( PDF ) Avaliação da técnica de PCR in house no diagnóstico de Tuberculose Pulmonar

Download PDF

ads:

Universidade Federal do Rio Grande do Sul

Instituto de Ciências Básicas da Saúde

Programa de Pós- Graduação em Ciências-Biológicas Bioquímica

Avaliação da técnica de PCR in house no

diagnóstico de Tuberculose Pulmonar

Luciene Cardoso Scherer

Orientador: Dr. Afrânio Kritski

Tese apresentada ao Programa de Pós-Graduação em Ciências Biológicas-

Bioquímica da Universidade Federal do Rio Grande do Sul para a obtenção

do título de Doutor em Ciências Biológicas - Bioquímica

2007

ads:

Livros Grátis

http://www.livrosgratis.com.br

Milhares de livros grátis para download.

Universidade Federal do Rio Grande do Sul

Instituto de Ciências Básicas da Saúde

Programa de Pós- Graduação em Ciências-Biológicas Bioquímica

Avaliação da técnica de PCR in house no

diagnóstico de Tuberculose Pulmonar

Luciene Cardoso Scherer

Orientador: Dr. Afrânio Kritski

Tese apresentada ao Programa de Pós-Graduação em Ciências Biológicas-

Bioquímica da Universidade Federal do Rio Grande do Sul para a obtenção

do título de Doutor em Ciências Biológicas - Bioquímica

2007

ads:

III

Dedicatória

Dedico este trabalho a meu pai, obrigada pelo exemplo de trabalho, luta e

dedicação.

Citações

“Pouco conhecimento faz com que as pessoas se sintam orgulhosas. Muito

conhecimento, que se sintam humildes. É assim que as espigas sem grãos

erguem desdenhosamente a cabeça para o Céu, enquanto que as cheias as

baixam para a terra, sua mãe.”

Leonardo da Vinci

Agradecimentos

- À Universidade Federal do Rio Grande do Sul (UFRGS) por fornecer o suporte

institucional.

- Ao Pós Graduação de Ciências Biológicas- Bioquímica por acreditar e apostar

neste estudo, mesmo este não sendo o foco de suas linhas de pesquisa.

- Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPQ)

pelo fomento do estudo.

- À Fundação Estadual de Produção e Pesquisa em Saúde (FEPPS), por

fornecer suporte institucional ao desenvolvimento deste estudo.

- Ao Centro de Desenvolvimento Científico e Tecnológico (CDCT), por fornecer

suporte tecnológico e de infraestrutura para o desenvolvimento da parte

experimental do estudo.

- Ao Hospital Sanatório Partenon e seus funcionários, por terem nos

possibilitado o desenvolvimento deste estudo nas dependências do hospital.

- À Dra Carla Jarcwieski, do Hospital Sanatório Partenon pelo apoio na seleção

dos pacientes.

- À Dra Fernanda Queiroz Mello, obrigada por me mostrar os primeiros passos

de avaliação econômica.

- Á Dra Maria Lúcia Rosa Rossetti por ter me proporcionado a oportunidade de

desenvolver este estudo junto ao grupo do CDCT.

- As colegas farmacêuticas Cíntia Costi, Candice Michelon e Rúbia Rupenthal, e

a bióloga Patrícia Cafrune, o meu carinho e a minha saudade dos momentos

que passamos juntas, sem o suporte técnico e laboratorial de vocês, com suas

idéias e sugestões este estudo, não teria passado de um projeto.

- À Dra Vera Treis Trindade constante estímulo com o seu conhecimento e sua

vocação à docência.

- À Dra Rosa Dea Sperhacke, o meu carinho especial pela amizade e pelo apoio

incondicional no desenvolvimento da parte experimental e teórica deste estudo.

- Ao Dr. Afrânio Kritski, agradeço a paciência durante a minha gestação, a

disposição de trabalho, aos valiosos conhecimentos repassados, a confiança a

mim destinada, ao apoio nas horas em que pensei que não seria possível

chegar até aqui, mas principalmente gostaria de agradecer ao amigo com quem

sempre pude contar.

- Aos meus pais, pela constante torcida.

- Ao João, pelo apoio e por compreensão.

- À Ana, por renovar minhas energias, no final de cada dia.

- A Deus que me proporciona, a cada dia, momentos como este!

Resumo

Objetivos: Avaliar o desempenho e o custo-efetividade de duas técnicas de PCR

(Polymerase Chain Reaction) in house: PCR dot-blot e o PCR utilizando a eletroforese

em gel de agarose (PCR-AG) no diagnóstico de Tuberculose Pulmonar em pacientes

infectados ou não pelo HIV .

Material e Métodos: Um estudo prospectivo foi conduzido (de Maio de 2003 a Maio de

2004) em um Hospital de Referência para TB/HIV. Escarros de 277 indivíduos com

suspeita de Tuberculose Pulmonar (PTB) foram testados pelas técnicas de microscopia

direta pela coloração de Ziehl-Neelsen (ZN), cultura e pelas metodologias de PCR in

house (PCR dot-blot e PCR-AG). A acurácia dos testes foi avaliada de acordo com o

status de HIV, com o status de tratamento prévio ou não, e com a estimativa de

probabilidade pré-teste feita pelos pneumologistas. O padrão ouro utilizado foi a cultura

positiva combinada com a definição clínica de PTB (usando sintomas, fatores de risco e

Raios-X). O custo efetividade foi expresso por: a) custo por correto caso diagnosticado

de Tuberculose; b) custo por correto caso diagnosticado de Tuberculose e tratado

incluindo tratamento de casos falsamente diagnosticados; c) custo por casos

incorretamente diagnosticados e não tratados.

Resultados: Prevalência de PTB foi 46,2% (128/277); em HIV soropositivo (HIV

)

foi de

54% (40/74). Em pacientes com baciloscopias negativas foi de 28,4% (43/151) e nos

grupos com probabilidades pré-teste alta, intermediária e baixa foi de 67,4% (31/46);

24% (6/25) e 7,5% (6/80).

A sensibilidade e a especificidade do PCR dot-blot foi 74% (CI 95%; 66,1%-81,2%) e

85% (CI 95%; 78,8%-90,3%); do PCR-AG foi 43% (CI 95%; 34,5%-51,6%) e 76% (CI

95%; 69,2%-82,8%), respectivamente. Sensibilidades do PCR dot-blot (72% vs 75%;

p=0,46) e PCR-AG (42% vs 43%; p=0,54) foi similar para HIV

and HIV seronegativo

(HIV

Em relação ao efeito da suspeita clínica no desempenho do PCR em pacientes com

PTB e com a baciloscopia negativa, o PCR dot-blot combinado com alta probabilidade

pré-teste de TB mostrou uma sensibilidade, Valor Preditivo Negativo (VPN) e Razão de

Verossimilhança negativa (RV-) de 93%, 96% e 0,1, respectivamente.

Usando a estratégia de associar ZN a Cultura, a PCR-AG e PCR dot-blot. A ZN

associada à Cultura mostrou o melhor desempenho com sensibilidade de 94% e VPN

de 99%, e RV- de 0,07, seguida da ZN associado ao PCR dot-blot com sensibilidade de

90%, com VPN de 99% e uma RV- de 0,12. Não houve diferença significativa no

desempenho do PCR em relação ao status de HIV.

Na análise de custo-efetividade os custos por correto caso diagnosticado de

Tuberculose foram U$1.462,00 , U$1.296,00 e U$1.136,00; os custos por correto caso

diagnosticado de Tuberculose e tratado, incluindo tratamento de casos falsamente

diagnosticados, foram de US$1.608,00 para a estratégia do ZN associado ao PCR-dot-

blot e de US$2.359,00 para a estratégia de ZN associado a Cultura. Os custos por

casos não diagnosticados que retornam aos serviços de saúde foram de US$3.735,00

para a estratégia de ZN associado ao PCR-dot-blot e de US$2.329,00 para a estratégia

de ZN associada à Cultura.

Conclusão: Este estudo mostra que as técnicas de PCR in house podem oferecer uma

melhora para o diagnóstico de exclusão de TB em pacientes com suspeita de TB

atendidos em hospitais com alta prevalência de TB e HIV.

VII

Abstract

Objective: To evaluate the performance and cost-effectiveness of two in house

PCR (Polymerase Chain Reaction) techniques: PCR dot-blot methodology (PCR

dot-blot) and PCR agarose gel electrophoresis (PCR-AG) for the diagnosis of

Pulmonary Tuberculosis (PTB) in patients with or without HIV.

Methods: A prospective study was conducted (from May 2003 to May 2004) in a

TB/HIV reference hospital. First sputum from 277 PTB patients suspects was

tested by Ziehl-Neelsen direct microscopy staining (ZN), culture and in house

PCR assays (PCR dot-blot and PCR-AG). The accuracy of tests was evaluated

in according to HIV status, previous treatment and the estimative of pretest

probability (PP) of PTB performed by chest physicians. Gold standard was the

culture positive combined with the definition of clinical PTB (based on symptoms,

risk factors and chest X- Ray). The cost effectiveness was expressed as: a) cost

per correctly diagnosed case of PTB; b) cost per case correctly diagnosed and

treated, including treatment of falsely diagnosed cases; c) cost per case

incorrectly diagnosed and non treated.

Results: The prevalence of PTB was 46% (128/277); in HIV Seropositive (HIV

)

was 54% (40/74). In patients ZN negative was 28.% (43/151) and in the groups

with high, intermediary and low PP was 67.4% (31/46); 24% (6/25) and 7.5%

(6/80).

The Sensitivity and Specificity of PCR dot-blot were 74% (CI 95%; 66.1%-81.2%)

and 85% (CI 95%; 78.8%-90.3%); of PCR-AG were 43% (CI 95%; 34.5%-51.6%)

and 76% (CI 95%; 69.2%-82.8%), respectively. Sensitivities of PCR dot-blot

(72% vs 75%; p=0.46) and PCR-AG (42% vs 43%; p=0.54) were similar for HIV

and HIV Seronegative (HIV

In relation to the effect of clinical suspicion on the performance of PCR in

patients with PTB and ZN negative, the PCR dot-blot associate to high pretest

probability of PTB showed sensitivity, Negative Predictive Value (NPV) and

negative likelihood ratio (LR-) of 93%, 96% and 0.1, respectively.

Using the strategy of associate ZN with Culture and PCR methods (PCR-AG and

PCR dot-blot), the ZN plus Culture had the highest performance: Sensitivity of

94%, VPN of 99% and LR- of 0.07. ZN plus PCR dot-blot also had a good

performance with sensitivity of 90%, VPN of 99% and LR- of 0.12.There was not

statistical difference on the performance of PCR in relation to HIV status.

Costs per correctly diagnosed case were U$1,462, U$1,296 and U$1,136 for ZN

plus culture, ZN plus PCR-AG and ZN plus PCR dot-blot, respectively. The cost

per case correctly diagnosed and treated, including treatment of falsely

diagnosed cases, was US$1,608 for ZN plus PCR dot-blot and US$2,359 for ZN

plus culture. Cost of the return of all false negatives to health service was

US$3,735 for ZN plus PCR dot-blot and US$2,329 for ZN plus Culture.

Conclusion: This study shows that in house PCR may offer an improvement for

ruling out TB diagnosis for PTB suspects assisted at hospitals with a high

prevalence of TB and HIV.

VIII

ÍNDICE

Lista de Abreviaturas .......................................................................................... XI

Lista de Figuras ................................................................................................. XII

Lista de Tabelas................................................................................................ XIII

1. Introdução.........................................................................................................1

1.1 Tuberculose ....................................................................................................1

1.2 Epidemiologia da Tuberculose........................................................................2

1.3 O agente etiológico da Tuberculose ...............................................................5

1.3.1 Mycobacterium tuberculosis.........................................................................5

1.3.2 Genoma do Mycobaterium tuberculosis.......................................................6

1.4 Transmissão ...................................................................................................6

1.5 Imunopatogenia ..............................................................................................8

1.6 Tratamento....................................................................................................10

1.7 Manifestações Clínicas da TB.......................................................................12

1.7.1 Tuberculose Pulmonar...............................................................................13

1.8 Tuberculose e HIV ........................................................................................14

1.9 Métodos de Diagnóstico Laboratoriais da Tuberculose ................................14

1.9.1 Métodos Convencionais para diagnóstico de TB pulmonar .......................16

1.9.1.1 Baciloscopia............................................................................................16

1.9.1.2 Cultura ....................................................................................................17

1.9.1.3 Métodos Radiológicos.............................................................................18

1.10 Novos Métodos para o diagnóstico de TB pulmonar ..................................18

1.10.1 Métodos de Biologia Molecular Comerciais .............................................19

1.10.2 Métodos de Biologia Molecular in house .................................................22

1.11 Análise de Custo Efetividade ......................................................................25

2.Objetivos..........................................................................................................27

2.1 Objetivo Geral...............................................................................................27

2.2 Objetivos Específicos....................................................................................27

3. Material e Métodos .........................................................................................29

3.1 Pacientes......................................................................................................29

3.2. Primers utilizados para a amplificação do Dna de Mycobaterium tuberculosis

............................................................................................................................33

3.3 Logística da análise e métodos de PCR in house avaliados.........................29

3.3.1 Logística da avaliação ...............................................................................29

3.3.1.1 Fluxograma da logística operacional de recrutamento de pacientes e

coleta de dados...................................................................................................30

3.3.1.2 Fluxograma das diferentes fases de análise da técnica de PCR in house

desenvolvidas.....................................................................................................31

3.3.2 Métodos de PCR in house analisados.......................................................32

3.3.2.1 Região selecionada para amplificação por PCR.....................................32

3.3.2.2 PCR in house com detecção em gel de agarose (PCR- AG)..................35

3.3.2.3 PCR in house colorimétrico (PCR dot-blot).............................................35

4. Resultados......................................................................................................38

4.1 Artigo 1 .........................................................................................................39

4.2 Artigo 2 .........................................................................................................69

4.3 Artigo 3 .........................................................................................................89

4.4 Artigo 4 .......................................................................................................116

5 Discussão ......................................................................................................143

5.1 Dados Epidemiológicos da população estudada ........................................143

5.2 Análise de Sinais e Sintomas Clínicos associados em pacientes infectados

ou não por HIV..................................................................................................143

5.3 Sensibilidades e Especificidades das técnicas de PCR in house para o

diagnóstico de TB pulmonar .............................................................................144

5.4 Dificuldades no diagnóstico de TB pulmonar em pacientes infectados por

HIV....................................................................................................................147

5.5 Análise da Suspeita Clínica do Médico (probabilidades pré-teste) de

diagnóstico de Tuberculose Pulmonar..............................................................147

5.6 O Impacto da Associação das técnicas de PCR in house com a técnica de

microscopia direta (baciloscopia) para o diagnóstico de TB pulmonar .............148

5.7 O Impacto das diferentes taxas de prevalência de Tuberculose Pulmonar no

desempenho da técnica de PCR in house (PCR dot-blot) utilizada em

associação com a técnica de microscopia direta (baciloscopia) para o

diagnóstico de TB pulmonar .............................................................................151

5.8 Dificuldades no diagnóstico de TB pulmonar em pacientes com baciloscopia

negativa (ZN negativo)......................................................................................152

5.9 O Impacto da suspeita Clínica do médico na avaliação do desempenho da

técnicas de PCR in house no diagnóstico de TB pulmonar ..............................153

5.10 Falsos positivos e negativos nas técnicas de PCR in house ....................154

5.11 Análise de custo-efetividade das técnicas de PCR in house ....................157

5.12 Recomendações para a utilização de testes moleculares em rotina ........160

6 Conclusões....................................................................................................163

7 Perspectivas ..................................................................................................165

8 Referências....................................................................................................167

9 Anexos...........................................................................................................182

9.1 Anexo 1: Termo de consentimento .............................................................182

9.2 Anexo 2: Questionário Clínico.....................................................................184

9.3 Anexo 3: Questionário aplicado aos pacientes ...........................................185

9.4 Anexo 4: Parecer do comitê de ética ..........................................................188

9.5 Anexo 5: Instruções das revistas para os autores ......................................189

9.5.1 Brazilian Journal of Microbiology .............................................................189

9.5.2 Journal of Clinical Laboratory Analysis ....................................................192

9.5.3 The International Journal of Tuberculosis and Lung Disease ................194

Lista de Abreviaturas

AAN – Amplificação de ácido Núcleico

AIDS- Síndrome da Imunodeficiência Adquirida

BAAR- Bacilo álcool ácido resisitente

CDCT- Centro de Desenvolvimento Científico e Tecnológico

DOTS- Tratamento supervisionado para Tuberculose

DNA- Ácido desoxirribonucléico

EP- Especificidade

HIV- Vírus da Imunodeficiência Humana

HSP – Hospital Sanatório Partenon

MDR- Multi-Droga Resistente

MOTT –Outro Mycobacterium que não Tuberculosis

MS-Ministério da Saúde

MTB- Mycobacterium tuberculosis

PCR- Reação em cadeia da Polimerase

PP- Probabilidade Pré- teste

PPD- Prova Tuberculínica

RV- Razão de Verossimilhança

- Razão de Verossimilhança Positiva

- Razão de Verossimilhança Negativa

SE- Sensibilidade

TB –Tuberculose

TBP- Tuberculose Pulmonar

VPN- Valor Preditivo Negativo

VPP- Valor Preditivo Positivo

ZN- Ziehl Nieelsen

ZN negativo – Baciloscopia por Ziehl Nieelsen Negativa

ZN positivo – Baciloscopia por Ziehl Nieelsen Positiva

XII

Lista de Figuras

Figura 1. Fluxograma da logística operacional de recrutamento de pacientes e

coleta de dados...................................................................................................30

Figura 2. Fluxograma das diferentes fases de análise da técnica de PCR in

house desenvolvidas ..........................................................................................31

Figura 3. Esquema representativo de uma região do elemento de inserção

IS6110 mostrando a localização dos primers utilizados no estudo...................323

Figura 4. Eletroforese em gel de agarose (2%). ..............................................344

Figura 5. Eletroforese em gel de agarose (2%). ...............................................355

Figura 6. Representação esquemática do procedimento Dot-blot colorimétrico.

..........................................................................................................................366

Figura 7. PCR dot-blot, realizado com os produtos da PCR obtidos de diferentes

amostras de escarro espontâneo......................................................................377

Figura 8. Comprovação da submissão do artigo ..............................................699

Figura 9. Comprovação do resumo na PUBMED .............................................899

Figura 10. Comprovação da submissão do artigo...........................................1166

XIII

Lista de Tabelas

Tabela 1. Testes moleculares para detecção de M. tuberculosis .......................21

Tabela 2. Técnica de detecção, limite de detecção, sensibilidade e

especificidade da PCR obtidos por diferentes métodos de preparação da

amostra...............................................................................................................24

Tabela 3. Primer, seqüências, regiões, posições no genoma de M. tuberculosis e

tamanho do fragmento de DNA amplificado referentes à sonda utilizada na

hibridização e ao DNA amplificado das amostras clínicas..................................33

1. Introdução

1.1 Tuberculose

A tuberculose (TB), endêmica na Antiguidade permaneceu como uma

enfermidade sem importância durante o período feudal no ocidente, até o

aumento de sua ocorrência no período da revolução industrial, no século XVIII.

Durante este século e no início do século XX, o sofrimento e o confinamento

proporcionado pela doença tornavam as almas tristes e poéticas. Nesta época,

associou-se à tuberculose a uma "doença romântica", idealizada nas obras

literárias e artísticas ao estilo do romantismo (Bates, 1980).

Em 1882, Robert Koch descobre o agente causador da TB, o bacilo

Mycobaterium tuberculosis (MTB), sendo um marco para o conhecimento da

enfermidade na área diagnóstica e na área da terapêutica. A descoberta do

tratamento antimicrobiano, específico a partir de 1940, alterou mundialmente o

perfil epidemiológico da TB, com a queda da mortalidade. Entretanto desde os

anos 80, vem ocorrendo um aumento da mortalidade associada à TB,

principalmente em grandes centros urbanos com elevada prevalência do Vírus

da Imunodeficiência Humana (HIV) e TB, onde normalmente, o sistema de

saúde está mais desestruturado e é maior a taxa de TB multirresistente (MDR),

principalmente em instituições como hospitais e prisões (WHO, 2005).

Com o advento do HIV/ “Acquired Immune Deficiency Syndrome” (AIDS),

tornou-se mais difícil o diagnóstico da TB, em razão da maior ocorrência de

formas clínico-radiológicas atípicas (Schijman, et al. 2004). Na fase avançada de

imunossupressão (AIDS), os sítios extrapulmonares são os mais afetados,

isoladamente ou em associação com as formas pulmonares. O rendimento da

baciloscopia utilizada para diagnóstico é inferior, sendo a proporção de casos

com baciloscopia positiva entre 20% a 40%, mantendo-se a cultura para

micobactérias com rendimento próximo daquele observado entre pacientes não

infectados pelo HIV (Sharma, et al. 2005). Diante de tal situação, organizações

internacionais passaram a priorizar o desenvolvimento e avaliação de novos

testes diagnósticos para a TB, que possam ser úteis em regiões de elevada

prevalência de M.tuberculosis e HIV (Walker, et al. 2000). Em um estudo

realizado no Rio de Janeiro, em pacientes atendidos nos Centros Municipais de

Saúde, observou-se uma maior ocorrência de TB pulmonar com baciloscopia

negativa naqueles infectados pelo HIV. Tais dados indicam a necessidade de

viabilizar a cultura para micobactéria nestes pacientes e também, priorizar o

desenvolvimento e a análise da aplicabilidade de novos métodos para o

diagnóstico rápido da TB pulmonar, principalmente nos grandes centros urbanos

(Kritski, 2003).

1.2 Epidemiologia da Tuberculose

De acordo com a Organização Mundial da Saúde (OMS) em 2007, o

maior número de casos novos ocorreu na região do sudeste asiático, com uma

taxa de incidência de 52 casos a cada 100.000 habitantes. Entretanto, a

incidência em países africanos é quase 50% maior àquela da região de Sudeste

Asiático (em torno de 75 casos a cada 100 000 habitantes (WHO, 2006). A OMS

estima que existam no mundo, anualmente, oito milhões de novos casos de TB

resultando em cerca de dois milhões de mortes por ano, sendo estimado um

crescimento anual de 0,6% (Wang, 1999; WHO, 2006). Além disso, estima-se

que cerca de 1,7 bilhões de indivíduos em todo o mundo estejam infectados pelo

bacilo da TB, correspondendo a 30% da população global (Jeffrey, 2000). Nos

países desenvolvidos, a cada ano, cerca de 60 mil mortes são devidas à TB e

mais de 500 mil novos casos são descobertos (WHO, 2006). Nesses países, a

TB é mais freqüente entre idosos, minorias étnicas e imigrantes estrangeiros.

No Brasil, com uma população de aproximadamente 182 milhões, estima-

se que, do total da população, 35 a 45 milhões de pessoas estejam infectadas

pelo bacilo da TB, e aproximadamente, ocorrem em torno de 80 a 90 mil casos

novos (Brasil, 2005). Com uma incidência de 44 casos por 100000 habitantes e

uma taxa de mortalidade de 2,8 (Brasil, 2005). Nos últimos anos, o Ministério da

Saúde passou a considerar a TB como um problema prioritário, pois o país

ocupa o 14º lugar entre os 23 países em desenvolvimento responsáveis por 80%

dos casos mundiais da doença (Dye, et al. 2002; Brasil, 2005; WHO 2006).

Com relação ao tratamento para TB no Brasil, em torno de 72% dos

casos notificados recebem alta por cura, com abandono de 12%, 7% de óbitos, e

9% em falência terapêutica, distantes, portanto, das metas internacionais

estabelecidas pela OMS e pactuadas pelo Ministério da Saúde de curar 85% dos

casos estimados. (Picon et al. 2002; Mello, et al. 2003; Tuberculose, 2004),

sendo que, em grandes centros urbanos, onde é elevada a taxa de HIV, o

abandono do tratamento anti-TB pode chegar a 30% (Mello, et al. 2003;

ECE/CGVS, 2005).

O aumento nas taxas de incidência da TB ocorre devido a alguns fatores,

como sistemas de saúde e programas de controle da TB deficitários e de

péssima qualidade; elevada ocorrência de TB entre as populações de baixa

renda; co-infecção pelo HIV; e surgimento de linhagens resistentes aos

fármacos utilizados no tratamento (Suffys, et al. 1997; Dalcomo, 1999).

No Brasil o aumento do número de linhagens MDR (resistentes a, pelo

menos, rifampicina e isoniazida), com taxa de 0.9% entre os novos casos (WHO

2006) tem causado enorme preocupação, pois contribui para aumentar a

mortalidade de TB, pricipalmente diante do cenário da infecção pelo HIV (Dye

and Williams 2000; Rossetti et al., 2002).

No Rio Grande do Sul, no ano de 2004, a taxa de incidência da TB foi de

47 casos a cada 100.000 habitantes, tendo sido notificados 5.037 casos da

doença, com uma população de 10.726.408 habitantes (Brasil, 2005).

Taxas alarmantes são encontradas em grandes centros urbanos com

altos índices populacionais e elevada taxa de infecção pelo HIV e baixos níveis

sócio-econômicos, como na região metropolitana de Porto Alegre.

Em Porto Alegre em 2004, a Equipe de Controle Epidemiológico (ECE),

responsável pela Vigilância Epidemiológica da TB, registrou 1432 casos novos

de TB, sendo que 29% desses casos foram diagnosticados durante a internação

hospitalar e 71% nos ambulatórios de referência. Em relação a co-infecção

HIV/TB 420 casos novos foram diagnosticados (ECE/CGVS, 2005).

A estratégia de controle da TB tem sido elaborada por programas

governamentais que primam pelo diagnóstico e tratamento dos casos de TB o

mais rápido possível, a fim de interromper a transmissão e evitar a difusão da

doença. Entretanto, é necessário um planejamento de controle de TB que

contemple um olhar sob as variações de tendência relativas à epidemia do

HIV/AIDS, e à multiresistência das drogas ultilizadas no tratamento de TB

(Tuberculose, 2004). No Brasil, é fundamental a análise destas situações, pois a

taxa de 17% para co-infecção de HIV/TB e a taxa de multiresistência de 0,9%,

evidenciam a importância da análise destas situações no planejamento dos

programas de Controle de Tuberculose (WHO, 2006).

1.3 O agente etiológico da Tuberculose

1.3.1 Mycobacterium tuberculosis

Mycobacterium tuberculosis, pertencente à ordem dos Actinomycetales, à

família Mycobacteriaceae, é um dos componentes do complexo Mycobacterium

tuberculosis, juntamente com Mycobacterium bovis, Mycobacterium bovis BCG,

Mycobacterium microti , Mycobacterium africanum, Mycobacterium canetti

Mycobacterium caprae e Mycobacterium pinnipedii. No Brasil, o principal agente

causal da TB pulmonar é o M. tuberculosis, sendo raros os casos de TB

causados por outras espécies do complexo. Os bacilos do complexo MTB

possuem alto conteúdo lipídico na parede celular, podendo atingir até 40% do

peso seco da célula. Os bacilos são resistentes à ação de agentes químicos,

mas sensíveis a agentes físicos, como radiação ultravioleta e calor(Kritski, 2000)

As micobactérias são álcool-ácido resistente em reações tintoriais, em

sua grande maioria de crescimento lento, com um tempo de geração de

aproximadamente 15 a 20 horas, dependendo da oferta de oxigênio, de

nutrientes e pH do meio. As micobactérias são aeróbias, não formadoras de

esporos e não possuem motilidade. A morfologia das colônias varia entre às

espécies, apresentando aspecto do liso ao rugoso, e pigmentado ou não

pigmentado. A temperatura de crescimento também varia entre as espécies, de

30ºC a 45ºC (Murray, 1999).

1.3.2 Genoma do Mycobaterium tuberculosis

Em 1998, o genoma da linhagem H37Rv de M. tuberculosis foi

completamente seqüenciado (Cole and Barrell, 1998). O genoma desse

microorganismo é composto de 4.411.529 pares de bases (pb), contém em torno

de 4.000 genes e possui um conteúdo de GC de 65,6%. Seu genoma possui

sequências de DNA repetitivo, particularmente seqüências de inserção (IS).

Foram descritos 56 elementos de inserção. O elemento IS6110, membro da

família IS3, não é somente o mais abundante como também o melhor

caracterizado, sendo que o número de cópias varia de linhagem para linhagem

de cepas analisadas (Cole and Barrell, 1998; Camus et al. 2002).

1.4 Transmissão

A tuberculose é transmitida de pessoa para pessoa através do ar

(Edwards et al. 1986). As formas mais freqüentes de contágio são a fala, o

espirro e, principalmente, a tosse (ATS, 2000). As partículas contagiantes

(núcleos de Wells), com bacilos em suspensão no ar, alcançam os alvéolos e

apresentam um tamanho de 5 a 10 µm (Wells, 1948; Kritski, 2000). Tais

partículas, com um ou dois bacilos viáveis, podem permanecer suspensas no ar

por várias horas. Chegando aos alvéolos, são fagocitadas pelos macrófagos

alveolares e então iniciam a multiplicação. Apenas 1% dos bacilos sobrevivem

por algumas horas nas gotículas suspensas, desde que não estejam expostos à

ventilação e à luz solar (Kritski, 2000).

As características dos focos de contágio (pacientes com TB pulmonar e

escarro positivo na baciloscopia: bacilíferos), dos contatos intra-domiciliares ou

institucionais, bem como o ambiente, a maneira como ocorrem suas relações e o

tempo de exposição, interferem na transmissão da TB. Portanto, é consenso que

a transmissão do MTB é determinada por alguns fatores: 1) o número de

organismos expelidos no ar; 2) a concentração de organismos no ar

determinado pelo volume do espaço físico ambiente e a ventilação promovida

pelo paciente; 3) o tempo de exposição em que a pessoa respira o ar

contaminado; e 4) o estado imune do indivíduo exposto (ATS, 2000).

Calcula-se que, numa determinada população, uma pessoa bacilífera

infecte de 10 a 15 pessoas por ano, com as quais tem contato. O risco de

contágio de contatos intra-domiciliares ou institucionais é de 5% a 20%, e de

contatos casuais de 0,2% a 2% (Kritski, 2000). Até pouco tempo a principal

ferramenta no diagnóstico e o monitoramento do paciente com TB pulmonar era

a baciloscopia positiva. Entretanto, com o uso de tipagem molecular tem sido

possível demonstrar que mesmo os pacientes com baciloscopia negativa e

cultura positiva são responsáveis por 17 a 20% da transmissão da TB em

determinada região, principalmente em grandes centros urbanos com elevada

taxa de tuberculose associada a outras co-morbidades, como a infecção pelo

HIV (Behr et al., 1999). Tais dados têm sinalizado os pesquisadores e gestores

de políticas públicas de que se torna necessário identificar outras técnicas de

diagnóstico rápido de TB, mais sensíveis que a baciloscopia e no mínimo

similares à cultura de micobactérias para ser utilizada como uma nova

ferramenta do controle de TB, nestas regiões.

1.5 Imunopatogenia

Na infecção inicial, quando a micobactéria penetra no pulmão, no alvéolo,

de um indivíduo após ser expectorada em minúsculas partículas por um paciente

bacilífero, esta é inicialmente fagocitada por um macrófago alveolar, e

posteriormente os bacilos sofrem a fagocitose pela ação dos neutrófilos. Se o

processo de resposta imunológica (fagocitose- mediada por células) for

ineficiente, ocorre um processo de interação celular entre os macrófagos

alveolares e os linfócitos T (CD4+), através da liberação de citocinas, com o

objetivo de quimiotaxia celular, e resposta imunológica humoral (produção de

anticorpos) (Kritski, 2000).

Os macrófagos fagocitam os bacilos e parte destes são destruídos, mas

um contingente expressivo permanece vivo. Os bacilos remanescentes se

multiplicam dentro dos fagossomos, no citoplasma do macrófago, ou na

cavidade alveolar (Bates, 1980). O bacilo cresce lentamente, dividindo-se

aproximadamente a cada 25 a 32 horas. O microrganismo cresce por 2 a 12

semanas até alcançar um crescimento na potência de 10

a 10

, já suficiente

para provocar uma resposta imune celular específica (ATS, 2000).

O risco de infecção ativa pelo bacilo é elevado, pois em cerca de 50% dos

expostos, o bacilo alcança os alvéolos e promove a infecção ativa. A infecção é

identificada pela prova tuberculínica positiva. Entretanto, num período de 2 anos,

o risco de desenvolvimento de TB ativa entre pessoas saudáveis infectadas é de

5% a 10% (Styblo, 1991; ATS, 2000). Nos demais casos, o bacilo fica em estado

de latência, podendo reativar posteriormente no decorrer da vioda do indivíduo.

A evolução para a doença depende de múltiplos fatores relacionados com o

microorganismo (virulência) e com o hospedeiro (imunidade, fatores genéticos,

existência de outras doenças). Essa evolução para a TB ativa depende do tipo

de infecção que está ocorrendo; se o indivíduo está sendo infectado pela

primeira vez (primo-infecção ou infecção primária) ou sendo reinfectado

(reinfecção exógena). Estima-se que a ocorrência de TB ativa é mais freqüente

principalmente em crianças, idosos e/ou imunodeprimidos. Entretanto, os

indivíduos previamente infectados pelo bacilo da TB, com prova tuberculinica

positiva, apesar de uma defesa imune anterior, caso sejam expostos

continuamente à TB, podem adoecer. Além disso, os bacilos latentes poderão

desenvolver TB ativa mesmo muitos anos depois (reativação endógena) (Bloom

and Murray, 1992)

Indivíduos infectados pelo HIV, especialmente aqueles com baixa

contagem de linfócitos T (CD4+) (menos de 100 células por mm

), desenvolvem

a TB rapidamente após serem infectados pelo M. tuberculosis, e entre 10% a

25% destes podem desenvolver a doença nos primeiros 2 anos. Por outro lado,

indivíduos que possuem uma infecção latente com M. tuberculosis (não tratada)

e adquirem a infecção com HIV poderão desenvolver tuberculose em uma taxa

de aproximadamente 5% a 10% ao ano (Conde et al., 1999; ATS, 2000). Tais

dados sinalizam a necessidade do rápido diagnóstico de TB pulmonar em

instituições (hospitais ou prisões) e em nível domiciliar, onde indivíduos

infectados pelo HIV estejam convivendo no mesmo ambiente.

1.6 Tratamento

A tuberculose é uma doença grave, porém curável em,

praticamente, 95% dos casos novos, desde que, uma vez diagnosticada a

doença, seja empregado o tratamento antimicrobiano adequado A associação

medicamentosa adequada, as doses corretas, a supervisão da tomada dos

medicamentos e o uso por tempo suficiente (em média 6 a 9 meses) são

medidas importantes para evitar a resistência e a persistência bacteriana, assim

como medidas que favoreçam a adesão ao tratamento(Tuberculose, 2004).

