA
presentes nas amostras hibridizadas, foi necessária a transformação dos
valores de intensidade, referentes às sondas, em um único valor de
intensidade final (Irizarry et al., 2003). Para se chegar a esta etapa,
primeiramente os dados foram processados pela NimbleGen. Os passos de
processamento dos dados visaram eliminar o background, quantificar os
sinais de fluorescência, examinar a qualidade dos dados e normalizá-los
para a análise.
84
Figura 2. Imagem derivada da eletroforese capilar de fração das
amostras de RNA total de Eucalyptus enviadas à NimbleGen e executada
por técnicos daquela empresa com o equipamento Bioanalyzer (Agilent
Technologies Inc.). A ordem de amostras aplicadas foi: (L) Marcador de
tamanhos de fragmentos de DNA (origem não informada); (1 a 6)
amostras G1 a G6, conforme legenda da Figura 1; (7-10) outras amostras
de RNA de Eucalyptus (11 e 12); controles de RNAs ribossômicos de
eucariotos (origem não informada).
Após o processamento, os dados foram enviados aos nossos
laboratórios. Estes, quando recebidos, foram submetidos a nova
normalização pelo método “Análise Robusta de Multi-arranjos” (do inglês,
Robust Multi-Array Analysis ou RMA; Irizarry et al., 2003). Somente após
essas etapas, a identificação dos genes candidatos e a interpretação dos
dados puderam ser realizadas, visando o reconhecimento dos padrões de
expressão gênica e a compreensão do significado biológico de tais
padrões (Clarke & Zhu, 2006).
Das análises preliminares aos resultados finais
As análises preliminares foram realizadas a fim de avaliar a
consistência dos dados dos microarranjos fornecidos pela plataforma da
NimbleGen. Para tanto, foram realizadas comparações entre diversos
grupos de amostras pelo Teste t (resultados não apresentados). A
consistência dos dados foi comprovada em termos da baixa variação
observada entre os blocos do mesmo slide (chip) e entre as réplicas
biológicas, ou seja, com uma elevada reprodutibilidade. Assim, como
resultado, foi possível validar a robustez dos microarranjos realizados
pela NimbleGen.
85
As análises dos dados já normalizados referentes aos quatro
microarranjos de DNA específicos às folhas e xilemas dos clones 1 e 2
derivados de uma matriz de E. grandis foram realizadas pelo método
“Análise da Significância de Microarranjos” (do inglês, Significance
Analysis of Microarrays ou SAM; Tusher et al., 2001). O algoritmo SAM
faz parte do pacote MeV, disponibilizado pelo TIGR, e é uma alternativa ao
Teste t de Student para a busca de expressão diferencial. Este teste leva
em consideração o grande número de genes analisados e garante um nível
de erro de 0%, diferentemente dos testes estatísticos comumente
utilizados, como o Teste t ou a “Análise da Variância” (ANOVA, com
porcentagens de erro de no mínimo 1%). No caso da análise desse
experimento de microarranjo que incluiu um total de 21.442 seqüências
únicas, um erro de 1% poderia significar 214 genes com falsa expressão
diferencial.
O método SAM baseia-se na razão entre a mudança na expressão
gênica entre duas condições e o erro padrão das medições. O algoritmo
SAM permite identificar genes com mudanças estatísticas significantes na
expressão por meio da realização de conjuntos de Testes t gene-
específicos. Genes com valores maiores do que o ponto de corte são
considerados potencialmente significantes. A porcentagem desses genes
identificados ao acaso é a denominada “Falsa Razão de Descobertas” (do
inglês, False Discovery Rate ou FDR) que, nestas análises, foi de 0%.
No algoritmo SAM, os dados de cada gene são permutados e um
valor estatístico d (d-value) é computado para ambos os dados, o original
e o permutado de cada gene. Nas análises finais, utilizamos o teste de
duas classes não pareadas. Nesse tipo de análise, d é análogo ao valor
estatístico t do Teste t, no qual é capturada a diferença entre os níveis de
expressão média das condições experimentais, representados pela medida
da variância dos dados. Na análise de duas classes, genes são
86
considerados positivos se a média de expressão do grupo B for
significantemente maior que a do grupo A. São considerados negativos se
o inverso ocorrer (MeV Manual, 2006).
Ao final das análises, o programa MeV gerou um gráfico interativo
(Figura 1 do capítulo II) onde estão os valores observados versus os
valores esperados (baseados nos d-values). O valor de delta foi ajustado
manualmente no gráfico e o mesmo representa a distância vertical (em
unidades de gráfico) da linha sólida que representa o grau de inclinação
(quando o observado é igual ao esperado) e entre duas linhas paralelas
pontilhadas que representam a região dentro da qual os genes são
considerados sem expressão diferencial significante. Saindo desta linha,
os genes apresentam expressão diferencial significativa. Foi utilizado,
ainda, o critério de fold change que determina o número de vezes que um
gene é mais ou menos expresso em relação a outro (MeV Manual, 2006).
87
Figura 3. Representação gráfica de 42 dos 302 genes diferencialmente
expressos entre folhas e xilema de E. grandis segundo análises dos
resultados de microarranjos de DNA. Cada linha da figura representa um
único gene que possui expressão variando entre baixa (verde) e alta (roxa)
em folhas (esquerda) e xilema (direita). Onde: Egr_cA, Eucalyptus
grandis; r1, clone 1; r2, clone 2; L, leaf; X, xylem; b1, block 1 (slide); b2,
block 2.
Com o objetivo principal de identificar os genes mais
diferencialmente expressos entre xilema e folhas de E. grandis, foram
comparados os dados normalizados dos microarranjos hibridizados com
cDNAs derivados dos xilemas e folhas dos clones 1 e 2 de uma única
matriz de E. grandis, denominada matriz “A”, incluindo os dois blocos de
cada slide (réplicas técnicas ou experimentais):
Grupo 1: FOLHAS Grupo 2: TECIDO
VASCULAR
Egr_cA_r1_L_b1 Egr_cA_r1_X_b1
Egr_cA_r1_L_b2 Egr_cA_r1_X_b2
Egr_cA_r2_L_b1 Egr_cA_r2_X_b1
Egr_cA_r2_L_b2 Egr_cA_r2_X_b2
Foram realizadas 70 permutações únicas entre os dois grupos e foi
utilizado um fold change de 2, ou seja, apenas genes com valor de
expressão diferencial mínimo de duas vezes foram selecionados. O valor
de delta utilizado foi de 9,15. Como resultados desta análise foram obtidos
153 genes com expressão maior em folhas e 149 genes com maior
expressão em tecido vascular de E. grandis. O perfil de expressão de
todos os genes analisados estão demonstrados nas Figuras 3, 4 e 5.
Do total de aproximadamente 300 genes, com base nos maiores
valores de fold change, foram selecionados os 30 genes candidatos mais
expressos em folhas e 30 mais expressos em xilema de E. grandis e seus
88
perfis de expressão foram analisados in silico. A seguir, uma busca pelos
clones de cDNA potencialmente mais completos e representativos de cada
um dos agrupamentos representados pelos 60 supostos genes foi
realizada no banco de dados de ESTs do Projeto Genolyptus. Em seguida,
a anotação foi refeita (com a ferramenta BLASTx) submentendo as
seqüências deduzidas de peptídeos dos 60 genes candidatos contra o
banco de seqüências protéicas derivadas de plantas disponíveis pelo NCBI
(dados não apresentados). Uma segunda seleção foi realizada baseada nas
identidades moleculares e homologias dos genes candidatos e seus
prováveis papéis no metabolismo em células vegetais. No total, 15 genes
foram selecionados (Tabela 3), seu perfil de expressão analisado in silico e
primers para qRT-PCR foram projetados, sendo seis mais expressos nas
folhas e nove no tecido vascular (dados demonstrados no Capítulo II). Por
meio dessa análise, foi possível verificar o alto nível de expressão
diferencial entre os genes selecionados.
Abreviatura Identidade (BLASTx)
Fold
Chang
e
(log
10
)
MT3
Proteína semelhante à metalotioneína
do tipo 3 [Carica papaya] 6e-26
2,55
GO
Glicolate-oxidase
[Mesembryanthemum crystallinum]
0.0
2,35
CAT Catalase [Prunus persica] 0.0 2,30
PRK
Fosforribulocinase precursora de
cloroplasto (PRK)
[Mesembryanthemum crystallinum]
0.0
2,27
MYB142
Fator de transcrição MYB do tipo
MYB142 [Glycine max] 3e-25
2,17
CO
Proteína tipo “dedo-de-zinco”
CONSTANS-LIKE 16, [Arabidopsis
thaliana] 5e-26
1,38
HyPRP2
Proteína rica em prolina híbrida do tipo
2 (HyPRP2) [Gossypium hirsutum] 9e-
24
1,15
UNK1
Proteina expressa [Arabidopsis
thaliana] 5e-11
2,09
UNK2
Proteina expressa [Arabidopsis
thaliana] 3e-110
2,00
89
UNK3
Proteína hipotética [Nicotiana
benthamiana] 4e-13
1,96
UDP-gluc 2
Descarboxilase de UDP-glicuronato do
tipo 2, [Nicotiana tabacum] 1e-175
1,87
ELP
Quitinase do tipo ELP [Arabidopsis
thaliana] 1e-20
1,79
CeSA3
Celulose-sintase tipo 3 [Eucalyptus
grandis] 0.0
1,60
MYB
Fator de transcrição MYB [Eucalyptus
gunnii] 7e-150
1,49
CCOAMT
Cafeoil-CoA-3-O-metiltransferase
[Linum usitatissimum] 3e-15
1,28
Tabela 3. Lista dos genes selecionados de acordo com a análise dos
microarranjos pelo método de SAM, com as respectivas abreviaturas. Os
valores de identidade atribuídos por BLASTx estão representados pelos E-
values.
90
Figura 4. Gráfico gerado pelo algoritmo SAM. Correspondente à
média e desvio-padrão das itensidades de sinal (em log2) dos genes nas
amostras de folhas (primeiras quatro à esquerda) e xilemas (últimas
quatro à direita) do experimento de microarranjo. A: Genes mais
expressos no tecido vascular. B: Genes mais expressos nas folhas. C:
Todos os genes com expressão diferencial significativa (sobreposição de A
e B). D: Genes sem expressão diferencial significativa.
91
Figura 5. Gráfico gerado pelo algoritmo SAM. Cada linha
representa a itensidade de sinal (em log2) de um único gene nas amostras
de folhas (primeiras quatro à esquerda) e xilemas (últimas quatro à
direita) do experimento de microarranjo. A linha rosa representa a média.
A: Genes mais expressos no tecido vascular. B: Genes mais expressos nas
folhas. C: Todos os genes com expressão diferencial significativa
(sobreposição de A e B). D: Genes sem expressão diferencial significativa.
92
O pacote MeV (fornece, ainda, diversas outras ferramentas para a
análise de dados de microarranjos de DNA. A formação de agrupamentos
(clusters) de genes com perfis semelhantes de expressão é uma dessas
ferramentas. Métodos para a análise de clusters fornecem uma maneira
relativamente simples de organizar informações, pois permitem ao
usuário ver, entender e analisar os dados com maior facilidade.
O grande número de genes e a complexidade das vias metabólicas
aumentam em muito os desafios de compreender e interpretar os tantos
dados resultantes da análise de microarranjos de DNA. O primeiro passo
em direção a esse desafio é o uso de técnicas de clustering (“agrupar”), as
quais são essenciais na identificação de padrões interessantes dos dados.