Os antimicrobianos recomendados pela OMS e mais comumente usados

para o tratamento da TB em países em desenvolvimento nas Américas são: a

estreptomicina, etambutol, etionamida, e pirazinamida, além da Isoniazida e

Rifampicina.

Desde 1979, o Ministério da Saúde padroniza dois esquemas para

tratamento, um de primeira linha para os casos virgens de tratamento, o

Esquema I, com 2 meses de rifampicina, isoniazida e pirazinamida e 4 meses de

rifampicina e isoniazida e, um de reserva ou de segunda linha, o Esquema III,

com 3 meses de estreptomicina, pirazinamida, etambutol e etionamida e 9

meses de etambutol e etionamida, indicado para pacientes com falência ao E-I.

Para casos de meningocefalite isolada ou associada a outras formas, é proposto

um esquema especial, o Esquema II, com 2 meses de rifampicina, isoniazida e

pirazinamida e 7 meses de rifampicina e isoniazida, acrescido de corticóides por

um período de um a 4 meses, no início do tratamento (Tuberculose, 2004)

A resistência aos fármacos é definida como a diminuição da sensibilidade

in vitro do M. tuberculosis a uma ou mais drogas utilizadas para combater a

doença (Silva et al., 2003). O aumento de cepas de M. tuberculosis resistentes a

um ou mais fármacos (MDR) vem se tornando um dos principais problemas no

tratamento e combate da TB em nível mundial (Silva et al., 2003). Tais linhagens

são prevalentes em determinadas áreas geográficas ou populações (hospitais,

prisões), causando importantes surtos (Bloom and Murray 1992). Isso é ainda

mais grave em pacientes com AIDS, pois como foi mencionado anteriormente, o

risco à infecção seguida de adoecimento por TB nestes indivíduos é

extremamente elevado. Além disso, nestes ambientes de elevada prevalência de

MTB-MDR, enquanto o diagnóstico de TB multiresistente não for realizado

precocemente e um tratamento adequado for instituído, a transmissão não será

interrompida (Haas and Des Prez 1994). Pacientes com Tuberculose causada

por MDR devem ser tratados com regimes terapêuticos contendo

antituberculostáticos de segunda linha. Pelo menos quatro drogas a que os

organismos são suscetíveis devem ser usadas, e o tratamento deve ser dado

pelo período mínimo de 18 meses, medidas que assegurem a aderência ao

tratamento devem ser seguidas (Tuberculose, 2006).

1.7 Manifestações Clínicas da TB

A TB é uma doença crônica ou subaguda, podendo apresentar períodos

de remissão, retardando o paciente na busca de serviço médico especializado.

Esta conduta pode agravar ainda mais seu estado clínico e pode aumentar o

tempo de transmissão do bacilo na população. As manifestações clínicas da TB

variam muito e dependem de diversos fatores, inerentes ao microrganismo e ao

hospedeiro (imunodeficiência, desnutrição, etc), bem como as suas interações,

as quais influenciam diretamente na apresentação clínica da doença (ATS,

2000).

Como a TB é normalmente adquirida por inalação do bacilo, a localização

inicial é no pulmão. Posteriormente, pode ocorrer uma disseminação para outros

órgãos, causando o que é chamado de tuberculose extrapulmonar (óssea,

meningoencefálica, renal, genitourinária, etc.). Como citado anteriormente, após

o advento da AIDS vários estudos têm descrito menor apresentação da forma

pulmonar da TB (38%) entre pacientes com infecção por HIV na fase avançada

e a ocorrência de lesões pulmonares associadas a lesões extrapulmonares em

32% (ATS, 2000; Kritski and Ruffino-Netto, 2000). Entre as formas

extrapulmonares isoladas, a mais freqüente é a forma ganglionar. Nos pacientes

com TB pulmonar e infectados pelo HIV, principalmente naqueles na fase

avançada de sua imunodepressão, é menos comum a tosse produtiva e

hemoptise e mais freqüente a dispnéia. Estas características clínicas dificultam o

diagnóstico clínico e a obtenção de amostras clínicas para exame baciloscópico

(Kritski 2000). O M. tuberculosis pode determinar lesões em outros órgãos, além

do pulmão, entre estes o coração (preferencialmente no pericárdio), a pele, o

peritônio, os órgãos genitais, o intestino, as glândulas adrenais, o olho e a

laringe.

1.7.1 Tuberculose Pulmonar

Os sintomas mais comuns de Tuberculose Pulmonar são tosse

persistente por mais de duas ou três semanas, freqüentemente associada a

sintomas sistêmicos como febre, sudorese e emagrecimento. Adicionalmente,

outros sintomas como linfoadenopatia, em conformidade com tuberculose

extrapulmonar, pode ser notado, especialmente em pacientes com infecção por

HIV. Todos estes sintomas e sinais são inespecíficos e podem estar presentes

em outras enfermidades pulmonares, incluindo doenças agudas do trato

respiratório, asma, doença pulmonar obstrutiva crônica. Tradicionalmente, a

tosse persistente tem servido como critério para a definição de suspeita de

tuberculose e é usada nacional e internacionalmente, particularmente em áreas

de moderada a alta prevalência de Tuberculose (Tuberculose, 2006).

Inicialmente, nos pacientes não imunodeprimidos, os sintomas

respiratórios usualmente referidos são tosse acompanhada de expectoração

mucopurulenta, às vezes com sangue e dor torácica. Dispnéia é pouco

freqüente, ocorrendo apenas nos pacientes com lesões pulmonares mais

avançadas e de longa duração. Rouquidão normalmente caracteriza

comprometimento da laringe e requer confirmação pelo elevado risco de

transmissão aos contatos (Kritski, 2000).

1.8 Tuberculose e HIV

A infecção com HIV aumenta a probabilidade da progressão da infecção

com M. tuberculosis e as manifestações clínicas da doença. A infecção do HIV

também dificulta o diagnóstico de Tuberculose Pulmonar, uma vez que, em

comparação com os não infectados pelo HIV, pacientes infectados apresentam

uma menor sensibilidade de detecção pela microscopia direta. Além disto,

estudos mostram que as características radiográficas na fase avançada da

doença são atípicas. Portanto, o conhecimento do status do HIV, incluindo uma

busca de indicadores que sugiram a presença da infecção de HIV, de um

paciente é fundamental para o manejo diagnóstico e clínico do paciente,

particularmente em áreas com prevalência elevada de HIV/TB (Kivihya-Ndugga

et al., 2004; Sharma et al., 2005; van Cleeff et al., 2005; Keshinro and Diul,

2006; WHO, 2006)

1.9 Métodos de Diagnóstico Laboratorial da Tuberculose

Reconhecidamente, a pesquisa bacteriológica é o método prioritário, quer

para o diagnóstico, quer para o controle do tratamento da Tuberculose, além de

permitir a identificação da principal fonte de transmissão da infecção: o paciente

bacilífero. O diagnóstico microbiológico contempla a detecção e isolamento da

micobactéria, a identificação da cepa e/ou do complexo isolado, e a

determinação da sensibilidade do microorganismo aos antituberculostáticos. O

estudo radiológico convencional torácico é indicado sempre, como método

auxiliar para os sintomáticos respiratórios negativos à baciloscopia do escarro

espontâneo e para os indivíduos em contato com pacientes bacilíferos, de todas

as idades, intradomiciliares ou institucionais, com ou sem sintomatologia

respiratória, suspeitos de TB extrapulmonar e infectados por HIV ou com AIDS.

A prova Tuberculínica (PPD) também faz parte dos métodos de abordagem

diagnóstica e é indicada como método de triagem de hipersensibilidade. Outros

métodos são incluídos no diagnóstico de TB pulmonar de acordo com a

complexidade do caso, como avaliação do escarro induzido, broncoscopia,

biópsia transbrônquica, tomografia de tórax, técnicas de biologia molecular. Os

testes sorológicos não apresentaram sensibilidade e especificidade que

justifiquem o uso rotineiro na investigação clínica da TB (ATS, 2000; Kritski,

2000; Tuberculose, 2004). A falta de um diagnóstico rápido e confiável para a TB

constitui um sério problema de saúde pública. Recentemente, em estudos

realizados em países africanos de elevada prevalência de infecção pelo HIV, a

ocorrência de TB pulmonar paucibacilar (com baciloscopia negativa/cultura

positiva) foi associada à menor sobrevida, mesmo em pacientes submetidos ao

tratamento supervisionado (DOTS) (Hargreaves et al., 2001).

A detecção da doença na sua fase inicial é de vital importância para o

início efetivo do tratamento, bem como para evitar a utilização inadequada de

medicamentos potencialmente tóxicos. O diagnóstico clínico precoce da doença

se faz bastante complicado, sobretudo quando a TB ocorre associada a outras

enfermidades (infecção pelo HIV, neoplasias malignas, pós-transplantes, etc),

quando então o diagnóstico laboratorial é de extrema importância.

1.9.1 Métodos Convencionais para diagnóstico de TB pulmonar

1.9.1.1 Baciloscopia

A baciloscopia consiste na visualização microscópica do bacilo da TB

após fixação em lâmina e coloração específica do material a ser analisado. O

método de coloração específico para micobactéria usado na rotina do

diagnóstico é o Ziehl-Nielsen (ZN) (ATS, 2000; Tuberculose, 2004). Este método

baseia-se na capacidade das micobactérias em reter a fucsina após coloração

quando se apresentam como bastonetes, ligeiramente delgados, corados em

vermelho com fundo azul, que não descora com álcool-ácido, sendo por isso

referidas como bacilos álcool-ácido resistentes (BAAR) (Bloom and Murray,

1992).

A metodologia é simples, rápida, de fácil execução e de baixo custo. A

baciloscopia disponibiliza uma ampla cobertura diagnóstica, possibilitando a

identificação da principal fonte de infecção (pacientes com baciloscopia positiva:

bacilíferos), o que permite a pronta atuação na interrupção da cadeia de

transmissão. No entanto, é pouco sensível, detectando apenas 60% dos

materiais clínicos com crescimento em cultura, e não é específica, uma vez que

não é possível distinguir entre as espécies de micobactérias descritas,

necessitando identificação da micobactéria posteriormente (Styblo, 1991). A

sensibilidade do método depende da presença de 10.000 organismos por mL de

amostra para um resultado positivo (Kritski, 2000). Isto significa que um

esfregaço negativo não exclui um caso de TB. Esse fato é ainda mais notável

quando a infecção ocorre em outros órgãos (pleura, meninges), onde um

número ainda menor de organismos pode causar manifestações clínicas.

1.9.1.2 Cultura

O isolamento de micobactérias em meio de cultura é um método mais

sensível que a baciloscopia, tanto para TB pulmonares como para TB

extrapulmonares. A cultura pode detectar de 10 a 100 bacilos por mL de material

(Kritski, 2000). Um diagnóstico pode ser realizado pela cultura, mesmo nos

casos em que o número de bacilos é insuficiente para uma baciloscopia positiva.

Tradicionalmente, o isolamento através da cultura tem sido realizado em

meios sólidos e/ou líquidos, tais como o meio de Löwenstein-Jensen, o meio

sólido de Ogawa, e aqueles que utilizam o ágar, como o meio Middlebrook (7H-

10 e 7H-11). (Kudoh and Kudoh, 1974). O crescimento só é detectável 3 a 6

semanas após a inoculação. Quando os espécimes como escarro, urina e

secreção de cavidade aberta são utilizados para o cultivo, estes materiais são

normalmente contaminados, sendo necessário eliminar a flora associada, que

contamina o meio e impede a multiplicação dos bacilos. O método de

descontaminação mais utilizado é o tratamento com hidróxido de sódio e/ou N-

acetil-L-cisteína/NaOH (Kritski, 2000). A sensibilidade e especificidade da cultura

variam consideravelmente com o material analisado, respectivamente de 30% a

96% e de 98% a 100%, sendo melhor em escarro (Bloom and Murray, 1992;

ATS, 2000).

1.9.1.3 Métodos Radiológicos

A TB apresenta opacidades radiológicas na maioria dos casos,

constituindo um relevante instrumento diagnóstico. As manifestações

radiológicas da TB associadas à infecção por HIV dependem do nível de

imunodepressão e do tempo da doença. Assim, pacientes com imunidade

celular íntegra apresentam lesões semelhantes às da pessoa não infectada e

entre os pacientes com grave imunosupressão, 10 a 20% apresentam

radiografias normais (Tuberculose, 2004). Achados radiológicos atípicos são

encontrados na fase mais avançada da doença, com maior freqüência de

imagens difusas, não cavitárias, com linfonodomegalia hiliar e/ou mediastinal, e

em 10% dos casos, sem alteração no radiograma torácico (Kritski, 2000;

Tuberculose, 2004).

1.10 Novos Métodos para o diagnóstico de TB pulmonar

As técnicas de amplificação de ácidos nucléicos (AAN), tendo como alvo

seqüências específicas de microorganismos, surgiram como promissores

instrumentos para o diagnóstico de TB sensível ou resistente. Entre estas, as

mais utilizadas para o diagnóstico de TB são as técnicas de reação em cadeia

da polimerase (PCR), amplificação mediada por transcrição, amplificação por

deslocamento de fita e reação em cadeia da ligase (Catanzaro et al., 2000;

Ellingson et al., 2000; Dziadek et al., 2001; Cleary et al., 2003)

1.10.1 Métodos de Biologia Molecular Comerciais

Apesar de apresentarem em média elevadas sensibilidades e

especificidades em amostras com baciloscopia positiva, o seu rendimento

diagnóstico é inferior nas amostras com baciloscopia negativa. Até o momento,

existem alguns testes disponíveis comercialmente: AMTD® e o EMTD®- nova

geração do AMTD® (Gen- Probe Inc, San Diego, CA); Amplicor® e Cobas

Amplicor® (Roche Molecular Systems, Brancburg, NJ) – o último uma geração

mais completa; LCx® (Abbott Labortories) e SDA® (Biosciences, Sparks, Md).

Entretanto, apenas o AMTD®, o Amplicor® e o EMTD® foram aprovados pelo

Food and Drug Administration (FDA). Inicialmente, os testes Amplicor® e o

EMTD® foram aprovados somente para a utilização em amostras clínicas

pulmonares com baciloscopia positiva, mas recentemente, EMTD® foi aprovado

para a utilização em amostras de pacientes suspeitos de TB pulmonar com

baciloscopia positiva e negativa. Ambos os testes tem seu uso aprovado no

Brasil (Soini et al., 1996; ATS, 2000; Sarmiento et al. 2003).

A sensibilidade e especificidade de ambos os testes têm sido analisados

em diferentes estudos (Gamboa et al., 1997; Yuen et al., 1997; Gamboa et al.

1998; Scarparo et al., 2000; Shibuya et al., 2000; Al Zahrani et al., 2001; Mitarai

et al., 2001; Mitarai et al., 2001; Woods, 2001; Fegou et al., 2005; Goessens et

al., 2005; Tarhan et al., 2005; van Cleeff et al., 2005). A Tabela 1, adaptada de

Drobniewski et al. (2003), mostra uma comparação entre alguns estudos de

sensibilidade e especificidade.

Tabela 1. Testes moleculares para detecção de DNA de Mycobacterium

tuberculosis

SE:sensibilidade; ES: especificidade; P: amostras pulmonares, ExP: amostras extrapulmonares.

Adaptado de Drobniewski et al., (2003).

Referência Bibliográfica

Testes Utilizados SE – ES

(%)

Fegou et. Al, 2005 Cobas Amplicor 73,6- 100%

Goessen et al, 2005 Cobas Amplicor

AMTD II

78- 99,9%

86,2-99,9%

Ribeiro et al, 2004 LCx 92,7-93%

Sperhacke et al, 2004 IS6110

PCR dot-blot

94-95%

Persimioni et al., 2002

AMTD II

88,– 99,2%,

Scarparo et al., 2000

AMTD II

Cobas Amplicor

85,7 – 100% (P),

82,9 – 100% (ExP)

94,2 – 100% (P),

85,0 – 100% (ExP)

Della-Latta et al., 1998

AMTD II

Amplicor

97,1 – 99,5%

96,7 – 100%

Eing et al., 1998

Cobas Amplicor

In-House

IS6110 PCR

66,3 – 99,7%

91,1 – 99,8%

1.10.2 Métodos de Biologia Molecular in house

Além dos testes comerciais, alternativas de custo mais baixo (técnicas in

house) tem sido descritas, inclusive no nosso meio, com rendimentos

promissores entre as amostras com baciloscopia negativa (88% com detecção

em gel de agarose e 94.4% com detecção colorimétrica), porém para serem

disponibilizadas na rotina necessitam de estudos de validação inter-laboratorial e

análises de custo-efetividade (Sperhacke et al., 2004). A maioria de ensaios

padronizados em laboratório (in house) utiliza a amplificação através da reação

em cadeia da polimerase (PCR) como estratégia. Uma das regiões “alvo” mais

utilizadas é a seqüência de inserção de DNA (IS6110) repetitiva e específica do

complexo M. tuberculosis. Esta seqüência de inserção está repetida de 1 a 20

vezes no cromossomo bacteriano, conferindo uma maior sensibilidade aos

testes que utilizam essa região para a amplificação (Eisenach et al., 1990;

Thierry et al., 1990; Eisenach et al., 1991; Folgueira et al., 1993; Forbes and

Hicks, 1993; Rossetti, 1997; Almeda et al., 2000; Portillo-Gomez et al., 2000). De

maneira geral, a diferença entre os métodos in house reside na região de

amplificação, no preparo da amostra e na detecção dos fragmentos amplificados

pela PCR.

Algumas revisões qualitativas (Ieven and Goossens, 1997; ATS, 2000;

Drobniewski et al., 2003) e estudos interlaboratoriais (Noordhoek et al., 1994;

Noordhoek et al., 1996; Noordhoek et al., 2004) têm apontado para a grande

variabilidade na sensibilidade e especificidade em diferentes estudos utilizando a

PCR. As explicações para estas diferenças incluem os diferentes processos de

descontaminação das amostras, a contaminação cruzada, a inibição, o erro de

amostragem, a qualidade do padrão ouro, e a análise de amostras respiratórias

e não respiratórias (Sarmiento et al., 2003). Outro aspecto importante na

acurácia da técnica de detecção de M. tuberculosis refere-se à análise do limite

de detecção considerado em cada procedimento de amplificação. A tabela 2

mostra a comparação de alguns métodos de amplificação por PCR que

utilizaram os primers IS6110 em amostras de espécimes respiratórios com a

respectiva sensibilidade e especificidade, os valores de limite de detecção com

valores em unidades formadoras de colônias (UFC) e a sensibilidade e

especificidade em relação aos resultados das amostras clínicas obtidos em

cultura (resultado em %).

Tabela 2. Técnica de detecção, limite de detecção, sensibilidade e

especificidade da PCR obtidos por diferentes métodos de preparação de

amostra.

Preparo Amostra Técnica de

Detecção

UFC SE

(%)

Referência

bibliográfica

sacarose 50% gel de agarose/Dig-

PCR Elisa

n.i.

96,5 95,3

Borun et al., 2001

lisozima/proteinase

K /SDS

gel de agarose 3 59 97

Almeda et al., 2000

triton/proteinase K/

tiocianato de

guanidina

gel de agarose 1 94 100

Portilio-Gomes et al., 2000

Tiocianato de

guanidina,

Sílica

Southern blotting,

sonda/ biotina

100 98 100

Andersen et al., 1993

fervura, SDS,

chelex (Biorad)

1.gel de agarose 2.

sonda /digoxigenina

Zambardi et al., 1993

fervura

fenol/clorofórmio

sonda/biotina 2 91 100

Nolte et al., 1993

fenol/clorofórmio

resina

colorimétrica

sonda /biotina

200

Amicosante et al., 1995

partículas de

zircônio

clorofórmio/

isoamilico

colorimétrica

primers/biotina

12.5 100 97

Cho et al., 1995

sonicação e

fervura

gel de agarose/

sonda digoxigenina

n.i.

91 99,8

Eing et al., 1998

n.i; não informado, UFC: unidade formadora de colônias, SE: Sensibilidade, ES: Especificidade

Para que a técnica da PCR seja executada com sucesso no diagnóstico

de doenças, precauções rigorosas são essenciais e devem ser adotadas a fim

de evitar resultados falso-positivos e falso-negativos. São necessárias a

utilização de controles em todas as etapas do processo para confirmar a

obtenção adequada do DNA da amostra clínica, a eficácia da reação de PCR e a

ausência de contaminação cruzada com produto de M. tuberculosis nos

reagentes ou no processo de manipulação (Kritski et al., 1996; Suffys et al.,

2000; Valentine-Thon, 2002). Os métodos moleculares trouxeram avanços no

diagnóstico das doenças nos últimos anos, entretanto a utilização destes testes

exige cautela, pois, ainda são escassos, em nosso meio, estudos que avaliem a

utilidade clínica destas metodologias. Alguns estudos sugerem que testes de

AAN (testes comerciais, PCR in house) devem ser sempre solicitados junto com

os testes bacteriológicos e na análise final laboratorial, os dados clínicos são

imprescindíveis e devem ser considerados (Watterson and Drobniewski, 2000).

1.11 Análise de Custo Efetividade

A base desta análise de custo-efetividade é a comparação entre as

atividades de rotina em uso e a intervenção proposta para a identificação de um

possível impacto positivo. Para avaliação do impacto da nova tecnologia, são

construídas árvores decisórias cujos ramos representam as diferentes

seqüências de investigação diagnóstica que podem preceder o tratamento dos

casos de TB. A análise da seqüência de atividades até o tratamento, em cada

ramo, sinaliza qual apresenta menor custo por caso ativo tratado. Para comparar

o custo de cada opção de investigação, isolamos o ramo da árvore decisória e

avaliamos o custo total e o que foi obtido através desse ramo.

A inclusão deste tópico atende a uma necessidade crescente no

planejamento da distribuição dos recursos destinados às medidas de Saúde

Pública. A associação do custo e da efetividade fornece indicação da relativa

eficiência da medida a ser considerada e facilita a alocação e o gerenciamento

de recursos, ao permitir que sejam identificadas intervenções com maior impacto

no controle das doenças.

2.Objetivos

2.1 Objetivo Geral

• Determinar a utilidade das técnicas de PCR “in house” (PCR dot-blot e

AG-PCR) desenvolvidas pelo CDTC/ RS para o diagnóstico da

Tuberculose Pulmonar utilizando amostras respiratórias de pacientes

infectados por HIV ou não atendidos em uma Unidade Hospitalar de

Saúde Pública.

2.2 Objetivos Específicos

• Avaliar a acurácia e valores preditivos negativos e positivos no

diagnóstico laboratorial através das técnicas de PCR in house para a

detecção de TB pulmonar em pacientes infectados por HIV.

• Avaliar a acurácia e valores preditivos negativos e positivos no

diagnóstico laboratorial através da técnica de PCR para a detecção de TB

pulmonar em pacientes com baciloscopia negativa e positiva.

• Avaliar o efeito da suspeita clínica (Probabilidade Pré-teste) estimada

pelos pneumologistas em pacientes com baciloscopia negativa no

desempenho da técnica de PCR in house (PCR dot-blot) no diagnóstico

de Tuberculose pulmonar.

• Avaliar o desempenho e valores preditivos negativos e positivos no

diagnóstico laboratorial das técnicas de PCR in house através da

associação destas à técnica de baciloscopia para a detecção de TB

pulmonar em pacientes infectados por HIV ou não.

• Avaliar o custo-efetividade da técnica de PCR in house (PCR dot-blot) em

uma Unidade de Saúde Pública.

3. Material e Métodos

3.1 Pacientes

Pacientes com suspeita de Tuberculose Pulmonar, referenciados a um

hospital de referência para o atendimento de TB e HIV, o hospital Sanatório

Partenon do Estado do Rio Grande do Sul, foram avaliados em um estudo

prospectivo de Maio de 2003 a maio de 2004. Os pacientes elegíveis foram

aqueles que apresentavam sintomas clínicos de TB, como tosse por mais de 3

semanas. Todos os pacientes que participaram do estudo assinaram termo de

consentimento (anexo 1) e este estudo foi aprovado pelo Comitê de ética da

Fundação Estadual de Pesquisa em Saúde (n. 01/2002) (anexo 4).

3.3 Logística da análise e métodos de PCR in house avaliados

A fim de proporcionar um melhor entendimento dos artigos que serão

apresentados no item 4, seguem abaixo algumas ferramentas que visam facilitar

tal compreensão.

3.3.1 Logística da avaliação

3.3.1.1 Fluxograma da logística operacional de recrutamento de

pacientes e coleta de dados

A figura 1 mostra a sequência de procedimentos realizada com os pacientes do

recrutamento à análise laboratorial.

Figura 1. Fluxograma da logística operacional de recrutamento de pacientes e coleta de dados

3.3.1.2 Fluxograma das diferentes fases de análise da técnica de

PCR in house desenvolvidas

A figura 2 mostra a sequência das diferentes análises realizadas neste estudo e

apresentadas na forma de artigos.

Critério de Elegibilidade:

Divisão dos resultados de acordo com

a característica da análise a ser

desenvolvida

Crit ério de Elegibilidade:

Fase II- Avaliação da acurácia das

metodologias

Fase III- Avaliação das metodologias

em rotinas clínicas

Crit ério de Elegibilidade:

Fase I- Comparação das met odologias

Critério de Elegibilidade:

Fase IV- Avaliação do cust o-

efetividade das met odologias em

rotinas clínicas

Critério de Elegibilidade:

Art igo 1

Contribution of two in house PCR (color imet r ic

and non colorimetric) in the diagnosis of

Pulmonary Tuberculosis in Brazilian patients

with and without HIV

Critério de Elegibilidade:

Ar t i go 3

PCR colorimetric dot-blot assay and clinical

pretest probability for diagnosis of Pulmonary

Tuberculosis in Smear-Negative patients

Ar t i go 2

The usefulness of PCR colorimetricdot-blot

assay for the rapid and convenient diagnosis

of pulmonary tuberculosisin HIV seropositive

and HIV seronegat ive individuals when used in

parallel with Ziehl Neelsen smear examination

Ar t i go 4

Cost-effectiveness analysis of PCR for the

rapid diagnosis of pulmonary tuberculosis

Figura 2. Fluxograma das diferentes fases de análise da técnica de PCR in house desenvolvidas

3.3.2 Métodos de PCR in house analisados

3.3.2.1 Região selecionada para amplificação por PCR

A região cromossômica utilizada como alvo de amplificações foi baseada

na região do elemento IS6110 presente em múltiplas cópias no complexo M.

tuberculosis (Eisenach, Cave et al. 1990). Foram utilizados dois pares de

primers:

A) Os primers SK1 e SK2 complementares à região do elemento de

inserção IS6110, os quais amplificam um fragmento de DNA de 132 pb.

B) Os primers biotinilados INS1 e INS2, que amplificam um fragmento de

DNA de 245 pb. O produto desta amplificação foi purificado e utilizado como

sonda.

A figura 3 representa a posição dos primers e a complementaridade

destes à região do elemento de inserção IS6110.

5´

3´

Os primers INS1 e INS2 amplificam um fragmento de DNA correspondente a 245 pb; os primers SK1 e SK2 amplificam

um fragmento de DNA de 132 pb.

Figura 3. Esquema representativo de uma região do elemento de inserção IS6110 mostrando a localização dos

primers utilizados no estudo.

INS1

SK1

SK2

INS2

IS6110

3.3.2.1 Primers utilizados para a amplificação do DNA de

Mycobaterium tuberculosis

Os primers utilizados estão listados na tabela 3 e foram sintetizados pela

Invitrogen (Molecular Biology Incorporating Life Technologies

and ResGen

Brand).

Tabela 3. Primer, seqüências, regiões, posições no genoma de M. tuberculosis e

tamanho do fragmento de DNA amplificado referentes à sonda utilizada na

hibridização e ao DNA amplificado das amostras clínicas.

Primers

Seqüências (5´⇒ 3´)

Região

Posição

Tamanho do

fragmento de DNA

amplificado (pb)

INS-1/INS-2

Biotinilados

(sonda)

CGTGAGGGCATCGAGGTGGC

CGCTAGGCGTCGGTGACAAA

IS6110

631-875

245

SK1 / SK2

AACGGCTGATGACCAAACTC

GGTTAGGTGCTGGTGGTCC

IS6110

666-807

132

A figura 4 corresponde à análise dos produtos da PCR amplificados com

DNA de M. tuberculosis. O fragmento de DNA de 132 pb foi gerado pela

amplificação com os primers SK1/SK2 e o fragmento de DNA de 245 pb foi

gerado pela amplificação com os primers INS1/INS2.

Figura 4. Eletroforese em gel de agarose (2%).

A primeira linha corresponde ao contém o marcador de tamanho molecular (MTM, 100bp ladder),

as linhas 1 e 2 mostram os fragmentos de DNA de 132 pb, a linhas 3 e 4 mostram o fragmento

de DNA de 245 pb.

MTM 1 2 3 4

3.3.2.2 PCR in house com detecção em gel de agarose (PCR-

AG)

A reação de amplificação foi padronizada com os primers SK1 e SK2

utilizando o DNA de M. tuberculosis (H37Rv). A figura 5 corresponde à análise

dos produtos de PCR amplificados. O fragmento amplificado de DNA de 132 pb

foi visualizado em gel de agarose 2%.

Figura 5. Eletroforese em gel de agarose (2%).

A primeira linha contém o marcador de tamanho molecular (MTM, 100bp ladder), as linhas 1, 2 e

3 mostram o controle negativo de extração, o controle negativo de reação e o controle positivo

de reação), respectivamente. A linha 4 correspondem a uma amostra clínica positiva escarro

espontâneo.

3.3.2.3 PCR in house colorimétrico (PCR dot-blot)

Os produtos da PCR de cada amostra clínica foram transferidos para

membrana de naylon (Biodyne B - Gibco-BRL) e processadas conforme

protocolo padronizado.

A figura 6 é uma representação esquemática do procedimento da PCR

dot-blot colorimétrico. No esquema está representado parte do elemento de

inserção IS6110 e as regiões de localização de cada primer utilizados no

procedimento.

400

300

200

100

132 pb

MTM 1 2 3 4

A, B, C e D mostram as etapas do processo.

(A) O sistema envolve a imobilização (dot) na membrana dos produtos da PCR amplificados a partir das

amostras clínicas.

(B) A sonda correspondendo ao fragmento de DNA de 245 pb obtido da PCR com os primers INS biotinilados é

hibridizada com os produtos fixados na membrana.

(D) A adição dos substratos 5-Bromo-4-Chloro-3-Indoyl Phosphate (NBT) e Nitro Blue Tetrazolium (BCIP)

forma um precipitado insolúvel (azul-púrpura) com a enzima, podendo então ser visualizado na membrana.

Figura 6. Representação esquemática do procedimento de Dot-blot colorimétrico.

Produto da PCR (132 pb)

Fixado na

Membrana

Sonda INS Biotinilada (245 pb)

Complexo Streptavidina Fosfatase

Alcalina

Membrana

Substratos da Enzima (NBT/BCIP)

SK2 INS2

INS1 SK1

Nucleotídeo 631-650 Nucleotídeo 666-686

CGTGAGGGCATCGAGGTGGC AACGGCTGATGACCAAACTC

A figura 7 representa a análise utilizando a metodologia do PCR dot-blot

colorimétrico.

Figura 7. PCR dot-blot, realizado com os produtos da PCR obtidos de diferentes amostras de escarro

espontâneo

Os pontos 1 e 2 mostram os fragmentos de DNA amplificado correspondentes a 132 pb controle

positivo de reação e extração, respectivamente. Os pontos 3, 4 e 5 mostram o produto da

amplificação (132 pb) correspondendo as amostras de escarro espontâneo positivas para

Mycobacterium. tuberculosis. Os pontos 6 e 7 correspondem a resultados negativos para

Mycobacterium tuberculosis. Pontos 8 e 9 correspondem ao controle negativo de reação e

extração, respectivamente.

4. Resultados

Os resultados a seguir apresentados foram organizados na forma de

artigos.

A sequência de análise seguiu a sequência proposta no fluxograma

apresentado na figura 2.

O artigo 1 avalia a performance da técnica de PCR in house utilizando

dois tipos de metodologias de detecção de PCR por gel agarose e por dot-blot. A

partir desta avaliação e com os resultados superiores do PCR dot-blot, partiu-se

para uma avaliação da acurácia deste, quando utilizado em associação com

técnicas convencionais de rotina. Então, surgiu o artigo 2 que avalia a utilidade

do PCR dot-blot quando utilizado em associação com a técnica de microscopia

direta por coloração de ZN.

Além disto, com a intenção de verificar a acurácia do PCR dot-blot

quando associado a suspeita clínica de diagnóstico surgiu o artigo 3, sendo este

já aceito para publicação.

A partir dos resultados obtidos no artigo 2, resolveu-se avaliar o custo

efetividade da técnica de PCR dot-blot, quando uitilizada em associação com a

microscopia direta por coloração de ZN, estes dados encontram-se no artigo 4.

4.1 Artigo 1

Submissão posterior ao Brazilian Journal of Microbiology, cujas instruções

para os autores estão no anexo 5 (item 9.5.1).

Contribution of two in house PCR (colorimetric and non colorimetric) in the 1

diagnosis of Pulmonary Tuberculosis in Brazilian patients with and without HIV 2

Luciene C. Scherer,

1,3

; Rosa D. Sperhacke.

; Fernanda C. Q. Mello.

; Carla Jarczewski

; 3

Patrícia I. Cafrune.

; Candice Michellon

, Marta Osorio Ribeiro.

; Antonio Ruffino 4

Netto.

; Maria L. R. Rossetti.

2,3

and Afrânio L. Kritski.