No caso da análise do experimento de microarranjo como um todo, o
agrupamento de genes em clusters permite separar, juntamente com
genes de função conhecida e de interesse, muitos outros genes que
possuem um padrão de expressão semelhante e provavelmente estejam
envolvidos numa mesma rota metabólica ou exerçam função semelhante.
Clusters apenas dos genes estudados por qRT-PCR foram criados neste
trabalho, como exemplificado na Figura 6. O primeiro método utilizado foi
o de “Análise Hierárquica de Clusters” (do inglês, Hierarchical Cluster
Analysis ou HCL). Outro tipo de método utilizado para a análise dos dados
foi o da “Técnica de Busca de Clusters por Afinidade” (do inglês, Cluster
Affinity Search Technique ou CAST). Este método permitiu a geração de 5
clusters segundo os perfis de expressão gênica, conforme ilustrado na
Figura 7. O perfil de expressão de cada cluster pode ser visualizado na
Figura 8.
93
Figura 6. Análise Hierárquica de Clusters (HCL) de 15 genes de E.
grandis selecionados segundo suas expressões diferenciais em folhas e
xilema. A escala de cores na parte superior da figura demonstra a
expressão baixa (azul) a alta (amarela) para os genes analisados. Onde:
Egr_cA, Eucalyptus grandis; r1, clone 1; r2, clone 2; L, leaf; X, xylem; b1,
block 1 (slide); b2, block 2.
A - Cluster 1
B - Cluster 2
94
C - Cluster 3
D - Cluster 4
E - Cluster 5
Figura 7: Clusters formados pela técnica CAST e os genes
participantes de cada cluster. A-E: Cluster 1: MT3, GO, CAT, PRK e
MYB142; Cluster 2: CO; Cluster 3: CCOAMT; Cluster 4: ELP, CeSA3,
UNK1, UNK2 e UNK3; Cluster 5: MYB, UDP-gluc 2 e HyPRP2
(abreviações de acordo com Tabela 2 do Capítulo II). Onde: Egr_cA,
Eucalyptus grandis; r1, clone 1; r2, clone 2; L, leaf; X, xylem; b1, block 1
(slide); b2, block 2.
95
Figura 8: Clusters formados pela técnica CAST e o perfil de expressão
dos genes de cada cluster. Valores de expressão em escala log
2
. O nome
do cluster está indicado no canto inferior esquerdo de cada quadro. A-E:
Cluster 1: MT3, GO, CAT, PRK e MYB142; Cluster 2: CO; Cluster 3:
CCOAMT; Cluster 4: ELP, CeSA3, UNK1, UNK2 e UNK3; Cluster 5:
MYB, UDP-gluc 2 e HyPRP2 (abreviações de acordo com Tabela 2 do
Capítulo II).
Estratégias genômicas baseadas em microarranjos e outras técnicas
de larga-escala estão tornando-se cada vez mais importantes na biologia e
química. Como resultado, é necessário desenvolver táticas para
96
A
B
C
D
E
“enxergar” a informação contida em um enorme número de tabelas de
medidas quantitativas produzidas por este tipo de técnica. Uma premissa
básica na organização de dados de expressão gênica é agrupar genes com
padrões muito similares de expressão (Eisen et al., 1998). Seria esperado
que os genes agrupados num mesmo cluster exercessem a mesma função
biológica ou que estivessem sob o controle dos mesmos fatores de
transcrição. É importante ressaltar que o uso de técnicas de validação das
análises de clusters é necessário para que as mesmas sejam confiáveis
(Handl et al., 2005).
Como resultado da análise pela técnica CAST, pode-se ver a visível
separação de grupos de genes com padrões de expressão semelhantes. O
cluster 1 engloba os genes mais diferencialmente expressos nas folhas de
E. grandis (MT3, GO, CAT, PRK e MYB142), que possuem uma expressão
diferencial média de 2,3 (Fold change em escala log
10
). O cluster 2 é
composto somente pelo gene CO, que apresenta menor grau de expressão
diferencial nas folhas (1,4). Os clusters 3, 4 e 5 englobam somente genes
diferencialmente expressos nos tecidos vasculares. Enquanto o cluster 3
abriga o gene CCOAMT, que é o menos diferencialmente expresso, o
cluster 4 agrupa genes com a maior expressão diferencial no xilema (ELP,
CeSA3, UNK1, UNK2 e UNK3), com média de fold change de 1,7. Já no
cluster 5, estão genes com uma variação um pouco menor de expressão
entre folhas e xilema. São estes: MYB, UDP-gluc 2 e HyPRP2, com média
de fold change de 1,5.
A técnica de análise de cluster, como pôde ser visto neste caso,
mostrou-se confiável. No caso do uso deste tipo de técnica para análise
global de experimentos de microarranjo, é de extrema importância que os
resultados obtidos possam e sejam validados assim como o são os
resultados das análises de expressão gênica do experimento de
microarranjo.
97
Selecionar uma grande quantidade de genes potencialmente
interessantes a partir de experimentos de microarranjos de DNA e
confirmar os candidatos por análise de RT-PCR quantitativo em tempo real
é uma estratégia amplamente utilizada. Existem diversos trabalhos
demonstrando a correlação entre experimentos de microarranjos e análise
de qRT-PCR. Enquanto numerosos estudos obtiveram resultados similares
por RT-PCR quantitativo em tempo real e experimentos de microarranjos,
com uma correlação linear de até cinco ordens de magnitude, muitos
outros artigos relataram que a variação, em número de vezes, medida
pelo qRT-PCR foi geralmente menor (em até 10 vezes) do que a variação
medida quando se utilizam experimentos de microarranjos, nos quais
podem ocorrer hibridização cruzada para genes muito semelhantes,
porém distintos (revisado em Gachon et al., 2004). Em 2003, Wang et al.
demonstraram que dados gerados por PCR em tempo real poderiam
apresentar valores em escala maior do que os dados gerados por
microarranjos, porém conservando ainda uma boa correlação entre as
duas técnicas. Dados obtidos a partir do trabalho de Dallas et al. (2005)
indicam que as correlações entre qRT-PCR e experimentos de
microarranjos são geralmente fortes, um resultado um tanto encorajador
para pesquisadores com acesso a pouca quantidade ou raro acesso a
amostras. Nesse trabalho, é enfatizada a importância de garantir que a
reação de PCR e o experimento de microarranjo reconheçam o mesmo
transcrito. Em todos os casos, RT-PCR em tempo real é considerada a
técnica mais confiável e discrepâncias podem freqüentemente ser
consideradas como resultado dos métodos de normalização e subtração de
backgrounds utilizados na análise de microarranjos. Como resultado,
análises de qRT-PCR estão sendo utilizadas como referência para
comparar diferentes métodos de análises de experimentos de
microarranjos (Puthoff et al., 2003).
98
CONSIDERAÇÕES FINAIS
No presente trabalho, foi realizada a análise de experimentos de
microarranjos de DNA com o objetivo de encontrar genes
diferencialmente expressos entre folhas e xilema de E. grandis, assim
como escolher genes para futuros caracterização e estudo. Por se tratar
de uma tecnologia nova e nunca antes utilizada no Centro de
Biotecnologia da UFRGS, a análise dos microarranjos requisitou o
estabelecimento de técnicas de bioinformática e estatística. Após a
primeira etapa de análise e validação de resultados, os dados gerados
estão sendo de extrema utilidade para o projeto Genolyptus como um
todo, fornecendo bases científicas que deverão ser testadas
experimentalmente, dando origem a outros projetos em muitos dos
laboratórios participantes. Tais projetos incluem a super-expressão e a
inibição (RNAi) dos genes diferencialmente expressos em plantas de A.
thaliana, Nicotiana tabacum e um modelo experimental de Eucalyptus sp.
em desenvolvimento, assim como estudos de fatores de transcrição
diferencialmente expressos em xilemas de E. grandis e E. globulus. A
partir dos resultados gerados após esta primeira etapa, novos
experimentos de microarranjos para indivíduos selecionados serão
realizados com a finalidade de fornecer informação em abundância sobre
os principais processos envolvidos na gênese da madeira de Eucalyptus.
REFERÊNCIAS BIBLIOGRÁFICAS (Capítulos I e III)
Abbott, A.; Georgi, L.; Yvergniaux, D.; Wang, Y.; Blenda, A.; Reighard,
G.; Inigo, M. & Sosinski B. Peach the model genome for Rosaceae. Acta
Hort., 575: 145–155, 2002.
ABRAF. Anuário estatístico da ABRAF: ano base 2006. ABRAF Brasília,
2007.
99
Disponível em: http: <www.abraflor.org.br/estatisticas/anuario-ABRAF-
2007.pdf>. acesso em dezenove de dezembro de 2007.
Alba, R.; Payton, P.; Fei, Z.; McQuinn, R.; Debbie, P.; Martin, G. B.;
Tanksley S. D. & Giovannoni, J. J. Transcriptome and selected
metabolite analyses reveal multiple points of ethylene control during
tomato fruit development. The Plant Cell, 17: 2954–2965, 2005.
Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St.Cyr, S.; Carlis, J.; Riedl,
J.; Retzel, E.; Campbell, M. M.; Sederoff, R. & Whetten, R. W. Analysis
of xylem formation in pine by cDNA sequencing. P Natl Acad Sci USA,
95: 9693-9698, 1998.
An, G.; Ebert, P. R.; Yi, B. & Choi, C. H. Both tata box and upstream
regions are required for the nopaline synthase promoter activity in
transformed tobacco cells. Mol Gen Genet, 203: 245–250, 1986.
Andersson-Gunneras, S.; Mellerowicz, E. J.; Love, J.; Segerman, B.;
Ohmiya, Y.; Coutinho, P. M.; Nilsson, P.; Henrissat, B.; Moritz, T. &
Sundberg, B. Biosynthesis of cellulose-enriched tension wood in
Populus: global analysis of transcripts and metabolites identifies
biochemical and developmental regulators in secondary wall
biosynthesis. Plant J, 45: 144–165, 2006.
Aspeborg, H.; Schrader, J.; Coutinho, P. M.; Stam, M.; Kallas, A.; Djerbi,
S.; Nilsson, P.; Denman, S.; Amini, B.; Sterky, F.; Master, E.; Sandberg,
G.; Mellerowicz, E.; Sundberg, B.; Henrissat, B. & Teeri, T. T.
Carbohydrate-active enzymes involved in the secondary cell wall
biogenesis in hybrid aspen. Plant Physiol, 137: 983–997, 2005.
Ausubel, F. M.; Brent, R.; Kingston, R. E.; Moore, D. D.; Smith, J. A.;
Seidman, J.G. & Stuhl, K. Current Prot Mol Biol. New York: John Wiley
and Sons, 1997.
Beers, E. P. & Zhao, C. Arabidopsis as a model for investigating gene
activity and function in vascular tissues. Molecular breeding of wood
plants. Proceedings of the International Wood Biotechnology
Symposium, Narita, Japan, 43: 52, 2001.
Bergeron, D.; Boivin, R.; Baszczynski, C. L. & Bellemare, G.
Rootspecific expression of a glycine-rich protein in Brassica napus.
Plant Sci, 96: 87–98, 1994.
100
Bhandari, S.; Fujino, T.; Thammanagowda, S.; Zhang, D.; Xu, F. & Joshi,
C.P. Xylem-specific and tension stress-responsive coexpression of
KORRIGAN endoglucanase and three secondary wall-associated
cellulose synthase genes in aspen trees. Planta, 224: 828–837, 2006.
Boudet, A. M.; Kajita, S.; Grima-Pettenati, J. & Goffner, D. Lignins and
lignocellulosics: a better control of synthesis for new and improved
uses. TRENDS Plant Sci, 8(12): 576-581, 2003.