1-Post Graduation Program in Biological Science- Biochemistry Department, Federal 6

University of Rio Grande do Sul -UFRGS, Porto Alegre/RS/ Brazil; 7

2- Technological and Scientific Development Center -CDCT, State Foundation in 8

Production and Health Research - FEPPS/RS) Porto Alegre/RS/Brazil; 9

3- Lutheran University of Brasil-ULBRA, Canoas/ RS/ Brazil; 10

4- Tuberculosis Research Unit, Clementino Fraga Filho Hospital, UPT/ HUCFF, Federal 11

University of Rio de Janeiro -UFRJ, Rio de Janeiro, Brazil; 12

5- Partenon Hospital / Secretary of Health of Rio Grande do Sul /Porto Alegre/ RS/ 13

Brazil; 14

6- Public Laboratory of the State of Rio Grande do Sul (LACEN/RS), State Foundation in 15

Production and Health Research - FEPPS/RS) Porto Alegre/RS/Brazil; 16

*From: Technological and Scientific Development Center -CDCT, State Foundation in 18

Production and Health Research - FEPPS/RS) Porto Alegre/RS/Brazil; 19

Correspondence and requests for reprints should be addressed to Luciene Cardoso 21

Scherer, Technological and Scientific Development Center -CDCT, State Foundation in 22

Production and Health Research - FEPPS/RS) Porto Alegre/RS/Brazil, Av Ipiranga 5400, 23

3 andar, Centro de Desenvolvimento Científico e tecnológico- CDCT, Porto Alegre CEP 24

91000000. Phone/fax number 05133520336, Porto Alegre, Brazil. E-25

mail:luciene.scherer@hotmail.com 26

Financial Support: this work was supported by CNPq, REDE-TB - number 62.005/01-4-27

PADCT; ICIDR-NIH-grant number 1 U19 AI45432 28

Key words: in house PCR, HIV, tuberculosis, diagnosis 29

Abbreviation List: 30

AFB- Acid Fast Bacilli 31

CHC- Community Health Centers 32

HIV- Human Imunnodeficiency Virus 33

HIV

-HIV seropositive 34

HIV

- HIV seronegative 35

MOTT -Mycobacterium Other Than Tuberculosis 36

MTB- Mycobacterium tuberculosis 37

NAA -Nucleic Acid Amplification 38

NPV- Negative Predictive Value 39

PCR- Polymerase Chain Reaction 40

PCR-AG- Polymerase Chain Reaction agarose gel electrophoresis 41

PCR-dot-blot- Polymerase Chain Reaction dot-blot methodology 42

PPV- Positive Predictive Value 43

PTB- Pulmonary Tuberculosis 44

SE- Sensitivity 45

SP- Specificity 46

PRH -Partenon Reference Hospital 47

TB –Tuberculosis 48

Abstract 49

Background: Direct smear examination with Ziehl-Neelsen (ZN) staining for the 50

diagnosis of pulmonary tuberculosis (PTB), is cheap and easy to use, but its low 51

sensitivity is a major drawback, mainly in HIV patients. So, new tools for the laboratory 52

diagnosis are urgently needed to improve the case detection rate, especially in regions 53

with high prevalence of TB and HIV. 54

Objective: To evaluate the performance of two in house PCR (Polymerase Chain 55

Reaction): PCR dot-blot methodology (PCR dot-blot) and PCR agarose gel 56

electrophoresis (PCR-AG) for the diagnosis of Pulmonary Tuberculosis (PTB) in HIV 57

patients. 58

Methods: A prospective study was conducted (from May 2003 to May 2004) in a 59

reference TB/HIV hospital. Sputum specimens from 277 PTB suspects were tested by 60

Acid Fast Bacilli (AFB) smear, Culture and in house PCR assays (PCR dot-blot and 61

PCR-AG) and the performance was evaluated. Gold standard was the culture positive 62

combined with the definition of clinical pulmonary TB. 63

Results: The overall prevalence of PTB was 46% (128/277); in HIV seropositive (HIV

)

was 54.0% (40/74). The Sensitivity and Specificity of PCR dot-blot were 74% (CI 95%; 65

66.1%-81.2%) and 85% (CI 95%; 78.8%-90.3%); of PCR-AG were 43% (CI 95%; 66

34.5%-51.6%) and 76% (CI 95%; 69.2%-82.8%), respectively. For HIV

and HIV 67

seronegative (HIV

) Sensitivities of PCR dot-blot (72% vs 75%; p=0.46) and PCR-AG 68

(42% vs 43%; p=0.54) were similar. 69

Conclusion: This study shows that in house PCR may offer an improvement for ruling 70

out PTB diagnosis for PTB suspects assisted at hospitals with a high prevalence of 71

TB/HIV. 72

Contribuição de duas técnicas de PCR in house (colorimétrica e não colorimétrica) 74

no diagnóstico de TB pulmonar em pacientes brasileiros infectados ou não por HIV 75

Resumo 76

Introdução: Microscopia direta por coloração com Ziehl-Neelsen (ZN) para o diagnóstico 77

de Tuberculose (TB), é barata, de fácil uso, mas apresenta baixa sensibilidade 78

principalmente para pacientes HIV soropositivos, sendo necessárias novas técnicas de 79

diagnóstico para melhorar a detecção de casos de TB em regiões com alta prevalência de 80

TB/ HIV. 81

Objetivos: Avaliar o desempenho de duas metodologias de detecção de PCR in house: 82

PCR colorimétrico em dot-blot (PCR dot-blot) e PCR em eletroforese de gel de agarose 83

(PCR-AG) para o diagnóstico de TB Pulmonar em HIV soropositivos 84

Métodos: Um estudo prospectivo foi conduzido de maio de 2003 a maio de 2004 em um 85

hospital de referência para TB/HIV. Escarros espontâneos de 277 pacientes com suspeita 86

de TB foram testados por microscopia direta por coloração de Ziehl-Neelsen (ZN), 87

Cultura e ensaios de PCR in house (PCR dot-blot e PCR-AG) e o desempenho dos testes 88

foram avaliados. Padrão Ouro foi a cultura positive combinada com a definição clínica de 89

TB. 90

Resultados: A prevalência de TB foi de 46% (128/277); em HIV soropositivo (HIV

)

foi 91

54,0% (40/74). A sensibilidade e a especificidade do PCR dot-blot foram 74% (CI 95%; 92

66,1%-81,2%) e 85% (CI 95%; 78,8%-90,3%); do PCR-AG foram 43% (CI 95%; 34,5%-93

51,6%) e 76% (CI 95%; 69,2%-82,8%), respectivamente. Sensibilidade do PCR dot-blot 94

(72% vs 75%; p=0,46) e do PCR-AG (42% vs 43%; p=0,54) foram similares para HIV

and HIV soronegativos (HIV

). 96

Conclusão: Este estudo mostra que PCR in house pode oferecer um melhora na exclusão 97

de TB pulmonar em pacientes com suspeita de TB pulmonar atendidos em hospitais com 98

alta prevalência de TB/HIV. 99

Palavras-chave: PCR in house, HIV, tuberculose, diagnóstico 100

101

Background 101

Tuberculosis (TB) is a persistent health problem, and it is responsible for 8.5 million 102

cases per year, and when in association with human immunodeficiency virus (HIV) is one 103

of the leading infectious agents of death (27, 36). Frequently, the diagnosis of TB is 104

based on the positive Acid Fast Bacilli (AFB) smear for Ziehl-Neelsen (ZN) staining , 105

and this method detects around 70% of cases (36). In clinical practice, the proportion of 106

positive AFB smear is around 40-60% (25). Usually, HIV patients are AFB smear 107

negative and have lower yield on AFB smear for the TB diagnosis. Moreover, these 108

patients usually, present more atypical radiological findings and higher mortality rate. 109

The usual laboratory procedure for clinical specimens involves microscopic examination 110

for the presence of AFB and isolation and identification of the organism by culture. In 111

paucibacillary infections, the current detection method is culture, which can take up to six 112

weeks to conclusion, due to the slow growth rate of mycobacteria. Timely identification 113

of mycobacterial infection in HIV patients is critical to initiate early specific treatment, to 114

improve prognosis and to reduce the risk of dissemination and spread to other 115

hospitalized patients (26). Therefore, a global strategy for the development and 116

strengthening of laboratory diagnosis is urgently needed to improve the case detection 117

rate, especially in regions with high prevalence of TB and HIV. 118

In recent years, rapid diagnostic tests based on nucleic acid amplification (NAA) tests 119

have been developed (4, 20). In industrialized nations, automated NAA commercial tests 120

are currently being used for detection of M. tuberculosis complex organisms in 121

respiratory specimens from adult patients, HIV seronegative and non-previously treated 122

for TB(28). 123

To evaluate the potential affordable NAA techniques in developing countries, the in 124

house methods frequently used the IS6110 element (2, 12, 22, 24, 28, 29). Accordingly, 125

we evaluated the performance of two in house PCR: PCR dot-Blot (colorimetric) and 126

PCR-AG (non-colorimetric), using as a target the IS6110 element, for the diagnosis of 127

Pulmonary Tuberculosis (PTB). We compared the status of HIV and of the treatment , in 128

a setting of high prevalence of TB and HIV. This study was conducted according to 129

routine procedures at the Reference Hospital of TB/HIV of a southern Brazilian city, 130

Porto Alegre. 131

Methods 132

Study location and population 133

Porto Alegre, a southern Brazilian city, when the study was developed, had a population 134

of 1,404,670, in 2004. Its public health system includes eight community health centers 135

(CHC), 30 general hospitals, 10 specialized hospitals for TB diagnosis and treatment and 136

3 hospitals based on correctional facilities. Partenon Reference Hospital (PRH) is the 137

largest TB/HIV Reference Hospital and cares for both inpatients and outpatients. In 2004, 138

1432 cases of TB were reported. Among them, 201 (20%) were TB/ HIV cases, assisted 139

at CHCs and 213 (51%) were from hospitals the public health system of Porto 140

Alegre(10). 141

Design 142

A prospective study was conducted to evaluate the performance of two molecular tests 143

for PTB diagnosis. 144

Patients Eligible and Ineligible 145

PTB suspect patients older than 18 years assisted at PRH from May 2003 to May 146

2004 were eligible. Eligible patients were those: (1) who reported more than 3 weeks of 147

cough. Patients illegible were those receiving anti-TB treatment. Patients with a history 148

of previous TB were not excluded. Patients were excluded from the study if any of the 149

following conditions were met: (1) culture was contaminated; (2) when expectorated 150

sputum was not obtained (3) laboratory or clinical data did not fulfill the SNPTB 151

definition; (4) written informed consent was not obtained from the study participant. All 152

clinical samples were sent to the Laboratory of the State of RS, State Foundation for 153

Research in Health, Porto Alegre/RS/Brazil, (FEEPS/Lacen/RS) for laboratory analysis. 154

This study was approved by the Institutional Review Boards of FEPPS/RS (n. 01/2002). 155

Logistic 156

PTB was diagnosed using a sputum specimen and it was collected according to WHO 157

recommendations(36). The selection of the suspects entering the diagnostic process 158

followed strictly routine diagnostic procedures of the Hospital. The local site coordinator 159

was responsible for collecting all epidemiological data (patient interview was conducted 160

with a validated questionnaire) and all specimens were sent to the Public State 161

Laboratory, for laboratory analysis. Pneumologists were blinded to PCR results for 162

the assessment of PTB cases. 163

Clinical Methods 164

Clinical PTB was defined by pneumologists using the clinical follow-up (symptoms, risk 165

factors and chest X-Ray). Assessment of PTB suspect was undertaken during return 166

visits by patients to the hospital and by the review of medical records respectively 6 and 167

12 months post diagnosis. Chest X-Ray was taken for those suspects whose symptoms 168

were compatible with active TB and/or whose sputum smear AFB results were negative. 169

PTB in the past was defined as a patient, during the interview, of prior use of anti-TB 170

treatment for more than 30 days. 171

PTB non-treated was defined as patients under treatment up to or less than14 days at the 172

moment of enrolment. 173

Laboratory methods 174

AFB smear, culture, and PCR methods 175

Overall methods were performed in the same sputum. 176

AFB smear 177

Specimens were processed by the acetylcysteine method and were submitted to AFB 178

smear staining according to ZiehlNeelsen(Kudoh and Kudoh 1974). 179

Culture 180

Specimens were tested in Lowestein Jensen solid medium, and those resulting positive 181

were submitted to standard identification procedures for differentiation of MTB-complex, 182

following the routine of the Public State Laboratory (16). Cultures with no growth after 8 183

weeks were scored as “negative.” 184

PCR methods 185

Preparation of clinical specimens was performed according to Rossetti (1997) (24). The 186

DNA was amplified by in house PCR (PCR dot-blot and PCR-AG) using the IS6110 187

element as target, which utilizes biotinylated primers to amplify a 132-bp DNA sequence 188

specific to the M. tuberculosis complex SK1 (5’-AACGGCTGATGACCAAACTC-3’) 189

and SK2 (5’-GGTTAGGTGCTGGTGGTCC-3’). The primers were sintesized by 190

Invitrogen (Molecular Biology Incorporating Life Technologies

and ResGen

Brand) 191

(24, 29). PCR products were analyzed in parallel using two procedures: (1) 192

electrophoresis on 2% agarose gel, stained with ethidium bromide and visualized by 193

ultra-violet transilluminator and (2) transfer to a nylon membrane and hybridization 194

according to Sperhacke (2004) (29) The biotinylated probe used in hybridization was 195

obtained by amplification with primers [INS-1 (5’- CGTGAGGGCATCGAGGTGGC -3’) 196

and INS-2 (5’-GCGTAGGCGTCGGTGACAAA -3’). Positive (M.tuberculosis Mt H37Rv) 197

and negative controls (PCR mixture with water instead of template DNA) were included 198

for each set of PCR. To detect specimen inhibitors, a duplicate tube of PCR mix for each 199

specimen was spiked with 2 µl of aqueous solution containing 10 pg of purified DNA 200

target(29). 201

HIV 202

Blood samples were tested for HIV1 and HIV2 by serology (GenScreen HIV Plus® 203

BioRad), according to the manufacturer’s instructions, and positive tests were confirmed 204

by Western blotting (Genelabs® Diagnostics). 205

Ethics 206

Written informed consent was obtained from all study participants. This study 207

was approved by the Institutional Review Boards of FEEPS (n. 01/2002). 208

Gold Standard 209

Positive bacteriological result (at least one positive culture and biochemical 210

identification) combined with diagnosys of clinical PTB. 211

Independent Review 212

Two independent experts in TB diagnosis who did not participate in the study reviewed 213

clinical PTB. In the absence of consensus, a third TB expert was invited to consider if the 214

patients with discordant results would be considered to be free of TB or not. 215

Analysis 216

Epidemiological and laboratory data were stored in a computer database and analyzed 217

by appropriate statistical software (SPSS version 10.0). The accuracy of both PCR 218

methods were compared to the gold standard. 219

220

Results 220

Study population 221

A total of 277 PTB suspect patients were enrolled. Prevalence of PTB was 46.2% 222

(128/277) and 73.3% (203/277) were not previously treated. In HIV seropositive (HIV

) 223

26.7% (74/277), the prevalence of PTB was 54.0% (40/74). Some risk factors for PTB 224

were significantly more frequent in HIV

patients than HIV seronegative (HIV

): alcohol 225

addiction (44.0% vs 25.1%; p=0.002); TB in the past (56.2% vs 23.1%, p=0.0007), 226

history of hospital admission (41.3% vs 25.6%, p=0.01), and schooling less than 8 years 227

(72.0% vs 58.6%, p=0.04) (Table 1). Weight loss was observed more frequently among 228

HIV

, 75.7%. The most consistent predictor of PTB in all patients was a positive culture 229

and suggestive chest radiography (R: 0.36; p<0.05) but in HIV

patients it was not 230

significant (R: 0.85; p=0.32). 231

Chest X- Ray suggestive of classical tuberculosis (upper-lobe fibrocavitary) was 232

observed more frequently in HIV

(67.3%) than in HIV+ (32.2%). (data not shown) 233

Comparative performances of AFB smear, Culture and two in house PCR methods 234

on the routine for PTB diagnosys 235

AFB smear sensitivity was 60% (CI 95%; 55.5%- 68.4%). PCR dot-blot sensitivity was 236

[74% (CI 95%; 66.1%-81.2%)] higher than that observed in PCR-AG sensitivity [43% 237

(CI 95%; 34.5%-51.6%)]. The negative predictive value (NPV) of PCR dot-blot (81) was 238

similar to the NPV of Culture (88); p=0.067 (Table 2) 239

Comparing results for patients with not treatment and those with previous treatment, AFB 240

smear(62%) and culture (86%) sensitivities was higher than that observed among 241

patients treated for TB in the past (47%; p=0.16), (68%; p=0.06), respectively. PCR dot 242

blot specificity (87%), among those not previously treated, was similar to the observed in 243

patients treated for TB in the past (84%; p=0.42) and it was higher than PCR-AG 244

specificity for TB not previously treated (71%; p=0.36), respectively (Table 2). 245

Among PTB suspects 71.8% (199/277) were AFB smear negative. Among those, in non 246

previously treated, PCR dot-blot had a sensitivity of 68% (CI 95%: 52.9%-81.0%) (data 247

not shown). 248

Comparative performances of AFB smear, Culture and two in house PCR methods 249

on the routine in HIV patients for PTB diagnosys 250

The AFB smear sensitivity was low in this group (43% to HIV+ and 68% to HIV-; 251

p<0.05). In HIV

group, the AFB smear sensitivity was higher among not previously 252

treated patients than in those treated in the past, respectively (70% and 54%; p<0.05); in 253

HIV

group there was not statistical difference among these groups (Table 3). 254

As shown in Table 3, culture sensitivity results remained similar (80% to HIV+ and 85% 255

to HIV- p=0.31), in the two groups, as well as NPV (81) for HIV+ and (90) for HIV-. 256

PCR dot-blot sensitivity was higher than PCR-AG for HIV

, (72% and 42%, p< 0.05); 257

and HIV

(75% and 43%, p< 0.05). NPV of PCR dot-blot was 72 to HIV+ and 82 to HIV-258

. NPV of PCR dot-blot was similar to that of culture in HIV+ group (72 and 81; p=0.54). 259

In HIV

patients not previously treated for TB, PCR dot-blot sensitivity was higher (74% 260

vs 40%, p> 0.05) than that observed for those treated in the past; but it was not observed 261

in HIV

. (Data not shown) 262

Stratified by negative AFB smear results and comparing for HIV status, in HIV+, 77% 263

(57/74) were AFB smear negative; PCR dot-blot had similar sensitivities (61% to HIV

264

and 64% HIV

, p=0.12) and specificities (85% HIV

and 85% HIV

, p=0.10), 265

respectively. (Data not shown) 266

Inhibition and limit of detection of two in house PCR 267

The inhibition of two in house PCR was 1.9%. Twenty-three specimens presented less 268

than 50 CFU in culture (detection limit of in house PCR). These specimens were included 269

in the analysis. Among these cases: 7 (30%) showed chest X- Ray suggestive of classical 270

Tuberculosis, 14 (61%) weight loss, 3 (13%) hepatitis, 23 (100%) cough, 14 (61%) chest 271

pain and 15 (65%) dyspnea. 272

Areas of ROC Curve of AFB smear, Culture, PCR dot-blot and PCR-AG of HIV 273

seronegative and HIV seronegative PTB suspects 274

Among 203 HIV seronegative PTB suspects, ROC analysis showed the areas of AFB 275

smear (0.837), Culture (0.926), PCR dot-blot (0.801) and PCR-AG (0.599). Among 74 276

HIV seropositive patients the areas were (0.713), (0.900), (0.789) and (0.595), 277

respectively (Figura 1). 278

279

Discussion 279

In this study, among PTB suspects that were assisted at a TB/HIV Reference Hospital, 280

using the first sample of expectorated sputum, the performance of bacteriological and two 281

in house PCR techniques was compared. The potential of this study was to be carried out 282

in a developing country with a large number of PTB suspects analysed by HIV status and 283

previous anti-TB treatment. Patients were carefully characterized, with independent 284

review to determine the final PTB cases. 285

In this study we observed high prevalence of active PTB (46.2%), and a high rate of HIV 286

infection (27%) among PTB suspects, confirming the epidemiological data described by 287

Control Program of TB from Porto Alegre (10).

The most consistent predictors of PTB in 288

all patients were culture positive and suggestive chest X- Ray, but in HIV

patients this 289

was not significant, and these patients frequently present more atypical radiological 290

results(26). Moreover, we observed lower yield in the direct microscopy of expectorated 291

sputum as described previously(17, 35). These facts confirm that in developing countries 292

with high prevalence of TB and HIV, better tests and more-efficient diagnostic processes 293

are urgently needed (17). 294

Sensitivities of PCR dot-blot, showed in Table 2, ranged from 63% to 76% and presented 295

a trend to be higher than that obtained with PCR-AG (42% to 47%). The PCR dot-blot 296

sensitivities were statistically higher among not previously treated patients in comparison 297

to those treated for TB in the past, despite the HIV status. Nevertheless, similar results 298

were obtained with AFB smear and culture, suggesting that in the not previously treated 299

group there was a higher bacterial load in the clinical specimens than in the group of 300

patients treated for TB in the past. 301

Among smear negative PTB suspects with or without HIV, the sensitivity of in house 302

PCR (PCR dot-blot) ranged from 61% to 68%, similar to that reported in the meta-303

analysis of Sarmiento (32% to 92%), and also from studies in developing nations using in 304

house PCR techniques (40% to 64%), and using automated NAA tests (52% to 76%) (3, 305

11, 15, 18, 23, 25, 30). 306

Specificities of in house PCR ranging from 76% for PCR-AG to 87% for PCR dot-blot 307

were similar to values described previously (77% to 92%) in developing countries, using 308

automated NAA tests, and lower (> 95%) than those described in industrialized countries 309

(1, 2, 6, 8, 13). 310

Lower PCR-AG specificity (71% ) among those patients not previously treated could be 311

due to contact with respiratory symptomatic patients, in fact among these patients with 312

false positive results, 18 (67%) reported previous tuberculosis contact. And lower 313

specificity of PCR dot-blot (84%) among those patients with anti-TB treatment in the past 314

was due to those patients with previous infection, so it is not surprising that DNA could 315

be detected from their respiratory specimens. Decrease of specificity for PCR was similar 316

to that cited elsewhere, using in house PCR tests (7, 9). 317

The lower sensitivity of both in house PCR, PCR-AG sensitivity (42% ) among those 318

patients not previously treated and PCR dot-blot sensitivity (63%) among patients with 319

anti-TB treatment in the past may be due, in part, to the presence of inhibitors that remain 320

in the specimen following the current extraction procedure and/or a small number of 321

mycobacteria unequally distributed in test suspension or below the detection limit of 322

amplification of this test (50 CFU)(29). In fact, in our study, among false negative results, 323

20 (32%) in PCR-AG and 3 (43%) patients in PCR dot-blot, were below the detection 324

limit of amplification test. The proportion of inhibitors was (1.9%) for in house PCR, 325

similar to studies using automated NAA (0.85% to 5%) and lower than others reports 326

using in house PCR (3.7% to 22.7%) (2, 13, 14, 21, 33). The use of the IS6110 insertion 327

element as the PCR target could be a potential source of decreased sensitivity, due MTB 328

lacking this element has been reported before. However, DNA fingerprinting studies 329

performed in Brazil and especially in our state (RS), did not detect the presence of these 330

strains. On the contrary, the great majority of strains presented high copy numbers of 331

IS6110 (5, 31) 332

In this report the sensitivity of AFB Smear was significantly lower among HIV 333

seropositive /TB patients, and the sensitivity of both in house PCR was not influenced by 334

the HIV status of the patient, it was also reported by others authors (17, 35).

335

In the present study, the analysis of plot in the ROC space of accuracy in all patients 336

shows a similar performance for culture and PCR dot-blot among HIV seropositive and 337

seronegative PTB suspects. The culture method had the best performance for PTB 338

diagnosis; however, it is necessary more than 6 weeks for its final result but fast 339

identification of micobacterial infections is necessary, mainly in HIV/TB patients, who 340

need an early appropriate and specific treatment to improve prognosis. 341

Possible study limitations were the use of only one respiratory specimen (which can lead 342

to a lower sensitivity) instead of two or three specimens as proposed by WHO to 343

outpatients. However, we analyzed outpatients and inpatients, and rapid diagnosis of PTB 344

is important for these patients and sometimes it is difficult to obtain three specimens, 345

mainly in TB/HIV patients. Other limitations were the presence of inhibitions of in house 346

PCR and the low limit of detection of 50 CFU. These findings may influence the 347

performance of PCR tests (25, 28). In fact, laboratory studies have pointed low 348

sensitivities of PCR for the diagnosis of PTB and the significant variability in sensitivities 349

and specificities in different studies, mainly due to the decontamination procedures, cross 350

contaminations, inhibitions sampling error, detection limit of tests and quality of the 351

reference standard (14, 19, 25). 352

This study shows that in house PCR may offer an improvement for rulling out PTB 353

diagnosis, for PTB suspects not treated previously, evaluated in hospitals, in the 354

environment with high prevalence of TB and HIV. Among in house PCR tests, PCR dot-355

blot seems to be more appropriate for routine use, once this method includes a 356

hybridization step, which increases the sensitivity of detection. It also offers higher 357

accuracy, rapidity, ease of use, greater safety, cost effectiveness and greater objectivity in 358

the reading of results, as reported previously (32). 359

Additionally, in house PCR tests are costless than automated NAA and might be 360

introduced more widely after a proper evaluation in different settings of its clinical utility 361

and cost-effectiveness. 362

Acknowledgments. We gratefully thank Fabio Mendonça for laboratory support; 363

CEARGS (Center of studies in AIDS/ RS) for statistical support; health personnel from 364

PRH; CNPQ and REDE TB for financial support. 365

References

1. Al Zahrani, K., H. Al Jahdali, et al. (2001). "Yield of smear, culture and

amplification tests from repeated sputum induction for the diagnosis of pulmonary

tuberculosis." Int J Tuberc Lung Dis 5(9): 855-60.

2. Almeda, J., A. Garcia, et al. (2000). "Clinical evaluation of an in-house IS6110

polymerase chain reaction for diagnosis of tuberculosis." Eur J Clin Microbiol

Infect Dis 19(11): 859-67.

3. Araj, G. F., R. S. Talhouk, et al. (2000). "Comparative performance of PCR-based

assay versus microscopy and culture for the direct detection of Mycobacterium

tuberculosis in clinical respiratory specimens in Lebanon." Int J Tuberc Lung Dis

4(9): 877-81.

4. Brodie, D. and N. W. Schluger (2005). "The diagnosis of tuberculosis." Clin

Chest Med 26(2): 247-71, vi.

5. Cafrune, P. I., L. W. Riley, et al. (2006). "Recent transmission of tuberculosis

involving retired patients." J Infect.

6. Chin, D. P., D. M. Yajko, et al. (1995). "Clinical utility of a commercial test based

on the polymerase chain reaction for detecting Mycobacterium tuberculosis in

respiratory specimens." Am J Respir Crit Care Med 151(6): 1872-7.

7. Cohen, R. A., S. Muzaffar, et al. (1998). "Diagnosis of pulmonary tuberculosis

using PCR assays on sputum collected within 24 hours of hospital admission."

Am J Respir Crit Care Med 157(1): 156-61.

8. Dalovisio, J. R., S. Montenegro-James, et al. (1996). "Comparison of the

amplified Mycobacterium tuberculosis (MTB) direct test, Amplicor MTB PCR,

and IS6110-PCR for detection of MTB in respiratory specimens." Clin Infect Dis

23(5): 1099-106; discussion 1107-8.

9. Dilworth, J. P., M. Goyal, et al. (1996). "Comparison of polymerase chain

reaction for IS6110 and Amplicor in the diagnosis of tuberculosis." Thorax 51(3):

320-2.

10. Equipe de Controle Epidemiológico. Coordenadoria de Vigilância em Saude.

Secretaria Municipal de Saúde de Porto Alegre. (2005) "Análise comparativa do

ingresso de casos novos de Tuberculose ocorrido na rede ambulatorial e hospitalar

de Porto Alegre nos anos de 2003 e 2004." Boletim Epidemiológico 27(Ano

VIII).

11. Fegou, E., E. Jelastopulu, et al. (2005). "Sensitivity of the Cobas Amplicor system

for detection of Mycobacterium tuberculosis in respiratory and extrapulmonary

specimens." Clin Microbiol Infect 11(7): 593-6.

12. Flores, L. L., M. Pai, et al. (2005). "In-house nucleic acid amplification tests for

the detection of Mycobacterium tuberculosis in sputum specimens: meta-analysis

and meta-regression." BMC Microbiol 5: 55.

13. Goessens, W. H., P. de Man, et al. (2005). "Comparison of the COBAS

AMPLICOR MTB and BDProbeTec ET assays for detection of Mycobacterium

tuberculosis in respiratory specimens." J Clin Microbiol

43(6): 2563-6.

14. Ieven, M. and H. Goossens (1997). "Relevance of nucleic acid amplification

techniques for diagnosis of respiratory tract infections in the clinical laboratory."

Clin Microbiol Rev

10(2): 242-56.

15. Kambashi, B., G. Mbulo, et al. (2001). "Utility of nucleic acid amplification

techniques for the diagnosis of pulmonary tuberculosis in sub-Saharan Africa." Int

J Tuberc Lung Dis 5(4): 364-9.

16. Kent PT and Kubica G: Public Health Mycobacteriology – a guide for level III

laboratory. Centers for Disease Control and Prevention 1985

17. Kivihya-Ndugga, L., M. van Cleeff, et al. (2004). "Comparison of PCR with the

routine procedure for diagnosis of tuberculosis in a population with high

prevalences of tuberculosis and human immunodeficiency virus." J Clin

Microbiol 42(3): 1012-5.

18. Kwiatkowska, S., J. Marczak, et al. (1999). "Clinical utility of a commercial

ligase chain reaction kit for the diagnosis of smear-negative pulmonary

tuberculosis." Int J Tuberc Lung Dis 3(5): 421-5.

19. Noordhoek, G. T., A. H. Kolk, et al. (1994). "Sensitivity and specificity of PCR

for detection of Mycobacterium tuberculosis: a blind comparison study among

seven laboratories." J Clin Microbiol 32(2): 277-84.

20. Perkins, M. D. (2000). "New diagnostic tools for tuberculosis." Int J Tuberc Lung

Dis 4(12 Suppl 2): S182-8.

21. Piersimoni, C., C. Scarparo, et al. (2002). "Performance assessment of two

commercial amplification assays for direct detection of Mycobacterium

tuberculosis complex from respiratory and extrapulmonary specimens." J Clin

Microbiol 40(11): 4138-42.

22. Portillo-Gomez, L., S. L. Morris, et al. (2000). "Rapid and efficient detection of

extra-pulmonary Mycobacterium tuberculosis by PCR analysis." Int J Tuberc

Lung Dis 4(4): 361-70.

23. Ribeiro, F. K., V. Dettoni Vdo, et al. (2004). "Evaluation of a commercial test

based on ligase chain reaction for direct detection of Mycobacterium tuberculosis

in respiratory specimens." Rev Soc Bras Med Trop 37(6): 431-5.

24. Rossetti L R, J. S. B., Rodrigues V F S, Moura A R, Oliveira H, Zaha A (1997).

"Improvement of Mycobacterim tuberculosis detection in clinical samples using

DNA purified by glass matrix." J Microbiol Meth 28: 139-146.

25. Sarmiento, O. L., K. A. Weigle, et al. (2003). "Assessment by meta-analysis of

PCR for diagnosis of smear-negative pulmonary tuberculosis." J Clin Microbiol

41(7): 3233-40.

26. Schijman, A. G., M. H. Losso, et al. (2004). "Prospective evaluation of in-house

polymerase chain reaction for diagnosis of mycobacterial diseases in patients with

HIV infection and lung infiltrates." Int J Tuberc Lung Dis 8(1): 106-13.

27. Sharma, S. K., A. Mohan, et al. (2005). "Miliary tuberculosis: new insights into

an old disease." Lancet Infect Dis 5(7): 415-30.

28. Soini, H. and J. M. Musser (2001). "Molecular diagnosis of mycobacteria." Clin

Chem 47(5): 809-14.

29. Sperhacke, R. D., F. C. Mello, et al. (2004). "Detection of Mycobacterium

tuberculosis by a polymerase chain reaction colorimetric dot-blot assay." Int J

Tuberc Lung Dis 8(3): 312-7.

30. Su, W. J., A. P. Tsou, et al. (2000). "Clinical experience in using polymerase

chain reaction for rapid diagnosis of pulmonary tuberculosis." Zhonghua Yi Xue

Za Zhi (Taipei) 63(7): 521-6.

31. Suffys, P. N., M. E. Ivens de Araujo, et al. (2000). "Usefulness of IS6110-

restriction fragment length polymorphism typing of Brazilian strains of

Mycobacterium tuberculosis and comparison with an international fingerprint

database." Res Microbiol 151(5): 343-51.

32. Tansuphasiri, U., S. Suttirat, et al. (2002). "Comparison of microplate

hybridization with gel electrophoresis and dot blot hybridization for the rapid

detection of Mycobacterium tuberculosis PCR products." Southeast Asian J Trop

Med Public Health 33(1): 136-46.

33. Tarhan, G., M. B. Saygan, et al. (2005). "[Retrospective evaluation of Cobas

Amplicor system in the rapid diagnosis of Mycobacterium tuberculosis

complex]." Mikrobiyol Bul 39(1): 35-41.

34. TB, A. (2006). "API TB Consensus Guidelines 2006: Management of pulmonary

tuberculosis, extra-pulmonary tuberculosis and tuberculosis in special situations."

J Assoc Physicians India 54: 219-34.

35. van Cleeff, M., L. Kivihya-Ndugga, et al. (2005). "Cost-effectiveness of

polymerase chain reaction versus Ziehl-Neelsen smear microscopy for diagnosis

of tuberculosis in Kenya." Int J Tuberc Lung Dis 9(8): 877-83.