Bourquin, V.; Nishikubo, N.; Abe, H.; Brumer, H.; Denman, S.; Eklund,
M.; Christiernin, M.; Teeri, T. T.; Sundberg, B. & Mellerowicz, E. J.
Xyloglucan endotransglycosylases have a function during the formation
of secondary cell walls of vascular tissues. The Plant Cell, 14: 3073–
3088, 2002.
BRACELPA - Associação Brasileira de Celulose e Papel: Relatório anual
de desempenho 2006. Disponível em:
<http://www.bracelpa.org.br/bra/estatisticas/> acesso em dezenove de
dezembro de 2007.
Brito, J. O.; Barrichelo, L. E. G. & Seixas, F. Análise da Produção
Energética e de Carvão Vegetal de Espécies de Eucalipto. Instituto de
Pesquisas e Estudos Florestais, 23: 53-56, 1993.
Brunner, A. M.; Busov, V. B. & Strauss, S. H. Poplar genome sequence:
functional genomics in an ecologically dominant plant species. Trends
in Plant Sci, 9(1): 49-56, 2004.
Calsa, Jr. T. & Figueira, A.
Serial analysis of gene expression in
sugarcane (Saccharum spp.) leaves revealed alternative C
4
metabolism
and putative antisense transcripts. Plant Mol Biol, 63(6): 745-62, 2007.
Cassab, G. I. Plant cell wall proteins. Annu Rev Plant Phys, 49: 281–
309, 1998.
Chaffey, N. Cambium: old challenges - new opportunities. Trees-Struct
Funct, 13: 138-151, 1999.
Cheng, S. H.; Keller, B. & Condit, C. M. Common occurrence of
homologues of petunia glycine-rich protein-1 among plants. Plant Mol
Biol, 31: 163-168, 1996.
Chiang, V. L. Monolignol biosynthesis and genetic engineering of lignin
in trees, a review. Environ Chem Lett, 4: 143–146, 2006.
101
Clarke, J. D. & Zhu, T. Microarray analysis of the transcriptome as a
stepping stone towards understanding biological systems: practical
considerations and perspectives. Plant J, 45: 630–650, 2006.
Colodette, J. L.; Mokfienski, A.; Gomide, A. & Oliveira, R. Relative
importance of wood density and carbohydrate content on pulping yield
and product quality. J Tianjin Univ Sci Technol, 19(4): 71-80, 2004.
Dallas, P. B.; Gottardo, N. G.; Firth, M. J.; Beesley, A. H.; Hoffmann, K.;
Terry, P. A.; Freitas, J. R.; Boag, J. M.; Cummings, A. J. & Kees, U. R.
Gene expression levels assessed by oligonucleotide microarray analysis
and quantitative real-time RT-PCR – how well do they correlate? BMC
Genomics, 6: 59, 2005.
Demura, T.; Tashiro, G.; Horiguchi, G.; Kishimoto, N.; Kubo, M.;
Matsuoka, N.; Minami, A.; Nagata-Hiwatashi, M.; Nakamura, K.;
Okamura, Y.; Sassa, N.; Suzuki, S.; Yazaki, J.; Kikuchi, S. & Fukuda, H.
Visualization by comprehensive microarray analysis of gene expression
programs during transdifferentiation of mesophyll cells into xylem
cells. P Natl Acad Sci USA, 99(24): 15794–15799, 2002.
Doblin, M.; Kurek, I.; Jacob-Wilk, D. & Delmer, D. P. Cellulose
biosynthesis in plants: from genes to rosettes. Plant Cell Physiol, 43:
1407–1420, 2002.
Eisen, M. B.; Spellman, P. T.; Brown, P. O. & Botstein, D. Cluster
analysis and display of genome-wide expression patterns. Proc. Natl.
Acad. Sci. USA, 95: 14863-14868, 1998.
Emmanuel, E. & Levy, A. A. Tomato mutants as tools for functional
genomics. Curr Opin Plant Biol, 5: 112–117, 2002.
FAO – Food and Agriculture Organization. Forest products and
services.
Disponível em: < http://www.fao.org/forestry/index.jsp> acesso em
cinco de setembro de 2007.
Foucart, C.; Paux, E.; Ladouce, N.; San-Clemente, H.; Grima-Pettenati,
J. & Sivadon, P. Transcript profiling of a xylem vs phloem cDNA
subtractive library identifies new genes expressed during xylogenesis
in Eucalyptus. New Phytol, 170: 739–752, 2006.
102
Fukuda, H. Tracheary element differentiation. The Plant Cell, 9: 1147-
1156, 1997.
Gachon, C.; Mingam, A. & Charrier, B. Real-time PCR: what relevance
to plant studies? J Exp Bot, 55(402): 1445-1454, 2004.
Girke, T.; Todd, J.; Ruuska, S.; White, J.; Benning, C. H. & Ohlrogge, J.
Microarray analysis of developing Arabidopsis seed. Plant Physiol, 124:
1570–1581, 2000.
Gittins, J. R.; Pellny, T. K.; Biricolti, S.; Hiles, E. R.; Passey, A. J. &
James, D. J. Transgene expression in the vegetative tissues of apple
driven by the vascular-specific rolC and CoYMV promoters. Transgenic
Res, 12: 391–402, 2003.
Goes da Silva, F.; Iandolino, A.; Al-Kayal, F.; Bohlmann, M. C.;
Cushman, M. A.; Lim, H.; Ergul, A.; Figueroa, R.; Kabuloglu, E. K.;
Osborne, C.; Rowe, J.; Tattersall, E.; Leslie, A.; Xu, J.; Baek, JM.;
Cramer, G. R.; Cushman J. C. & Cook, D. R. Characterizing the grape
transcriptome. Analysis of expressed sequence tags from multiple Vitis
species and development of a compendium of gene expression during
berry development. Plant Physiol, 139: 574-597, 2005.
Grima-Pettanti, J. & Goffner, D. Lignin genetic engineering revisited.
Plant Sci, 145: 51–65, 1999.
Groover, A. T. What genes make a tree a tree? TRENDS Plant Sci, 10:
210-214, 2005.
Groover, A. & Robischon, M. Developmental mechanisms regulating
secondary growth in woody plants. Curr Opin Plant Biol, 9: 55–58,
2006.
Haberer, G.; Young, S.; Bharti, A. K.; Gundlach, H.; Raymond, C.; Fuks,
G.; Butler, E.; Wing, R. A.; Rounsley, S.; Birren, B.; Nusbaum, C.; Mayer,
K. F. X. & Messing, J. Structure and architecture of the maize genome.
Plant Physiol, 139: 1612–1624, 2005.
Handl, J.; Knowles, J. & Kell, D. B. Computational cluster validation in
post-genomic data analysis. Bioinformatics, 21: 3201-3212, 2005.
Hertzberg, M.; Aspeborg, H.; Schrader, J.; Andersson, A.; Erlandsson,
R.; Blomqvist, K.; Bhalerao, R.; Uhlén, M.; Teeri, T. T.; Lundeberg, J.;
103
Sundberg, B.; Nilsson, P. & Sandberg, G. A transcriptional roadmap to
wood formation. P Natl Acad Sci USA, 98(25): 14732–14737, 2001.
IPEF- Instituto de Pesquisas e Estudos Florestais. Chave de
identificação de Espécies Florestais. Piracicaba-SP. 2004. Disponível
em: <http://www.ipef.br/identificacao/cief/especies/grandis.asp>.
acesso em dezenove de dezembro 2007.
Israelsson, M.; Eriksson, M. E.; Hertzberg, M.; Aspeborg, H.; Nilsson,
P. & Moritz, T. Changes in gene expression in the wood-forming tissue
of transgenic hybrid aspen with increased secondary growth. Plant Mol
Biol, 52: 893–903, 2003.
Irizarry, R. A.; Hobbs, B.; Collin, F.; Beazer-Barclay, Y. D.; Antonellis, K.
J.; Scherf, U. & Speed, T. P. Exploration, normalization, and summaries
of high density oligonucleotide array probe level data. Biostatistics, 4:
249–264, 2003.
Jaillon, O.; Aury, J. M.; Noel, B.; Policriti, A.; Clepet, C.; Casagrande, A.;
Choisne, N.; Aubourg, S.; Vitulo, N.; Jubin, C.; Vezzi, A.; Legeai, F.;
Hugueney, P.; Dasilva, C.; Horner, D.; et al. French-Italian Public
Consortium for Grapevine Genome Characterization. The grapevine
genome sequence suggests ancestral hexaploidization in major
angiosperm phyla. Nature, 449: 463-467, 2007.
Joshi, C. P.; Bhandari, S.; Ranjan, P.; Kalluri, U. C.; Liang, X.; Fujino, T.
& Samuga, A. Genomics of cellulose biosynthesis in poplars. New
Phytol, 164: 53–61, 2004.
Keller, B.; Sauer, N. & Lamb, C. J. Glycine-rich cell wall proteins in
bean: gene structure and association of the protein with the vascular
system. EMBO J, 7: 3625–3633, 1988.
Ko, J. & Han, K. Arabidopsis whole-transcriptome profiling defines the
features of coordinated regulations that occur during secondary
growth. Plant Mol Biol, 55: 433–453, 2004.
Kubo, M.; Udagawa, M.; Nishikubo, N.; Horiguchi, G.; Yamaguchi, M.;
Ito, J.; Mimura, T.; Fukuda, H. & Demura, T. Transcription switches for
protoxylem and metaxylem vessel formation. Gene Dev, 19: 1855–1860,
2005.
104
Lawrence, C. J.; Dong, Q.; Polacco, M. L.; Seigfred, T. E. & Brendel, V.
MaizeGDB, the community database for maize genetics and genomics.
Nucl Acids Res, 32: D393–D397, 2004.
Lawton, M. A.; Tierney, M. A.; Nakamura, I.; Anderson, E.; Komeda, Y.;
Dube, P.; Hoffman, N.; Fraley, R. T. & Beachy, R. N. Expression of a
soybean beta-conclycinin gene under the control of the cauliflower
mosaic virus-35s and 19s-promoters in transformed petunia tissues.
Plant Mol Biol, 9: 315–324, 1987.
Li, L.; Lu, S. & Chiang, V. A Genomic and molecular view of wood
formation. Critical Rev Plant Sci, 25(3): 215-233, 2006.
Li, L.; Osakabe, Y.; Joshi, C. P. & Chiang, V. L. Secondary xylem-specific
expression of caffeoyl-coenzyme A 3-O-methyltransferase plays an
important role in the methylation pathway associated with lignin
biosynthesis in loblolly pine. Plant Mol Biol, 40: 555-565, 1999.
Liu, Z.; Wang, J.; Huang, X.; Xu, W.; Liu, Z. & Fang, R. The promoter of
a rice glycine-rich protein gene, Osgrp-2, confers vascular-specific
expression in transgenic plants. Planta, 216: 824-833, 2003.
Lorenz, W. W. & Dean, J. F. D. SAGE profiling and demonstration of
differential gene expression along the axial developmental gradient of
lignifying xylem in loblolly pine (Pinus taeda). Tree Physiol, 22: 301–
310, 2002.
Lu, H.; Zeng, Q.; Zhao, Y.; Wang, S. & Jiang, X. Xylem-specific
expression of a GRP1.8 promoter::4CL gene construct in transgenic
tobacco. Plant Growth Regul 41: 279-286, 2003.
Lu, H.; Zhao, Y. & Jiang, X. Stable and specific expression of 4-
coumarate:coenzyme A ligase gene (4CL1) driven by the xylem-specific
Pto-4CL1 promoter in the transgenic tobacco. Biotechnol Lett, 26:
1147-1152, 2004.