36. WHO (2005). "Global tuberculosis control: Surveillance, Planning, Financing."

WHO report WHO/HTM/TB/2005.349

Table 1: Patient symptoms and Medical History according to HIV status

HIV seronegative group

HIV seropositive group

Symptoms

and

Medical

History

Overall

suspects

N=203

(%)

Non

previously

treated TB

suspects

N=156

(%)

TB in the

past

N=47

(%)

Overall

suspects

N=74

(%)

Non

previously

treated

TB suspects

N=33

(%)

TB in

the past

N=27

(%)

Culture

positive

75 (36.9) 67 (42.9) 8 (17.0) 32 (43.2) 27 (81.8) 5 (18.5)

Weight loss

104 (51.2) 79 (50.6) 25(53.2) 56 (75.7) 36 (75.0) 20 (74.1)

Cough 190 (93.5) 148 (94.9) 25(53.2) 67 (90.9) 43 (89.6) 24 (88.9)

Chest pain 121 (59.6) 96 (61.5) 31 (66.0) 42 (56.7) 22 (66.7) 14 (51.9)

Dyspnea 123 (60.1) 92 (58.9) 50 (67.6) 50 (67.6) 33 (100.0) 17 (63.0)

Comparison between HIV

vs HIV

p=0.004

Table 2. Comparative performance of AFB Smear, Culture and two in house PCR dot-blot methods in PTB suspects

All Group

N=277

TB non-treated

Group

N=203

TB in the past

Group

N=74

Laboratory

Results and

Performance of

methods

N=128

Non-TB

N=149

N=109

Non-TB

N=94

N=19

Non-TB

N=55

Positive 77 1 68 0 9 1 Performance

of AFB

smear

Negative 51 148 41 94 10 54

SE SP PPV NPV SE SP PPV NPV SE SP PPV NPV

60% 99% 99 74 62% 100% 100 70 47% 98% 90 84

Positive 107 0 94 0 13 0 Performance

of Culture Negative 21 149 15 94 6 55

SE SP PPV NPV SE SP PPV NPV SE SP PPV NPV

84% 100% 100 88 86% 100%, 100 90 68% 100% 100 90

Positive 95 22 83 13 12 9 Performance

of PCR dot -

blot

Negative 33 127 26 81 7 46

SE SP PPV NPV SE SP PPV NPV SE SP PPV NPV

74% 85% 81 81 76% 87% 86 76 63% 84% 57 86

Positive 55 35 46 27 9 8 Performance

of PCR-AG Negative 73 114 63 67 10 47

SE SP PPV NPV SE SP PPV NPV SE SP PPV NPV

43% 76% 61 61 42% 71% 63 51 47% 85% 53 82

SE: Sensivity, SP: Specificity, PPV: Positive Predictive Value, NPV: Negative Predictive Value

All group

TB non-treated Group

TB in the past Group

Table 3. Comparative performance of AFB Smear, Culture and two in house PCR dot-

blot methods stratifying by HIV status

HIV seronegative

Group

N=203

HIV seropositive

Group

N=74

Laboratory

Results and

Performance of methods

N=88

Non-TB

N=115

N=40

Non-TB

N=34

Positive 60 1 17 0 Performance

of AFB

smear

Negative 28 114 23 34

SE SP PPV NPV SE SP PPV NPV

68% 99% 98 81 43% 100% 100 60

Positive 75 0 32 0 Performance

of Culture Negative 13 115 8 34

SE SP PPV NPV SE SP PPV NPV

85% 100% 100 90 80% 100% 100 81

Positive 66 17 29 5 Performance

of PCR dot -

blot

Negative 22 98 11 29

SE SP PPV NPV SE SP PPV NPV

75% 85% 79 82 72% 85% 85 72

Positive 38 27 17 8 Performance

of PCR-AG Negative 50 88 23 26

SE SP PPV NPV SE SP PPV NPV

43% 76% 58 64 42% 76% 68 53

SE: Sensivity, SP:Specificity, PPV: Positive Predictive Value, NPV: Negative Predictive Value

HIV seronegative Group

HIV seropositive Group

Figure 1. Plot in the ROC space of accuracy estimates to each method and areas

corresponds to 203 HIV seronegative and to 74 HIV seropositive (Blue: AFB Smear;

Green: Culture; Yellow: PCR-AG and Purple: PCR dot-blot)

0,0 0,2 0,4 0,6 0,8 1,0

1 - Specificity

0,0

0,2

0,4

0,6

0,8

1,0

Sensitivity

0,0 0,2 0,4 0,6 0,8 1,0

1 - Specificity

0,0

0,2

0,4

0,6

0,8

1,0

Sensitivity

HIV seronegative HIV seropositive

4.2 Artigo 2

Submetido na revista Journal of Clinical Laboratory Analysis, cujas

instruções para os autores se encontram no anexo 5 (item 9.5.2).

A figura 8 apresenta a confirmação da submissão deste artigo à revista

Journal of Clinical Laboratory Analysis.

Figura 8. Comprovação da submissão do artigo

Running Title: PCR: alternative to diagnosis of Tuberculosis

The usefulness of PCR colorimetric dot-blot assay for the rapid and convenient

diagnosis of pulmonary tuberculosis in HIV seropositive and HIV seronegative

individuals when used in parallel with Ziehl Neelsen smear examination.

Luciene C. Scherer

1,3*

; Rosa D. Sperhacke

; Maria L. R. Rossetti

2,3

, Antonio Ruffino-

Netto

and Afrânio L. Kritski

Affiliations:

Programa de Pós Graduação em Ciências Biológicas - Bioquímica,

Universidade Federal do Rio Grande do Sul -UFRGS, Porto Alegre/RS/ Brazil,

Centro

de Desenvolvimento de Ciência e Tecnologia- CDCT, Fundação Estadual de Produção e

Pesquisa em Saúde-FEPPS/RS Porto Alegre/RS/Brazil,

Universidade Luterana do

Brasil-ULBRA, Canoas/ RS/ Brazil,

Faculdade de Medicina de Ribeirão Preto,

Universidade de São Paulo

Unidade de Pesquisa em Tuberculose/Programa Acadêmico

de TB, Hospital Universitário Clementino Fraga Filho, UPT/ HUCFF, Universidade

Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, Brazil

*Correspondence to: Luciene Cardoso Scherer, Centro de Desenvolvimento Científico e

Tecnológico, Fundação Estadual de Produção e Pesquisa em Saúde, CDCT/FEPPS, Porto

Alegre/ RS/Brazil Av Ipiranga 5400, 3º andar, CEP 90610-000. Tel/fax: (+55) 51 3352

0336, Porto Alegre, Brazil. E-mail:luciene.scherer@hotmail.com

Key words: Mycobacterium tuberculosis, respiratory specimens, polymerase chain

reaction, IS6110, accuracy

Financial Support

This work was supported by CNPq, REDE-TB – Projeto Milenio I (Complemento-

CNPq) processo nº 480269/2003-3; ICIDR-NIH-grant number 1 U19 AI45432

Kritski

ABSTRACT

There is scarce data regarding the usefulness of molecular tests used in parallel to classic

tools for Tuberculosis (TB) diagnosis under field conditions, especially in regions with

high burden of co-infection TB/HIV. We evaluated the usefulness of PCR dot-blot used

in parallel to Ziehl-Neelsen staining (ZN) for pulmonary Tuberculosis (PTB) diagnosis,

in a TB/HIV reference hospital. Sputum from 277 patients was tested by ZN, Culture and

PCR. Performances were assessed individually, in parallel, by HIV status, history of anti-

TB treatment, and in different simulated TB prevalence rates.

In overall PTB prevalence was 46% (128/277); in HIV seropositive (HIV

): 54% (40/74);

ZN had sensitivity (SE) lower in HIV

than in HIV

(43%vs68%;p<0.05); SE of PCR was

not influenced by HIVstatus (p=0.46).

ZN in parallel with PCR showed the following results: a) among all PTB suspects: SE

(90%), Specificity (84%), Likelihood (LR)

(5.65), and LR

(0.12); b) in HIV seronegative

subjetcts: SE (92%), LR

(0.10); c) in non previously treated cases: SE (90%), LR

(0.11);d) in TB prevalence rates(5-20%): negative PV(98-99).

ZN used in parallel with PCR showed an improvement in SE, LR

and negative PV. This

strategy may offer a novel approach in ruling out PTB cases, especially in HIV

, not-

previously treated, attended in hospitals in developing nations.

Kritski

INTRODUCTION

Tuberculosis (TB) is one of the most important health problems in the world, with 1.8

million deaths reported each year (1). Direct smear examination with Ziehl-Neelsen (ZN)

staining for the diagnosis of pulmonary tuberculosis (PTB), as employed in most low-

income countries, is cheap and easy to use, but its low sensitivity is a major drawback

(2). In Brazil, ZN is the recommended method both for TB diagnosis and treatment

control, and sputum culture in solid medium is only indicated in PTB suspect cases, such

as: a) ZN-negative results; b) paucibacilary and extrapulmonary specimens; c) therapeutic

failure with suspicion of drug resistance, and d) individuals infected by HIV (3). Rapid

TB diagnosis became crucial, especially in clinical specimens from subjects with atypical

presentation, where direct microscopy presents low sensitivity, and culture can delay

diagnosis by 3 to 6 weeks (1).

Important advances in molecular techniques, which rapidly identify mycobacterial DNA

in sputa, may overcome these obstacles (2). In developing countries, in house polymerase

chain reaction (PCR) for the amplification of Mycobacterium tuberculosis (MTB) DNA,

using the IS6110 insertion as PCR target, could be a rapid diagnostic test for tuberculosis.

However, PCR methods in respiratory specimens present some caveats: a) reaction

inhibitors; b) lower sensitivity in paucibacillary specimens; and c) high costs.

In most studies assessing the performance of molecular tests, PCR results are evaluated

separately, in contrast to clinical practice, where diagnosis tests are usually required in

association with other tests and/or clinical criteria, and, commonly culture is used as

Kritski

the gold standard, and clinical criteria only to evaluate discrepant results (4).

More recently, the evaluation of the usefulness of PCR in parallel with the classic

diagnostic techniques for rapid diagnosis of TB has been considered a novel approach (5-

7).

In the present study, in order to compare the performance of the use of a molecular test

(PCR colorimetric dot-blot assay) or culture in parallel with ZN for diagnosis of PTB, a

prospective study was conducted in a TB/HIV reference hospital. This hospital is located

in Porto Alegre City in the South of Brazil, where in 2004, 1432 TB cases were reported,

420 of them diagnosed in hospitals, being 51% in HIV-infected patients (8).

MATERIALS AND METHODS

In a reference center for TB and HIV, consecutive patients with suspicion of PTB

attended at the Partenon Reference Hospital, Porto Alegre, Brazil were recruited. Sputum

specimens were sent to the Public Reference Laboratory of State of Rio Grande do Sul

for analysis. All clinical specimens were processed using the acetyl-cysteine method. ZN

and culture (Lowenstein Jensen solid medium) were performed following routine

procedures. Positive cultures were submitted to standard identification procedures for

differentiation of the MTB complex from atypical mycobacteria(9). PCR colorimetric

dot-blot assay was performed as previously published(10). Briefly, PCR products using

the IS6110 insertion element as a target for PCR, were plotted into a nylon membrane,

and hybridization was performed with a specific biotinylated probe, followed by

Kritski

detection with conjugated streptavidin-alkaline phosphatase. Visualization of positive

reaction was obtained by adding BCIP (5-bromo-4-chloro-3-indoyl phosphate) and NBT

(nitro blue tetrazolium). Positive and negative controls were included for each PCR set.

In order to detect specimen inhibitors in negative results, a tube of PCR mix for each

specimen was spiked with the purified DNA target (10).

The gold standard was the combination of positive culture with clinical definition of

pulmonary TB (10). Clinical and final diagnosis of confirmed PTB cases were defined as

those with a positive culture for MTB in the respiratory specimen; presumptive PTB, as

clinical improvement after six months of anti-TB treatment, as judged by three different

chest physicians not involved in this study in a blinded manner (11). Non-PTB was

considered when patients were negative in acid-fast smear and MTB culture, and did not

present clinical and chest radiographic changes after six months of follow-up.

Chest physicians that participate in the study were blinded as to PCR results. Patients

were submitted to a standardized and validated interview, with questions including

demographic variables and clinical history (e.g.: alcohol abuse, hepatitis) previously

described by our group (12).

Test performances were calculated using specific formulas as a function of sensitivity

(SE), specificity (SP)

parallel SE of ZN and PCR: SE

+ SE

PCR

– (SE

x SE

PCR

);

predictive values (PV) for different prevalence rates and likelihood ratio (LR), according

to literature (13).

Kritski

ETHICS

Written informed consent was obtained from all patients, and HIV was tested by ELISA,

using Western blot as a confirmatory test. This study was approved by the Institutional

Review Boards of FEEPS (n. 01/2002). LCS, RDS, MLR, ARN, ALK have no conflict of

interest.

RESULTS

From May 2003 to May 2004, 277 patients with suspicions of pulmonary TB suspects

were recruited at Partenon Reference Hospital, a reference center for TB and HIV, in

Porto Alegre.

No atypical mycobacteria was isolated from clinical samples during the

study period. Overall TB prevalence was 46% (128/277), 54% (40/74) among HIV

seropositive persons; 54% (109/203) in individuals not previously treated for TB, and

26% (19/74) in cases with history of anti-TB treatment.

Chest X-Ray images suggestive of classical TB (any parenchymal infiltrate or cavity

located in the upper zone, defined as the area above the posterior third rib) were more

frequently observed in HIV seronegative patients than in seropositive (67% vs. 32%,

p<0.05).

Overall, PCR dot-blot had a higher SE than ZN method (74% vs. 60%, p<0.05) but

lower than culture (74% vs. 84%, p=0.06) (Table IA). Culture and PCR colorimetric dot-

blot assay presented a positive LR of 84.0, 4.93 and negative LR of 0.16,

Kritski

0.31 respectively. ZN in parallel with PCR colorimetric dot-blot assay showed a SE of

90%, SP of 84%, positive LR of 5.65, and negative LR of 0.12. ZN in parallel with

culture had a SE of 94%, SP of 99%, a positive LR of 93.6, and a negative LR of 0.06

(Table 1B).

Among PTB suspects non previously treated for TB, ZN in parallel with PCR

colorimetric dot-blot assay had a SE of 90%, SP of 86%, positive LR of 6.52, and a

negative LR of 0.11. And, ZN in parallel with culture approach had a SE of 94%, SP of

99%, a positive LR of 94.4 and negative LR of 0.06.

Among PTB suspects with history of anti-TB treatment, ZN in parallel with PCR

colorimetric dot-blot assay had a SE of 85% and SP of 83%, positive LR of 5.06, and a

negative LR of 0.18. And, ZN in parallel with culture had a SE of 87%, SP of 99%, a

positive LR of 87.2 and negative LR of 0.13.

ZN sensitivity was significantly lower among HIV seropositive subjects as compared to

those HIV seronegative ones (43% vs. 68%; p<0.05) (Tables 2 and 3). PCR sensitivity

was not influenced by HIV status (p= 0.46).

Among HIV seropositive subjects, PCR dot-blot had higher SE than that of ZN (72% vs.

43%; p<0.05) and similar to the SE of culture (72% vs. 80%, p=0.54) (Table 2A). Culture

and PCR colorimetric dot-blot assay showed the following values regarding the LR

results, respectively: positive LR of 80.0 and 4.80, and negative LR of 0.20 and 0.33. ZN

in parallel with culture had a SE of 89%, SP of 100%, a positive LR of 88.6 and negative

Kritski

LR of 0.12. ZN in parallel with PCR colorimetric dot-blot assay had a SE of 84% and SP

of 85%, a positive LR of 5.60, and negative LR of 0.19. Comparing the SE and negative

LR among those individuals not previously treated and those treated for TB in the past

the figures were respectively: 84% and 0.18, and 86% and 0.17 (Table 2B).

Among HIV seronegative subjects, PCR dot-blot sensitivity was similar to that observed

with ZN (75% vs. 68%; p=0.36), and culture (75% vs. 85%, p=0.10) (Table 3A). Culture

and PCR colorimetric dot-blot assay showed positive LR respectively of 85.0 and 5.0 and

negative LR of 0.15 and 0.29. ZN in parallel with culture had a SE of 95%, SP of 99%, a

positive LR of 47.8 and negative LR of 0.05. ZN in parallel with PCR colorimetric dot-

blot assay had a SE of 92%, SP of 84%, positive LR of 5.80, and negative LR of 0.10.

Comparing the SE and negative LR of ZN in parallel with PCR among those individuals

not previously treated for TB and those that used anti-TB in the past, the figures were

respectively: 93% and 0.08, and 85% and 0.18 (Table 3B).

In the present study with a TB prevalence of 46%, the negative and positive PV of PCR

dot blot observed were 81% and 79%, respectively. The use of ZN in parallel with PCR

dot blot among HIV seronegative individuals showed a negative and positive PV of 93%

and 83%, respectively. This strategy among HIV seropositive individuals had different

results, with negative and positive PV of 82% and 87%, respectively. Among HIV

seropositive individuals not previously treated, the negative and positive PV of ZN with

PCR was respectively 88% and 82%.

Kritski

Assuming different TB prevalence scenarios, the use of ZN in parallel with PCR

colorimetric dot-blot showed similar positive and negative PVs than that observed with

ZN in parallel with culture, among HIV seropositive and HIV seronegative patients

(Table 4). ZN associated with culture presented the best performance under all scenarios.

ZN associated with PCR dot blot showed different performance. For TB prevalence of

5%-10%, usually observed in out-patient units attending individuals with cough for more

than three weeks (respiratory symptomatic according to WHO), negative PV for ZN

technique associated with PCR dot-blot ranged from 99-100%. In Health Units, where

the TB prevalence ranges from 15% to 20%, usually General Hospitals or Ambulatory

Reference Centers (TB Clinics), negative PV of this diagnostic strategy was 98-99%. In

Reference TB Hospitals where the TB prevalence ranges from 30% to 50%, among HIV

seronegative individuals, negative PV of ZN in parallel with PCR dot blot was 96 to 94%

but among HIV seropositive ones, this value was reduced to 93 and 89% (Table 4).

DISCUSSION

The observed overall PTB prevalence of 46% and among HIV seropositive subjects of

54% confirmed the high prevalence of TB/HIV co-infection in Hospital Units in Brazil as

reported by the Porto Alegre City TB Control Program and highlight the necessity to

evaluate innovative approaches on TB diagnostic in these settings, where atypical chest

X-Ray images and low sensitivity of ZN were more frequently observed in HIV

seropositive patients, similar to that described by others (6).

Kritski

Considering anti-TB treatment status, there was a tendency to have a higher sensitivity of

in all tested methods in the non-treated group as compared with previous TB, and a

specificity was similar to that previously reported by other authors (5).

Considering HIV status, ZN sensitivity was significantly lower in HIV seropositive

subjects than in HIV seronegative ones, and PCR sensitivity was not influenced by HIV

status, as reported by others (2).

The ZN used in parallel with PCR colorimetric dot-blot assay strategy showed

specificities ranging from 83% to 86%, as previously described (84% to 87%) in

developing countries using solely automated nucleic acid amplification tests, and lower

than those described (>95%) in industrialized countries (2, 5, 14). When different

prevalence rates were simulated, high negative PV was observed with TB prevalence of

5-20%, characteristic of outpatient Units and General Hospital settings. However, these

figures decreased in scenarios with TB prevalence higher than 30%, especially among

HIV seropositive subjects. These data confirm that the strategy of using ZN in parallel

with PCR dot-blot can be used for excluding tuberculosis in outpatient units and hospital

settings, particularly in HIV seronegative subjects.

The lower sensitivity of ZN used in parallel with PCR colorimetric dot-blot assay (85%)

may be due to several factors. One of them is the presence of inhibitors that remained in

the specimen after the extraction procedure, but in this study, the proportion of inhibitors

was (1.9%) as similar to those detected in NAA tests (0.85% to 22.7%) (14, 15). Other

Kritski

factors could be a small number of unequally distributed mycobacteria in the test

suspension once it was splitted into three aliquots for the laboratory tests used in this

study, or even levels below the detection limit for in house PCR (50 CFU) (10). In fact,

among the false negative results, 33.3% (11/33) specimens were below the amplification

test detection limit used for the colorimetric dot-blot assay. Additionally, the low copy

number of IS6110 (insertion element) in MTB is reported to decrease sensitivity, but this

was not previously reported in Brazil (10).

The strategy of associating results of ZN and culture showed the best performance in

subjects infected or not by HIV; however, culture can delay diagnosis by 3 to 6 weeks,

making the rapid diagnostic of TB difficult. Therefore, the use of ZN in parallel with

PCR colorimetric dot-blot assay may provide an alternative for the rapid diagnosis of TB,

particularly among HIV seropositive individuals or those with atypical presentation

and/or with co-morbidities, where diagnosis it is critical for the prompt initiation of anti-

TB treatment and delay may be lethal (16). Additionally, this strategy could reduce the

risk of dissemination to other hospitalized patients and health care personnel.

In our study, the combination of ZN and PCR colorimetric dot-blot assay showed a great

improvement in sensitivity and negative likelihood ratio. Thus, the use of ZN and PCR

may offer a novel approach in ruling out pulmonary TB cases, especially among HIV

seronegative subjects, not previously treated for TB, attended in hospitals in developing

nations. In house PCR is usually less expensive than automated nucleic acid

amplification tests, and should be introduced more widely in developing nations after an

Kritski

evaluation of its cost-effectiveness and refined estimates of the likelihood of TB disease

in different settings.

ACKNOWLEDGMENTS

FEPPS/RS, CEARGS (Center of studies in AIDS/RS); Partenon Hospital; Brazilian

REDE-TB.

Kritski

REFERENCES

1. WHO: Global tuberculosis control - surveillance, planning, financing

WHO Report 2006 2006:362.

2. Kivihya-Ndugga L, van Cleeff M, Juma E, Kimwomi J, Githui W, Oskam

L, Schuitema A, van Soolingen D, Nganga L, Kibuga D et al: Comparison of

PCR with the routine procedure for diagnosis of tuberculosis in a population

with high prevalences of tuberculosis and human immunodeficiency virus. J

Clin Microbiol 2004, 42(3):1012-1015.

3. Tuberculose II Consenso Brasileiro -Diretrizes Brasileiras para

Tuberculose 2004. Jornal Brasileiro de Pneumologia 30:1).

4. Flores LL, Pai M, Colford JM, Jr., Riley LW: In-house nucleic acid

amplification tests for the detection of Mycobacterium tuberculosis in

sputum specimens: meta-analysis and meta-regression. BMC Microbiol 2005,

5:55.

5. Sarmiento OL, Weigle KA, Alexander J, Weber DJ, Miller WC:

Assessment by meta-analysis of PCR for diagnosis of smear-negative

pulmonary tuberculosis. J Clin Microbiol 2003, 41(7):3233-3240.

6. Schijman AG, Losso MH, Montoto M, Saez CB, Smayevsky J, Benetucci

JA: Prospective evaluation of in-house polymerase chain reaction for

diagnosis of mycobacterial diseases in patients with HIV infection and lung

infiltrates. Int J Tuberc Lung Dis 2004, 8(1):106-113.

7. Ieven M, Goossens H: Relevance of nucleic acid amplification

techniques for diagnosis of respiratory tract infections in the clinical

laboratory. Clin Microbiol Rev 1997, 10(2):242-256.

8. Equipe de Controle Epidemiológico/Coordenadoria de Vigilância em

Saúde/Secretaria Municipal de Porto Alegre 2005. Análise comparativa do

ingresso de casos novos de Tuberculose ocorrido na rede ambulatorial e

hospitalar de Porto Alegre nos anos de 2003 e 2004. Boletim Epidemiológico

2005, 27(Ano VIII).

9. Kent PT, Kubica G: Public Health Mycobacteriology – a guide for level

III laboratory. Atlanta, GA: Centers for Disease Control and Prevention,1985.

10. Sperhacke RD, Mello FC, Zaha A, Kritski A, Rossetti ML: Detection of

Mycobacterium tuberculosis by a polymerase chain reaction colorimetric

dot-blot assay. Int J Tuberc Lung Dis 2004, 8(3):312-317.

11. ATS: Diagnostic Standards and Classification of Tuberculosis in

Adults and Children. This official statement of the American Thoracic

Society and the Centers for Disease Control and Prevention was adopted by

the ATS Board of Directors, July 1999. This statement was endorsed by the

Council of the Infectious Disease Society of America, September 1999. Am J

Respir Crit Care Med 2000, 161(4 Pt 1):1376-1395.

12. Mello FC, Bastos LG, Soares SL, Rezende VM, Conde MB, Chaisson RE,

Kritski AL, Ruffino-Netto A, Werneck GL: Predicting smear negative

pulmonary tuberculosis with classification trees and logistic regression: a

cross-sectional study. BMC Public Health 2006, 6:43.

13. Medronho RA, Carvalho DM, Bloch KV, Luiz RR, Werneck GL 2002:

Epidemiologia. Editora Atheneu, São Paulo, 2002.

14. Goessens WH, de Man P, Koeleman JG, Luijendijk A, te Witt R, Endtz

HP, van Belkum A: Comparison of the COBAS AMPLICOR MTB and

BDProbeTec ET assays for detection of Mycobacterium tuberculosis in

respiratory specimens. J Clin Microbiol 2005, 43(6):2563-2566.

15. Almeda J, Garcia A, Gonzalez J, Quinto L, Ventura PJ, Vidal R, Rufi G,

Martinez JA, Jimenez de Anta MT, Trilla A et al: Clinical evaluation of an in-

house IS6110 polymerase chain reaction for diagnosis of tuberculosis. Eur J

Clin Microbiol Infect Dis 2000, 19(11):859-867.

16. Carvalho AC, Nunes ZB, Martins M, Araujo RO, Comelli M, Marinoni A,

Kritski AL: Clinical presentation and survival of smear-positive pulmonary

tuberculosis patients of a university general hospital in a developing country.

Mem Inst Oswaldo Cruz 2002, 97(8):1225-1230.

Kritski

Table 1. Performance of ZN, Culture, and PCR dot-blot tests according to the history of

anti-TB treatment.

Table 1A. Laboratory Results and Performance of methods

All

Groups

N=277

non-treated TB

Group

N=203

TB in the past

Group

N=74

N=128

Non-

N=149

N=109

Non-

N=94

N=19

Non-

N=55

Positive

77 1 68 0 9 1

Negative

51 148 41 94 10 54

SE SP SE SP SE SP

60% 99% 62% 100% 47% 98%

Positive

107 0 94 0 13 0

Culture

Negative

21 149 15 94 6 55

SE SP SE SP SE SP

84% 100% 86% 100% 68% 100%

Positive

95 22 83 13 12 9

PCR

dot –blot Negative

33 127 26 81 7 46

SE SP SE SP SE SP

74% 85% 76% 87% 63% 84%

Table 1B. Performance of methods used in paralell

SE SP SE SP SE SP ZN in parallel with

Culture

94% 99% 94% 99% 87% 99%

SE SP SE SP SE SP ZN in parallel with

PCR dot –blot

90% 84% 90% 86% 85% 83%

SE: Sensitivity, SP: Specificity

a: All groups b: non-treated TB Group c: TB in the past Group

Kritski

Table 2. Performance of ZN, Culture, and PCR dot-blot tests according to the history of

anti-TB treatment, among HIV seropositive individuals.

Table 2A. Laboratory Results and Performance of methods

All

Groups

N=74

non-treated

Group

N=47

TB in the

past

Group

N=27

N=40

Non-

N=34

N=32

Non-

N=15

N=8

Non-

N=19

Positive

17 0 14 0 3 0

Negative

23 34 18 15 5 19

SE SP SE SP SE SP

43% 100% 43% 100% 37% 100%

Positive

32 0 27 0 5 0

Culture

Negative

8 34 5 15 3 19

SE SP SE SP SE SP

80% 100% 84% 100% 62% 100%

Positive

29 5 23 2 6 3

PCR

dot -blot Negative

11 29 9 13 2 16

SE SP SE SP SE SP

72% 85% 72% 87% 75% 84%

Table 2B. Performance of methods used in parallel

SE SP SE SP SE SP ZN in parallel with

Culture

89% 100% 91% 100% 78% 100%

SE SP SE SP SE SP ZN in parallel with

PCR dot -blot

84% 85% 84% 87% 86% 84%

SE: Sensitivity, SP: Specificity

a: All groups

b: non-treated TB Group

Kritski

Table 3. Performance of ZN, Culture, and PCR dot-blot tests according to the history of

anti-TB treatment, in HIV seronegative individuals.

Table 3A. Laboratory Results and Performance of methods

All

Groups

N=203

non-treated

Group

N=156

TB in the past

Group

N=47

N=88

Non-

N=115

N=77

Non-

N=79

N=11

Non-

N=36

Positive

60 1 54 0 6 1

Negative

28 114 23 79 5 35

SE SP SE SP SE SP

68% 99% 70% 100% 54% 97%

Positive

75 0 67 0 8 0

Culture

Negative

13 115 10 79 3 36

SE SP SE SP SE SP

85% 100% 87% 100% 73% 100%

Positive

66 17 60 11 6 6

PCR

dot –blot Negative

22 98 17 68 5 30

SE SP SE SP SE SP

75% 85% 78% 86% 54% 83%

Table 3B. Performance of methods used in parallel

SE SP SE SP SE SP ZN in parallel with

Culture

95% 99% 96% 99% 91% 99%

SE SP SE SP SE SP ZN in parallel with

PCR dot -blot

92% 84% 93% 85% 85% 82%

c: TB in the past Group

SE: Sensitivity, SP: Specificity

a: All groups

b: non-treated TB Group

c: TB in the past Group

Kritski

Table 4. Simulation of positive and negative predictive values of ZN and Culture/ PCR

dot-blot tests according to different TB prevalence rates.

Subjects with

HIV

N=74

Subjects without

HIV

N=203

Simulated Prevalence

Rates

N=40

N=34

N=88

N=115

PPV NPV PPV NPV

ZN /

Cuture

100 99 83 100

ZN / PCR

dot -blot

23 99 23 100

PPV NPV PPV NPV

ZN /

Cuture

100 99 91 99

10%

ZN / PCR

dot -blot

38 98 39 99

PPV NPV PPV NPV

ZN /

Cuture

100 97 96 99

20%

ZN / PCR

dot -blot

58 98 59 98

PPV NPV PPV NPV

ZN /

Cuture

100 95 98 98

30%

ZN / PCR

dot -blot

71 93 71 96

PPV NPV PPV NPV

ZN /

Cuture

100 93 98 97

40%

ZN / PCR

dot -blot

79 89 79 94

PPV NPV PPV NPV

46%

ZN /

Cuture

99 88 98 96

ZN / PCR

dot -blot

87 82 83 93

________________________

PPV: Positive Predictive Value NPV: Negative Predictive Value

a: Subjects with HIV

b: Subjects without HIV

c: The present study

4.3 Artigo 3

Aceito na revista BMC Public Health e se encontra em fase final de

editação. A figura 9 apresenta o resumo do artigo 3 na PUBMED.

Figura 9. Comprovação do resumo na PUBMED

PCR colorimetric dot-blot assay and clinical pretest

probability for diagnosis of Pulmonary Tuberculosis in Smear-

Negative patients

Luciene Cardoso Scherer

1,3§*

, Rosa Dea Sperhacke

, Carla Jarczewski

, Patrícia I.

Cafrune

, Simone Minghelli

, Marta Osório Ribeiro

, Fernanda C. Q. Mello

, Antonio

Ruffino-Netto

, Maria L. R. Rossetti

2,3

and Afrânio L. Kritski

Programa de pós Graduação em Ciências Biológicas- Bioquímica, Universidade Federal

do Rio Grande do Sul -UFRGS, Porto Alegre/RS/ Brazil

Centro de Desenvolvimento de Ciência e Tecnologia- CDCT, Fundação Estadual de

Produção e Pesquisa em Saúde-FEPPS/RS, Porto Alegre/RS/Brazil

Universidade Luterana do Brasil-ULBRA, Canoas/ RS/ Brazil

Unidade de Pesquisa em Tuberculose, Hospital Universitário Clementino Fraga Filho,

UPT/ HUCFF, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro,RJ, Brazil

Hospital Sanatório Partenon /Secretaria da Saúde do Rio Grande do Sul/Porto Alegre/

RS/ Brazil

State Reference Laboratory (Laboratório Central do Rio Grande do Sul- Lacen/RS),

Fundação Estadual de Produção e Pesquisa em Saúde-FEPPS/RS) Porto

Alegre/RS/Brazil

Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, SP, Brazil

*These authors contributed equally to this work

Corresponding author

Email addresses:

LCS: luciene.scherer@hotmail.com

RDS: deasperhacke@hotmail.com

CJ: jarczews@terra.com.br

PIC: patricia_cafrune@hotmail.com

SM: sminghelli@terra.com.br

MOR: martaoso@terra.com.br

FCQM: fcqmello@hucff.ufrj.br

ARN: aruffino@fmrp.usp.br

MLRR: mrossett@terra.com.br

ALK: kritskia@gmail.com

Abstract

Background

Smear-negative pulmonary tuberculosis (SNPTB) accounts for 30% of Pulmonary

Tuberculosis (PTB) cases reported annually in developing nations. Polymerase chain

reaction (PCR) may provide an alternative for the rapid detection of Mycobacterium

tuberculosis (MTB); however little data are available regarding the clinical utility of PCR

in SNPTB, in a setting with a high burden of TB/HIV co-infection.

Methods

To evaluate the performance of the PCR dot-blot in parallel with pretest

probability (Clinical Suspicion) in patients suspected of having SNPTB, a prospective

study of 213 individuals with clinical and radiological suspicion of SNPTB was carried

out from May 2003 to May 2004, in a TB/HIV reference hospital. Respiratory specialists

estimated the pretest probability of active disease into high, intermediate, low categories.

Expectorated sputum was examined by direct microscopy (Ziehl-Neelsen staining),

culture (Lowenstein Jensen) and PCR dot-blot. Gold standard was based on culture

positivity combined with the clinical definition of PTB.

Results

In smear-negative and HIV subjects, active PTB was diagnosed in 28.4%

(43/151) and 42.2% (19/45), respectively. In the high, intermediate and low pretest

probability categories active PTB was diagnosed in 67.4% (31/46), 24% (6/25), 7.5%

(6/80), respectively. PCR had sensitivity of 65% (CI 95%: 50%-78%) and specificity of

83% (CI 95%: 75%-89%). There was no difference in the sensitivity of PCR in relation to

HIV status. PCR sensitivity and specificity among non-previously TB treated and those

treated in the past were, respectively: 69%, 43%, 85% and 80%. The high pretest

probability, when used as a diagnostic test, had sensitivity of 72% (CI 95%:57%-84%)

and specificity of 86% (CI 95%:78%-92%). Using the PCR dot-blot in parallel with high

pretest probability as a diagnostic test, sensitivity, specificity, positive and negative

predictive values were: 90%, 71%, 75%, and 88%, respectively. Among non-previously

TB treated and HIV subjects, this approach had sensitivity, specificity, positive and

negative predictive values of 91%, 79%, 81%, 90%, and 90%, 65%, 72%, 88%,

respectively.

Conclusion

PCR dot-blot associated with a high clinical suspicion may provide an important

contribution to the diagnosis of SNPTB mainly in patients that have not been previously

treated attended at a TB/HIV reference hospital.

Background

Tuberculosis (TB) is one of the most widespread mortality-causing infectious

diseases in humans. Timely detection of the disease allows the institution of an effective

and life-saving treatment, thereby reducing transmission to close contacts. Conventional

diagnosis of Pulmonary Tuberculosis (PTB) is time-consuming, and the acid fast bacilli

(AFB) smear has a low sensitivity (40%-60%) [1]. HIV infection has been associated

with an increased incidence of smear negative pulmonary tuberculosis (SNPTB) and a

higher mortality rate in TB patients. [2-4]. In Brazil, almost 30% of PTB cases among

adults are SNPTB [2-4]. Diagnosis of SNPTB is a difficult task and, in developing

countries, the majority of these cases have been treated only on the basis of clinical and

chest radiographic findings. Without a standardized clinical work up, the misdiagnosis

rates have been estimated to be as high as 35% [5]. Therefore, in settings with a high rate

of TB and HIV, the clinical evaluation of new tools for smear negative PTB diagnoses is

extremely valuable [1, 6]

In industrialized countries, tests for Mycobacterium tuberculosis (MTB), using

rapid nucleic acid amplification (NAA), have been considered a major breakthrough in

the diagnosis of PTB [7]. In developing countries, the in house polymerase chain reaction

(PCR) for amplification of MTB DNA, using the IS6110 insertion element as a target,

offers a potentially sensitive, specific and low-cost test that could provide a rapid

diagnosis of PTB [8-11].

In these settings, the published evaluations of NAA techniques for smear negative

PTB diagnosis have been based mainly on laboratory criteria for diagnosis of disease

with or without clinical records used to evaluate discrepant results [11-17].

In the present study, we investigated the performance of a home-made

colorimetric PCR (PCR dot-blot) to diagnose TB using expectorated sputum from

patients suspected of having SNPTB, in isolation and in parallel with pretest probability

(based on Clinical Suspicion) in a hospital setting with a high burden of TB and HIV.

The PCR technique performance was compared with conventional routine diagnostic

methods for smear negative patients.

Methods

Setting and patient selection

Consecutive adults suspected of having SNPTB, referred to the TB and HIV

Reference Center, Parthenon Reference Hospital (PRH) in Porto Alegre City, capital of

Rio Grande do Sul, State of Brazil, were studied prospectively, from May 2003 to May

2004. SNPTB suspects were referred from community health care units to have their

respiratory specimens cultured for mycobacteria, according to Brazilian National

Guidelines [18].

Eligible patients were those: (1) who reported more than 3 weeks of cough; (2)

who had two consecutive samples of spontaneous sputum that were acid fast bacilli

smear-negative. Patients illegible were those receiving anti-TB treatment. Patients with a

history of previous TB were not excluded. Patients were excluded from the study if any

of the following conditions were met: (1) culture was contaminated; (2) when

expectorated sputum was not obtained (3) laboratory or clinical data did not fulfill the

SNPTB definition; (4) written informed consent was not obtained from the study

participant. All clinical samples were sent to the Laboratory of the State of RS, State

Foundation for Research in Health, Porto Alegre/RS/Brazil, (FEEPS/Lacen/RS) for

laboratory analysis. This study was approved by the Institutional Review Boards of

FEPPS/RS (n. 01/2002).

Suspects of SNPTB, after signing their written informed consent, underwent a

validated questionnaire with questions regarding demographic variables and clinical

history (e.g.: smoking, alcohol abuse, HIV infection/AIDS)[19]. Chest radiographs and

physical examination was performed by a respiratory specialist using a standardized

form. Respiratory specialists were blinded for the results of cultures and PCR dot-blot,

and laboratory technicians were blinded for the chest radiographs results and clinical

predictors. HIV testing by ELISA was performed, using Western blot as a confirmatory

test.

Estimate of pretest probability

To estimate pretest probability (clinical suspicion), all eligible individuals were

classified into three relative risk categories during the first appointment: low (≤25%);

intermediate (26%-75%); and high (>75%) pretest probabilities of active PTB.

Classifications were made by four respiratory specialists (2 with 10 years of experience

and 2 with 20 years of experience in diagnosing TB). This was an estimate of disease

probability based on clinical history, physical examination, other laboratory data

available besides microbiological tests, and chest radiographs evaluation performed using

a validated form [19].

Radiographic analysis

Chest radiographs were classified as typical, compatible, atypical and normal.

Typical were those considered as having any parenchymal infiltrate or cavity localized in

the upper zone (defined as the area above the posterior third rib); compatible were those

presenting a miliary pattern, pleural effusion or thoracic adenopathy, and atypical those

showing any other abnormality [19].

Case definition

PTB cases were defined as those with a positive culture for MTB in the

respiratory specimen or those with clinical and radiological improvement after six

months of solely anti-TB treatment, as judged by three different chest physicians in a

blinded review, not involved in this study [20]. Non-PTB was considered in patients

whose acid-fast smear and culture for MTB were negative and who had no chest

radiographic changes after six months of follow-up. PCR results were not available for

routine care or for the panel of experts.

Gold standard criteria for SNPTB final diagnosis included all PTB cases,

confirmed or not by culture.

Routine laboratory process

All sputum specimens were processed at the Public Reference Laboratory. All

sputum specimens were tested by the Ziehl- Neelsen method, cultured in Lowentein

Jensen and identified according to Kubica's method [21].

The presence of the amplified fragment derived from IS6110 insertion element

sequence in PCRs positives was checked by electrophoresis with 2% agarose gel, stained

with ethidium bromide, and visualized under ultraviolet light [16]. The positive and

negative controls were included in electrophoresis analysis.

The PCR colorimetric dot-blot assay was performed as previously published [16].

Briefly, the biotinylated PCR products were transferred to a nylon membrane and

hybridization was performed with a specific probe. The detection of hybridization was

performed using a conjugated streptavidin-alkaline phosphatase probe. The positive

reaction was obtained by adding BCIP and NBT (5-bromo-4-chloro-3-indoyl phosphate

and nitro blue tetrazolium). The positive and negative controls were included for each set

of PCR. To detect specimen inhibitors in negative results, a tube of PCR mix for each

specimen was spiked with purified DNA target. All PCRs tests with discrepancies in

results were tested in duplicate.

Data analysis

Epidemiological and laboratory data were entered into a computer database and

analyzed by appropriate statistical software (SPSS version 10.0). The endpoints were

sensitivity (SE), specificity (SP), positive predictive and negative predictive values (PPV,

NPV) for detection in smear-negative subjects. For MTB DNA detection, the analyses of

PCR SE, SP, PPV, NPV were performed on a per-study-subject basis, using the diagnosis

of PTB as a reference standard (defined above). Agreement between the PCRs duplicates

was evaluated using the Kappa score, a measurement of agreement that considers the

excess of the amount of agreement that could be expected by chance.

For secondary analysis, using the high pretest probability (HPP) as a diagnostic

test, suspects of SNPTB with high pretest probabilities were considered as positive for

active PTB, and those with intermediate and low pretest probabilities were considered

negative.

Additionally, test performances of HPP in parallel with PCR as a diagnostic test

were calculated using specific formulas: SE of HPP with PCR: SE

HPP +

PCR –

(SE

HPP X

PCR

), predictive values (PV) for different prevalence rates according to the

literature[22].

Results

Of the total of 277 SNPTB suspects enrolled, 64 (23.1%) were not included in the

analysis for the following reasons: 63 (22.6%) had an incomplete set of clinical data (14

patients had no chest X-ray available; 48 did not fulfill the SNPTB definition, one

refused to participate, and the culture of one was contaminated. Of the 213 SNPTB

suspects included in the analysis, all with known HIV test results, 104 (48.8%) were

diagnosed with active TB. Stratifying by HIV status, the sensitivity of acid-fast bacilli in

expectorated sputum was lower in HIV seropositive than in HIV seronegative suspects of

SNPTB (67% vs 41%; p=0.01). Among the 213 SNPTB suspects, 62 (29%) had positive

smear acid-fast bacilli tests and were excluded. In this study, data were analyzed for 151

SNPTB suspects with negative smear tests. Overall, active PTB was diagnosed in 28.4%

(43/151) of patients, HIV infection in 29.8% (45/151), and a history of previous PTB was

referred to by 35.0% (53/151). Positive culture results occurred in 69.8% (30/43) of all

TB cases, and 73.7% (14/19) of HIV seropositive TB cases.

Analysis of pretest probability (clinical suspicion) for PTB

Clinical features of SNPTB suspects are shown in Table 1. In 151 SNPTB

suspects, according to risk categories, the prevalence of PTB in high, intermediate and

low clinical pretest probabilities was 67.4% (31/46), 24% (6/25) and 7.5% (6/80),

respectively (p<0.05). The proportion of patients with a suggestive chest radiograph

increased steadily in those with a clinical suspicion of TB groups; 0% of low probability

patients had suggestive radiographs, 24% in the intermediate group, and 78% of the high

level group (p<0.001).

Comparative performance analysis of tests

100

The performance of tests for detection of MTB and diagnosis of PTB are shown

in Table 2. The PCR sensitivity was 65% (CI 95%, 50%-78%) and specificity was 83%

(CI 95%, 75%-89%).

When the pretest probability (Clinical Suspicion) is used as a diagnostic test, the

high pretest probability sensitivity was 72% and specificity was 86%. The Intermediary

pretest probability sensitivity was 14% and specificity was 82%. The Low pretest

probability sensitivity was 14% and specificity was 31%.

PCR had a similar sensitivity to the culture results (65% vs 70%, p=0.65) and to

the high pretest probability (65% vs 72%; p=0.66). The PCR dot-blot demonstrated 18

false-positive results (9 had TB in the past, 1 presented a scar image in the chest X-

ray that resembled inactive TB, 4 were HIV+, 4 referred proximity with smear positive

PTB cases in the last 6 months). The PCR dot-blot demonstrated 15 false-negative

results. The value of the Kappa score obtained between the duplicates of PCRs was

100%. PCR dot-blot inhibition was found in one SNPTB suspect (2.3%).

In a parallel evaluation, the sensitivity of PCR used in parallel with the high

pretest probability was higher than the sensitivity of the high pretest probability when

used alone (90% vs 72%), and of culture sensitivity (90% vs 70%) (Table 2B). PCR

colorimetric dot-blot assay, used in parallel with the high pretest probability, had a PPV

and NPV of 75% and 88%, respectively. The NPV was similar to that observed with

culture alone (88% vs 89%). Comparing the SE and NPV of PCR used in parallel with

the high pretest probability among those individuals not previously treated and those

treated for TB in the past, the figures were respectively 91%, 90% vs 83%, 79%, p>0.05.

101

In HIV seropositive subjects, the sensitivity of PCR was 63% (CI 95%, 40%-

82%), and specificity was 85% (CI 95%, 66%-94%). The PCR sensitivity was similar to

that of culture (74%) and to the high pretest probability method (74%). The PCR

colorimetric dot-blot assay, used in parallel with the high pretest probability, had a SE,

SP, PPV and NPV of 90%, 65%, 72%, and 88%, respectively.

In HIV seronegative subjects the sensitivity of PCR was 66%, and specificity was

83%. PCR sensitivity was similar to that of culture (67%) and to the high Pretest

Probability method (71%). The PCR colorimetric dot-blot assay used in parallel with the

high pretest probability had a SE, SP, PPV and NPV of 90%, 74%, 77%, and 89%,

respectively.

Considering the HIV status and comparing the SE and NPV of PCR with high

pretest probability among those individuals not previously treated and those treated for

TB in the past, the figures were respectively: 91%, 90%, and 89%, 88% for HIV

seropositive subjects and 93%, 92% and 83%, 80% for HIV seronegative group.

An increased sensitivity of PCR, when used in parallel with the high pretest

probability, was observed in non-previously treated patients, compared to those who had

had previous anti-TB treatment (sensitivity: 91% vs 83%). Similar results were found in

HIV seropositive study subjects, in which the sensitivity was 91% among non-previously

treated cases and 89% among those treated in the past. In HIV seronegative suspects,

similar results were observed, in which sensitivity was 93% among non-previously

treated cases and 83% among those treated in the past.

An increased specificity of PCR associated with a high pretest probability was

observed in non-previously treated patients, compared to those who had previous anti-TB

102

treatment (specificity: 79% vs 61%). Similar results were found in HIV seropositive

study subjects: specificity was 79% among non-previously treated cases and 75% among

those treated in the past. In HIV seronegative subjects, using the same diagnostic test, the

specificity was 80% among non-previously treated cases and 62% among those treated

in the past.

Assuming different TB prevalence scenarios, the use of the PCR colorimetric dot-

blot in parallel with a high clinical suspicion of SNPTB showed similar positive and

negative PVs, among HIV seropositive and HIV seronegative patients (Figure 1). In

regions from developing nations with a estimated TB prevalence of 5%-10%, described

in out-patient units attending persons with coughs for more than three weeks (respiratory

symptomatic, according to WHO), NPV for the PCR colorimetric dot-blot technique used

in parallel with a high clinical suspicion of SNPTB, ranged from 98 to 99%, among HIV

seropositive and HIV seronegative subjects. In Health Units, in which the prevalence

ranges from 15% to 20%, usually in General Hospitals or Ambulatory Reference Centers

(TB Clinics), negative PV of this diagnostic strategy ranged from 96% to 97%. In

Reference TB Hospitals where the TB prevalence ranges from 30% to 40%, among HIV

seronegative individuals, NPV of PCR colorimetric dot-blot, used in parallel with a high

clinical suspicion of SNPTB, ranged from 95% to 92%, and among HIV seropositive

individuals, this figure was of 94% and 91%, respectively (Figure 1).

The median time to reveal growth of MTB was 30 days (interquartile range [IQR]

30 to 45) for culture and the median time for detection of MTB by PCR was 3.32 days

(IQR 3.0 to 3.75), respectively (p < 0.01). Within one week, of the 30 positive cultures,

none were positive, whilst PCR detected 93% of positive specimens (p < 0.01).

103

Discussion

We evaluated the performance of tests in SNPTB suspects. The strengths of this

study, carried out in a developing country, included: a) a large number of SNPTB

suspects, b) comparison were made according to HIV status, history of previous anti-TB

treatment, the different levels of clinical suspicion and pretest probability and, c) the

prospective design, ensuring a more complete clinical, laboratory, and radiographic

information. Individuals were carefully characterized by independent reviews to

determine the final diagnosis.

In this study, performed at the Hospital Reference Center, we observed a high

prevalence of active PTB (48.8%) and TB /HIV co-infection (29.8%), confirming the

epidemiological data described by the TB Control Program of Porto Alegre City, where

29% of all new TB cases reported yearly are diagnosed in hospitals and where there is a

high TB and HIV burden[23].

The prevalence of PTB for the high pretest probability group was 67.4%, lower

than that described in the literature where smear-positive and smear-negative PTB were

included in analyses, the prevalence of PTB for intermediate pretest probabilities

was 24%, similar to that (29%) described by Catanzaro, but higher than that described by

Lim (3.4%). PTB prevalence for low pretest probability was 7.5%, higher than that cited

elsewhere with low burdens of TB and HIV infection in health settings [24-26].

The moderate PCR sensitivity and specificity in SNPTB suspects (sensitivity:

65%; specificity: 83%) observed were similar to the sensitivities (61%-83%)

and

specificities (84%-92%) described by others [11, 13, 14]; however the specificities

obtained were lower than those described in industrialized countries (>95%) [27]. As

104

mentioned by others, in this report, the sensitivity of PCR was not influenced by the HIV

status of the patient [12, 28].

Decreased sensitivities of new diagnostic tests are expected among smear-

negative pulmonary TB cases. In this study, this may be due to: 1) the presence of

inhibitors that remain in the specimen after the extraction procedure; 2) a small number

of mycobacteria unequally distributed in the test suspension; 3) a mycobacterium level

that is below the detection limit of in house PCR (50 CFU) [16]. The proportion of

inhibitors was 2.3%, and this result was lower than that reported by other studies using

home-made PCR (22.7%)

and similar to those using automated NAA (0.85%-5.0%) [17,

27, 29]. Twenty-three specimens presented less than 50 CFU in culture, which is below

the detection limit of the test. Partial loss of mycobacterial homogeneity, leading to

unequal distribution in the test suspension, may be due to the division of the suspension

into three aliquots for use in laboratory tests. Additionally, a potential source of

decreased sensitivity may be the use of the IS6110 insertion element as the target for

PCR, since MTB can present low copy numbers of the element. Meanwhile, DNA

fingerprinting studies, performed in Brazil, did not find the presence of these strains, as

mentioned by Sperhacke et al [16].

The decrease in specificity was due to eighteen false-positive results from

patients that referred to previous anti-TB treatment, thus it is not surprising that DNA

could be detected in their respiratory specimens, however the period elapsed between the

end of previous anti-TB treatment in these patients and the reported positive PCR

analyses was not collected, and this is a limitation of this study.

105

Using a high pretest probability as a diagnostic test for SNPTB diagnosis, this test

had a sensitivity of 72% and a specificity of 86%; these values were similar to those

observed with culture and PCR. These low accuracies can be explained by the fact that

the evaluation of patients was performed by young or less experienced physicians, as

described by LIM et al [30]. The large disparity in sensitivities found when the clinical

suspicion (pretest probability) is used as a diagnostic test, can be explained due to: a) the

classification in risk categories based on based on clinical data, b) different years of

experience in the SNPTB diagnosis of physicians that evaluated the patients. Therefore,

when a high, intermediate and low probability pretest is used as a diagnostic test, patients

with high risk had sensitivities higher than those of patients with intermediate and low

risk, because these patients had more symptoms compatible with SNPTB.

The clinical evaluation used in parallel with the PCR test may be an alternative to

the use of the PCR test for rapid diagnosis of PTB, especially in a hospital setting with a

high burden of TB/HIV co-infection. The combination of clinical judgment and

amplification results strongly enhances a rapid and correct diagnosis of PTB [26].

In this study, when we used PCR in parallel with high pretest probability, the

diagnostic appeared to offer a higher negative predictive value in SNPTB subjects that

had not been previously treated and in HIV seronegative cases, as described by others

[24, 25, 30]. In non-previously treated and HIV seronegative cases, the performance

results (SE: 93%; NPV: 92%) were similar to those recently described by Piersimoni et

al, using automated tests in 214 PTB suspects [26].

Due to the small number of active TB in the group with the low pretest

probability, additional evaluation is warranted in order to analyze the appropriateness of

106

the parallel use of the PCR technique in this group of patients. However, the most

difficult group for clinical assessment is the intermediate risk group, where PCR, used in

parallel with the intermediary pretest (Clinical Suspicion), appears not to be useful, as

already suggested by others. The prevalence of PTB may be overestimated in the

intermediate risk group, thus the utility of PCR assay in these patients needs further

evaluation, using more accurate clinical selection criteria [25, 30].

The PCR dot-blot was selected due to its low cost (around U$12), simple

extraction method and the colorimetric end point, all factors that might be expected to

facilitate the transfer of NAA tests to laboratories in low income countries [28, 31].

Additionally, as clinical risk assessment is more likely to reflect physician decision-

making, to our knowledge, this is the first prospective study that relates pretest

probability with the performance of a PCR in consecutive patients suspected of having

SNPTB, in South America.

In our study, we pursued, in a large number of smear negative pulmonary TB

suspects, a comprehensive clinical and laboratory approach for TB diagnosis using a

home-made PCR, as suggested by Flores et al.[32]. Due to the heterogeneity in the test’s

accuracy, it was emphasized the necessity to incorporate the clinical information for the

better evaluation of NAAs in TB diagnosis among smear negative cases[32, 33].

Another possible study limitation was the use of a home-made PCR that may

warrant validation in comparison with more reliable techniques, such as an automated

standardized test, as described by Greco et al [33]. Unfortunately, an automated test was

not available, therefore, the IS6110 element of insertion was used as a target for PCR; as

recent meta-analyses demonstrated its higher accuracy in the diagnosis of SNPTB [11].

107

Differing data in literature may be explained due to some factors. Firstly, few studies

have evaluated the utility of the home-made PCR technique among SNPTB suspects in

developing nations with a high TB and HIV burden. Secondly, those studies that

measured the clinical risk assessment were performed in settings with different TB

prevalence [24, 25]. Thirdly, clinical judgment and experience can influence the pretest

probabilities, interfering with the sample size in each clinical risk group. Finally, the

prevalence of co-morbidities (i.e.: HIV infection) of mycobacteria other than tuberculosis

(MOTT) disease and the patient’s response to interview may differ according to their

prevalence in the community.

Conclusions

The PCR dot-blot used in parallel with the high probability pretest has a high

negative predictive value suggesting that in a hospital setting in developing countries,

with a high prevalence of TB and HIV, the PCR technique may be useful for the

evaluation of SNPTB suspects. For example, when the pretest probability is high, a

negative PCR result indicates an increased likelihood of the absence of active TB in

SNPTB suspects, infected or not by HIV.

We conclude that our results are in agreement with those of the literature,

showing that molecular methods may provide an important contribution to the diagnosis

of SNPTB in patients with high clinical suspicion [24, 26]. Since home-made PCR is

less costly than automated NAA, this test could be introduced more widely after a proper

evaluation of its cost-effectiveness with clinical and radiographic characteristics to refine

estimates of likelihood of TB disease in different settings, as proposed by others [28, 34].

108

Abbreviations:

AFB- Acid Fast Bacilli

MOTT -Mycobacterium Other Than Tuberculosis

MTB- Mycobacterium tuberculosis

NAA -Nucleic Acid Amplification

PCR- Polymerase Chain Reaction

PTB- Pulmonary Tuberculosis

SNPTB - Smear Negative Pulmonary Tuberculosis

PRH - Parthenon Reference Hospital

TB –Tuberculosis

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

LCS carried out the study, participated in the laboratory tests, participated in data

acquisition, performed the statistical analysis and drafted the manuscript; RDS carried out

the laboratory tests, data analysis, participated in data acquisition and drafted the

manuscript, FCQM helped to draft the manuscript, CJ participated in the recruitment and

in the clinical evaluation of patients, PIC underwent the questionnaire in patients. SM and

MOR performed bacteriological tests, ARN performed the epidemiological analysis and

drafted the paper, MLRR helped design the study, performed the statistical analysis and

drafted the paper, ALK conceived of the study, participated in its design, performed the

109

data analysis, coordination and helped to draft the manuscript. All authors contributed to

the interpretation of results, have read and approved the final manuscript.

Acknowledgements

We thank Fabio Mendonça and Candice Tosi Michelon for laboratory support; CEARGS

(Center of studies in AIDS/ RS) for statistical support; and health personnel from SPRH.

Financial Support: This work was supported by CNPq, REDETB number 62.005/014-

PADCT and ICIDR, grant number: 1 U19 AI45432.

110

References

1. WHO: Global tuberculosis control - surveillance, planning, financing

WHO Report 2006 2006:362.

2. Brasil: Boletim Eletrônico Epidemiológico do Ministério da Saúde. 2000.

3. Elliott AM, Namaambo K, Allen BW, Luo N, Hayes RJ, Pobee JO, McAdam KP:

Negative sputum smear results in HIV-positive patients with pulmonary

tuberculosis in Lusaka, Zambia. Tuber Lung Dis 1993, 74(3):191-194.

4. Harries AD, Nyangulu DS, Kang'ombe C, Ndalama D, Glynn JR, Banda H,

Wirima JJ, Salaniponi FM, Liomba G, Maher D et al: Treatment outcome of an

unselected cohort of tuberculosis patients in relation to human

immunodeficiency virus serostatus in Zomba Hospital, Malawi. Trans R Soc

Trop Med Hyg 1998, 92(3):343-347.

5. Gordin FM, Slutkin G, Schecter G, Goodman PC, Hopewell PC: Presumptive

diagnosis and treatment of pulmonary tuberculosis based on radiographic

findings. Am Rev Respir Dis 1989, 139(5):1090-1093.

6. Dlodlo RA, Fujiwara PI, Enarson DA: Should tuberculosis treatment and

control be addressed differently in HIV-infected and -uninfected individuals?

Eur Respir J 2005, 25(4):751-757.

7. Sloutsky A, Han LL, Werner BG: Practical strategies for performance

optimization of the enhanced gen-probe amplified mycobacterium

tuberculosis direct test. J Clin Microbiol 2004, 42(4):1547-1551.

8. Schijman AG, Losso MH, Montoto M, Saez CB, Smayevsky J, Benetucci JA:

Prospective evaluation of in-house polymerase chain reaction for diagnosis of

mycobacterial diseases in patients with HIV infection and lung infiltrates. Int

J Tuberc Lung Dis 2004, 8(1):106-113.

9. Brodie D, Schluger NW: The diagnosis of tuberculosis. Clin Chest Med 2005,

26(2):247-271, vi.

10. Perkins MD: New diagnostic tools for tuberculosis. Int J Tuberc Lung Dis 2000,

4(12 Suppl 2):S182-188.

11. Sarmiento OL, Weigle KA, Alexander J, Weber DJ, Miller WC: Assessment by

meta-analysis of PCR for diagnosis of smear-negative pulmonary

tuberculosis. J Clin Microbiol 2003, 41(7):3233-3240.

12. Kivihya-Ndugga L, van Cleeff M, Juma E, Kimwomi J, Githui W, Oskam L,

Schuitema A, van Soolingen D, Nganga L, Kibuga D et al: Comparison of PCR

with the routine procedure for diagnosis of tuberculosis in a population with

high prevalences of tuberculosis and human immunodeficiency virus. J Clin

Microbiol 2004, 42(3):1012-1015.

111

13. Laifer G, Widmer AF, Frei R, Zimmerli W, Fluckiger U: Polymerase chain

reaction for Mycobacterium tuberculosis: impact on clinical management of

refugees with pulmonary infiltrates. Chest 2004, 125(3):981-986.

14. Mbulo GM, Kambashi BS, Kinkese J, Tembwe R, Shumba B, Godfrey-Faussett

P, McNerney R: Comparison of two bacteriophage tests and nucleic acid

amplification for the diagnosis of pulmonary tuberculosis in sub-Saharan

Africa. Int J Tuberc Lung Dis 2004, 8(11):1342-1347.

15. Ribeiro FK, Dettoni Vdo V, Peres RL, Vinhas SA, Co TR, Dietze R, Palaci M:

Evaluation of a commercial test based on ligase chain reaction for direct

detection of Mycobacterium tuberculosis in respiratory specimens. Rev Soc

Bras Med Trop 2004, 37(6):431-435.

16. Sperhacke RD, Mello FC, Zaha A, Kritski A, Rossetti ML: Detection of

Mycobacterium tuberculosis by a polymerase chain reaction colorimetric

dot-blot assay. Int J Tuberc Lung Dis 2004, 8(3):312-317.

17. Tarhan G, Saygan MB, Cesur S, Ocak F, Ceyhan I: [Retrospective evaluation of

Cobas Amplicor system in the rapid diagnosis of Mycobacterium

tuberculosis complex]. Mikrobiyol Bul 2005, 39(1):35-41.

18. Tuberculose II Consenso Brasileiro de Tuberculose: Diretrizes Brasileiras para

Tuberculose. Jornal Brasileiro de Pneumologia 2004, 30(1).

19. Mello FC, Bastos LG, Soares SL, Rezende VM, Conde MB, Chaisson RE, Kritski

AL, Ruffino-Netto A, Werneck GL: Predicting smear negative pulmonary

tuberculosis with classification trees and logistic regression: a cross-sectional

study. BMC Public Health 2006, 6:43.

20. ATS: Diagnostic Standards and Classification of Tuberculosis in Adults and

Children. This official statement of the American Thoracic Society and the

Centers for Disease Control and Prevention was adopted by the ATS Board

of Directors, July 1999. This statement was endorsed by the Council of the

Infectious Disease Society of America, September 1999. Am J Respir Crit Care

Med 2000, 161(4 Pt 1):1376-1395.

21. Kent PT and Kubica G: Public Health Mycobacteriology – a guide for level III

laboratory. Centers for Disease Control and Prevention 1985.

22. Medronho R.A. Carvalho D.M., Bloch K.V., Luiz R.R., Werneck G.L.:

Epidemiologia. Editora Atheneu, Sao Paulo 2002.

23. Equipe de Controle Epidemiológico. Coordenadoria de Vigilância em Saude.

Secretaria Municipal de Saúde de Porto Alegre: Análise comparativa do

ingresso de casos novos de Tuberculose ocorrido na rede ambulatorial e

hospitalar de Porto Alegre nos anos de 2003 e 2004. Boletim Epidemiológico

2005, 27(Ano VIII).

24. Catanzaro A, Perry S, Clarridge JE, Dunbar S, Goodnight-White S, LoBue PA,

Peter C, Pfyffer GE, Sierra MF, Weber R et al: The role of clinical suspicion in

evaluating a new diagnostic test for active tuberculosis: results of a

multicenter prospective trial. Jama 2000, 283(5):639-645.

112

25. Lim TK, Gough A, Chin NK, Kumarasinghe G: Relationship between estimated

pretest probability and accuracy of automated Mycobacterium tuberculosis

assay in smear-negative pulmonary tuberculosis. Chest 2000, 118(3):641-647.

26. Piersimoni C, Nista D, Zallocco D, Galassi M, Cimarelli ME, Tubaldi A: Clinical

suspicion as a primary guidance to use commercial amplification tests for

rapid diagnosis of pulmonary tuberculosis. Diagn Microbiol Infect Dis 2005,

53(3):195-200.

27. Goessens WH, de Man P, Koeleman JG, Luijendijk A, te Witt R, Endtz HP, van

Belkum A: Comparison of the COBAS AMPLICOR MTB and BDProbeTec

ET assays for detection of Mycobacterium tuberculosis in respiratory

specimens. J Clin Microbiol 2005, 43(6):2563-2566.

28. van Cleeff M, Kivihya-Ndugga L, Githui W, Ng'ang'a L, Kibuga D, Odhiambo J,

Klatser P: Cost-effectiveness of polymerase chain reaction versus Ziehl-

Neelsen smear microscopy for diagnosis of tuberculosis in Kenya. Int J Tuberc

Lung Dis 2005, 9(8):877-883.

29. Almeda J, Garcia A, Gonzalez J, Quinto L, Ventura PJ, Vidal R, Rufi G, Martinez

JA, Jimenez de Anta MT, Trilla A et al: Clinical evaluation of an in-house

IS6110 polymerase chain reaction for diagnosis of tuberculosis. Eur J Clin

Microbiol Infect Dis 2000, 19(11):859-867.

30. Lim TK, Mukhopadhyay A, Gough A, Khoo KL, Khoo SM, Lee KH,

Kumarasinghe G: Role of clinical judgment in the application of a nucleic acid

amplification test for the rapid diagnosis of pulmonary tuberculosis. Chest

2003, 124(3):902-908.

31. Dowdy DW, Maters A, Parrish N, Beyrer C, Dorman SE: Cost-effectiveness

analysis of the gen-probe amplified mycobacterium tuberculosis direct test as

used routinely on smear-positive respiratory specimens. J Clin Microbiol

2003, 41(3):948-953.

32. Flores LL, Pai M, Colford JM, Jr., Riley LW: In-house nucleic acid

amplification tests for the detection of Mycobacterium tuberculosis in

sputum specimens: meta-analysis and meta-regression. BMC Microbiol 2005,

5:55.

33. Greco S, Girardi E, Navarra A, Saltini C: Current evidence on diagnostic

accuracy of commercially based nucleic acid amplification tests for the

diagnosis of pulmonary tuberculosis. Thorax 2006, 61(9):783-790.

34. Lim TK, Cherian J, Poh KL, Leong TY: The rapid diagnosis of smear-negative

pulmonary tuberculosis: a cost-effectiveness analysis. Respirology 2000,

5(4):403-409.

113

Figure legend

Figure 1 - Simulation of positive and negative predictive values of ZN and Culture/ PCR

dot-blot tests, according to different TB prevalence rates.

PPV: Positive Predictive Value, NPV: Negative Predictive Value, PP: pretest probability

(clinical suspicion); TB prevalence rates: from 5% to 48.8%

114

Tables

Table 1 - Patient symptoms and medical history, associated with physicians’ clinical

suspicion of tuberculosis among smear-negative PTB suspects

Clinical Suspicion of Tuberculosis Group

Smear-Negative PTB suspects

Symptoms and

Medical History

N= 151

(%)

Low

(N=80)

Intermediate

(N=25)

High

(N=46)

Suggestive chest

radiography

42 (27.8%) 0 6 36

Weight loss 81 (53.6%) 37 12 32

Cough 135 (89.4%) 73 23 39

Chest pain 89 (58.9%) 48 15 26

Dyspnea 105 (69.5%) 57 17 31

Tuberculosis exposure

at home

74 (49.0%) 37 14 23

Hospital admission in

the last 24 months

53 (35.1%) 24 10 19

Hepatitis 31 (20.5%) 12 5 14

Immune suppression

51 (33.8%) 17 13 21

a: intake chest radiograph was suggestive of classical tuberculosis (upper-lobe fibrocavitary) disease

b: includes patients positive for the human immunodeficiency virus (27.2%) and those with a history of

steroid use or cancer chemotherapy (3.6%).

115

Table 2 - Performance of Culture, PCR dot-blot and Clinical suspicion tests, individually

and associated, in 151 smear negative PTB suspects.

Table 2A. Laboratory results and Performance of methods

All

Group

N=151

Non previously TB treated

Group

N=98

N=43

Non-TB

N=108

N=36

Non-TB

N=62

Positive

30 0 27 0

Culture

Negative

13 108 9 62

SE SP PPV NPV SE SP PPV NPV

70% 100% 100 89 75% 100% 100 87

Positive

28 18 25 9

PCR dot-blot

Negative

15 90 11 53

SE SP PPV NPV SE SP PPV NPV

65% 83% 61 86 69% 85% 73 83

Positive

31 15 26 4

High PP

Negative

12 93 10 58

SE SP PPV NPV SE SP PPV NPV

72% 86% 67 88 72% 93% 87 85

Positive

6 19 6 6

Intermediate

PP Negative

37 89 30 56

SE SP PPV NPV SE SP PPV NPV

14% 82% 24 71 17% 90% 50 65

Positive

6 74 4 52

Low PP

Negative

37 34 32 10

SE SP PPV NPV SE SP PPV NPV

14% 31% 7.5 48 11% 16% 7.1 24

Table 2B. Performance of methods used in parallel

SE SP PPV NPV SE SP PPV NPV Performance of PCR dot-

blot in parallel with High

Clinical Suspicion

90% 71% 75 88 91% 79% 81 90

SE SP PPV NPV SE SP PPV NPV Performance of PCR dot-

blot in parallel with

Intermediate Clinical

Suspicion

70% 68% 68 70 74% 77% 75 76

SE SP PPV NPV SE SP PPV NPV Performance of PCR dot-

blot in parallel with Low

Clinical Suspicion

26% 25% 47 47 26% 14% 45 34

SE: Sensitivity, SP: Specificity, PPV: Positive Predictive Value, NPV: Negative Predictive Value, PP:

pretest probability (clinical suspicion)

a: All group

b: Non previously TB treated group

patients

116

4.4 Artigo 4

Submetido na revista The International Journal of Tuberculosis and Lung

Disease, cujas instruções para os autores estão no anexo 5 (item 9.5.3)

A figura 10 apresenta a confirmação da submissão deste artigo à revista.

Figura 10. Comprovação da submissão do artigo

117

Cost-effectiveness analysis of PCR for the rapid diagnosis of pulmonary tuberculosis

Luciene C. Scherer

1,3

; Rosa D. Sperhacke

; Antonio Ruffino-Netto

; Maria L. R.

Rossetti,

2,3

, Claudia Vater

, Paul Klatser

and Afrânio L. Kritski.