Matsui, A.; Yokoyama, R.; Seki, M.; Ito, T.; Shinozaki, K.; Takahashi, T.;
Komeda, Y. & Nishitani, K. AtXTH27 plays an essential role in cell wall
modification during the development of tracheary elements. Plant J,
42(4): 525–534, 2005.
Matsuyama, T.; Satoh, H.; Yamada, Y. & Hashimoto, T. A maize glycine-
rich protein is synthesized in the lateral root cap and accumulates in
the mucilage. Plant Physiol, 120: 665–674, 1999.
105
MeV Manual - MultiExperiment Viewer, Version 4.0, 276p, 2006.
<http://mev.tm4.org>
Neilson, D. The global Eucalyptus resource and some solidwood-panel
product developmental issues. IUFRO Conference, Lauceston,
Austrália, 2000.
No, E.; Zhou, Y. & Loopstra, C. Sequences upstream and downstream
of two xylem-specific pine genes influence their expression. Plant Sci,
160: 77–86, 2000.
Nothnagel, E. A. Proteoglycans and related components in plant cells.
Int Rev Cytol, 174: 95–291, 1997.
Ohashi-Ito, K. & Fukuda, H. HD-Zip III homeobox genes that include a
novel member, ZeHB-13 (Zinnia)/ATHB-15 (Arabidopsis) are involved in
procambium and xylem cell differentiation. Plant Cell Physiol, 44(12):
1350–1358, 2003.
Oh, S.; Park, S. & Han, K. Transcriptional regulation of secondary
growth in Arabidopsis thaliana. J Exp Bot, 54(393): 2709-2722, 2003.
Patterson, B. D & Smillie, R. M. Developmental changes in ribosomal
ribonucleic acid and fraction I protein in wheat leaves. Plant Physiol,
47: 196-198, 1971.
Paux, E.; Tamasloukht, M.; Ladouce, N.; Sivadon, P. & Grima-Pettenati,
J. Identification of genes preferentially expressed during wood
formation in Eucalyptus. Plant Mol Biol, 55: 263–280, 2004.
Paux, E.; Carocha, V.; Marques, C.; Sousa, A. M.; Borralho, N.; Sivadon,
P. & Grima-Pettenati, J. Transcript profiling of Eucalyptus xylem genes
during tension wood formation. New Phytol, 167: 89-100, 2005.
Pavy, N.; Johnson, J. J.; Crow, J. A.; Paule, C.; Kunau, T.; MacKay, J. &
Retze, E. F. ForestTreeDB: a database dedicated to the mining of tree
transcriptomes Nucleic Acids Res, 35: D888–D894, 2007.
Pereira, J. C. D.; Sturion, J. A.; Higa, A. R.; Higa, R. C. V. & Shimizu, J. Y.
Características da madeira de algumas espécies de eucalipto plantadas
no Brasil. In: Embrapa Florestas Documentos 38: 113p, 2000.
Persson, S.; Wei, H.; Milne, J.; Page, G. P. & Somerville, C. R.
Identification of genes required for cellulose synthesis by regression
106
analysis of public microarray data sets. P Natl Acad Sci USA, 102(24):
8633–8638, 2005.
Plomion, C.; Leprovost, G. & Stokes, A. Wood formation in trees. Plant
Physiol, 127: 1513–1523, 2001.
Poke, F. S.; Vaillancourt, R. E.; Potts, B. M. & Reid, J. B. Genomic
research in Eucalyptus. Genetica, 125: 79–101, 2005.
Prassinos, C.; Ko, J.; Yang, J. & Han, K. Transcriptome profiling of
vertical stem segments provides insights into the genetic regulation of
secondary growth in hybrid aspen trees. Plant Cell Physiol, 46(8):
1213–1225, 2005.
Puthoff, D. P.; Nettleton, D.; Rodermel, S. R. & Baum, T. J. Arabidopsis
gene expression changes during cyst nematode parasitism revealed by
statistical analyses of microarray expression profiles. Plant J, 33: 911–
921, 2003.
Rafalski, A. Tagging the rice transcriptome. Nat Biotechnol, 25: 430-
431, 2007.
Revista da Madeira, Curitiba, REMADE - Portal Nacional da madeira.
No eucalipto a opção de futuro. n107, 2007. Disponível em:
<http://www.remade.com.br/pt/revista.php?ano=2007> Acesso em
doze de dezembro de 2007.
Schaffer, R.; Landgraf, J.; Accerbi, M.; Simon, V. V.; Larson, M. &
Wisman, E. Microarray analysis of diurnal and circadian-regulated
genes in Arabidopsis. Plant Cell, 13: 113–123, 2001.
Schena, M.; Shalon, D.; Davisl R. W. & Brown, P. O. Quantitative
monitoring of gene expression patterns with a complementary DNA
microarray. Science, 270: 467–470, 1995.
Schrader, J.; Nilsson, J.; Mellerowicz, E.; Berglund, A.; Nilsson, P.;
Hertzberg, M. & Sandberga, G. A high-resolution transcript profile
across the wood-forming meristem of poplar identifies potential
regulators of cambial stem cell identity. Plant Cell, 16: 2278–2292,
2004.
Smart, L. B.; Nall, N. M. & Bennett, A. B. Isolation of RNA and protein
from guard cells of Nicotiana glauca. Plant Mol Biol Rep, 17: 371–383,
1999.
107
Sociedade Brasileira de Silvicultura. Fatos e Números do Brasil
Florestal. 108p. São Paulo, 2006. Disponível em:
<http://www.sbs.org.br/FatoseNumerosdoBrasilFlorestal.pdf> acesso
em onze de julho de 2007.
Stalberg, K.; Ellerstrom, M.; Sjodahl, S.; Ezcurra, I.; Wycliffe, P. &
Rask, L. Heterologous and homologous transgenic expression directed
by a 2S seed storage promoter of Brassica napus. Transgenic Res, 7:
165–172, 1998.