1-Programa de Pós Graduação em Ciências Biológicas- Bioquímica, Universidade

Federal do Rio Grande do Sul -UFRGS, Porto Alegre/RS/ Brazil;

2- Centro de Desenvolvimento Científico e Tecnológico - CDCT, Fundação Estadual de

Produção e Pesquisa em Saúde- FEPPS/RS) Porto Alegre/RS/Brazil;

3- Universidade Luterana do Brasil-ULBRA, Canoas/ RS/ Brazil;

4- Unidade de Pesquisa em Tuberculose, Hospital Universitário Clementino Fraga Filho,

UPT/ HUCFF, Instituto de Saúde Coletiva/IESC/Universidade Federal do Rio de Janeiro

-UFRJ, Rio de Janeiro, Brazil;

5 – Royal Tropical Institute (KIT), KIT Biomedical Research – The Netherlands.

6- Faculdade de Medicina de Ribeirão Preto- Universidade de São Paulo

*From: Centro de Desenvolvimento Científico e Tecnológico - CDCT, Fundação Estadual de Produção e

Pesquisa em Saúde- FEPPS/RS) Porto Alegre/RS/Brazil;

Correspondence and requests for reprints should be addressed to Luciene Cardoso Scherer, Centro de

Desenvolvimento Científico e Tecnológico- CDCT, Fundação Estadual de Produção e Pesquisa em Saúde-

FEPPS/RS Porto Alegre/RS/Brazil, Av Ipiranga 5400, 3 andar, Centro de Desenvolvimento Científico e

tecnológico- CDCT, Porto Alegre CEP 91000000. Phone/fax number 05133520336, Porto Alegre, Brazil.

Email:luciene.scherer@hotmail.com

Running head: Cost-effectiveness analysis of PCR dot-blot

Word count of the text: 2500

Key words: in house PCR, HIV, tuberculosis, diagnosis, cost effectiveness

118

Abbreviation List:

AFB- Acid Fast Bacilli

CHC- Community Health Centers

HIV- Human Imunnodeficiency Virus

HIV

-HIV seropositive

HIV

- HIV seronegative

MOTT -Mycobacterium Other Than Tuberculosis

MTB- Mycobacterium tuberculosis

NAA -Nucleic Acid Amplification

NPV- Negative Predictive Value

PCR- Polymerase Chain Reaction

PCR-AG- Polymerase Chain Reaction agarose gel electrophoresis

PCR-dot-blot- PCR colorimetric dot-blot assay

PPV- Positive Predictive Value

PTB- Pulmonary Tuberculosis

SE- Sensitivity

SP- Specificity

PRH - Partenon Reference Hospital

TB –Tuberculosis

119

Abstract

Setting: A public reference TB/HIV hospital in Brazil.

Objective: To compare the cost-effectiveness of diagnostic strategies for diagnosis of

pulmonary TB (PTB): culture and two in house PCR tests: PCR-AG and PCR dot-blot, in

conjunction with direct microscopy by Ziehl-Neelsen staining (ZN).

Design: From May 2003 to May 2004, sputum was collected consecutively from PTB

suspects attending the Parthenon Reference Hospital. Sputum samples were examined

with direct microscopy by ZN, culture, PCR-AG and PCR dot-blot. Gold standard was a

positive culture combined with the definition of clinical PTB. Cost analysis included

health services and patients costs.

Results: Costs per correctly diagnosed case were U$ 1462, U$ 1296 and U$ 1136 for ZN

plus culture, ZN plus PCR-AG and ZN plus PCR dot-blot, respectively. ZN plus PCR

dot-blot was as cost-effective as ZN plus culture, when cost of treating all correctly

diagnosed cases was considered. Cost of the return of all false negatives to health service

was more expensive in ZN plus PCR-AG than in other strategies.

Conclusion: This study shows that in house PCR (PCR dot-blot) has great potential to be

used in hospitals, and can be considered in combination with ZN as an alternative to the

diagnosis of PTB.

120

Background

Tuberculosis (TB) is one of the most important health problems in the world

causing 1.8 million deaths each year. The rapid clinical diagnosis and diagnosis is more

challenging in patients who have co-morbidities such as Human Immunodeficiency Virus

(HIV) infection. Direct microscopy has low sensitivity and culture takes 3 to 6 weeks[1,

2]. Therefore, new tools for TB diagnosis are necessary, especially in health settings with

high prevalence of HIV/TB co-infection.

In developing countries, in house polymerase chain reaction (PCR) based on

amplifying the insertion element IS6110 is often used for the amplification of

Mycobacterium tuberculosis (MTB) DNA and offers the potential of a sensitive, specific

and rapid diagnostic for diagnosis of pulmonary tuberculosis (PTB) [3-6].

The majority of previous studies evaluated

and automated PCR,

reported PCR sensitivities ranging from 77% to 95% and PCR specificities of 95% in

smear positive specimens, using culture as the gold standard and clinical criteria only to

evaluate the discrepant results. Moreover, the PCR tests were evaluated separately, which

is different from clinical practice, where tests for diagnosis, are required in

association.[6-8]. Many prior studies note that clinical routine use of PCR may be

difficult due to its high cost, mainly if the PCR was used itself and emphasize the clinical

importance utility and cost effectiveness analysis for this test as better argument for

making such a decision. For regions with high burden of TB and HIV, that urgently

needed new strategies for TB control, there are scarce data on cost-effectiveness analysis

of PCR technique for TB diagnosis in developing nations [7-13].

The purpose of this study was to measure the cost-effectiveness of in house PCR

121

in conjunction with direct microscopy by Ziehl-Neelsen staining (ZN) for PTB diagnosis,

using as gold standard (the combination of positive culture with the clinical definition of

PTB.

122

Study population and Methods

From May 2003 to May 2004, subjects were recruited at the Partenon Reference

Hospital (PRH) of Rio Grande do Sul State in South of Brazil. Clinical and final

diagnoses of PTB cases were based on the review of clinical evaluation 6 months post

diagnosis. Chest physicians were blinded to PCR results. Participants underwent a

standardized and validated interview, which included demographic information and

clinical history and written informed consent was obtained. HIV status was screened by

serology (GenScreen HIV Plus® BioRad), and confirmed by Western blotting

(Genelabs® Diagnostics) at the laboratory hospital.

Examinations and performance evaluation

All sputum specimens were sent to the State Public Reference Laboratory, for

analysis. ZN, Culture and two in house PCR techniques were performed following the

routine of laboratory [14]. The extraction and amplification of DNA, for PCR assays:

colorimetric test (PCR dot-blot) and agarose gel test (PCR-AG) were performed as

previously published [7, 15]. Positive (MTB Mt H37Rv) and negative controls (PCR

mixture with water instead of template DNA) were included for each set of PCR. To

detect specimen inhibitors in negative results, a tube of PCR mix for each specimen was

spiked with purified DNA target[7]. The gold standard was the combination of positive

culture with clinical definition of pulmonary TB. Clinical and final diagnosis of

confirmed PTB cases was defined as those with a positive culture for MTB in the

respiratory specimen; presumptive PTB, as clinical improvement after six months of anti-

TB treatment, as judged by three different chest physicians not involved in this study in a

123

blinded manner. Non-PTB was considered when patients were negative in acid-fast smear

and MTB culture, and did not present clinical and chest radiographic changes compatible

with PTB after six months of follow-up.

Costs

The cost components for each procedure included costs incurred by the patient,

labor costs, drugs, consumables and equipment costs. Number and level of staff screening

for TB in hospital were considered the same in all strategies. Clinical, radiological and

laboratory staff costs were calculated from salary base of Rio Grande do Sul State of

Brazil. For each procedure there were attributed costs based on procedures costs of

Brazilian Public Health System. All costs were expressed in US$, using an exchange rate

of US$ 1= 3 R$ (REAIS), the average range exchange rate from 2003 to 2004. In the

treatment costs analysis the cost related to: a) the inadequate use of non anti-TB drugs

and; b) the adverse effects to the inadequate use of anti-TB drugs for nonTB subjects,

were not included.

Cost effectiveness

A decision analytic model was developed using the software Excel 7.0 to compare

the routine diagnostic procedure for diagnosis of PTB using ZN methods in the sputum

specimens with a theoretical combination of procedures using ZN plus culture, ZN plus

PCR-AG, and ZN plus PCR dot blot. The cost effectiveness was expressed as cost per

correctly diagnosed case of TB, cost per case correctly diagnosed and treated, including

treatment of incorrectly diagnosed cases, and cost per case incorrectly diagnosed and not

treated. A sensitivity analysis was performed to assess to what extent changes in certain

environmental factors would affect cost-effectiveness.

124

Results

A total of 277 TB suspects were enrolled. Prevalence of PTB was 46.2%

(128/277) overall and 54.0% (40/74) among HIV infected subjects.

Test performance

Table 1 shows the yield and performance of each combined procedure in

detecting a PTB case. The positive (LR+) and negative (LR-) likelihood ratios were 47

and 0.07 for ZN plus culture, and 5.65 and 0.12 for ZN plus PCR-dot-blot, respectively.

The inhibition of two in house PCR was 1.9%. Twenty-three specimens presented less

than 50 CFU in culture, which is below the detection limit of the PCR. These specimens

were included in the analysis.

Costs

Table 2A shows the costs at the health service level and Table 2B shows costs due to

laboratory investment. The ZN plus In house PCR strategies (PCR-AG and PCR dot-blot)

strategy requires the largest laboratory investment for equipment (US$ 26,667). Table 2C

shows costs incurred by patients.

Table 3A shows the total cost of screening 1,000 suspects. When considering total

screening costs were considered ZN plus PCR dot blot costs were similar to ZN plus

Culture costs (US$ 120,591 versus US$ 162,300).

Table 3B shows the total cost (in US$) of treatment of 1000 suspects. When

considering total cost related to the treatment (inpatients plus outpatients) per strategy,

ZN plus PCR dot-blot was 1.4 times less expensive than ZN plus Culture strategy (US$

665 versus US$ 910).

125

Table 4 shows the cost-effectiveness expressed for total number correctly

diagnosed cases of TB in screening of 1,000 TB suspects. ZN plus PCR dot-blot costs

were 1.3 times cheaper than ZN plus Culture costs.

Table 5 shows that the cost-effectiveness of screening 1,000 suspects for ZN plus

PCR dot-blot was as cost-effective than the strategy of ZN plus Culture (US$1,611 vs

US$2,359), when the costs of treating all correctly diagnosed cases were considered.

However, the cost of treating all falsely diagnosed cases was 16 times more expensive

than ZN plus Culture.

Considering the similar costs between the ZN plus Culture and ZN plus PCR dot

blot, the Table 6 shows a sensitivity analysis comparing the cost-effectiveness of the two

strategies, adjusting for different features. The ratio of cost-effectiveness was higher than

0.78 in most adjustments. Considering high prevalence of TB 60%, PCR dot-blot was 1.3

times cheaper than current situation (Prevalence 46%). Considering low prevalence of TB

(10%), PCR dot-blot was 5 times more expansive than current situation, but the costs

decreased with the increase of the prevalence of TB. On reduction of the running cost of

PCR dot-blot by 22%, the cost-effectiveness was similar with ZN plus Culture.

Discussion

The approach of comparing more sensitive techniques, like PCR, to rapid, low

cost techniques, like ZN could improve the quality of diagnosis and reduce delayed

identification of mycobacterial infections. This is especially crucial among hospitalized

PTB suspects, in which the atypical clinical presentation and mortality rate are more

frequent, and sometimes is difficult to obtain multiple respiratory specimens [8, 18].

126

Additionally, ZN alone cannot distinguish TB from mycobacteria other than TB

(MOTT) [19]. In this study, in a setting with a high prevalence of TB/HIV (54.0%), we

evaluated sensitivity, specificity, likelihood ratios, predictive values and compared the

cost-effectiveness of strategies ZN plus Culture, ZN plus PCR-AG and ZN plus PCR dot-

blot for diagnosis of PTB [20].

Although, the ZN plus culture strategy showed the highest performance for PTB

diagnosis, ZN plus PCR dot blot strategy had a negative predictive value (87%) and low

likelihood ratio negative (0.12) similar to ZN plus Culture (90%, 0.07), respectively.

Suggesting that this strategy could be the alternative for rapid TB diagnosis, including

HIV infected individuals, where it is critical to initiate prompt, specific treatment and a

delayed diagnosis can be lethal. Additionally, this strategy could reduce the risk of

dissemination and spread to other hospitalized patients and health care personnel.[1, 21]

The specificity of ZN plus PCR dot-blot (84%) was similar to a series described

(84% to 87%) in developing countries even using automated nucleic acid amplification

tests (NAA) and lower than that described (>95%) in industrialized countries[6, 18, 22].

The lower specificity of ZN plus PCR-AG (76%) was similar to values published

previously using PCR [23].

The low sensitivities found in ZN plus PCR-AG (72%) and ZN plus PCR dot-

blot (85%) may be due to the presence of inhibitors that remain in the specimen after the

extraction procedure, or a small number of mycobacteria unequally distributed in the test

suspension or existing the below detection limit of both in house PCR tests( PCR dot blot

and PCR-AG) (50 CFU)[7]. Among false negative results, we had 42.9% (15/35) in PCR-

127

AG; 57.9% (11/19) in PCR dot-blot, that were below the detection limit of amplification

test. The proportion of inhibitors was (1.9%) to in house PCR, similar to those used in

NAA tests (0.85% to 22.7%) [9, 22] The low copy numbers of IS6110 (insertion element)

in MTB, is reported as a factor of decreased of sensitivity, but it has not been reported in

Brazil [24].

However to make rational decisions about the implementation of in house PCR in

the medical routine, cost-effectiveness studies are essential. Such studies give insight to

the composition of different cost components, which may be the most important factor

from the patient and the health service’s perspectives. Here we compared the cost-

effectiveness of ZN to the in house PCR with ZN and the Culture on the first sputum

specimen collection, including staff costs, using as a gold standard culture and clinical

evolution, different to the cost-effectiveness analysis described by van Cleef et al in a

reference ambulatory in Kenya, where only culture for mycobacteria was used as gold

standard [8].

In our study, we found less cost-effectiveness using ZN plus PCR per case

correctly diagnosed compared to that described earlier using theoretical model for

automated PCR (Amplicor MTB PCR and amplified Mycobacterium Tuberculosis Direct

test (MTD- Gen-Probe), probably due to lower accuracy observed with the in house PCR

techniques [19,25]. In the present study, we used a more conservative approach when it

was included in the analysis, health service and patient cost. The cost-effectiveness per

case correctly diagnosed to strategy ZN plus PCR dot-blot was higher than the strategy

ZN plus Culture (ratio of 0.78). ZN plus PCR dot-blot turned out to be 1.3 times the cost

of ZN plus Culture. The costs for every correctly diagnosed TB patient are 1.3 times

128

lower in ZN plus PCR dot-blot than in ZN plus Culture, similar to described previously to

automated PCR (ratio of 1.8) where it was compared to PCR with the smear microscopy

routine.[8]. When considering only patient costs, the ZN plus PCR dot-blot was more

cost-effective than ZN plus culture with ratio of 0.7.

The cost-effectiveness per case correctly diagnosed and treated, including

treatment of falsely diagnosed cases in ZN plus PCR dot-blot, was higher than the

strategy ZN plus Culture (ratio of 0.81). And, the cost-effectiveness per case incorrectly

diagnosed and non treated in ZN plus PCR dot-blot, was higher than the cost-

effectiveness per case correctly diagnosed to strategy ZN plus Culture (ratio of 0.95).

The over diagnosis due to the low specificity of the in house PCR, might indeed

be a barrier in the decision to invest in these tests. However, in our study, we evaluated

two in house PCR, ZN plus PCR dot-blot was more cost-effective than ZN plus PCR-AG,

and it was as cost-effective than ZN plus Culture, confirming the potential of some in

house PCR in routine diagnosis for PTB [9, 26-28]. Another reason to use the in house

PCR is that ZN plus Culture is time consuming and labor intensive. Additionally, PCR

method is patient friendly, reducing costs to patients and PCR is not influenced by HIV

status of the patient [18, 19].

Middle income countries, like Brazil have to consider the economic burden of

managing false negative results. The cost treating return false negative patients was more

expensive for ZN plus PCR-AG than ZN plus PCR dot-blot and it was similar to ZN plus

Culture. Some studies reported the importance of considering costs of false negative

patients, but the cost was not indicated [8, 25]. When these costs were associated to total

129

screening costs, the costs for each incorrectly diagnosed and not treated were thus 1.2

times higher in ZN plus PCR dot-blot in comparison to ZN plus Culture strategy.

The sensitivity analysis comparing the cost-effectiveness of ZN plus Culture and

ZN plus PCR dot-blot, adjusting different scenarios for TB prevalence, shows that the

ratio of cost-effectiveness remained more or less the same in most adjustments. Some

gains in cost-effectiveness can be obtained when the sensitivity and specificity of PCR

were adjusted to 95%, according to results reported previously which state that sensitivity

higher than 80% can be a factor to increase cost-effectiveness of PCR methods [25].

In reduction in the cost of PCR dot-blot for US$ 10 per test we also have an

increment on the cost-effectiveness of the ZN plus PCR dot-blot strategy. It was similar

to the method described for others when cost of PCR is reduced [8, 18, 19, 25]. And, it is

expected that the cost can be reduced with time and increased the utilization[29]. In

house PCR tests are estimated to cost about US$ 5-10. A price reduction to US$6 would

adjust the cost effectiveness of PCR to the same level of smear microscopy [25].

The cost-effectiveness of the ZN plus PCR dot-blot strategy described in this

study was similar to other strategies when lower TB prevalence made PCR more

expensive for diagnosis of PTB [8, 25].

In conclusion our study showed that, the strategy of ZN plus PCR dot-blot, using

the respiratory specimen can be a cost-effective alternative, especially in hospitals from

developing nations with high prevalence of TB and HIV. ZN plus PCR dot-blot showed a

great improvement in sensitivity, negative predictive value, and offered an improvement

for ruling out pulmonary TB diagnosis. However, inter laboratory and cost-effectiveness

130

studies in others settings are required to evaluate the performance of PCR dot-blot under

field conditions, before it be introduced for routine use.

Acknowledgments. CEARGS, PRH and REDE-TB for support

131

References

1. Sharma SK, Mohan A, Sharma A, Mitra DK: Miliary tuberculosis: new insights

into an old disease. Lancet Infect Dis 2005, 5(7):415-430.

2. WHO: Global tuberculosis control - surveillance, planning, financing

WHO Report 2006 2006:362.

3. Schijman AG, Losso MH, Montoto M, Saez CB, Smayevsky J, Benetucci JA:

Prospective evaluation of in-house polymerase chain reaction for diagnosis of

mycobacterial diseases in patients with HIV infection and lung infiltrates. Int J

Tuberc Lung Dis 2004, 8(1):106-113.

4. Brodie D, Schluger NW: The diagnosis of tuberculosis. Clin Chest Med 2005,

26(2):247-271, vi.

5. Perkins MD: New diagnostic tools for tuberculosis. Int J Tuberc Lung Dis 2000,

4(12 Suppl 2):S182-188.

6. Sarmiento OL, Weigle KA, Alexander J, Weber DJ, Miller WC: Assessment by

meta-analysis of PCR for diagnosis of smear-negative pulmonary tuberculosis. J

Clin Microbiol 2003, 41(7):3233-3240.

7. Sperhacke RD, Mello FC, Zaha A, Kritski A, Rossetti ML: Detection of

Mycobacterium tuberculosis by a polymerase chain reaction colorimetric dot-blot

assay. Int J Tuberc Lung Dis 2004, 8(3):312-317.

8. van Cleeff M, Kivihya-Ndugga L, Githui W, Ng'ang'a L, Kibuga D, Odhiambo J,

Klatser P: Cost-effectiveness of polymerase chain reaction versus Ziehl-Neelsen

smear microscopy for diagnosis of tuberculosis in Kenya. Int J Tuberc Lung Dis

2005, 9(8):877-883.

132

9. Almeda J, Garcia A, Gonzalez J, Quinto L, Ventura PJ, Vidal R, Rufi G, Martinez

JA, Jimenez de Anta MT, Trilla A et al: Clinical evaluation of an in-house IS6110

polymerase chain reaction for diagnosis of tuberculosis. Eur J Clin Microbiol

Infect Dis 2000, 19(11):859-867.

10. Flores LL, Pai M, Colford JM, Jr., Riley LW: In-house nucleic acid amplification

tests for the detection of Mycobacterium tuberculosis in sputum specimens: meta-

analysis and meta-regression. BMC Microbiol 2005, 5:55.

11. Portillo-Gomez L, Morris SL, Panduro A: Rapid and efficient detection of extra-

pulmonary Mycobacterium tuberculosis by PCR analysis. Int J Tuberc Lung Dis

2000, 4(4):361-370.

12. Rossetti ML, Valim AR, Silva MS, Rodrigues VS: [Resistant tuberculosis: a

molecular review]. Rev Saude Publica 2002, 36(4):525-532.

13. Soini H, Agha SA, El-Fiky A, Viljanen MK: Comparison of amplicor and 32-

kilodalton PCR for detection of Mycobacterium tuberculosis from sputum

specimens. J Clin Microbiol 1996, 34(7):1829-1830.

14. Kent PT and Kubica G: Public Health Mycobacteriology – a guide for level III

laboratory. Centers for Disease Control and Prevention 1985

15. Rossetti L R JSB, Rodrigues V F S, Moura A R, Oliveira H, Zaha A:

Improvement of Mycobacterim tuberculosis detection in clinical samples using

DNA purified by glass matrix. J Microbiol Meth 1997, 28:139-146.

16. Kritski AL: Tuberculose do Ambulatório a Enfermaria. Atheneu 2000, 2 ed.

17. Tuberculose II Consenso Brasileiro de Tuberculose:: Diretrizes Brasileiras para

Tuberculose. Jornal Brasileiro de Pneumologia 2004, 30(1).

133

18. Kivihya-Ndugga L, van Cleeff M, Juma E, Kimwomi J, Githui W, Oskam L,

Schuitema A, van Soolingen D, Nganga L, Kibuga D et al: Comparison of PCR

with the routine procedure for diagnosis of tuberculosis in a population with high

prevalences of tuberculosis and human immunodeficiency virus. J Clin Microbiol

2004, 42(3):1012-1015.

19. Dowdy DW, Maters A, Parrish N, Beyrer C, Dorman SE: Cost-effectiveness

analysis of the gen-probe amplified mycobacterium tuberculosis direct test as

used routinely on smear-positive respiratory specimens. J Clin Microbiol 2003,

41(3):948-953.

20. Equipe de Controle Epidemiológico/Coordenadoria de Vigilância em

Saúde/Secretaria Municipal de Porto Alegre 2005: Análise comparativa do

ingresso de casos novos de Tuberculose ocorrido na rede ambulatorial e hospitalar

de Porto Alegre nos anos de 2003 e 2004. Boletim Epidemiológico 2005, 27(Ano

VIII).

21. Keshinro B, Diul MY: HIV-TB: epidemiology, clinical features and diagnosis of

smear-negativeTB. Trop Doct 2006, 36(2):68-71.

22. Goessens WH, de Man P, Koeleman JG, Luijendijk A, te Witt R, Endtz HP, van

Belkum A: Comparison of the COBAS AMPLICOR MTB and BDProbeTec ET

assays for detection of Mycobacterium tuberculosis in respiratory specimens. J

Clin Microbiol 2005, 43(6):2563-2566.

23. Dilworth JP, Goyal M, Young DB, Shaw RJ: Comparison of polymerase chain

reaction for IS6110 and Amplicor in the diagnosis of tuberculosis. Thorax 1996,

51(3):320-322.

134

24. Cafrune PI, Riley LW, Possuelo LG, Valim AR, Borges M, Ribeiro MO, Rossetti

ML, Zaha A: Recent transmission of tuberculosis involving retired patients. J

Infect 2006.

25. Roos BR, van Cleeff MR, Githui WA, Kivihya-Ndugga L, Odhiambo JA, Kibuga

DK, Klatser PR: Cost-effectiveness of the polymerase chain reaction versus smear

examination for the diagnosis of tuberculosis in Kenya: a theoretical model. Int J

Tuberc Lung Dis 1998, 2(3):235-241.

26. Kivihya-Ndugga LE, van Cleeff MR, Githui WA, Nganga LW, Kibuga DK,

Odhiambo JA, Klatser PR: A comprehensive comparison of Ziehl-Neelsen and

fluorescence microscopy for the diagnosis of tuberculosis in a resource-poor

urban setting. Int J Tuberc Lung Dis 2003, 7(12):1163-1171.

27. Hazbon MH: Recent advances in molecular methods for early diagnosis of

tuberculosis and drug-resistant tuberculosis. Biomedica 2004, 24 Supp 1:149-162.

28. Mitarai S, Kurashima A, Tamura A, Nagai H, Shishido H: Clinical evaluation of

Amplicor Mycobacterium detection system for the diagnosis of pulmonary

mycobacterial infection using sputum. Tuberculosis (Edinb) 2001, 81(5-6):319-

325.

29. Catanzaro A, Perry S, Clarridge JE, Dunbar S, Goodnight-White S, LoBue PA,

Peter C, Pfyffer GE, Sierra MF, Weber R et al: The role of clinical suspicion in

evaluating a new diagnostic test for active tuberculosis: results of a multicenter

prospective trial. Jama 2000, 283(5):639-645.

135

Table 1. Sensitivities, specificities and likelihood ratios of PCR-AG, PCR dot-Blot, ZN

and Culture.

Total number of suspects

N=277

Laboratory

Results and

Performance of

methods

N=128

Non-TB

N=149

Positive 77 1 Performance

of ZN Negative 51 148

SE SP LR+ LR-

60% 99%

60 0.4

Positive 111 1 Performance

of ZN plus

Culture

Negative 17 148

SE SP LR+ LR-

87% 99% 47 0.07

Positive 109 22 Performance

of ZN plus

PCR dot -

blot

Negative 19 127

SE SP LR+ LR-

85% 84% 5.65 0.12

Positive 93 35 Performance

of ZN plus

PCR-AG

Negative 35 114

SE SP LR+ LR-

72% 76% 3.11 0.30

SE: Sensivity, SP: Specificity, LR+: Positive Likelihood Ratio, LR-: Negative Likelihood Ratio.

The performance of tests was calculated using specific formulas utilized by parallel tests: sensitivity (SE)

of ZN with culture: (SE

zn +

culture) –

(SE

zn .X

culture

), specificity (SP) of ZN with culture: SP

zn .X

culture

predictive values (PV) and likelihood ratio (LR), according to literature [22].

136

Table 2. Costs in US$ of TB diagnosis in Brazil.

A. Health service costs

Staff

Number

Salaries of all

staff per year

(US$)

Staff Cost per

day

(US$)

Time spent

to have

access for

result

(days)

ZN 2 9,260 39 1

ZN plus

Culture

2 9,260 116 3

ZN plus PCR-

2 9,260 77 2

ZN plus PCR-

dot-blot

2 9,260 77 2

B. Labour costs

Equipment

(US$)

Annualisation

Years

Running costs

per 1000

suspects

(US$)

Running

costs per

examination

(US$)

4,333

5 1,003 1.00

ZN plus

Culture

22,667 5 12,333 12.33

ZN plus PCR-

26,667 5 11,167 11.16

ZN plus PCR-

dot-blot

26,667 5 12,833 12.83

C. Estimated costs incurred by patients, including costs for travel, food and

income loss

(US$)

ZN plus

Culture

(US$)

ZN plus PCR-

(US$)

ZN plus

PCR dot-blot

(US$)

Travel 800 2,400 1,600 1,600

Food 3,333 10,000 6,667 6,667

Income Loss 5,833 17,500 11,667 11,667

Total patients

Cost

9,967 29,900 19,933 19,933

Microscopic

Microscopic and Laminar Flow Cabinets

, c

Thermocycler, reader, Centrifuge and Laminar Flow Cabinets

Income loss of patients was calculated from monthly salary base of Brazil (U$117) and was based on proportional days spent by patients for to have

access to the result of each laboratory procedure. Travel cost was considered U$0.8 one way. Food was considered U$3.3 per meal. Base salary in Brazil

was considered (U$5.83 per day). Staff costs in the laboratory were based on proportional days spent in each laboratory procedure. Costs of consumables

and equipment were provided by the program as well as by manufacturer. We annualized the capital cost of the equipment for 5 years. For PCR capital

costs included the cost of thermo cycler, reader and centrifuge. Building costs were not included. Patient costs were estimated using the average of two

trials for PCR procedure and three trials for ZN and culture procedures.

137

Table 3A. Costs (in US$) of screening 1000 TB suspects comparing ZN, ZN plus

Culture, ZN plus PCR-AG, ZN plus PCR dot- blot.

3A. Health Service Costs

ZN ZN plus Culture ZN plus PCR-AG ZN plus PCR

dot-blot

Total cases TB 128 128 128 128

Cost Component per 1000

TB suspects

(US$) (US$) (US$) (US$)

Laboratory Cost

Labour Costs 1,400 3,283 11,400 US$13,067

Investment costs 72 1,349 258 258

Running costs 1,003 12,333 11,167 12,833

Total Laboratory Cost 2,475 US$16,966 22,825 26,158

Staff per year

Laboratory technician 2,860 2,860 2,860 2,860

Clinical Laboratory and

Molecular Biology

technologists

6,400 6,400 6,400 6,400

Cost staff per strategy per

day

39 116 77 77

Total cost Staff per time

spent per 1000 samples

38,583

115,750 77,167 77,167

Total Treatment Costs

(inpatients plus

outpatients)

421 910 665 665

Total Health Service Costs 41,479 132,400 100,657 103,926

Patient Cost

Travel 800 2,400 1,600 1,600

Food 3,333 10,000 6,667 6,667

Income Loss 5,833 17,500 11,667 11,667

Total Patient Costs 9,967 29,900 19,933 19,933

Total Screening Costs 51,446 162,300 120,591 123,859

For each procedure there were attributed costs based on procedures costs of Brazilian Public Health System. (For ZN U$ 1.4 and Culture U$ 1.9) ,and

from CDCT/FEPPS (for PCR-AG U$ 10 and PCR dot-blot U$ 11.7), assuming investment laboratory equipment for 5 years ;

Staff salary was considered for laboratory technician US$2860 per year, for Laboratory technologist US$6400 per year.Staff costs in the laboratory

were based on proportional days spent in each laboratory procedure;

The days of internation in the hospital was considered the same days spent in each laboratory procedure. The time spent in each laboratory procedure to

have access for the result of the laboratory technique were assumed to be one day for ZN, two days for ZN plus in house PCR (PCR-AG and PCR dot

blot), and 3 days for ZN plus culture. Total treatment included clinical officer and hospital costs, assuming cost per pill U$ 0.22, using 3 pills for day,

during 180 days, hospital room costs US$ 4.16/day , costs with salary of staff clinical, clinical consult cost US$2,52 per patient, nurse clinical consult

US$2,52 per patient. Assuming that during the treatment (4 months) were performed 4 ZN e 4 RX, following Brazilian recommendations for treatment

[17];

travel, food and income loss for strategies ZN was considered 1 days, for strategies ZN plus Culture was considered 3 days, for ZN plus PCR-AG and

ZN plus PCR dot-blot 2 days. The health service costs analysis was based on processing 50 ZN slides, 86 samples for each in house PCR and 14 cultures

per day. ZN plus culture and in house PCR were performed by two trained staff, respectively. Costs of chest physicians were considered the same for all

strategies. Running costs were calculated from investments required to examine 1000 smears.

138

Table 3 B1. Costs (in US$) of treatment of 1000 TB suspects comparing ZN, ZN plus

Culture, ZN plus PCR-AG, ZN plus PCR dot- blot.

3B1. Treatment Costs

ZN ZN plus

Culture

ZN plus

PCR-AG

ZN plus PCR

dot-blot

Total cases TB diagnosed 77 111 93 111

Cost of Treatment per 1000 TB

suspects

(US$) (US$) (US$) (US$)

Total Treatment Costs 421 910 665 665

Costs related to the treatment of

outpatients

Antibiotics 88 88 88 88

Staff

Nurse 6,400 6,400 6,400 6,400

Clinical physician 6,400 6,400 6,400 6,400

Cost of staff per strategy per day 53 160 107 107

Health Service Costs

Clinical Physician Consult 3 8 5 5

Nurse Consult 3 8 5 5

Cost of consult per strategy per

day

5 15 10 10

RX Staff

Radiologist 6,400 6,400 6,400 6,400

RX technician 2,860 2,860 2,860 2,860

Costs of RX staff per strategy per

day

39 116 77 77

Diagnostic Service

ZN (6 times) 8 8 8 8

RX (6 times) 19 19 19 19

Costs of diagnostic service per

strategy

27 82 55 55

Total cost related to the treatment

of outpatients per strategy

213 461 337 337

The days of internation in the hospital was considered the same days spent in each laboratory procedure. The time spent in each

laboratory procedure to have access for the result of the laboratory technique were assumed to be one day for ZN, two days for ZN

plus in house PCR (PCR-AG and PCR dot blot), and 3 days for ZN plus culture.

Total treatment included clinical officer and hospital costs, assuming cost per pill U$ 0.22, using 3 pills for day, during 180 days,

hospital room costs US$ 4.16/day , costs with salary of staff clinical, clinical consult cost US$2,52 per patient, nurse clinical consult

US$2,52 per patient.

Assuming that during the treatment (4 months) were performed 4 ZN e 4 RX, following Brazilian recommendations for treatment

[17];

Staff salary was considered for clinical physician, nurse and radiologist were US$6400 per year, for RX technician was US$2860 per

year. The days of internation in the hospital was considered the same days spent in each laboratory procedure.

139

Table 3 B2. Costs in US$ of treatment of 1,000 TB suspects comparing ZN, ZN plus

Culture, ZN plus PCR-AG, ZN plus PCR dot- blot.

3B2. Treatment Costs

ZN plus

Culture

ZN plus

PCR-AG

ZN plus PCR

dot-blot

Costs related to the treatment of

inpatients

(US$) (US$) (US$) (US$)

Antibiotics 88 88 88 88

Staff

Nurse 6,400 6,400 6,400 6,400

Clinical physician 6,400 6,400 6,400 6,400

Cost of staff per strategy per day 53 160 107 107

Health Service Costs

Clinical Physician Consult 3 8 5 5

Nurse Consult 3 8 5 5

Cost of consult per strategy per

day

5 15 10 10

RX Staff

Radiologist 6,400 6,400 6,400 6,400

RX technician 2,860 2,860 2,860 2,860

Costs of RX staff per strategy per

day

39 116 77 77

Diagnostic Service

ZN (4 times) 6 6 6 6

RX (4 times) 13 13 13 13

Costs of diagnostic service per

strategy

19 57 38 38

In patient evaluation

Isolated hospital room per day 4 12 8 8

Total cost related to the treatment

of inpatients per strategy

208 448 328 328

The days of internation in the hospital was considered the same days spent in each laboratory procedure. The time spent in each laboratory procedure to

have access for the result of the laboratory technique were assumed to be one day for ZN, two days for ZN plus in house PCR (PCR-AG and PCR dot

blot), and 3 days for ZN plus culture.

Total treatment included clinical officer and hospital costs, assuming cost per pill U$ 0.22, using 3 pills for day, during 180 days, hospital room costs

US$ 4.16/day , costs with salary of staff clinical, clinical consult cost US$2.52 per patient, nurse clinical consult US$2,52 per patient. Assuming that

during the treatment (4 months) were performed 4 ZN e 4 RX, following Brazilian recommendations for treatment [17].

Staff salary was considered for clinical physician, nurse and radiologist were US$6400 per year, for RX technician was US$2860 per year. The days of

internation in the hospital was considered the same days spent in each laboratory procedure.

140

Table 4 Cost-effectiveness of screening 1000 TB suspects comparing ZN, ZN plus

Culture, ZN plus PCR-AG, and ZN plus PCR dot- blot.

Cost Component per 1 000 TB suspects

ZN ZN plus

Culture

ZN plus

PCR-AG

ZN plus PCR

dot-blot

Total number

correctly

diagnoses cases

of TB

111

109

(US$) (US$) (US$) (US$)

Total Screening

Costs

51,446 162,300 120,591 123,859

Total Health

Service Costs 41,479 132,400 100,657 103,926

Total Patient

Costs

9,967 29,900 19,933 19,933

Cost per correctly diagnosed case of TB

Screening

Costs

668 1462 1297 1136

Health Service

Costs

539 1193 1082 953

Patient Cost 129 269 214 183

141

Table 5. Costs involved in US$ and cost-effectiveness of screening 1000 TB suspects

and costs of return of false negatives patients for society

ZN ZN plus Culture ZN plus PCR-

ZN plus PCR

dot-blot

A. Cost per case correctly diagnosed and treated

Total number correctly

diagnoses cases of TB

77 111 93 109

False positives 1 1 35 22

(US$) (US$) (US$) (US$)

Total Screening Costs 51,446 162,300 120,591 123,859

Cost of treating all

correctly diagnosed

cases

32,421 10,992 61,886 72,534

Cost of treating all

falsely diagnosed cases

421 910 23,291 14,640

Cost per case correctly

diagnosed and treated

1,081 2,359 1,608 1,611

B. Cost per case incorrectly diagnosed and non treated

Total number correctly

diagnoses cases of non

148 148 114 127

False negatives 51 17 35 19

Estimative of false

negatives in 1000 TB

suspects

398 133 273 148

Estimative of

transmission of false

negatives in 1000 TB

suspects

3980 1330 2730 1480

(US$) (US$) (US$) (US$)

Cost of all falsely

diagnosed non cases

2,624 2,759 4,221 2,353

Cost of return all false

negatives to health

service

204,980 215,555 239,740 183,854

Cost of false negatives

per patient

51 162 121 124

Total Costs 256,478 378,017 450,451 307,837

Cost per case

incorrectly diagnosed

and non treated

4,985 2,329 3,735 2,485

Cost of treating one case is US$421, US$910, US$665, for ZN, ZN plus Culture, and ZN plus PCR-AG and ZN plus PCR-dot-blot,

respectively .

including treatment of falsely diagnosed cases,

assuming that one false negative transmit TB to 10 individuals [16].

142

Table 6. Sensitivity analysis based on screening of 1000 suspects comparing ZN, ZN plus Culture, ZN plus PCR-AG, ZN plus PCR

dot- blot.

assuming that PCR dot-blot could be decreased running costs in 22%

Cost per correctly diagnosed case

of TB

Cost per case correctly

diagnosed and treated,

including treatment of falsely

diagnosed cases

Cost per case incorrectly

diagnosed and non treated

Component Current

situation

Adjustment ZN plus

Culture

ZN plus

PCR

dot-blot

Ratio ZN plus

Culture

plus

PCR

dot-

blot

Ratio ZN plus

Culture

ZN plus

PCR

dot-blot

Ratio

(US$) (US$) (US$) (US$) (US$) (US$)

46% No

adjustment

1,462 1,136 0.78 2,380 1,936 0.81 2,554 U$2,424 0.95

10% 6,726 5,227 0.78 10,949 8,906 0.81 1,495 1,215 0.81

20% 3,363 2,614 0.78 5,474 4,453 0.81 1,653 1,341 0.81

40% 1,681 1,307 0.78 2,737 2,226 0.81 2,095 1,689 0.81

prevalence

60% 1,121 871 0.78 1,825 1,484 0.81 2,859 2,283 0.80

Sensitivity

PCR dot-blot

85%

95%

1,330

1,015

0.76

2,166

1,730

0.80

3,098

2,523

0.81

Specificity

PCR dot-blot

84%

95%

1,143

872

0.76

231

242

1.00

2,662

2,167

0.81

PCR dot-

blot running

costs

U$12833

U$10000

1,192

927

0.78

2,380

910

0.38

2,554

2,368

0.93

143

5 Discussão

5.1 Dados Epidemiológicos da população estudada

Neste estudo se observou uma prevalência elevada de Tuberculose

Pulmonar ativa (46%) com taxa de co-infecção HIV/TB (27%), como é

apresentado em todos os artigos que compõem esta tese. Estes dados estão de

acordo com os dados relatados pelo Controle do Programa de Porto Alegre e

estimados pela OMS, e estão acima dos dados relatados pelo Ministério da

Saúde do Brasil, provavelmente em função das deficiências nacionais do

sistema de notificação.(Brasil, 2005; ECE/CGVS, 2005; WHO, 2006).

5.2 Análise de Sinais e Sintomas Clínicos associados em

pacientes infectados ou não por HIV

Como foi discutido e mostrado através da tabela 1 no artigo 1 e no artigo

3 os mais consistentes fatores preditores para Tuberculose Pulmonar foram a

cultura positiva e Raio-X compatível com doença ativa, mas nos pacientes

infectados pelo HIV isto não foi significante, como é mostrado na tabela 1 do

artigo 1. Estes dados foram confirmados pela literatura uma vez que pacientes

com infecção por HIV muitas vezes apresentam resultados radiológicos atípicos

(Schijman et al., 2004).

144

5.3 Sensibilidades e Especificidades das técnicas de PCR in

house para o diagnóstico de TB pulmonar

Os artigos 1, 2 e 3 apresentam dados que discutem a performance das

técnicas de PCR in house (PCR dot-blot (método colorimétrico) and PCR-AG

(método não colorimétrico),com diferentes olhares, um mais metododológico no

sentido de comparar diferentes métodos de detecção para o PCR in house,

outro no sentido de avaliar a utilização da técnica de PCR in house com as

técnicas convencionais de diagnóstico e um mais clínico, com a expectativa de

avaliar a utilização da técnica de PCR in house com a suspeita clínica do

médico.

O artigo 1, com olhar metodológico, aponta os resultados da comparação

das metodologias de PCR in house, estratificando esta avaliação em diferentes

grupos. Os resultados do artigo 1, mostrados na tabela 2, apontam que as

sensibilidades do PCR dot-blot variaram de 63% a 76% e apresentaram

resultados melhores daqueles obtidos com o PCR-AG, técnica em que as

sensibilidades variam de 42% a 47%. Em relação aos pacientes com infecção

por HIV ou sem infecção as sensibilidades do PCR dot-blot variaram de 72% a

75% e apresentaram uma tendência a serem mais altas que as obtidas com

PCR-AG de 42% a 43%, como mostra a tabela 3 do artigo1.

Em relação aos pacientes com suspeita de Tuberculose Pulmonar e com

microscopia direta pela coloração de Ziehl-Neelsen (ZN) negativos infectados ou

não por HIV, a sensibilidade do PCR (PCR dot-blot) variou de 61% a 68%,

sendo estes dados comparáveis aos dados relatados em recente meta-análise

145

descrita por Sarmiento (32% to 92%), e também comparável a estudos

realizados em países em desenvolvimento usando técnicas de PCR in house

(40% a 64%), e usando metodologias automatizadas (52% a 76%)(Kwiatkowska

et al., 1999; Araj et al., 2000; Su et al., 2000; Kambashi et al., 2001; Sarmiento et

al., 2003; Ribeiro et al., 2004; Fegou et al., 2005).

Por outro lado, em relação aos pacientes com suspeita de TB pulmonar e

ZN negativos, avaliados especificamente no artigo 3, estudo cujo enfoque foi

clínico, na avaliação da técnica de PCR dot-blot foi determinada uma moderada

sensibilidade (SE) de (65%) e especificidade (SP) de (83%). A sensibilidade

descrita foi similiar ao descrito pela literatura para técnicas de PCR, que

apresentam variações de sensibilidade de 61% a 83% e variações de

especificidade de 84% a 92% para pacientes com TB pulmonar e ZN negativos

(Sarmiento et al., 2003; Laifer et al., 2004; Mbulo et al., 2004). Entretanto, as

especificidades foram mais baixas do que as descritas para países

industrializados (>95) (Goessens et al., 2005).

No artigo 1, a tabela 2 mostra que a sensibilidade do PCR dot-blot foi

mais alta entre os pacientes não tratados previamente em comparação com

aqueles tratados previamente, sendo estes resultados estatisticamente

significativos. Resultados semelhantes foram obtidos com as técnicas de

microscopia direta por ZN e de Cultura, sugerindo que no grupo não tratado

previamente, tem-se uma concentração de micobatéria mais alta nas amostras

clínicas, o que pode ser crucial para a melhora no desempenho das técnicas. O

status de HIV não foi significante na avaliação das sensibilidades. Estas

146

sensibilidades foram comparadas a estudos realizados em países em

desenvolvimento, com variações de sensibilidade de (40% a 64%) para técnicas

de PCR in house e comparável as variações de sensibilidade encontradas nos

estudos de avaliação de desempenho utilizando testes moleculares

automatizados (52% to 76%) (Kwiatkowska et al., 1999; Araj et al., 2000; Su et

al., 2000; Kambashi et al., 2001; Sarmiento et al., 2003; Ribeiro et al., 2004;

Fegou et al., 2005).

As especificidades das técnicas de PCR in house variaram de 76% para o

PCR-AG a 87% para PCR dot-blot, e como descrito anteriormente, foram

similares ao descrito anteriormente na literatura (77% to 92%) e mais baixa do

que descrito para os métodos automatizados (> 95%) (Chin et al., 1995;

Dalovisio et al., 1996; Almeda et al., 2000; Al Zahrani et al., 2001; Goessens et

al., 2005). No presente estudo, através da análise da curva ROC (Receiver

operator characteristic) das técnicas, que permite avaliar a acurácia global de

um teste, e a acurácia nesta situação é descrita como a área da curva ROC.

Nesta avaliação, a PCR dot-blot mostrou performance similar a cultura em todos

os pacientes com suspeita de Tuberculose Pulmonar analisados, infectados ou

não por HIV. Mesmo a cultura apresentando melhor desempenho na avaliação

realizada no artigo 1, este estudo mostrou que a PCR in house pode oferecer

um melhoramento na exclusão de Tuberculose Pulmonar em pacientes com

suspeita de Tuberculose Pulmonar, não previamente tratados e atendidos em

hospitais. Entre as técnicas de in house PCR, a PCR dot-blot parece ser mais

apropriada à rotina, uma vez que este método oferece maior acurácia,

147

provavelmente, em razão da utilização de uma etapa de hibridização, que pode

acarretar no aumento da sensibilidade da detecção. Além disso, oferece maior

rapidez, facilidade de uso, biossegurança e é custo-efetivo, como foi

amplamente discutido no artigo 4 (Tansuphasiri et al., 2002).

5.4 Dificuldades no diagnóstico de TB pulmonar em pacientes

infectados por HIV

Como foi amplamente discutido no artigo 1, se observou uma menor

sensibilidade na microscopia direta (baciloscopia) em pacientes infectados por

HIV (43%) na análise do escarro espontâneo, em acordo com o previamente

descrito pela literatura (van Cleeff et al., 2005). Como mencionado por Van Cleef

et. al. (2003) e Kivihya-Ndugga et.al.(2004), neste estudo a sensibilidade da

baciloscopia direta foi significantemente mais baixa entre pacientes com a co-

infecção HIV/TB, mas a sensibilidade de ambos PCR in house utilizados neste

estudo não foram influenciadas pelo status do HIV, demonstrando que as

técnicas moleculares podem representar uma possibilidade no diagnóstico de

TB Pulmonar em pacientes infectados pelo HIV. (Kivihya-Ndugga et al., 2004;

van Cleeff et al., 2005).

5.5 Análise da Suspeita Clínica do Médico (probabilidades pré-

teste) de diagnóstico de Tuberculose Pulmonar

Alguns estudos têm mostrado que a probabilidade pré-teste estimada

pelos médicos ao analisar o paciente, pode influenciar no desempenho das

148

técnicas moleculares (Lim et al., 2000; Cafrune et al., 2006). A fim de avaliar

esta hipótese, no artigo 3, esta questão foi amplamente discutida e analisada

com relação ao desempenho das técnicas convencionais e técnicas moleculares

in house , levando em consideração a probabilidade pré-teste estimada pelos

pneumologistas no momento da primeira consulta. Os pacientes com sintomas e

sinais consistentes com Tuberculose Pulmonar, com dados clínicos completos e

que apresentaram microscopia direta (baciloscopia) ZN negativa, foram

estratificados em relação a categorias de risco (Alta, Intermediária e Baixa) de

Probabilidade Pré-testes (PP). A prevalência de Tuberculose Pulmonar Ativa nas

relativas categorias foi de 67,4% (31/46); 24% (6/25) e 7,5% (6/80),

respectivamente (p<0,05), em acordo com descrito pela literatura(Catanzaro et

al., 2000). Nestes grupos a proporção de pacientes com Raio-X sugestivo de

Tuberculose Pulmonar foi de 0% para a baixa, 24% para a intermediária e 78%

para a alta (p<0,001), demonstrando que técnicas de diagnóstico mais sensíveis

podem ser fundamentais para o diagnóstico de pacientes com baixa e

intermediária suspeita clínica

5.6 O Impacto da Associação das técnicas de PCR in house com

a técnica de microscopia direta (baciloscopia) para o

diagnóstico de TB pulmonar

149

Os testes em paralelo, geralmente, são solicitados quando o clínico

necessita de um diagnóstico rápido, com a finalidade de aumentar a

sensibilidade da detecção da doença.

No artigo 2, foi usada esta estratégia de diagnóstico sugerindo que para

uma maior eficiência das técnicas in house, estas devam ser utilizadas em

conjunto com os testes bacteriológicos para o diagnóstico de TB pulmonar.

Em todos os pacientes a associação de técnicas trouxe um ganho na

acurácia das técnicas convencionais e das moleculares , mas principalmente

para os pacientes não infectados por HIV, e não tratados previamente para TB

pulmonar.

O desempenho da microscopia direta associada à cultura foi melhor para

os pacientes não previamente tratados para TB pulmonar, como pode ser

observado na tabela 1, do artigo 2. A sensibilidade apresentada neste grupo foi

de 94% e a especificidade de 99% , com likelihood ratio (LR) positiva de 94,4 e

LR negativa de 0,06. Também para os pacientes HIV soronegativos, foi

observado um razoável desempenho, com sensibilidade de 95% e

especificidade de 99% , com likelihood ratio (LR) positiva de 47,8 e LR negativa

de 0,05, como pode ser observado na tabela 2.

Por outro lado o desempenho da microscopia direta associada a PCR dot-

blot foi similar aos resultados obtidos para a associação da microscopia direta

associada a PCR dot-blot. Em pacientes não previamente tratados para TB

pulmonar, como pode ser observado na tabela 1 do artigo 2. A sensibilidade

apresentada neste grupo foi de 90% e a especificidade de 86% , com likelihood

150

ratio (LR) positiva de 6,52 e LR negativa de 0,11. Também para os pacientes

HIV soronegativos, tivemos um razoável desempenho, com sensibilidade de

92% e especificidade de 84% , com likelihood ratio (LR) positiva de 5,8 e LR

negativa de 0,10, como pode ser observado na tabela 2.

Entretanto quando estratificamos a análise e selecionamos os pacientes

não tratados previamente para TB pulmonar e HIV soronegativos, a

sensibilidade da microscopia associada a PCR dot-blot chega a 93% e o LR

negativo chega a 0,08.

Sendo assim, o artigo 2 confirmou e demonstrou que o PCR in house

(PCR dot-blot) em combinação com ZN é bastante confiável para o diagnóstico

rápido e acurado da TB pulmonar, entre pacientes atendidos em hospitais em

países em desenvolvimento. Além disto, os métodos de PCR in house são

menos caros do que os métodos automatizados e podem ser introduzidos na

rotina desde que sejam realizados estudos de custo-efetividade, levando em

consideração as características clínicas e radiológicas dos pacientes, a fim de

melhor estimar as probabilidades de TB em nosso meio.

Embora a rotina de diagnóstico de TB pulmonar utilize três espécimes

para identificar TB pulmonar (ATS, 2000), nesta tese foi avaliada uma única

amostra de escarro espontâneo, o que pode ser uma alternativa de diagnóstico

quando em associação com a baciloscopia direta em hospitais onde ás vezes é

difícil obter múltiplas espécimes respiratórias dos pacientes. Nossos dados

indicam que a estratégia de combinar as técnicas de diagnóstico pode aumentar

a qualidade do diagnóstico e reduzir o tempo de identificação das infecções

151

causadas pelas micobactérias. A combinação de testes bacteriológicos e de

testes moleculares apresenta um grande incremento da sensibilidade e baixa

razão de verosimilhança (likelihood ratio) para o diagnóstico de TB pulmonar,

principalmente na associação de ZN com PCR dot-blot.

5.7 O Impacto das diferentes taxas de prevalência de

Tuberculose Pulmonar no desempenho da técnica de PCR in

house (PCR dot-blot) utilizada em associação com a técnica de

microscopia direta (baciloscopia) para o diagnóstico de TB

pulmonar

Diferentes taxas de prevalência, também podem afetar o desempenho de

testes laboratoriais, baseado neste fato foram simuladas e discutidas diferentes

taxas de prevalência no artigo 2 para TB pulmonar. Estes dados demostraram

que o uso da microscopia direta por ZN em paralelo com o PCR dot-blot

alcançou similares valores preditivos positivos e negativos àqueles observados a

microscopia direta por ZN utilizada em paralelo com a cultura, entre HIV

soropositivos e HIV soronegativos, como mostra a tabela 4 do artigo 2.

A microscopia direta por ZN associado à cultura apresentou o melhor

desempenho. Em regiões com prevalências de TB variando de 5 a 10%,

usualmente, em unidades de atendimento ambulatoriais com pacientes que

apresentam tosse por mais de três semanas, ou seja, pacientes considerados

sintomáticos respiratórios de acordo com a OMS, o VPN para a técnica de ZN

associada ao PCR dot-blot, variou de 99 a 100%. Em unidades de saúde, onde

152

as taxas de prevalência variam de 15% a 20%, usualmente hospitais gerais ou

centros de referência ambulatoriais, o VPN desta estratégia variou de 98 a 99%.

Em hospitais de referência de TB, onde a prevalência de TB varia de 30% a

50%, entre HIV soronegativos, o VPN de ZN em paralelo com PCR dot-blot foi

de 96 a 94%, mas entre HIV soropositivos este parâmetro foi reduzido de 93 e

89%.

5.8 Dificuldades no diagnóstico de TB pulmonar em pacientes

com baciloscopia negativa (ZN negativo)

A acurácia das técnicas moleculares in house, tem sido avaliadas em

poucos estudos, a maioria dos estudos de avaliação dos desempenhos das

técnicas são realizados em amostras ZN positivas, em países em

desenvolvimento (Perkins and Kritski, 2002). Como mostra a Tabela 2, do artigo

3, quando estratificado pela baciloscopia negativa as sensibilidades de todas as

técnicas (convencionais e moleculares) foram menores, entretanto a

sensibilidade do PCR dot-blot e a alta suspeita clínica, quando esta é utilizada

como um teste diagnóstico, foram similares à sensibilidade encontrada para

cultura. Estes dados estão de acordo com dados descritos em recente meta-

análise que apresenta sensibilidades para ZN negativos que variam de 32% a

92%, usando as técnicas de PCR e são similares a estudos que utilizam

técnicas de PCR in house (Araj et al., 2000; Kambashi et al.,2001; Sarmiento et

al., 2003). Nossos dados demonstram que a técnica de PCR dot-blot, com valor

preditivo negativo (VPN) de 86 foi similar ao VPN da Cultura 89 (p=0,067)

153

podendo, desta forma, oferecer um acréscimo no diagnóstico de exclusão de TB

pulmonar e no manejo clínico de pacientes ZN negativos, não tratados

previamente e atendidos em hospitais em regiões de considerável prevalência

de TB e HIV.

5.9 O Impacto da suspeita Clínica do médico na avaliação do

desempenho das técnicas de PCR in house no diagnóstico de

TB pulmonar

Como apresentado no artigo 3, a PCR dot-blot parece oferecer um ganho

no valor preditivo negativo (VPN), e na razão de verossimilhança (RV), em

pacientes com baixa e alta suspeita clínica (probabilidade pré-teste). A utilidade

de testes de PCR para pacientes com alta e baixa suspeita clínica também foi

demonstrada em outros estudos (Catanzaro et al., 2000; Lim et al., 2000; Lim et

al., 2003). Como mostra a tabela 2 do artigo 3, em pacientes com ZN negativos

com suspeita de TB pulmonar, quando se associa a alta suspeita clínica com a

técnica de PCR dot-blot, a sensibilidade chega a 91% e o VPN a 90% em

pacientes não previamente tratados para TB pulmonar, similar ao descrito

utilizando a análise de um método molecular comercial em 214 pacientes

(Piersimoni et al., 2005). Considerando o status de HIV e comparando a

sensibilidade e o VPN da PCR com a alta suspeita clínica de diagnóstico entre

aqueles indivíduos não previamente tratados e aqueles que foram tratados no

passado, os resultados foram respectivamente: 91%, 90%, and 89%, 88% para

154

o grupo de pacientes HIV soropositivos e 93%, 92% e 83%, 80% para o grupo

de pacientes HIV soronegativos.

No artigo 3, quando utilizamos a PCR dot-blot em paralelo com a alta

probabilidade pré-teste (ou seja, a alta suspeita clínica de diagnóstico de TB

pulmonar) o diagnóstico parece oferecer um mais alto VPN em pacientes com

baciloscopia negativa com suspeita de TB pulmonar, que não foram

previamente tratados e que são HIV soronegativos, como descrito por outros

estudos (Catanzaro et al., 2000; Lim et al., 2000; Lim, Mukhopadhyay et al.,

2003).

Os pacientes não previamente tratados e HIV soronegativos

apresentaram altos valores de sensibilidade (93%) e de VPN (92%), sendo este

dados similares àqueles descritos por Piersimoni et al, usando técnicas

automatizadas em 214 pacientes suspeitos de TB pulmonar (Piersimoni et al.,

2005).

5.10 Falsos positivos e negativos nas técnicas de PCR in house

A baixa sensibilidade de ambas as técnicas de PCR in house, descritas

em todos os artigos desta tese, pode ser devido à presença em parte de

inibidores da PCR que permanecem no espécime depois do processo de

extração e/ou devido a um pequeno número de micobactérias não distribuídas

homogeneamente na amostra a ser testada ou abaixo do limite de detecção do

teste de PCR 50 Unidades Formadoras de Colônias (UFC) (Sperhacke et al.,

155

2004). Como pode ser evidenciado na tabela 2 do artigo1, entre os 73 falsos

negativos da metodologia de PCR-AG e entre os 33 falsos negativos da

metodologia de PCR dot-blot de todo o grupo analisado, 20/73 (27%) e 3/33

(9%), respectivamente estavam abaixo do limite de detecção do PCR in house.

A proporção de inibidores foi de 1,9% para o PCR in house. Estes dados foram

similares aos relatados por outros estudos usando PCR in house (0,85% até 5%)

(Ieven and Goossens, 1997; Almeda et al., 2000; Piersimoni et al., 2002;

Goessens et al., 2005; Tarhan et al., 2005). O uso do elemento de inserção

IS6110 como alvo para a PCR é também um colaborador para a diminuição da

sensibilidade, pois as cepas de MTB sem o elemento de inserção têm sido

relatadas. Todavia, estudos de DNA fingerprinting feitos no Brasil e

especialmente no RS, não detectaram a presença destas cepas. Além disso, a

grande maioria das cepas apresenta um alto número de cópias de IS6110

(Suffys et al., 2000; Cafrune et al., 2006).

A baixa especificidade da PCR, descrita nos artigos 1, 2 e 3, pode ser

devido ao contato dos pacientes estudados com indivíduos sintomáticos

respiratórios. De fato, 18/22 dos falsos positivos para a metodologia de PCR dot-

blot (82%) relataram contato prévio com tuberculosos. Além disso, alguns

pacientes apresentaram prévia infecção, portanto é de se esperar que DNA

possa ser detectado nas suas amostras respiratórias. A diminuição da

especificidade foi similar ao citado pela literatura usando PCR in house.

(Dilworth et al., 1996; Cohen et al., 1998).

156

Resultados falso-positivos, por outro lado, também podem ser gerados na

fase pré-analítica, isto é, antes da preparação da amostra. O risco pode ser

reduzido no momento da coleta da amostra, com a utilização de sistemas

fechados (Monovette

, Vacutainer

, para coleta de sangue). Uma vez que

para amostras de urina, biópsias, etc, este tipo de coleta é difícil, o laboratório

deverá requisitar amostras separadas somente para a análise por PCR e rejeitar

amostras inadvertidamente abertas em outro local (Valentine-Thon, 2002).

Resultados falso-negativos podem estar relacionados às variações nas

seqüências dos primers, às pequenas quantidades de amostra clínica para o

isolamento do DNA, e mais freqüentemente, à presença de substâncias que

inibem a DNA polimerase, como heparina, hemoglobina, etanol, fenol, SDS,

EDTA e acetato de sódio (Valentine-Thon, 2002). A presença de heparina e

hemoglobina em diferentes amostras clínicas, em sua maioria respiratórias

trouxeram enormes problemas na análise de resultados falso-negativos.

Mecanismos de prevenção e detecção de inibição têm sido implementados nos

últimos anos, entre eles, pode-se citar a utilização de controles positivo e interno

durante o processamento da amostra clínica (Niesters, 2002; Stocher et al.,

2002). Alguns estudos propõem a utilização de controles internos adicionados

juntamente com as amostras clínicas, antes da extração, permanecendo

presente durante todo o procedimento. Este recurso, além de identificar

inibidores, possibilita monitorar a eficácia do método da preparação da amostra

(Eisenach et al., 1991; Andersen et al., 1993; deWit et al., 1993; Nolte et al.,

1993; Kolk et al., 1994; Rosenstraus et al., 1998; Noordhoek et al., 2004). Há

157

alguns anos foi disponibilizado no mercado um sistema de PCR em tempo real,

no qual o risco de contaminação cruzada advinda de produtos amplificados é

eliminado, entretanto estudos de custo-efetividade deste tipo de metodologia

devem ser realizados (Torres et al., 2000; Miller et al., 2002; Niesters, 2002;

Cleary et al., 2003)

5.11 Análise de custo-efetividade das técnicas de PCR in house

No artigo 4, analisamos o custo-efetividade das técnicas de PCR in

house. Com a finalidade de executar esta análise, primeiramente, foram

levantados os custos relativos aos serviços de saúde e os custos relativos aos

gastos dos pacientes, descritos amplamente no artigo 4.

Um modelo de decisão analítico foi desenvolvido usando o software Excel

7.0 com a colaboração de Paul Klatzer, de The Netherlands do Royal Tropical

Institute (KIT), KIT Biomedical Research, que nos enviou um modelo para

análise em planilha de EXCEL, com base na literatura (Petitti, 2000). Este

modelo foi utilizado para comparar a rotina de procedimentos de diagnóstico de

TB pulmonar usando o método de microscopia direta por coloração com ZN em

escarros espontâneos com uma combinação de preocedimentos usando a

microscopia direta por coloração ZN associado à Cultura, a microscopia direta

por coloração ZN associado ao PCR-AG e a microscopia direta por coloração

ZN associado ao PCR dot-blot. Os custos de cada estratégia foram obtidos a

partir da referência do Sistema Único de Saúde (SUS). Os valores de custo-

158

efetividade foram expressos como: a) custo por caso de TB pulmonar

diagnosticado corretamente; b) custo por caso de TB pulmonar corretamente

diagnosticado e tratado, incluindo tratamento de casos incorretamente

diagnosticados; c) custo por caso de TB pulmonar incorretamente diagnosticado

e não tratado. Uma análise de sensibilidade, também, foi realizada para avaliar

se fatores ambientais ou laboratoriais poderiam afetar os valores de custo-

efetividade.

Neste estudo, foi encontrado menor índice de custo-efetividade usando o

a microscopia direta por coloração ZN em associação com o PCR, por caso

corretamente diagnosticado, quando comparado com o descrito em outros

modelos utilizando técnicas de PCR automatizadas [Amplicor MTB PCR e

amplified Mycobacterium tuberculosis Direct test (MTD-Gen-Probe)],

provavelmente, devido à menor acurácia observada em técnicas de PCR in

house (Roos et al., 1998; van Cleeff et al., 2005).

Como pode ser evidenciado e calculado através dos dados da tabela 4 do

artigo 4, a razão que representa o custo-efetividade por caso de TB pulmonar

corretamente diagnosticado para a estratégia de microscopia direta por

coloração ZN associada ao PCR dot-blot foi mais alta do que a razão de custo-

efetividade da estratégia microscopia direta por coloração ZN associada à

Cultura (razão de 0,78). O custo da estratégia da microscopia direta por

coloração ZN associado ao PCR dot-blot foi 1,3 vezes inferior ao custo da

estratégia da ZN associada à Cultura., similar ao descrito previamente para

técnicas de PCR automatizadas (razão de 1,8). Quando consideramos somente

159

os custos dos pacientes, a estratégia de microscopia direta por coloração ZN

associada ao PCR dot-blot foi mais custo-efetiva do que a estratégia de ZN

associada à cultura com razão de 0,7.

Como se evidencia na tabela 5, do artigo 4, o custo-efetividade por caso

corretamente diagnosticado e tratado, incluindo o tratamento dos casos

falsamente diagnosticados na estratégia de microscopia direta por coloração ZN

associado ao PCR dot-blot foi mais alto do que a estratégia de ZN associada à

Cultura (ratio of 0,7).

Como mostra a tabela 6 do artigo 4, a análise de sensibilidade

comparando o custo-efetividade da estratégia de ZN associada à Cultura e ZN

associada ao PCR dot-blot, ajustando diferentes taxas de prevalência, mostrou

que a razão de custo-efetividade foi muito similar na maioria dos ajustes. Alguns

ganhos no custo-efetividade, entretanto, podem ser obtidos quando a

sensibilidade e a especificidade do PCR são ajustadas para 95%, corroborando

com dados descritos previamente em que uma sensibilidade maior do que 80%

pode ser um fator importante para aumentar o custo-efetividade de métodos de

PCR (Roos et al., 1998).

A análise de custo-efetividade permitiu concluir que a estratégia de

associar microscopia direta por coloração de ZN ao PCR dot-blot usando

escarro espontâneo pode ser uma alternativa custo-efetiva, especialmente em

hospitais de países em desenvolvimento com alta prevalência de TB e HIV. ZN

associado ao PCR dot-blot mostrou um melhoramento na sensibilidade, valores

preditivos negativos e oferecem um ganho para a exclusão de casos de TB

160

pulmonar em pacientes suspeitos. Todavia, estudos interlaboratoriais e estudos

de custo-efetividade em outros ambientes devem ser realizados para avaliar o

desempenho do PCR dot-blot em outras condições, antes deste ser introduzido

efetivamente na rotina clínica.

5.12 Recomendações para a utilização de testes moleculares em

rotina

A utilidade clínica dos testes de AAN tem sido discutida e para os testes

comerciais aprovados, o FDA recomenda que sejam coletadas 3 amostras em

dias diferentes para a baciloscopia e cultura. Os testes devem ser realizados na

primeira amostra com baciloscopia positiva (Woods, 2001).

Por outro lado, se o resultado for baciloscopia positivo, mas AAN

negativo, um teste para verificar a presença de inibidores deve ser realizado.

Se não ocorrer detecção de inibidores e se o espécime clínico adicional

analisado permanecer negativo pelos testes de AAN, presume-se que o paciente

esteja contaminado com uma micobactéria que não cause tuberculose. Mas, se

inibidores forem detectados, o teste de AAN não oferece nenhuma ajuda no

diagnóstico. Se o espécime clínico tiver resultado de baciloscopia negativa, mas

AAN positivo, e o mesmo resultado for obtido com uma amostra adicional, o

paciente, presumivelmente, tem TB. No caso de todas as amostras de escarro

permanecerem negativas na baciloscopia e na AAN, pode-se afirmar apenas

161

que na amostra analisada, não foram detectados bacilos ou DNA de

M.tuberculosis, porém isto não exclui a possibilidade da TB ativa e o julgamento

clínico deverá prevalecer no prosseguimento da investigação diagnóstica ou

inicio de tratamento de prova (Soini and Musser, 2001).

Quando a suspeita é de TB extrapulmonar, o diagnóstico clínico é

bem mais complicado e o isolamento do agente infeccioso é um desafio. Nestes

casos, os testes de AAN podem ser de grande auxílio para o clínico. Entretanto,

é importante afirmar que os testes comerciais só estão aprovados para amostras

respiratórias. Porém, tanto os testes comerciais e os padronizados em

laboratório (PCR in house) têm sido avaliados em estudos com diferentes

amostras extrapulmonares. Em geral, o desempenho dos testes de AAN é

bastante similar ao obtido com as amostras pulmonares (Portillo-Gomez et al.,

2000).

Os testes de AAN podem, sem dúvida, contribuir para um diagnóstico

mais efetivo e em menor tempo. No entanto, principalmente em países de

elevada prevalência de TB, de TB associada ao HIV, de micobacterias atipícas,

a interpretação dos resultados deve ser realizada com cautela, sem substituir a

baciloscopia e a cultura (importante para a identificação da espécie e teste de

sensibilidade). Ainda não se têm informações suficientes sobre o desempenho

dos testes de AAN realizados com amostras provenientes de pacientes já

tratados de TB no passado, pois os resultados de AAN, freqüentemente,

permanecem positivos após o tratamento (Soini and Musser, 2001). Portanto,

em regiões de elevada prevalência de TB e HIV, como em grandes cidades do

162

Brasil, estudos de eficácia e de efetividade de testes de AAN que possam ser

aplicáveis à rotina clínica são de enorme importância.

163

6 Conclusões

• Os estudos realizados mostraram que a PCR in house pode oferecer um

ganho para a exclusão de TB pulmonar em pacientes com suspeita de TB

pulmonar não tratados previamente e avaliados em hospitais;

• Entre as técnicas de PCR in house PCR, a PCR dot-blot parece ser a

mais apropriada à rotina, porque este método ofereceu uma maior

acurácia, rapidez, facilidade de uso, maior segurança, e grande

objetividade na interpretação dos resultados.

• PCR dot-blot usado em paralelo com a alta suspeita clínica de diagnostico

de TB pulmonar pode contribuir para o diagnóstico de pacientes com

suspeita de TB pulmonar, com baciloscopia negativa, principalmente em

pacientes não tratados previamente e atendidos em hospitais de

referência para TB.

• PCR dot-blot usado em paralelo com a baciloscopia direta por ZN

mostrou um melhoramento na sensibilidade, likelihood ratio (LR)

negativas e valores preditivos negativos. Esta estratégia também pode

oferecer ganhos na exclusão de TB pulmonar, especialmente em

pacientes HIV negativos, não previamente tratados em hospitais de

países em desenvolvimento

• A estratégia da PCR dot-blot usada em paralelo com a baciloscopia

direta, usada em escarro espontâneo pode ser uma alternativa, custo-

164

efetiva, especialmente em hospitais de países em desenvolvimento com

alta prevalência de TB e HIV.

• Estudos interlaboratoriais e de custo-efetividade em outros cenários

devem ser realizados para avaliar o desempenho da PCR dot-blot em

outras condições, antes desta ser efetivamente introduzida na rotina.

165

7 Perspectivas

O PCR dot-blot parece ser promissor no diagnóstico de TB pulmonar,

principalmente, quando associado à suspeita clínica do médico e quando

associado à microscopia direta por clororação de ZN, notamente em pacientes

não previamente tratados e HIV negativos.

Entretanto a fim de efetivamente ser colocado no fluxograma de triagem

diagnóstico para TB, alguns estudos ainda são necessários, como:

• Estudos multicêntricos de validação interlaboratorial em parceria com

pesquisadores da Rede-TB, de São Paulo, Espírito Santo e Rio de

Janeiro, a fim de verificar a reprodutibilidade da metodologia quando

realizada por outros pesquisadores, levando em consideração as diversas

variáveis laboratoriais.

• Avaliação da acurácia do PCR dot-blot no diagnóstico de formas de TB

extraplumonar avaliando amostras não respiratórias, como líquor,

biópsias, líquido pleural e sangue.

• Avaliação da acurácia do PCR dot-blot usado em assocação com a

microscopia direta por ZN no diagnóstico de formas de TB extraplumonar

avaliando amostras não respiratórias, como líquor, biópsias, líquido

pleural e sangue.

• Estudos de custo-efetividade do PCR dot-blot associado à microscopia

direta por coloração de ZN para o diagnóstico de TB extra-pulmonar

166

• Estudos multicêntricos de custo-efetividade do PCR dot-blot em

colaboração com outras regiões do páis e com outros países, a fim de

verificar a efetividade em diferentes taxas de prevalência de TB e HIV

167

8 Referências

Al Zahrani, K., H. Al Jahdali, et al. (2001). "Yield of smear, culture and

amplification tests from repeated sputum induction for the diagnosis of

pulmonary tuberculosis." Int J Tuberc Lung Dis 5(9): 855-60.

Almeda, J., A. Garcia, et al. (2000). "Clinical evaluation of an in-house IS6110

polymerase chain reaction for diagnosis of tuberculosis." Eur J Clin

Microbiol Infect Dis 19(11): 859-67.

Andersen, A. B., S. Thybo, et al. (1993). "Polymerase chain reaction for detection

of Mycobacterium tuberculosis in sputum." Eur J Clin Microbiol Infect Dis

12(12): 922-7.

Araj, G. F., R. S. Talhouk, et al. (2000). "Comparative performance of PCR-

based assay versus microscopy and culture for the direct detection of

Mycobacterium tuberculosis in clinical respiratory specimens in Lebanon."

Int J Tuberc Lung Dis 4(9): 877-81.

ATS (2000). "Diagnostic Standards and Classification of Tuberculosis in Adults

and Children. This official statement of the American Thoracic Society and

the Centers for Disease Control and Prevention was adopted by the ATS

Board of Directors, July 1999. This statement was endorsed by the

Council of the Infectious Disease Society of America, September 1999."

Am J Respir Crit Care Med 161(4 Pt 1): 1376-95.

Bates, J. H. (1980). "Transmission and pathogenesis of tuberculosis." Clin Chest

Med 1(2): 167-74.

168

Behr, M. A., S. A. Warren, et al. (1999). "Transmission of Mycobacterium

tuberculosis from patients smear-negative for acid-fast bacilli." Lancet

353(9151): 444-9.

Bloom, B. R. and C. J. Murray (1992). "Tuberculosis: commentary on a

reemergent killer." Science 257(5073): 1055-64.

Brasil, M. d. S. d. (2005). "DATASUS-Indicadores e Dados Básicos do Brasil-

2005- IDB2005." Plano de Controle da Tuberculose no Brasil no período

de 2001-2005.

Cafrune, P. I., L. W. Riley, et al. (2006). "Recent transmission of tuberculosis

involving retired patients." J Infect.

Camus, J. C., M. J. Pryor, et al. (2002). "Re-annotation of the genome sequence

of Mycobacterium tuberculosis H37Rv." Microbiology 148(Pt 10): 2967-73.

Catanzaro, A., S. Perry, et al. (2000). "The role of clinical suspicion in evaluating

a new diagnostic test for active tuberculosis: results of a multicenter

prospective trial." Jama 283(5): 639-45.

Chin, D. P., D. M. Yajko, et al. (1995). "Clinical utility of a commercial test based

on the polymerase chain reaction for detecting Mycobacterium

tuberculosis in respiratory specimens." Am J Respir Crit Care Med 151(6):

1872-7.

Cleary, T. J., G. Roudel, et al. (2003). "Rapid and specific detection of

Mycobacterium tuberculosis by using the Smart Cycler instrument and a

specific fluorogenic probe." J Clin Microbiol 41(10): 4783-6.

169

Cohen, R. A., S. Muzaffar, et al. (1998). "Diagnosis of pulmonary tuberculosis

using PCR assays on sputum collected within 24 hours of hospital

admission." Am J Respir Crit Care Med 157(1): 156-61.

Cole, S. T. and B. G. Barrell (1998). "Analysis of the genome of Mycobacterium

tuberculosis H37Rv." Novartis Found Symp 217: 160-72; discussion 172-

Conde, M. B., C. M. Figueira, et al. (1999). "Predictive value of the acid fast

smear for detection of Mycobacterium tuberculosis in respiratory

specimens in a reference center of HIV/AIDS in Rio de Janeiro, Brazil."

Mem Inst Oswaldo Cruz 94(6): 787-90.

Dalcomo, M. P., A. Fortes, F.F Melo, R. Motta, J. I. Netto, N. Cardoso, M.

Andrade, A. W. Barreto, E.G. Gerhardt (1999). "Estudo da efetividade de

esquemas alternativos para o tratamento da tuberculose multirresistente

no Brasil." Jornal de Pneumologia 25: 70-77.

Dalovisio, J. R., S. Montenegro-James, et al. (1996). "Comparison of the

amplified Mycobacterium tuberculosis (MTB) direct test, Amplicor MTB

PCR, and IS6110-PCR for detection of MTB in respiratory specimens."

Clin Infect Dis 23(5): 1099-106; discussion 1107-8.

deWit, D., M. Wootton, et al. (1993). "Simple method for production of internal

control DNA for Mycobacterium tuberculosis polymerase chain reaction

assays." J Clin Microbiol 31(8): 2204-7.

170

Dilworth, J. P., M. Goyal, et al. (1996). "Comparison of polymerase chain reaction

for IS6110 and Amplicor in the diagnosis of tuberculosis." Thorax 51(3):

320-2.

Drobniewski, F. A., M. Caws, et al. (2003). "Modern laboratory diagnosis of

tuberculosis." Lancet Infect Dis 3(3): 141-7.

Dye, C., C. J. Watt, et al. (2002). "Low access to a highly effective therapy: a

challenge for international tuberculosis control." Bull World Health Organ

80(6): 437-44.

Dye, C. and B. G. Williams (2000). "Criteria for the control of drug-resistant

tuberculosis." Proc Natl Acad Sci U S A 97(14): 8180-5.

Dziadek, J., A. Sajduda, et al. (2001). "Specificity of insertion sequence-based

PCR assays for mycobacterium tuberculosis complex." Int J Tuberc Lung

Dis 5(6): 569-74.

Equipe de Controle Epidemiológico/Coordenadoria de Vigilância em

Saúde/Secretaria Municipal de Porto Alegre 2005. "Análise comparativa

do ingresso de casos novos de Tuberculose ocorrido na rede ambulatorial

e hospitalar de Porto Alegre nos anos de 2003 e 2004." Boletim

Epidemiológico 27(Ano VIII).

Edwards, C. K., 3rd, H. B. Hedegaard, et al. (1986). "Chronic infection due to

Mycobacterium intracellulare in mice: association with macrophage

release of prostaglandin E2 and reversal by injection of indomethacin,

muramyl dipeptide, or interferon-gamma." J Immunol 136(5): 1820-7.

171

Eisenach, K. D., M. D. Cave, et al. (1990). "Polymerase chain reaction

amplification of a repetitive DNA sequence specific for Mycobacterium

tuberculosis." J Infect Dis 161(5): 977-81.

Eisenach, K. D., M. D. Sifford, et al. (1991). "Detection of Mycobacterium

tuberculosis in sputum samples using a polymerase chain reaction." Am

Rev Respir Dis 144(5): 1160-3.

Ellingson, J. L., J. R. Stabel, et al. (2000). "Evaluation of the accuracy and

reproducibility of a practical PCR panel assay for rapid detection and

differentiation of Mycobacterium avium subspecies." Mol Cell Probes

14(3): 153-61.

Fegou, E., E. Jelastopulu, et al. (2005). "Sensitivity of the Cobas Amplicor

system for detection of Mycobacterium tuberculosis in respiratory and

extrapulmonary specimens." Clin Microbiol Infect 11(7): 593-6.

Folgueira, L., R. Delgado, et al. (1993). "Detection of Mycobacterium tuberculosis

DNA in clinical samples by using a simple lysis method and polymerase

chain reaction." J Clin Microbiol 31(4): 1019-21.

Forbes, B. A. and K. E. Hicks (1993). "Direct detection of Mycobacterium

tuberculosis in respiratory specimens in a clinical laboratory by

polymerase chain reaction." J Clin Microbiol

31(7): 1688-94.

Gamboa, F., G. Fernandez, et al. (1998). "Comparative evaluation of initial and

new versions of the Gen-Probe Amplified Mycobacterium Tuberculosis

Direct Test for direct detection of Mycobacterium tuberculosis in

respiratory and nonrespiratory specimens." J Clin Microbiol

36(3): 684-9.

172

Gamboa, F., J. M. Manterola, et al. (1997). "Direct detection of Mycobacterium

tuberculosis complex in nonrespiratory specimens by Gen-Probe

Amplified Mycobacterium Tuberculosis Direct Test." J Clin Microbiol 35(1):

307-10.

Goessens, W. H., P. de Man, et al. (2005). "Comparison of the COBAS

AMPLICOR MTB and BDProbeTec ET assays for detection of

Mycobacterium tuberculosis in respiratory specimens." J Clin Microbiol

43(6): 2563-6.

Haas, D. W. and R. M. Des Prez (1994). "Tuberculosis and acquired

immunodeficiency syndrome: a historical perspective on recent

developments." Am J Med 96(5): 439-50.

Hargreaves, N. J., O. Kadzakumanja, et al. (2001). "'Smear-negative' pulmonary

tuberculosis in a DOTS programme: poor outcomes in an area of high HIV

seroprevalence." Int J Tuberc Lung Dis 5(9): 847-54.

Ieven, M. and H. Goossens (1997). "Relevance of nucleic acid amplification

techniques for diagnosis of respiratory tract infections in the clinical

laboratory." Clin Microbiol Rev 10(2): 242-56.

Jeffrey, L. F. (2000). "Perspectives on Pathogens at ASM Centennial

Symposium." Amercican Society for Microbiology

66(1): 11-14.

Kambashi, B., G. Mbulo, et al. (2001). "Utility of nucleic acid amplification

techniques for the diagnosis of pulmonary tuberculosis in sub-Saharan

Africa." Int J Tuberc Lung Dis

5(4): 364-9.

173

Keshinro, B. and M. Y. Diul (2006). "HIV-TB: epidemiology, clinical features and

diagnosis of smear-negativeTB." Trop Doct 36(2): 68-71.

Kivihya-Ndugga, L., M. van Cleeff, et al. (2004). "Comparison of PCR with the

routine procedure for diagnosis of tuberculosis in a population with high

prevalences of tuberculosis and human immunodeficiency virus." J Clin

Microbiol 42(3): 1012-5.

Kolk, A. H., G. T. Noordhoek, et al. (1994). "Mycobacterium smegmatis strain for

detection of Mycobacterium tuberculosis by PCR used as internal control

for inhibition of amplification and for quantification of bacteria." J Clin

Microbiol 32(5): 1354-6.

Kritski, A., Queiroz M. F. C., Barreto C. E. N., Pereira N. M., Bravin Y.,

Vasconcelos G., Fonseca L. S. (2003). "Fatores de risco associados a

tuberculose pulmonar paucibacilar em pacientes atendidos em centros de

saúde da cidade do Rio de Janeiro." Pulmão 12: 10-16.

Kritski, A. L. (2000). "Tuberculose do Ambulatório a Enfermaria." Atheneu 2 ed.

Kritski, A. L., M. J. Marques, et al. (1996). "Transmission of tuberculosis to close

contacts of patients with multidrug-resistant tuberculosis." Am J Respir Crit

Care Med 153(1): 331-5.

Kritski, A. L. and A. Ruffino-Netto (2000). "Health sector reform in Brazil: impact

on tuberculosis control." Int J Tuberc Lung Dis 4(7): 622-6.

Kudoh, S. and T. Kudoh (1974). "A simple technique for culturing tubercle bacilli."

Bull World Health Organ 51(1): 71-82.

174

Kwiatkowska, S., J. Marczak, et al. (1999). "Clinical utility of a commercial ligase

chain reaction kit for the diagnosis of smear-negative pulmonary

tuberculosis." Int J Tuberc Lung Dis 3(5): 421-5.

Laifer, G., A. F. Widmer, et al. (2004). "Polymerase chain reaction for

Mycobacterium tuberculosis: impact on clinical management of refugees

with pulmonary infiltrates." Chest 125(3): 981-6.

Lim, T. K., A. Gough, et al. (2000). "Relationship between estimated pretest

probability and accuracy of automated Mycobacterium tuberculosis assay

in smear-negative pulmonary tuberculosis." Chest 118(3): 641-7.

Lim, T. K., A. Mukhopadhyay, et al. (2003). "Role of clinical judgment in the

application of a nucleic acid amplification test for the rapid diagnosis of

pulmonary tuberculosis." Chest 124(3): 902-8.

Mbulo, G. M., B. S. Kambashi, et al. (2004). "Comparison of two bacteriophage

tests and nucleic acid amplification for the diagnosis of pulmonary

tuberculosis in sub-Saharan Africa." Int J Tuberc Lung Dis 8(11): 1342-7.

Melo, F. A. F., J. B. Afiune, et al. (2003). "Aspectos epidemiológicos da

tuberculose multirresistente em serviço de referência na cidade de São

Paulo." Rev. Soc. Bras. Med. Trop. 36(1).

Miller, N., T. Cleary, et al. (2002). "Rapid and specific detection of

Mycobacterium tuberculosis from acid-fast bacillus smear-positive

respiratory specimens and BacT/ALERT MP culture bottles by using

fluorogenic probes and real-time PCR." J Clin Microbiol 40(11): 4143-7.

175

Mitarai, S., A. Kurashima, et al. (2001). "Clinical evaluation of Amplicor

Mycobacterium detection system for the diagnosis of pulmonary

mycobacterial infection using sputum." Tuberculosis (Edinb) 81(5-6): 319-

25.

Mitarai, S., S. Tanoue, et al. (2001). "Potential use of Amplicor PCR kit in

diagnosing pulmonary tuberculosis from gastric aspirate." J Microbiol

Methods 47(3): 339-44.

Murray, J. (1999). "Manual of Clinical Microbiology." 7 th Edition.

Niesters, H. G. (2002). "Clinical virology in real time." J Clin Virol 25 Suppl 3: S3-

12.

Nolte, F. S., B. Metchock, et al. (1993). "Direct detection of Mycobacterium

tuberculosis in sputum by polymerase chain reaction and DNA

hybridization." J Clin Microbiol 31(7): 1777-82.

Noordhoek, G. T., A. H. Kolk, et al. (1994). "Sensitivity and specificity of PCR for

detection of Mycobacterium tuberculosis: a blind comparison study among

seven laboratories." J Clin Microbiol 32(2): 277-84.

Noordhoek, G. T., S. Mulder, et al. (2004). "Multicentre quality control study for

detection of Mycobacterium tuberculosis in clinical samples by nucleic

amplification methods." Clin Microbiol Infect

10(4): 295-301.

Noordhoek, G. T., J. D. van Embden, et al. (1996). "Reliability of nucleic acid

amplification for detection of Mycobacterium tuberculosis: an international

collaborative quality control study among 30 laboratories." J Clin Microbiol

34(10): 2522-5.

176

Perkins, M. D. and A. L. Kritski (2002). "Diagnostic testing in the control of

tuberculosis." Bull World Health Organ 80(6): 512-3.

Petitti D. B.(2000). "Meta-Analysis, Decision Analysis and Cost-Effectiveness

Analysis: Methods for quantitative synthesis in Medicine.Oxford University

Press. 2 ed

Picon, P. D., M. L. D. Giustina, et al. (2002). "Resultado do tratamento da

tuberculose com estreptomicina, isoniazida e etambutol (esquema SHM)

" Jornal de Pneumologia 28 (4).

Piersimoni, C., D. Nista, et al. (2005). "Clinical suspicion as a primary guidance

to use commercial amplification tests for rapid diagnosis of pulmonary

tuberculosis." Diagn Microbiol Infect Dis 53(3): 195-200.

Piersimoni, C., C. Scarparo, et al. (2002). "Performance assessment of two

commercial amplification assays for direct detection of Mycobacterium

tuberculosis complex from respiratory and extrapulmonary specimens." J

Clin Microbiol 40(11): 4138-42.

Portillo-Gomez, L., S. L. Morris, et al. (2000). "Rapid and efficient detection of

extra-pulmonary Mycobacterium tuberculosis by PCR analysis." Int J

Tuberc Lung Dis 4(4): 361-70.

Ribeiro, F. K., V. Dettoni Vdo, et al. (2004). "Evaluation of a commercial test

based on ligase chain reaction for direct detection of Mycobacterium

tuberculosis in respiratory specimens." Rev Soc Bras Med Trop 37(6):

431-5.

177

Roos, B. R., M. R. van Cleeff, et al. (1998). "Cost-effectiveness of the

polymerase chain reaction versus smear examination for the diagnosis of

tuberculosis in Kenya: a theoretical model." Int J Tuberc Lung Dis 2(3):

235-41.

Rosenstraus, M., Z. Wang, et al. (1998). "An internal control for routine

diagnostic PCR: design, properties, and effect on clinical performance." J

Clin Microbiol 36(1): 191-7.

Rossetti L R, J. S. B., Rodrigues V F S, Moura A R, Oliveira H, Zaha A (1997).

"Improvement of Mycobacterim tuberculosis detection in clinical samples

using DNA purified by glass matrix." J Microbiol Meth 28: 139-146.

Rossetti, M. L., A. R. Valim, et al. (2002). "[Resistant tuberculosis: a molecular

review]." Rev Saude Publica 36(4): 525-32.

Sarmiento, O. L., K. A. Weigle, et al. (2003). "Assessment by meta-analysis of

PCR for diagnosis of smear-negative pulmonary tuberculosis." J Clin

Microbiol 41(7): 3233-40.

Scarparo, C., P. Piccoli, et al. (2000). "Comparison of enhanced Mycobacterium

tuberculosis amplified direct test with COBAS AMPLICOR Mycobacterium

tuberculosis assay for direct detection of Mycobacterium tuberculosis

complex in respiratory and extrapulmonary specimens." J Clin Microbiol

38(4): 1559-62.

Schijman, A. G., M. H. Losso, et al. (2004). "Prospective evaluation of in-house

polymerase chain reaction for diagnosis of mycobacterial diseases in

178

patients with HIV infection and lung infiltrates." Int J Tuberc Lung Dis 8(1):

106-13.

Sharma, S. K., A. Mohan, et al. (2005). "Miliary tuberculosis: new insights into an

old disease." Lancet Infect Dis 5(7): 415-30.

Shibuya, Y., T. Shiozaki, et al. (2000). "Efficacy of Amplicor PCR for the

diagnosis of tuberculosis in respiratory specimens other than sputum."

Tuber Lung Dis 80(4-5): 209-15.

Silva, M. S., S. G. Senna, et al. (2003). "Mutations in katG, inhA, and ahpC

genes of Brazilian isoniazid-resistant isolates of Mycobacterium

tuberculosis." J Clin Microbiol 41(9): 4471-4.

Soini, H., S. A. Agha, et al. (1996). "Comparison of amplicor and 32-kilodalton

PCR for detection of Mycobacterium tuberculosis from sputum

specimens." J Clin Microbiol 34(7): 1829-30.

Soini, H. and J. M. Musser (2001). "Molecular diagnosis of mycobacteria." Clin

Chem 47(5): 809-14.

Sperhacke, R. D., F. C. Mello, et al. (2004). "Detection of Mycobacterium

tuberculosis by a polymerase chain reaction colorimetric dot-blot assay."

Int J Tuberc Lung Dis 8(3): 312-7.

Stocher, M., V. Leb, et al. (2002). "A simple approach to the generation of

heterologous competitive internal controls for real-time PCR assays on the

LightCycler." J Clin Virol 25 Suppl 3: S47-53.

Styblo, K. (1991). "The impact of HIV infection on the global epidemiology of

tuberculosis." Bull Int Union Tuberc Lung Dis 66(1): 27-32.

179

Su, W. J., A. P. Tsou, et al. (2000). "Clinical experience in using polymerase

chain reaction for rapid diagnosis of pulmonary tuberculosis." Zhonghua Yi

Xue Za Zhi (Taipei) 63(7): 521-6.

Suffys, P., J. C. Palomino, et al. (2000). "Evaluation of the polymerase chain

reaction for the detection of Mycobacterium tuberculosis." Int J Tuberc

Lung Dis 4(2): 179-83.

Suffys, P. N., M. E. Araujo, et al. (1997). "The changing face of the epidemiology

of tuberculosis due to molecular strain typing--a review." Mem Inst

Oswaldo Cruz 92(3): 297-316.

Suffys, P. N., M. E. Ivens de Araujo, et al. (2000). "Usefulness of IS6110-

restriction fragment length polymorphism typing of Brazilian strains of

Mycobacterium tuberculosis and comparison with an international

fingerprint database." Res Microbiol 151(5): 343-51.

Tansuphasiri, U., S. Suttirat, et al. (2002). "Comparison of microplate

hybridization with gel electrophoresis and dot blot hybridization for the

rapid detection of Mycobacterium tuberculosis PCR products." Southeast

Asian J Trop Med Public Health 33(1): 136-46.

Tarhan, G., M. B. Saygan, et al. (2005). "[Retrospective evaluation of Cobas

Amplicor system in the rapid diagnosis of Mycobacterium tuberculosis

complex]." Mikrobiyol Bul 39(1): 35-41.

Tuberculose (2006). "API TB Consensus Guidelines 2006: Management of

pulmonary tuberculosis, extra-pulmonary tuberculosis and tuberculosis in

special situations." J Assoc Physicians India 54: 219-34.

180

Thierry, D., A. Brisson-Noel, et al. (1990). "Characterization of a Mycobacterium

tuberculosis insertion sequence, IS6110, and its application in diagnosis."

J Clin Microbiol 28(12): 2668-73.

Torres, M. J., A. Criado, et al. (2000). "Use of real-time PCR and fluorimetry for

rapid detection of rifampin and isoniazid resistance-associated mutations

in Mycobacterium tuberculosis." J Clin Microbiol 38(9): 3194-9.

Tuberculose II Consenso Brasileiro -Diretrizes Brasileiras para Tuberculose 2004

Jornal Brasileiro de Pneumologia 30(1).

Valentine-Thon, E. (2002). "Quality control in nucleic acid testing--where do we

stand?" J Clin Virol 25 Suppl 3: S13-21.

van Cleeff, M., L. Kivihya-Ndugga, et al. (2005). "Cost-effectiveness of

polymerase chain reaction versus Ziehl-Neelsen smear microscopy for

diagnosis of tuberculosis in Kenya." Int J Tuberc Lung Dis 9(8): 877-83.

van Cleeff, M. R., L. Kivihya-Ndugga, et al. (2003). "A comprehensive study of

the efficiency of the routine pulmonary tuberculosis diagnostic process in

Nairobi." Int J Tuberc Lung Dis 7(2): 186-9.

Walker, D., R. McNerney, et al. (2000). "An incremental cost-effectiveness

analysis of the first, second and third sputum examination in the diagnosis

of pulmonary tuberculosis." Int J Tuberc Lung Dis

4(3): 246-51.

Wang, S. X. and L. Tay (1999). "Evaluation of three nucleic acid amplification

methods for direct detection of Mycobacterium tuberculosis complex in

respiratory specimens." J Clin Microbiol

37(6): 1932-4.

181

Watterson, S. A. and F. A. Drobniewski (2000). "Modern laboratory diagnosis of

mycobacterial infections." J Clin Pathol 53(10): 727-32.

Wells, W. (1948). "On the mechanismof droplet-nucleus infection, II: quantitative

experimental air-bone tuberculosis in rabbits." AM J Hygiene 47(11).

WHO (2005). "Global tuberculosis Control: Surveillance, Planning, Financing."

WHO Report: 349.

WHO (2006). "Global tuberculosis control - surveillance, planning, financing

" WHO Report 2006: 362.

Woods, G. L. (2001). "Molecular techniques in mycobacterial detection." Arch

Pathol Lab Med 125(1): 122-6.

Yuen, K. Y., W. C. Yam, et al. (1997). "Comparison of two automated DNA

amplification systems with a manual one-tube nested PCR assay for

diagnosis of pulmonary tuberculosis." J Clin Microbiol 35(6): 1385-9.

182

9 Anexos

9.1 Anexo 1: Termo de consentimento

Termo de consentimento Livre

Objetivos e Relevância da pesquisa

Objetivos

• Avaliar uma técnica mais sensível para o diagnóstico precoce da tuberculose

• Avaliar o custo- efetividade clínica da técnica de PCR no diagnóstico de Tuberculose Pulmonar em pacientes co-

infectados. (Soropositivos- portadores de HIV e Tuberculose)

Relevância da pesquisa

A tuberculose é uma infecção oportunista muito comum em pessoas infectadas com o vírus HIV. A tuberculose

pode causar uma doença pulmonar caracterizada por tosse, febre, suores noturnos e perda de peso.

O diagnóstico precoce da tuberculose em pacientes portadores de HIV é importante para o correto tratamento

da doença. Atualmente, os métodos de rotina para o diagnóstico da tuberculose em pacientes portadores de HIV são a

baciloscopia, que é pouco sensível, e a cultura que normalmente leva de 8 a 12 semanas para a correta identificação e

isolamento da micobactéria causadora da tuberculose.

O CDCT (Centro de Desenvolvimento em Ciência e Tecnologia do Estado do Rio Grande do Sul), o

Laboratório da Prefeitura de Porto Alegre, e a Unidade de Pneumologia da Universidade do Rio de Janeiro estão

trabalhando juntos para validar uma técnica mais sensível e mais rápida para o diagnóstico de tuberculose em escarro, a

PCR (Reação em cadeia da polimerase).

1. Procedimentos

1.1 Coleta de Dados:

Se eu concordar em participar deste estudo, eu responderei a um questionário padronizado que investigará

aspectos do meu perfil sócio - econômico, os fatores de risco que estão associados ao adoecimento por tuberculose, o

consumo de bebidas alcoólicas e a presença de sintomas.

Exames que serão realizados

Serei submetido a exame médico, a um teste na pele (teste tuberculínico cutâneo - teste de PPD) , a uma

radiografia de tórax, e à coleta de material proveniente dos pulmões (escarro espontâneo). Se eu permitir também, serão

coletados 5ml de sangue no meu antebraço, na face anterior, com agulha e seringa descartáveis, antecedido por

antissepsia local. O sangue será utilizado para realização da PCR.

Utilização dos materiais coletados

O material coletado, seguindo modelo de investigação da tuberculose pulmonar neste Centro de Saúde ou

Hospital, será submetido à rotina do laboratório de micobacteriologia, e uma parte deste material também será submetida

à um teste de pesquisa chamada PCR (Reação em Cadeia da Polimerase) na tentativa de melhorar as possibilidades de

diagnóstico da tuberculose.

2. Local do Estudo

Os procedimentos de coleta no Laboratório do HSP e os demais exames serão realizados pela equipe médica do HSP.

3. Riscos / Desconfortos

Algumas das questões que constam do questionário podem ser inapropriadas e produzir sentimentos indesejáveis, mas

caso eu ache necessário poderei interromper a entrevista a qualquer momento. Os riscos da retirada de sangue incluem

introdução da agulha, desconforto temporário, pequena ferida e, raramente a formação de um pequeno hematoma. A

realização do teste na pele (teste PPD) pode causar leve desconforto no local de aplicação e as vezes prurido (coceira),

de fácil controle e sem posteriores seqüelas. A radiação empregada para a realização de radiografia de tórax não implica

em riscos significativos para a saúde. Caso seja necessário realizar a indução de escarro, conforme rotina padronizada,

os riscos envolvidos serão de: desconforto causado pela tosse e eventuais naúseas de curta duração. Raramente, em

pacientes com hiperreatividade brônquica ocorre chiado no peito (broncoespasmo), usualmente de rápida reversão. Caso

seja necessário realizar broncofibroscopia com coleta de lavado broncoalveolar, os riscos envolvidos serão de:

desconforto causado pela tosse, febrícula de curta duração e sangramento respiratório de pequena quantidade, com

controle geralmente alcançável por medidas locais.

4.Tratamento e compensação por danos

183

Se eu tiver algum problema de saúde em decorrência deste estudo, o tratamento será fornecido pela instituição

participante. A, a SES, o LACEN/RS e o CDCT/RS não prevêm nenhuma forma de compensação financeira por

possíveis injúrias.

5.Desistência da participação no estudo

Se eu decidir não participar neste estudo, ou interromper a minha participação a qualquer momento, o meu tratamento

médico será mantido pelo SES-SUS

6.Custos para os participantes

Não haverá custos para mim, caso decida pela minha participação neste estudo, nem para os tratamentos que eu

porventura necessitar. Os custos dos exames laboratoriais, radiológicos, dos testes cutâneos e de análise das minhas

amostras respiratória e sangüínea serão cobertos pelo estudo.

7.Benefício

Os procedimentos médicos aos quais eu irei me submeter aumentarão as possibilidades de um diagnóstico mais rápido

da tuberculose pulmonar seja feito e, desta forma, tratamentos inadequados poderão ser evitados. Com isto, espera-se

que mais conhecimentos científicos sejam obtidos com conseqüente melhoria futura do diagnóstico e do tratamento de

pessoas que estejam na mesma condição que eu.

8.Reembolso

Eu não serei reembolsado por participar deste estudo.

9.Confidencialidade dos dados

A participação em projetos de pesquisa pode resultar em perda de privacidade, entretanto, procedimentos

serão tomados pelos responsáveis por este estudo, no intuito de proteger a confidencialidade das informações que eu

forneça. As informações serão codificadas e mantidas num local reservado o tempo todo. Somente a Dra. Luciene

Cardoso Scherer e os pesquisadores envolvidos neste projeto terão acesso às informações e aos questionários. Após o

término deste estudo, as informações serão transcritas dos questionários para arquivos em computador e aqueles serão

mantidos arquivados em local reservado e com acesso restrito por senha. Os dados deste estudo poderão ser discutidos

com pesquisadores de outras instituições, mas nenhuma identificação será fornecida.

Pelo presente Termo de Consentimento Livre e Esclarecido, declaro que autorizo a minha participação neste

projeto de pesquisa, pois fui informado, de forma clara e detalhada, livre de qualquer forma de constrangimento e

coerção, dos objetivos, da justificativa, dos procedimentos a que serei submetido, dos riscos, desconfortos e benefícios,

assim como das alternativas às quais poderei ser submetido, todos acima listados. Fui igualmente, informado:

• da garantia de receber resposta a qualquer pergunta ou esclarecimento a qualquer dúvida do procedimento,

risco, benefício e outros assuntos relacionados com a pesquisa;

• da liberdade de retirar meu consentimento, a qualquer momento, e deixar de participar do estudo, sem que isto

traga prejuízo à continuidade do meu cuidado e tratamento;

• da garantia de que não serei identificado quando da divulgação dos resultados e de que as informações

obtidas serão utilizadas apenas para fins científicos vinculados ao presente projeto de pesquisa;

• do compromisso de proporcionar informação atualizada obtida durante o estudo, ainda que esta possa afetar a

minha vontade em continuar participando;

• da disponibilidade de tratamento médico e indenização, conforme estabelece a legislação, caso existam danos

a minha saúde diretamente causados por esta pesquisa;

• de que se existirem gastos adicionais, estes serão absorvidos pelo orçamento da pesquisa.

O Pesquisador envolvido diretamente neste Projeto de Pesquisa é a Dra Luciene Scherer, farmacêutica bioquímica,

(33520336), disponível para prestar qualquer esclarecimento, tendo este documento sido revisado e aprovado pelo

Comitê de Ética em Pesquisa dessa Instituição em ______/ ______/ _____.

Data ______/ ______/ _______

Nome e assinatura do Paciente ou Voluntário:

Nome__________________________________________________________

Assinatura_______________________________________________________

Nome e assinatura do responsável pela obtenção do presente consentimento

Nome__________________________________________________________

Assinatura_______________________________________________________

Observação: O presente documento, baseado no item IV das Diretrizes e Normas Regulamentadoras para a Pesquisa

em Saúde, do Conselho Nacional de Saúde (Resolução 196/96), será assinado em duas vias, de igual teor, ficando uma

via em poder do Paciente ou de seu Representante Legal e outra com o Pesquisador Responsável.

Livros Grátis
( http://www.livrosgratis.com.br )
 
Milhares de Livros para Download:
 
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas

Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
 
 