Tattersall, E. A. R.; Ergul, A.; AlKayal, F.; DeLuc, L.; Cushman, J. C. &
Cramer, J. R. Comparison of methods for isolating high-quality RNA
from leaves of grapevine. Am J Enol Viticult, 56: 400-406, 2005.
Trainotti, L.; Bonghi, C.; Ziliotto, F.; Zanin, D.; Rasori, A.; Casadoro, G.;
Ramina, A. & Tonutti, P. The use of microarray μPEACH1.0 to
investigate transcriptome changes during transition from pre-
climacteric to climacteric phase in peach fruit. Plant Sci, 170: 606-613,
2006.
Tuskan, G. A.; DiFazio, S.; Jansson, S.; Bohlmann, J.; Grigoriev, I.;
Hellsten, U.; Putnam, N.; Ralph, S.; Rombauts, S.; Salamov, A.; Schein,
J.; Sterck, L.; Aerts, A.; Bhalerao, R. R.; Bhalerao, R. P.; Blaudez, D.; et
al. The Genome of Black Cottonwood, Populus trichocarpa (Torr. &
Gray). Science 313: 1596-1604, 2006.
Tusher, V. G.; Tibshirani, R. & Chu, G. Significance analysis of
microarrays applied to the ionizing radiation response. P Natl Acad Sci
USA, 98(9): 5116–5121, 2001.
Velasco, R.; Zharkikh, A.; Troggio, M.; Cartwright, D. A.; Cestaro, A.;
Pruss, D.; Pindo, M.; Fitzgerald, L. M.; Vezzulli, S.; Reid, J.; Malacarne,
G.; Iliev, D.; Coppola, G.; Wardell, B.; Micheletti, D.; Macalma, T.; et al.
A high quality draft consensus sequence of the genome of a
heterozygous grapevine variety. PLoS ONE, 2(12): e1326.
doi:10.1371/journal.pone.0001326, 2007.
Vettore, A. L.; da Silva, F. R.; Kemper, E. L.; Souza, G. M.; da Silva, A.
M.; Ferro, M. I. T.; Henrique-Silva, F.; Giglioti, E. A.; Lemos, M. V. F.;
Coutinho, L. L. et al. Analysis and functional annotation of an
expressed sequence tag collection for tropical crop sugarcane.
Genome Res, 13: 2725–2735, 2003.
108
Wang, R. C.; Okamoto, M.; Xing, X. J. & Crawford, N. M. Microarray
analysis of the nitrate response in Arabidopsis roots and shoots reveals
over 1000 rapidly responding genes and new linkages to glucose,
trehalose-6-phosphate, iron, and sulfate metabolism. Plant Physiol,
132: 556–567, 2003.
Wang, T.; Zhang, N. & Du, L. Isolation of RNA of high quality and yield
from Ginkgo biloba leaves. Biotechnol Lett, 27: 629–633, 2005.
Waters, D. L. E.; Holton, T. A.; Ablett, E. M.; Lee, L. S. & Henry, R. J.
The ripening wine grape berry skin transcriptome. Plant Sci, 171(1):
132-138, 2006.
Whetten, R.; Sun, Y, H,; Zhang, Y. & Sederoff, R. Functional genomics
and cell wall biosynthesis in loblolly pine. Plant Mol Biol, 47: 275–291,
2001.
Whetten, R. W.; MacKay, J. J. & Sederoff, R. R. Recent advances in
understanding lignin biosynthesis. Annu Rev Plant Phys, 49: 585–609,
1998.
White, J. A.; Todd, J.; Newman, T.; Focks, N.; Girke, T.; Martinez de
Ilarduya, O.; Jaworski, J. G.; Ohlrogge, J. B. & Benning, C. H. A new set
of Arabidopsis expressed sequence tags from developing seeds. The
metabolic pathway from carbohydrates to seed oil. Plant Physiol, 124:
1582–1594, 2000.
Wissenbach, M.; Uberlacker, B.; Vogt, F.; Becker, D.; Salamini, F. &
Rohde, W. Myb genes from Hordeum vulgare: tissue specific expression
of chimeric Myb promoter/Gus genes in transgenic tobacco. Plant J, 4:
411–422, 1993.
Xue, Y.; Li, J. & Xu, Z. Recent highlights of the China Rice Functional
Genomics Program. Trends Genet, 19: 390–394, 2003.
Yamamoto, K. & Sasaki, T. Large-scale EST sequencing in rice. Plant
Mol Biol, 35: 135–144, 1997.
Yang, J.; Park, S.; Kamdem, D. P.; Keathley, D. E.; Retzel, E.; Paule, C.;
Kapur, V. & Han, K. Novel gene expression profiles define the
metabolic and physiological processes characteristic of wood and its
extractive formation in a hardwood tree species, Robinia pseudoacacia.
Plant Mol Biol, 52: 935–956, 2003.
109
Yang, S.; Zyl, L.; No, E. & Loopstra, C. A. Microarray analysis of genes
preferentially expressed in differentiating xylem of loblolly pine (Pinus
taeda). Plant Sci, 166: 1185–1195, 2004.
Yazaki, J.; Kojima, K.; Suzuki, K.; Kishimoto, N. & Kikuchi, S. The Rice
PIPELINE: a unification tool for plant functional genomics. Nucleic
Acids Res, 32: D383-D387, 2004.
Ye, Z-H. Vascular tissue differentiation and pattern formation in plants.
Annu Rev Plant Biol, 53: 183–202, 2002.
Zhao, C.; Craig, J. C.; Petzold, H. E.; Dickerman, A. W. & Beers, E. P.
The xylem and phloem transcriptomes from secondary tissues of the
Arabidopsis root-hypocotyl. Plant Physiol, 138: 803–818, 2005.
110
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo