ads:
Pelotas, 2007
Tiago Veiras Collares
Animais transgênicos: transferência gênica
mediada por espermatozóides (SMGT) em peixe
(Rhamdia quelen) e ave (Gallus gallus)
UNIVERSIDADE FEDERAL DE PELOTAS
Programa de Pós-Graduação em Biotecnologia
Agrícola
Tese
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
TIAGO VEIRAS COLLARES
Animais transgênicos: transferência gênica mediada por espermatozóides
(SMGT) em peixe (Rhamdia quelen) e ave (Gallus gallus)
Orientador: João Carlos Deschamps
Pelotas, 2007
Tese apresentada ao Programa de Pós-
Graduação em Biotecnologia Agrícola da
Universidade Federal de Pelotas, como
requisito parcial à obtenção do título de
Doutor em Ciências (área de conhecimento:
Embriologia Molecular e Transgênese
Animal).
ads:
Dados de catalogação na fonte:
Ubirajara Buddin Cruz – CRB-10/901
Biblioteca de Ciência & Tecnologia - UFPel
C697a Collares, Tiago Vieiras
Animais transgênicos: transferência gênica mediada por
espermatozóides (SMGT) em peixe (Rhamdia quelen) e ave (Gallus
gallus) / Tiago Vieiras Collares ; orientador João Carlos Deschamps. –
Pelotas, 2007. – 137f. – Tese (Doutorado). Programa de Pós-
Graduação em Biotecnologia Agrícola. Centro de Biotecnologia.
Universidade Federal de Pelotas. Pelotas, 2007.
1.Biotecnologia. 2.Espermatozóides. 3.Peixes transgênicos.
4.Aves transgênicas. 5.Plasma seminal. 6.DNA exógeno. 7.Animais
transgênicos. 8.Rhamdia quelen. 9.Gallus gallus. I.Deschamps, João
Carlos. II.Título.
CDD: 591.1592
Banca examinadora:
Orientador
Prof. Ph.D. João Carlos Deschamps, Universidade Federal de Pelotas
Membros
Prof
a
. Ph.D. Denise Calisto Bongalhardo, Universidade Federal de Pelotas
Prof. Ph.D. Odir Antônio Dellagostin, Universidade Federal de Pelotas
Prof. Dr. Luis Fernando Fernandes Marins, Fundação Universidade Federal
do Rio Grande
AGRADECIMENTOS
A Universidade Federal de Pelotas e ao Centro de Biotecnologia, pela
oportunidade de realização do Curso de Pós-Graduação em Biotecnologia.
A CAPES, CNPq e FAPERGS pelo financiamento destes estudos.
Ao meu orientador e amigo, João Carlos Deschamps, pela valiosa orientação,
experiência, confiança dispensada neste período de formação acadêmica e
humanística, sempre com palavras sábias. É importante registrar o carinho exemplar
da família Deschamps.
A minha esposa Fabiana Seixas, pelo amor, carinho, conselhos,
companheirismo e apoio profissional ao longo de todo este período.
Aos meus queridos pais, Jeronimo Collares e Anna Collares, pelo carinho,
incentivo e principalmente pela formação familiar sólida baseada na diversidade ao
longo de minha vida.
Ao meu tio e amigo Gilberto Collares pelo carinho, atenção, apoio e incentivo
do fazer e agir.
Aos meus grandes amigos e colegas de trabalho, Vinicius Campos e Paulo
Cavalcanti pelo convívio, amizade e confiança.
As colegas de laboratório Cristian Kaefer, Evelise Silva, Alinca Fonseca e
Thaís Collares pela confiança depositada e pela coragem de aceitar os desafios
durante este período e superá-los com competências e habilidades.
As minhas madrinhas Marta Amaral e Claudia Fernandes pelo carinho,
amizade e convívio agradável.
Ao professor e amigo Odir Dellagostin pela atenção dispensada em todos os
momentos desta jornada e pela confiança depositada em momentos importantes de
construção acadêmica.
Ao professor e amigo Ricardo Robaldo pela parceria e convívio ao longo dos
últimos anos.
E a todos os professores e colegas que direta ou indiretamente contribuíram
de alguma forma para a realização deste trabalho.
Muito Obrigado!
RESUMO
COLLARES, Veiras Tiago. Animais Transgênicos: transferência gênica mediada
por espermatozóides (SMGT) em peixe (Rhamdia quelen) e ave (Gallus gallus).
2007. 134 f. Tese (Doutorado) - Programa de Pós - Graduação em Biotecnologia
Agrícola. Universidade Federal de Pelotas, Pelotas.
O desenvolvimento da transgênese proporciona aos pesquisadores uma ferramenta
poderosa para analisar efeitos biológicos, bem como a possibilidade de gerar
animais transgênicos em massa por SMGT. Esta estratégia para gerar animais
transgênicos, teoricamente, consiste na introdução de DNA exógeno em gametas
masculinos antes do processo de fertilização. No entanto, espermatozóides de cada
espécie têm as suas próprias especificidades e potenciais biológicos, o que irá
determinar o sucesso do método de transferência em massa de DNA. O nosso
objetivo foi avaliar a eficiência dos espermatozóides de Rhamdia quelen e Gallus
gallus submetidos à SMGT, através de parâmetros reprodutivos in vitro e in vivo,
expressão gênica e por análises de PCR. Tratamentos espermáticos foram: 1)
desidratados / reidratados (DR), 2) desidratados / reidratados / eletroporados (DRE),
3) eletroporados (E), 4) incubados com plasma seminal (INC); E 5) incubados sem
plasma seminal (INCSP). As taxas de expressão da GFP em larvas foram: DRE =
63%; DR = 44%; E = 34%; INC = 8% e INCSP = 38%. As taxas de PCR positivos
foram: DRE = 60%; DR = 40%; E = 25%; INC = 5%; e INCSP = 25%. Não houve
diferença significativa (P> 0,05) entre DRE e DR; E e DR; E e INCSP. Em aves, o
principal objetivo deste estudo foi avaliar o potencial de espermatozóides de galo
submetidos à SMGT usando dimetilsulfóxido (DMSO) ou dimetilacetamida (DMA),
em sêmen suplementado com DNA (pEGFP) após sucessivas lavagens dos
espermatozóides. As análises PCR demonstraram 38% (18/47) para DMSO-pEGFP
e 19% (3 / 16) para DMA-pEGFP in F0 (p <0,05). O seqüenciamento confirmou a
presença do gene GFP em todos os tratamentos e amostras analisadas para peixes
e aves. Este estudo sugere que a SMGT é uma ferramenta promissora para gerar
Silver catfish e aves transgênicas em massa.
Palavras-chave: SMGT, espermatozóides, plasma seminal, DNA exógeno,
biotecnologia.
ABSTRACT
COLLARES, Veiras Tiago. Transgenic Animals: sperm mediated gene transfer
(SMGT in fish (Rhamdia quelen) and poultry (Gallus gallus). 2007. 134 f. Tese
(Doutorado) - Programa de Pós-Graduação em Biotecnologia Agrícola. Universidade
Federal de Pelotas, Pelotas.
The development of transgenesis has given researchers a powerful tool to examine
biological effects and the possibility of generating transgenic animals in mass by
SMGT. The strategy to generate transgenic animals theoretically consists of
introducing foreign DNA into male gametes before fertilization process. However,
each species sperm has its own particularities and biologic potentials, which will
determine the success of mass DNA transfer methods. Our aim was to evaluate the
efficiency Rhamdia quelen and Gallus gallus sperm submitted to SMGT, by in vitro
and in vivo reproductive parameters, gene expression and PCR analyses. Sperm
treatments: 1) dehydrated/rehydrated (DR), 2) dehydrated/rehydrated/electroporated
(DRE), 3) electroporated (E), 4) incubated with seminal plasma (INC); and 5)
incubated in absence of seminal plasma (INCSP). The rates of fish embryo GFP
expression were: DRE = 63%; DR = 44%; E = 34%; INC = 8% and INCSP = 38%.
The rates of PCR positivity: DRE = 60%; DR = 40%; E = 25%; INC = 5%; and INCSP
= 25%. There was no significant difference (P>0.05) between DRE and DR, E and
DR, E and INCSP for embryo GFP expression and PCR analyses. In poutry, the
main objective of this study was to evaluate the potential of rooster sperm submitted
to SMGT using dimethylsulfoxide (DMSO) or dimethylacetamide (DMA) in semen
supplemented with DNA (pEGFP) after successive sperm washes. PCR analyses
demonstrated that 38% (18/47) from pEGFP-DMSO group and 19% (3/16) from
pEGFP-DMA in F0 (p<0.05). The sequencing of the PCR product confirmed the
presence of the gene GFP in all treatments and sample analyzed to fish and chiken.
This study suggests that SMGT is a powerful tool for generating transgenic Silver
Catfish and chickens in mass.
Key words: SMGT, sperm, seminal plasma, foreign DNA, biotechnology.
SUMÁRIO
ANIMAIS TRANSGÊNICOS: TRANSFERÊNCIA GÊNICA MEDIADA
POR ESPERMATOZÓIDES (SMGT) EM PEIXES (Rhamdia quelen) E
AVES (Gallus gallus) ........................................................................................... 7
RESUMO................................................................................................................... 12
ABSTRACT ............................................................................................................... 13
1 INTRODUÇÃO GERAL ............................................................................................ 7
2 ARTIGO 1 (REVISÃO BIBLIOGRÁFICA) ................................................................ 9
Transgenicanimals:Themeldingofmolecularbiologyandanimalreproduction.............................9
3 ARTIGO 2 (REVISÃO BIBLIOGRÁFICA) .............................................................. 49
Animaistransgênicosbiorreatores...................................................................................................49
4 ARTIGO 3 .............................................................................................................. 90
Sperm‐mediatedgenetransferinSouthAmerican SilverCatfish(Rhamdiaquelen).......................90
KEYWORDS: SPERM; SILVER CATFISH; TRANSGENIC ANIMAL; OSMOTIC
DIFFERENTIAL; ELECTROPORATION; ................................................................. 92
1. INTRODUCTION ................................................................................................... 92
5 ARTIGO 4 ............................................................................................................ 114
Spermmediatedgenetransfer(SMGT)inchickenusingforeignDNA/DMSOorDNA/DMAcomplex
.........................................................................................................................................................114
6 CONCLUSÕES ................................................................................................ 135
7
1 INTRODUÇÃO GERAL
Apresentação da Tese
A hipótese deste trabalho é que espermatozóides de peixes (Rhamdia quelen)
e de aves (Gallus gallus) podem ser utilizados como carreadores de DNA exógeno
durante o processo de fertilização. Em nossa visão, ambos modelos biológicos
apresentam grande potencial como biorreatores. No entanto, estratégias de
transferência gênica em larga escala devem ser definidas para ambas as espécies.
Assim, foram traçados os seguintes objetivos:
- Avaliar o potencial das células espermáticas de Rhamdia quelem como
carreadores de DNA exógeno durante aplicação de diferencial osmótico,
eletroporação e incubação espermática na presença ou ausência de plasma seminal
para gerar peixes transgênicos;
- Avaliar o potencial espermático de Gallus gallus após sucessivas lavagens
do sêmen e incubações com DNA exógeno complexado com DMA
(Dimetilacetamida) ou DMSO (Dimetilsulfóxido) para gerar aves transgênicas.
Optamos por apresentar a tese na forma de artigos científicos. A nosso ver,
essa modalidade é mais prática que o modelo de tese tradicional, uma vez que
propicia uma divulgação objetiva e rápida dos resultados obtidos.
Inicialmente é apresentada uma revisão bibliográfica (artigo 1) sobre as
principais metodologias utilizadas na geração de animais transgênicos. Ao longo
desta revisão foi dado enfoque a técnica de transferência gênica mediada por
espermatozóides (SMGT) em diversas espécies. Uma abordagem sobre os
principais avanços científicos promovidos por técnicas de biologia molecular
aplicada à reprodução animal foi destacada nesta revisão sendo publicada na revista
Animal Reproduction, em 2005.
Em seguida, o artigo 2, segunda revisão bibliográfica sobre o tema, trata da
utilização de animais transgênicos como modelos de biorreatores para proteínas
recombinantes de interesse à indústria farmacêutica. Aborda os principais fluidos
alvos para a produção destas moléculas e apresenta novamente a técnica de
transferência gênica em massa como a mais promissora metodologia para geração
de modelos biorreatores em larga escala. Esta revisão foi recentemente aceita para
publicação no periódico Brazilian Journal of Animal Reproduction, em 2007.
8
O artigo 3, trata da aplicação da SMGT em Rhamdia quelen demonstrando
estratégias na manipulação de células espermáticas de Silver Catfish utilizando
técnicas de eletroporação e/ou diferencial osmótico e incubação na presença e
ausência de plasma seminal para gerar peixes transgênicos expressando GFP
(Green Fluorescent Protein). Esse artigo será submetido na forma de Original Paper
para publicação no periódico Transgenic Research, ainda em 2007.
No último artigo, foram descritas pela primeira vez metodogias de geração de
aves transgênicas através de SMGT utilizando moléculas transfectantes como DMA
e DMSO complexadas com DNA exógeno, após sucessivas lavagens para remoção
do plasma seminal. Este artigo será submetido na forma de Original Paper para o
periódico Molecular Reproduction and Development, ainda em 2007.
Os artigos estão compilados na formatação exigida de acordo com as normas
dos periódicos científicos em que foram ou serão publicados. Foram determinados
previamente, critérios de escolha dos periódicos como perfil do tema, impacto da
revista e contribuição científica constante dos periódicos.
9
2 ARTIGO 1 (Revisão bibliográfica)
(Animal Reproduction., v.2. n.1, p.11-27, Jan./March 2005)
Transgenic animals: The melding of molecular biology and
animal reproduction
T.Collares
1,2,4
, D.C. Bongalhardo
1,3
, J.C. Deschamps
1,2,3
, H.L.M. Moreira
1,2
1
Biotechnology Center – Federal University of Pelotas, Pelotas –RS /Brazil
2
Laboratory of Animal Genetic Engineering – LEGA
3
Laboratory of Animal Reproduction
4
Corresponding Author: [email protected],
Web.: www.ufpel.edu.br/lega, Phone: +55.53.2757350
Received: January 17, 2005
Accepted: March 16, 2005
10
Abstract
Biotechnology applied to livestock encompasses various reproductive
techniques supported by molecular biology. Technologies for the transfer of gene
constructs involve microinjection into the pronucleus of fertilized oocytes or DNA
mass transfer. The last one can be made through the use of sperm, which carry the
incorporated gene construct into the ovum at fertilization, or through the use of
retroviral vectors in cell lines. One of the prerequisites to establishing transgenic lines
is the presence of the foreign DNA in the gametes or one-cell embryos to ensure that
the conceptus develops into a transgenic animal. To reach this objective, foreign
genes can be transferred using different methods and strategies depending upon the
species of domestic animal used for this venture and their biological potential.
Transgenic animals are now commonly used worldwide as models for human
disease and the commercial availability of transgenic protein products for therapeutic
use is thought to be nearing realization. Advanced research is being conducted in
areas such as organ development for human transplantation and improved animal
production. Transgenic animals provide a true in vivo environment for evaluating the
mechanisms by which gene expression is modulated during development and in
adults. “Animal pharming”, the process of using transgenic animals to produce
pharmaceutical proteins for human use, is staking its claim in a lucrative world market
since the inserted gene, enables an animal to generate the targeted pharmaceutical
protein in its milk, urine, blood, sperm, or eggs, or to grow rejection-resistant organs
for transplant. This paper is a brief review of the most recent events in the area of
domestic animal trangenesis.
Keywords: transgenic animal; genes; foreign DNA; vectors; bioreactor.
11
Introduction
The optimization of the animal production efficiency depends on the success
of advanced reproductive techniques (Deschamps et al.,2000). Transgenesis is one
of these techniques which depend on the fusion of knowledge-base in genetics,
molecular biology, and animal reproduction. Functional genomic analyses in
vertebrate model systems, including fish, frogs, and mice, have greatly contributed to
the understanding of embryonic development and human disease processes.
However, new molecular tools and strategies are needed to meet the increasing
demands for information on gene function (Ivics and Izsvak, 2004).
In 1982, a gene construct containing the mouse metallothionein promoter
(mMT) and the rat growth hormone gene (rGH) were introduced by microinjection into
mouse zygotes (Palmiter et al,. 1982). This was not the first, but the main paper
published in the area, being considered as the initial mark on animal transgenesis.
Sequencing projects have supplied molecular geneticists with raw material which,
along with the advent of bioinformatics and information on gene expression obtained
from in silico, are expected to allow transgenesis in animal models to reach its full
potential (Carter, 2004). In fact, with the advances in molecular biology techniques
applied to animal reproduction, new methods directed to the introduction of specific
genes into the genome of farm animals, started to be used. The stable incorporation
of these genes into the germ line has been a major technological advance in
agriculture (Wheeler, 2003). The production of animals with large transgenes is a
valuable tool for biotechnology and for genetic studies, including the characterization
and manipulation of large single gene traits and polygenic traits (Moreira et al.,
2004).
Transgenesis includes the introduction of foreign DNA sequences in the
genome of multicellular organisms, and ensuring that the sequences are transmitted
to the progeny of the manipulated species (Houdebine, 2003). On the other hand,
Brink et al., (2000) define transgenesis as the alteration of the genetic information
with the intention of modifying a physical characteristic of an animal. However, the
latter concept does not encompass introduction of the gene to obtain new functions
such as the production of proteins of pharmacological interest. Transgenesis differs
from gene therapy since in the former the inserted gene is expected to be transmitted
12
to the next generations. Furthermore, the term “transgenic” has wider implications
since it could comprise animals which had addition, or deletion (knock out) of genes,
from the genome.
Transgenic technology is a fast method for introducing “new” genes in cattle,
swine, sheep, goats, chicken and fish. It is a more extreme methodology, but does
not differ in its essence from the long-term results obtained by classic genetics
(Wheeler, 2003). In this way, the techniques to generate transgenic models represent
one of the most promising biotechnologies for commercial use, as well as for different
areas of basic research.
Transgenic animal production has various applications, including generation of
animals with better or improved performance (Maclean et al.,2002; Karatzas, 2003),
animals as models to study human diseases (Duverger et al.,1996; Carter, 2004),
animals for the production of proteins of pharmacological interest (Brem et al.,1994;
Houdebine, 1994; Limonta et al.,1995; Wall, 1999; Hwang et al., 2004), animals for
the production of organs for transplant (xenotransplants) (Houdebine, 2000;
Niemann, 2001), and animals for gene expression and regulation - promoters and
coding sequences - (Montoliu, 2002; Giraldo et al.,2003). Current applications of
gene transfer in farm animals include the improvement of product quality and
quantity, disease resistance, production of valuable proteins in the mammary gland
or other organs, the genetic modification of pigs for the production of xenotransplants
and the generation of new animal models where rodent models are not useful or
practical for studying the problem under evaluation (Wolf et al., 2000).
The developmental costs and the inefficiency of the technique to produce
transgenic animals, particularly large animals, together with the fact that the majority
of interest characteristics are complexes and controlled by more than one gene, have
restricted the use of transgenesis in animal production (Clark and Whitelaw, 2003).
The present review will focus on the currently used techniques to generate
transgenic animals, the principal events in gene manipulation, and the main
applications of this biotechnology.
Methods to generate transgenic animals
During the past few decades, various methods have been developed to
generate transgenic animals. With the advent of gene sequencing, many sequences
13
have been determined, bringing the knowledge of promoters and genes of interest,
for various species. The advent of genomics, proteomics, and the new generation of
reproductive biotechnologies hold the promise of successful application of
transgenesis to domestic animals.
The techniques and methodologies to be implemented in the generation of a
transgenic animal depend on the targeted use of the animal. Many transgenic animal
models have been created to study gene function, to serve as bioreactors and as
models for new approaches in animal breeding (Houdebine, 2002a,c; Maclean et al.,
2002; Montoliu, 2002; Dyck et al., 2003; Houdebine, 2003; Niemann and Kues, 2003;
Baldassarre et al., 2004; Hwang et al., 2004; Keefer, 2004;). The objective of the
research will determine the costs and the tools necessary for the approach. A
summary of the main techniques used to generate transgenic animals is presented in
Fig. 1. These techniques comprise basically three forms of foreign DNA transfer:
DNA microinjection into the pronuclei, mass transfer of genes through gametes, and
somatic cell nuclear transfer (SCNT). Techniques using gene transfer mediated by
retro-transposons and retrovirus are also presented (Fig.1).
Figure 1. Main techniques used to generate transgenic animals.
Pronuclear Microinjection
Various methods can be used to produce transgenic animals. However, the
main method used to-date is the microinjection of genes into the pronuclei of zygotes
(Wheeler, 2003). Two decades ago, the microinjection of foreign genes into the
14
pronuclei of newly fertilized embryos was the most efficient technique to generate the
first transgenic mice (Gordon et al., 1980). In the 80’s, this method was used on
rabbits, pigs, and sheeps, and later on, on goats and cows. However, the efficiency
of this method in domestic animals is still low (Wolf et al., 2000).
Production of transgenic livestock by pronuclear microinjection of DNA into
fertilized zygotes is impaired by the low embryo survival and the low rate of
integration of the injected DNA into the genome (Maga et al., 2003; Auerbach, 2004).
The main obstacle with this method is that some copies of the foreign gene is
integrated randomly into the host genome and upset the expression of the transgene,
as well as the host genes. Generally, this method generates a mosaic transgenic
animal. Because of these limitations, a large number of embryos in the pronucleus
stage, need to be used in the experiment (Houdebine, 2002c). Thus, with the 500 to
5000 copies of the foreign DNA injected into the pronuclei, the mean progeny
obtained ranges from 1 to 4 %. This means that less than 1 to 4 transgenic animals
are obtained from a hundred injected cells. The lowest rate of success is obtained in
cattle. In pigs, the pronuclear DNA microinjection has long been the most reliable
method; however, even in this species, the efficiency of transgenic offspring
production is low, with only 1% of the DNA-injected embryos resulting in transgenic
animals (Nagashima et al., 2003).
The results obtained with this method vary greatly depending up on the
species. However, there is also within-species variation in the success rate
(Reviewed by Pinkert, 2002). The reasons for this difference are still not known, but
they are probably related to the inherent difference in the DNA repair mechanism or
intrinsic DNA integration process into host genome. Furthermore, the purity of the
exogenous DNA, the strategy used for the construction of the artificial molecule
(promoters and coding regions), and other factors involving cellular machinery, could
lead to the low efficiency of transgenesis in domestic animals (Clark et al., 1994;
Houdebine, 2002b).
The presence of lipids renders embryos of pigs and ruminants opaque, making
the manipulation difficult and decreasing the efficiency of pronuclei microinjection.
Centrifuging embryos before micromanipulation promotes the migration of the lipids
to one side of the cell, facilitating the visualization of the pronuclei.
The pronuclear DNA microinjection method is routinely used to generate
transgenic mice and some species of fish, despite the peculiar characteristics of the
15
latter. In fish, egg microinjection poses some difficulties, since fish egg has a thick
membrane. This membrane impairs the visualization of the nuclei during egg
fertilization and penetration of the glass micropipettes (Kang et al., 1999; Lu et al.,
2002).
According to Baldassarre et al., (2004), the production of transgenic goats
through the traditional method of DNA microinjection also presents low efficiency,
which discourages their use in advanced breeding programs. New alternatives
proposed by this research group, using laparoscopic ovum pick-up (LOPU-IVF) and
oocyte maturation in vitro prior to DNA microinjection, have shown interesting results.
These efforts routinely result in the birth of transgenic offspring, showing that the
established LOPU-IVF technology combined with pronuclear microinjection can be
successfully used to produce transgenic goats (Wang et al., 2002; Baldassarre et al.,
2004).
Although pronuclear microinjection has succeeded in the generating many
transgenic cows, the success rates of transgenesis is low in this species (Hodges
and Stice, 2003). The costs to produce a transgenic cow through pronuclear injection
are of the order of U$ 300.000,00 (Whitelaw, 2004). Hence, a more efficient system
of gene transfection that works in large animals is necessary. These inefficiencies
are one of the major obstacles to the large-scale use of pronuclear microinjection
techniques in livestock (Maga et al., 2003). Another method that has demonstrated
success recently, is the nuclear transfer or "cloning" (Wheeler, 2003).
Somatic Cell Nuclear Transfer (SCNT)
The first important results with SCNT were obtained in 1986 by Willadsen, with
the production of lambs cloned from nuclei of embryos at stage of 8 to 16 cells. This
result stimulated the interest in the use of nuclear transfer to multiply embryos
derived from animals with high agricultural value (Campbell et al.,1996). This
laborious method also offered new and attractive possibilities to animal transgenesis.
Montoliu, 2002 opines that animals obtained by nuclear transfer could be
considered as a group of transgenic animals when the nuclei used in the embryo
reconstruction originates from a cell that carries some genetic modification (addition,
substitution or alteration of some gene). In this sense, those embryos and animals
generated by nuclear transfer of cells genetically modified will also be, by definition,
16
transgenic, since they carry the initial modifications present in the nuclei of the donor
cell from which the animal originated.
Exogenous genes of interest can be transfected into somatic cells and later on
transferred by to pluripotent cells (cells of morulae or blastocysts). The resulting
chimera can transfer the exogenous gene to the offspring, which will be transgenic
(Wolf et al., 2000; Houdebine, 2002b). In this way, cultivated cells can be transfected,
and the insertion and expression of the transgene can be verified before using these
cells for producing cloned animals genetically modified (Bordignon et al., 2003).
Using this method, the DNA is randomly incorporated into the genome by
selective pressure; however, the transgenic cells can be fully characterized (site of
integration, number of integrated copies and integrity of the transgene) prior to use
for nuclear transfer. As a result, although the developmental capacity of
“reconstructed” nuclear transfer (NT) embryos is lower, the majority of animals born
are transgenic, making this technology much more efficient than pronuclear
microinjection. Somatic cell nuclear transfer has dramatically improved the efficiency
rates of transgenesis (Baldassarre et al., 2004). This approach would enable more
efficient and sophisticated genetic modification of pigs (Nagashima et al., 2003).
Gene replacement by homologous recombination can be presently achieved only in
somatic cells, used to generate genetically modified animals. Gene inactivation has
been accomplished in sheep (McCreath et al., 2000) and pigs (Lai and Prather,
2002). In pigs, the α-galactosyltransferase was knocked out in this way. The kidneys
from homozygous pigs have become resistant to hyperacute rejection when grafted
to experimental monkeys (Lai and Prather, 2002). Results obtained in cattle, sheep,
goats and pigs demonstrate that the majority of animals cloned from transfected
somatic cells express the transgene (Lai and Prather, 2002; Bordignon et al., 2003;
Nagashima et al., 2003; Niemann and Kues, 2003; Baldassarre et al., 2004).
Mass Transfer of DNA
Sperm-mediated gene transfer (SMGT)
The microinjection technique results in high success rates in mice, but it is not
an efficient method when applied to livestock (Lavitrano et al., 2003). Sperm cells are
considered by some authors as metabolically inert cells, since they do not have most
17
of the molecular and biochemical apparatus that exist in somatic cells engaged in
such functions as DNA replication, gene transcription, and protein synthesis. This
point of view has been corroborated, in some way, by their peculiar morphology,
characterized by the extremely reduced cytoplasmic compartment and the nucleus
which contains the genomic DNA compacted as condensed chromatin, connected to
a long flagellum. These morphological observations lead to the conclusion that the
only possible role of sperm cells is to act as vectors of their own genome during
fertilization. The first evidence that mammalian sperm cells were capable of
incorporating foreign DNA when incubated in solutions containing these
macromolecules were described by Brackett et al., (1971).
In 1989, Lavitrano et al., demonstrated for the first time that (a) the epididymal
sperm of the mouse can spontaneously incorporate plasmid DNA molecules; (b)
genetically modified offspring can be generated by the approach using sperm cells
containing plasmid, by in vitro fertilization procedures; (c) exogenous DNA
sequences are expressed in the progenitors, and (d) that the sperm-carried
exogenous DNA incorporated in the fertilized ovum, is transmitted from the parents to
the F1 progeny. These characteristics are conserved in a variety of species and
SMGT have been explored to generate genetically modified (transgenic) animals in a
variety of species.
The SMGT technique in vertebrates has gone through many adaptations in the
last 10 years, in different laboratories (Gandolfi, 2000). The incubation of sperm cells
with foreign DNA, followed by in vitro or in vivo fertilization, has generated transgenic
mice, rabbits, pigs, sheep, cows, chicken and fish. The definition and the
establishment of work protocols for SMGT that could be effectively applied to
different animal species would be of high value in biotechnology (Celebi et al., 2002).
In addition, this procedure does not require any particular equipment or ability, and
can be performed at field conditions. Another interesting aspect of the use of sperm
as DNA vectors is referred to as mass transgenesis. Contrary to microinjection,
which requires individual manipulation of the embryos, the genetic transformation of
a great number of embryos can be obtained collectively, in one step, by SMGT. This
can be of particular interest to transgenesis of aquatic animals including fish
(Spadafora, 1998).
Wu et al., (1990) revealed that the main binding site of foreign DNA in mouse
sperm is mediated by a complex structure of molecules from class II major
18
histocompatibility complex, located in the posterior region of the sperm head.
Associated DNA was also mainly located in the posterior area of the rabbit sperm
head (Lavitrano et al., 1997; Wang et al., 2003).
Attempts to elucidate the mechanism of DNA integration identified a complex
net of factors, secreted by and linked to the sperm, which modulates this interaction.
Carballada and Esponda (2001) identified two components in the mouse seminal
plasma: a DNAse from the seminal vesicle, and diverse exogenous DNA binding
proteins from the prostate. These components show inhibitory activity to exogenous
DNA sequestration. These authors (Carballada and Esponda 2001) suggest that the
mechanisms of control and uptake of exogenous DNA by mammalian sperm are
highly regulated and specific. In fact, seminal fluid strongly antagonizes foreign DNA
binding and, under normal conditions, is a strong protection of sperm cells against
foreign DNA (Celebi et al., 2003). A specific inhibitor of the DNA binding reaction
factor (IF-1), was identified in the membrane surface of sea-urchin sperm (Arezzo,
1989). IF-1 is a glycoprotein and its inhibitory activity is linked to the polysaccharide
component. In fact, the ability of IF-1 to inhibit DNA binding can be completely
removed by pre-incubation with glycosidases. IF-1 binds to the subacrosomal
segment of sperm head, which is the same area aimed by the foreign DNA, and can
exert its inhibitory effect in heterologous as well as homologous sperm. Therefore, IF-
1 has an important natural role, acting as a barrier and protecting epididymal sperm
against the entry of undesirable exogenous molecules, which could compromise the
sperm integrity and the genetic identity of the future progeny (Spadafora, 1998;
Spadafora et al., 2002).
The ability of rabbit sperm to take up foreign DNA from the incubation media
was tested by Wang et al., (2003), when spermatozoa were incubated with plasmid
vector marked with tetramethylrodamine-6-dUTP. After incubation, spermatozoa
were treated with DNAse I and evaluated by fluorescent microscopy. The results of
this study demonstrated that rabbit sperm cells have the capacity to take up
exogenous DNA from the media.
In domestic animals including cattle and pigs, SMGT is applied by the
exploitation of the normal artificial insemination (AI) procedure used by the farmers.
The fresh semen is collected from donor animals and repeatedly washed to remove
seminal plasma by sequential centrifugations. Sperm cell suspensions are incubated
19
with the foreign plasmid DNA (around 1 h at 18ºC), diluted in an appropriate media
and used for AI (Shemesh et al., 2000).
Sasaki et al., (2000) demonstrated that significant loss of motility occurs in
murine epididymal sperm incubated with complexes of DNA-liposomes, in keeping
with the concentrations of the foreign DNA. Also, in vitro fertilization (IVF) rate
decreases as the DNA concentration increases.
Alternative techniques to promote better incorporation of foreign DNA are
being tested. To increase DNA uptake by the sperm cell, non-polar detergents,
including Triton and Tween which promote destabilization of sperm membrane, could
be used. Similar results have been obtained through sperm freezing and thawing.
The chromatin cleavage by restriction enzymes in the sperm genome site, but not in
the foreign DNA site, triggers repairing mechanisms and increases the possibilities of
integration of the foreign DNA of interest. This method is known as restriction enzyme
mediated integration (REMI). REMI utilizes a linear DNA derived from a plasmid by
the cleavage with a restriction enzyme, which originates a cohesive end in one of the
strips. The linear DNA with the cohesive end is then introduced, together with the
restriction enzyme, into the sperm cells by lipofection or eletroporation. It is believed
that the restriction enzyme cleaves the genomic DNA at the sites that allow the
integration of the exogenous DNA by the pairing of the cohesive ends (Khoo et al.,
1992; Khoo, 2000; Sparrow et al., 2000).
Another interesting alternative method is the direct injection of sperm treated
and incubated with foreign DNA, into the oocyteby the method known as intra-
cytoplasmic sperm injection (ICSI). ICSI was successfully used in mice to transfer
long fragments of DNA, as in yeast, bacteria and other artificial chromosome
constructs (YACs or, BACs and MACs) (Giraldo et al., 1999; Giraldo and Montoliu,
2001; Moreira et al., 2004). The potential use of more recent approaches, such as
REMI and ICSI are also being explored (Khoo, 2000).
The use of electroporation of sperm incubated in isosmotic solutions
containing DNA has been described in some species. Electroporation of sperm
subjected to osmotic differential demonstrated an increase in foreign DNA uptake by
fish sperm cells (Kang et al., 1999; Collares et al., 2004). However, the generation of
transgenic animals by osmotic differential SMGT alone has not been described to
date. Wang et al., (2003) demonstrated that 66% of rabbit spermatozoa incubated
with lipofectin and marked foreign DNA carried the foreign DNA. Cationic detergents
20
have been used with the intent of promoting sperm membrane solubility, thus
allowing the entry of marked foreign DNA. Sin et al., (2000) showed that
electroporated salmon sperm cells were more efficient and more reliable for picking
up foreign DNA and subsequently transferring the DNA into salmon embryos, than
untreated sperm. Indirect evidence suggests that some of the foreign DNA was
internalized in the sperm nuclei and the incorporated DNA retained its integrity as
demonstrated by PCR (Symonds et al., 1994).
Chang et al., (2002) present an extremely interesting strategy for generating
transgenic animals, using incubation of sperm cells with marked foreign DNA and
monoclonal antibody (mAb C). mAb C is a basic protein that binds to DNA through
ionic interaction, allowing foreign DNA to be linked specifically to sperm. This linker
protein is reactive to a surface antigen on sperm of all tested species, including pig,
mouse, chicken, cow, goat, sheep, and human. It is important to note that foreign
DNA uptake mediating mechanisms are integral parts of the biology of the species
that have sexual reproduction.
Accordingly to Lavitrano et al., (2003), SMGT is highly efficient and relatively
cheap, and can be used in species refractory to microinjection. The use of
spermatozoa as noninvasive delivery vehicles to transfer foreign DNA into oocytes
during in vitro fertilization has provided a new alternative to the approach in
generation of transgenic animals (Lazzereschi et al., 2000; Spadafora, 2002).
Sperm-mediated “Reverse” Gene Transfer
Sciamanna et al., (2003) demonstrated the presence of an active reverse
transcriptase (RT) in murine sperm. RT can reversely transcribe a foreign viral RNA
into cDNA fragments that can be subsequently transferred to embryos during
fertilization. The RNA vector was incorporated by sperm cells, reverse transcribed
and transferred to in vitro-derived embryos which eventually will be passed on to their
F1 progeny. These results suggests that the reverse transcribed cDNA molecules are
maintained as extra-chromossomal structures replicating autonomously, while the
integration into the host genome would rarely occur.
It has been shown that the sequenced human genome contains 223 bacterial
genes (Lander et al., 2001). Probably, multiple independent gene transfers from
different bacteria occurred during the evolution of the human genome. Some
21
introduced genes appear to be involved in important physiological functions and have
been fixed during evolution, because of the selective advantage they provide (Lander
et al., 2001). Would a highly gene-mediated mechanism to ensure the genetic
identity of sexually reproducing species exist? Do gametes have more extensive
evolutionary functions?
Although strong natural barriers exist against sperm-mediated gene transfer,
such barriers are unlikely to be absolutely inviolable (Smith, 2002). Sciamanna et al.,
(2003) demonstrated that sperm endogenous reverse transcriptase (RT) has the
potential to reverse-transcribe exogenous RNA, generating transcriptional competent
sequences that are transmitted to the progeny upon fertilization. This event, if proved
to occur in nature, would reveal its profound implications to human health and to
evolutionary processes.
This assumption is supported by the previous findings that extra-
chromossomal structures are frequently hosted by eukaryotic nuclei. Indeed,
transgenic sequences can generate extra-chromossomal structures that are
transmitted to the next generation, as documented in transgenic animals obtained by
SMGT of mammals, birds, fish and insects (Giordano et al., 2000; Sciamanna et al.,
2000; Spadafora, 2002).
Testis-mediated gene transfer (TMGT)
Other approaches have also been developed for making transgenic spermatozoa.
One of these is the testis mediated gene transfer approach which is considered as a
simplified variation of SMGT, since it does not require IVF or embryo transfer (ET)
procedures.
The testis is also considered an immune-privileged site. Transferring genes into
specific cell types of the testis in vivo should provide a tool to study the regulation of
spermatogenesis at the molecular level (Blanchard and Boekelheide, 1997).
Liposome- based methods have successfully generated transgenic mice and fish by
TMGT (Lu et al., 2002; Celebi et al., 2003; Zhao et al., 2003).
The mechanism of gene transfer into epididymal spermatozoa by injection of a
DNA-transfectant complex into the testis is under study. However, it is suggested that
foreign DNA introduced into the testis is rapidly transported to epididymal ducts via
22
the rete testis and efferent ducts, and then incorporated by epididymal epithelial cells
and epididymal spermatozoa (Sato et al., 2002).
Round plasmid carrying the reporter gene lacZ mixed with lipossomal complexes
were injected into mouse seminiferous tubules, prior to subjecting them to natural
mating. The presence of the foreign gene was observed in the progeny, but in
episome–like form (Celebi et al., 2003). The efficiency of gene transfer was improved
more than 80% by injecting multiple doses of the liposome-transgene mixture into the
gonads of treated males (Lu et al., 2002). More than 80% of morula-stage embryos
generated by means of TMGT using liposomes, expressed EGFP, as revealed by
fluorescence microscopy (Yonezawa et al., 2001). High incidences of mosaicism, as
well as a decrease in the rate of cells carrying foreign DNA during embryo
development, have been noted with this technique, suggesting that TMGT efficiency
is directly related to liposome characteristics (Yonezawa et al., 2001).
Another strategy for foreign gene introduction employs adenovirus vector solution
injected into the interstitial space (intratesticular injection) or seminiferous tubules
(intratubular injection) of the mouse testis. Although spermatogenesis is slightly
impaired and the inflammatory response caused by these methods may present
some problems, the results suggest that adenovirus mediated gene transfer may be
effective for transfecting testicular somatic cells and that this approach may be
applicable for in vivo gene therapy for male infertility in the future (Kojima et al.,
2003). In general, the results also suggest that TMGT could be applicable to fetal
gene therapy, as well as to the generation of transgenic animals (Yonezawa et al.,
2001).
Retroviruses and Transposon -mediated gene transfer
The retrotransposons and retroviruses are vectors with highly efficient intrinsic
capacity of integration into the genome (Linney et al., 1999; Houdebine, 2002b).
Retroviral vectors are currently being used because of their ability to integrate the
foreign gene into the host genome with high efficiency. Retroviruses and
retrotransposons belong to this category of natural gene delivery vehicles to
mammalian cells (Houdebine, 2003). Vectors based on lentivirus have been shown
to be an efficient transgene delivery system (Hofmann et al., 2003; Whitelaw, 2004).
Whitelaw et al., (2004) used a vector derived from equine infectious anaemia virus to
23
carry a green fluorescent protein expressing transgene and showed that 31% of the
injected/transferred eggs resulted in a transgenic founder animal and 95% of the
founder animals displayed green fluorescence. This method is more efficient than the
standard pronuclear microinjection, indicating that lentiviral transgene delivery may
be a general tool to generate transgenic animals (Rottmann et al., 1991; Hofmann et
al., 2003; Whitelaw et al., 2004).
Simple structure and easy laboratory handling of transposome vectors are
coupled with efficient and stable transgene integration and persistent, long-term
transgene expression by transposome-mediated gene transfer (Ivics and Izsvak,
2004). Transposomes are DNA sequences which contain at least one gene coding
for a transposase and motives located on both ends, to trigger integration.
Transposome sequences are transcribed into RNA, which drives transposase
synthesis. The RNA is retrotranscribed in DNA, which integrates in the multiple sites
of the genome under the action of the transposase (Houdebine, 2002b). The
transposome vectors must be transcomplemented with a plasmid capable of
expressing the transposase gene required for the integration of the recombinant
transposome. In practice, a circular plasmid containing a construct capable of
expressing the transposase gene is injected with the recombinant vector. This allows
the integration of the foreign gene with the vector whereas the assistant plasmid is
rapidly degraded (Dupuy et al., 2002; Houdebine, 2002b; Kawakami et al., 2004).
Grabhera et al., (2003) tested the Sleeping Beauty (SB) transposable element
for its ability to efficiently insert transgenes into the genome of medaka (Oryzias
latipes), an important model system for vertebrate development. These investigators
demonstrated that the SB transposome efficiently mediates integration of a reporter
gene into the fish germ line with a transgenesis efficiency of 32% .The efficiency of
transposome-mediated germline transformation is dependent on the mobility of
transposomes in the host embryo, and on the detectability of the used transformation
marker (Horn et al., 2000). These features contribute to the usefulness of
transposable elements as tools for vertebrate functional genomics, as well as for
animal biotechnology and human gene therapy (Ivics and Izsvak, 2004). These
aspects will be of great interest to the field of evolutionary developmental biology and
to modern pest management programs (Horn et al., 2000).
24
Genes of interest and detection of the transgene
Among the genes of direct interest for animal production application are the
GH (growth hormone), the IGF-I and II (Insulin-like Growth Factors), and the
hormones secreted by muscle, fat cells and stomach (leptin, adiponectin, myostatin,
ghrelin), which regulate feed intake, energy metabolism, and body composition.
Through genetic manipulation, there is the potential to exploit these genes in a range
of livestock species.
Bovine GH over-expression in rabbits did not produce positive results on
growth (Costa et al., 1998). The high level of expression was accompanied by the
over-expression of IGF-I and, as consequence, resulted in the development of
acromegaly and diabetes mellitus.
In contrast to the effects observed with the introduction of GH in large animals,
the majority of GH - introduced fish species showed a marked effect in growth (Hinits
and Moav, 1999; Martinez et al., 1999; Rahman and Macclean, 1999; Morales et al.,
2001). For example, 10% gain in food conversion and a 2, 62 to 2, 85 fold higher
growth rates in transgenic than in non-transgenic salmon were obtained by Cook et
al., (2000). Other investigators have presented positive results, among them the
research of Du et al., (1992), with transgenic fish manifesting 2 to 6 fold higher
growth than non-transgenic fish. Even higher results were obtained by Devlin et al.,
(1994) with coho salmon (Oncorhynchus kisutch), where the transgenic fish were 11
times faster in growth than control salmon. The insulin-like growth factors (IGF-I e o
IGF-II) produced in the liver, bones and other tissues, mediate some of GH functional
effects (Strobl and Thomas, 1994). IGF-I has proved to be of more use as a growth
reporter/selection marker in pigs, than as a viable treatment. However, a niche for
this product could exist in the manipulation of neonatal growth, causing a life-long
change in lean: fat ratio (Sillence, 2004).
Other genes of interest are related to food metabolism and disease resistance.
For example, a reduction up to 75% in fecal phosphorus output was observed in
transgenic pig expressing phytase gene in saliva, thus showing an effect on the
digestion of dietary phosphorus (Golovan et al., 2001). Antibacterial proteins, such as
lysostaphin, can be used to confer resistance to bovine mammary gland infection.
This protein has potent anti-staphylococcal activity and its secretion into milk
25
conferred substantial resistance to infection in three lines of transgenic mice (Kerr
and Wellnitz, 2003).
Initially, the introduced foreign gene in a transgenic system was detected by
PCR and Southern blot; however, now a day the detection system is built-in in the
transgene so that its own expression can be evaluated. Among the detection
systems built-in the construct are CAT, Luc, Lac-Z (Gibbs and Schmale, 2000;
Maclean, et al., 2002), and more recently, GFP in swine (Whitelaw, 2004). The main
methods used for transgene detection in transgenesis in animals, are presented in
Table 1.
A rapid and simple method based on PCR was presented by Nam et al.,
(2003) for analysis of transgenic fish using small amounts of tissue. This method
allows the screening of a large amount of larvae, but the cost of analysis is higher
compared to the visual methods based on fluorescence. In spite of the problems
GFP expression or other fluorescent protein could present, their use as reporter
genes seems to be the best choice.
26
Table 1. A summary of the principal techniques involving gene transfer for generation
transgenic animal
Biological
model
Technical Detection Reference
Rabbit DNA Microinjection method and in
vitro cultivation
RT-PCR Bodo et al.,2004
SMGT - Liposome PCR; GE Wang et al.,2003
Mouse SMGT SB; GE Lavitrano et al.,1989
SMGT GE, SB,
FISH
Chang et al.,2002
SMGT PCR, GE Sciamanna et al.,2003
Celebi et al.,2003
TMGT- Adenovirus GE Kojima et al.,2003
TMGT – Liposome --------- Yonezawa et al.,2001
TMGT - Liposome PCR; SB Zhao et al.,2003
Cattles SMGT - Eletroporation PCR Gagne et al.,1995
Infection of bovine oocytes with
lentiviral vectors
Hofmann et al.,2004
SMGT - Eletroporation PCR / HR Rieth et al.,2000
SMGT PCR, GE Shemesh et al.,2000
SMGT PCR Sperandio et al.,1996
SMGT GE Rottmann et al.,1996
Pigs Lentiviral microinjection PCR Whitelaw et al.,2004
SMGT SB Sperandio et al.,1996
SMGT – monoclonal antibody GE; SB, FISH Chang et al.,2002
Goats Pronuclear microinjection PCR; SB Baldassarre et al.,2003
SMGT – monoclonal antibody GE; SB, FISH Chang et al.,2002
Fish
SMGT DB; GE;
PCR, SB
Jesuthasan and
Subburaju., 2002
Khoo, 2000
Transposon - mediated GE Kawakami et al.,2004
Transposon - mediated PCR, GE Grabhera et al.,2003
SMGT/Electroporation PCR; Sin, et al.,2000
SMGT/Electroporation/
Osmotic Differencial
PCR, GE Kang et al.,1999
Collares et al.,2004
SMGT
TMGT - Lipossome
PCR,SB Lu et al.,2002
SB= Southern blot; PCR= polymerase chain reaction; FISH (fluorescent in situ hibrization). RT-PCR=
real-time polymerase chain reaction; SMGT= Sperm-Mediated Gene transfer; TMGT = Testis-
Mediated Gene Transfer. HR= Homologous Recombination; GE = Gene Expression.
27
Regulatory sequences and artificial chromosomes (YAC, BAC, and MAC)
Genes in eukaryotic organisms have regulatory regions that participate in the
control of their expression. Sequences of 150-200 nucleotides called promoters are
part of these regulatory regions and are located near the transcription initiation sites
(Houdebine, 2003; Hu et al., 2004). The promoters define the level and tissue
specificity of genic expression. Thus, the transgene should have, besides the target
gene, regulatory sequences in the upstream region and the poliadenilation signal in
the downstream region of the construct. Other elements which participate in the
genic expression control are the enhancers, the insulators, the silencers and the
locus control region (LCR), which contains different enhancers or insulator elements
(Guglielmi et al., 2003; Houdebine, 2003). The presence of introns in the gene
constructions also can lead to a more efficient expression (Petitclerc et al., 1995;
Rocha et al., 2004) or to a less efficient expression if their sequences contain
silencers (Lin et al., 2004).
The first promoters used in gene constructs were derived from human genes
since there was a lack of knowledge of the target species sequence. Other promoters
used include CMV (cytomegalovirus), β-actin genes, myosin light chain, WAP (Whey
Acidic Protein), a protein expressed in salivary gland (Golovan et al., 2001),
primordial cells (Yoshizaki et al., 2000), and gene P12 expressed in male accessory
gland (Dyck et al., 1999). The CMV promoter present in various commercial vectors
drives the expression predominantly to nervous tissue. The β-actin promoter has
been fused to the growth hormone (GH) gene to direct the expression to muscular
tissue. The light chain myosin promoter was used by Gong et al., (2003) to express
different fluorescent proteins in zebrafish muscle. Extremely high levels of the target
protein were observed in the transgenic products, demonstrating the potential use of
fish muscle to synthesize proteins of interest. The WAP gene promoter was used by
Limonta et al., (1995) to direct the hGH expression to transgenic rabbit mammary
gland. Besides the WAP promoter, the ovine β-lactoglobulin, the goat β-casein, and
the bovine S1-α-casein promoters drive the expression of milk secretion (Whitelaw et
al., 1991; Brink et al., 2000, Parker et al., 2004). The promoters can also be used to
mark cells, as was demonstrated by Yoshizaki et al., (2000). The authors used the
promoter RtVLG to drive the expression of GFP (green fluorescent protein) to
28
rainbow trout primordial cells. The promoter P12 was used by Dyck et al., (2003) to
express human GH in transgenic mice seminal vesicle epithelium. GH was secreted
in the seminal fluid ejaculated, with the seminal vesicle lumen contents containing
GH concentrations of up to 0.5 mg/ml.
The transcription enhancers are sequences found upstream or downstream of
the promoters and generally have multiple sites for transcription factors. The
enhancers increase the transcription rate and direct the expression to a specific
tissue. Glasser et al., (2005) demonstrated that an enhancer located in the proximal
region of a 4.8KB SP-C is essential to the expression of pulmonary surfactant protein
C. A distal and a proximal upstream element, as well as a downstream-located
enhancer of pseudo-allelic versions of FoxD5 genes of Xenopus laevis, contribute to
transcription (Schon et al., 2004). Besides, the downstream enhancer cooperates
with the proximal upstream element and also contributes to the spatial expression.
The insulators or chromatin borders are DNA sequences that have the
capacity of establishing genomic barriers, protecting DNA sequences from the
neighbor heterochromatin expansion, and have the potential to interfere with the
activity of enhancers distally located (Giraldo et al., 2003). A comparative analysis of
the use of insulators in transgenic animals, produced from heterologous constructs,
was presented by Giraldo et al., (2003). A functional analysis of suHw insulators was
made by Majumder and Cai (2003) in Drosofila embryos. The suHw insulator is a
sequence of 340-bp present in the gypsy retrotransposon. It was observed that the
pairing of type suHw insulators or even suHw heterologous with other insulators
could increase the enhancers blocking activity, suggesting that insulators can act
independently or additively. In transgenesis, insulators are used to protect a
transgene against chromatin position effects at their genomic integration sites, and
they are able to maintain transgene expression for long periods of time (Recillas-
Targa et al., 2004). One application of the insulator type element in the transfection
of animal cells was presented by Yao et al., (2003). The authors succeeded to block
the silencer in transgenic mice using insulator elements to avoid the retrovirus
blocking. Retroviral vector silencing is of interest to mark stem cells and for studies of
gene manipulation, because it can compromise therapeutic gene expression during
the application of gene therapy (Yao et al., 2003).
Restricting transgene expression to specific cell types and maintaining long-
term expression are major goals for gene therapy (Kim et al., 2004). Therefore, the
29
development of systems to induce expression of transgene that could control time
and tissue expression, and the development of methodologies to direct construction,
are desirable for the control of gene expression, insertion efficiency, and loci
incorporation into genomes (Rocha et al., 2004). Recent advances in transgenic
technologies to generate temporally and spatially restricted targeted gene disruptions
are promising for the understanding of epididymal genes involved in sperm
maturation process (Lye and Hinton, 2004).
Although plasmid and viral gene delivery systems have been used
successfully to introduce genes of interest into mammalian cell lines and transgenic
animals, they are limited with regard to the amount of foreign DNA sequence that can
be delivered (Lindenbaum et al., 2004). Potential problems of conventional
transgenes include insertional disruption of the host genome and unpredictable,
irreproducible expression of the transgene by random integration (Katoh et al., 2004).
Artificial chromosomes (engineered mini-chromosomes and other
chromosome-based DNA constructs) are promising new vectors for use in gene
therapy, protein production and transgenesis. Artificial chromosomes are able to
carry extremely large DNA fragments of more than one megabase (Mb) (Oberle et
al., 2004).
The use of YAC (yeast artificial chromosome) and BAC (bacterial artificial
chromosome), constructs is usually associated with optimal performance in
transgenic experiments. The size of their genomic inserts habitually ensures the
inclusion of most regulatory elements that are relevant for the right expression of a
given gene. Therefore, artificial chromosome-type transgenes are normally
expressed in spatially and temporally correct manners (Giraldo et al., 1999; Giraldo
and Montoliu, 2001; Montoliu, 2002; Oberle et al., 2004).
The generation of artificial chromosomes, known as MACs (mammalian
artificial chromosomes), are expected to incorporate all the benefits of the classical
artificial chromosome-type vectors while maintaining the normal chromosomal status
within the mammalian host cells (Montoliu, 2002). Compared to traditional
methodologies, MACs offer significant advantages for cellular protein production,
animal transgenesis and gene-based cell therapy applications on account of their
capacity for carrying large constructs and ability to self replicate without relying on
integration into the host genome. Despite the numerous advantages of MAC
technology, systematic limitations have precluded its widespread implementation.
30
These limitations include the requirement for de novo chromosome synthesis for
each individual application, the inability to shuttle MACs easily across various cell
types and the inability to precisely engineer gene targets onto the artificial
chromosome. For broad applicability of MAC technology, all of these limitations must
be addressed (Lindenbaum et al., 2004).
The intra-cytoplasmic sperm injection (ICSI) method for the stable
incorporation and phenotypic expression of large yeast artificial chromosome (YAC)
constructs has been able to produce founders exhibiting germ line transmission of an
intact and functional transgene. Compared with the standard pronuclear
microinjection method, the efficiency of the ICSI-mediated YAC transfer system by
co-injecting spermatozoa and YACs into metaphase II oocytes has been significantly
greater (Moreira et al., 2004).
The benefits of artificial chromosomes in transgenesis will soon be exported to
biotechnological applications, including the production of recombinant proteins of
interest in the mammary gland of transgenic animals, with the hope that animal
transgenesis will eventually become more reproducible, efficient, and predictable
(Montoliu, 2002).
Applications of transgenesis
Livestock production
Enhanced prolificacy and reproductive performance, increased feed utilization
and growth rate, improved carcass composition, improved milk production and/or
composition, and increased disease resistance are practical applications of
transgenesis in livestock production (Wheeler, 2003; Gerrits et al.,2005).
The first livestock targeting experiments have been directed at engineering
animals either to render their organs immunologically compatible for use as human
transplants, or for improving the commercial production of recombinant proteins in
the transgenic mammary gland (Thomson et al., 2003).
Alpha-Lactalbumin plays a role in lactose synthesis and in the regulation of
milk volume. Transgenic hemizygous sows over-expressing the milk protein, bovine
alpha-lactalbumin produced as much as 0.9 g bovine alpha-lactalbumin per litre of
milk obtained from the sow (Wheeler et al., 2001). A higher weight gain (days 7-21
31
after parturition) of piglets suckling alpha-lactalbumin gilts was also observed.
Therefore, the over-expression of milk proteins in transgenic sows could contribute to
a better lactation performance of pigs (Noble et al., 2002).
Transgenic cows containing extra copies of the genes encoding bovine beta-
and kappa-casein (CSN2 and CSN3, respectively) produced milk with an 8-20%
increase in beta-casein and twofold increase in kappa-casein levels (Brophy et
al.,2003). This work showed that it is feasible to substantially alter a major
component of milk in high producing dairy cows by the transgenic approach to
improve the functional properties of dairy milk.
Alteration of the protein composition of the wool fiber via transgenesis with
sheep wool keratin and keratin associated protein (KAP) genes may lead to the
production of fiber types with improved processing and wearing qualities (Bawden et
al., 1998). These authors obtained wool fibers with higher luster and reduced crimp,
as a result of alterations in their micro and macrostructure due to a higher level of
cortical-specific expression of a wool type II intermediate filament (F) keratin gene.
Application as Bioreactors
The production of therapeutic proteins represents the first application of
recombinant DNA technology (Walsh, 2003). By the 2003, the European Union had
approved 88 products. However, none of these approved products were obtained in
transgenic systems. Despite this, domestic animals represent an efficient production
system for large and complex (and biologically active) recombinant proteins which
could be used to treat or prevent human diseases. The production of these
pharmaceutical proteins in the mammary gland of livestock originated the term
biopharming (Keefer, 2004). Transgenic rabbits, sheep, goats, pigs and cattle
express heterologous proteins have been have been produced successfully by
various investigators (Lubon et al., 1996; Paleyanda et al., 1997; Houdebine, 2000;
van Berkel et al., 2002, Fan and Watanabe, 2003). The production of
biopharmaceuticals presents the most varied purposes (Rutovitz and Mayer, 2002):
for treating such diseases as multiple sclerosis, hepatitis, cystic fibrosis, blood
disorders, some types of cancers, hemophilia, thrombosis, growth disorders,
Pompe’s disease, osteoporosis, Paget’s disease and anemia, and for improving
infant’s formula.
32
Initially the use of transgenic animals as bioreactors focused on the use of
mammary gland as target organ (Whitelaw et al., 1991, Wright et al., 1991; Van Cott
et al., 1999, Houdebine, 2000; Wheeler et al.,2001, An et al.,2004). For example,
human protein alpha-glycosidase is secreted in the milk of transgenic rabbit. It has
been successfully used to treat patients who are genetically deficient in this enzyme
(Fan and Watanabe, 2003). However, nowadays other systems are being evaluated,
including the excretion of specific proteins in mouse urine (Ryoo et al., 2001) and in
pig semen (Dyck et al., 2003).
An interesting alternative for the production of therapeutic proteins is to use
the initial developmental stage of embryos of some species of fish (Hsiao and Tsai,
2003; Hwang et al., 2004; Morita et al., 2004). Hwang et al., (2004) demonstrated the
production of factor VII in fertilized eggs of zebrafish, catfish, African catfish, and
tilapia. However, the method used for introducing the transgene into the embryo was
the micromanipulation, which is extremely laborious.
The search for other animal models, and other tissues for protein production,
continues because of the cost involved in obtaining a large transgenic animal such as
a cow. Even in goats which serve as a better model than cattle for transgenesis,
there are some adverse effects on the mammary gland due to the production of
certain proteins. Also, the necessary post-translational protein modifications are not
invariably realized even in the mammary gland epithelium (Houdebine, 2002b). All
these point to the fact that an efficient and inexpensive system of producing
transgenic animals, is yet to be found in spite of the advances already achieved in
this area.
Applications for organ donation
An organ transplant between discordant (non-related) species is defined as
xenotransplants this procedure is usually associated with a hyperacute rejection
response (HAR) that destroys the transplanted organ within minutes (Niemann,
2001). The HAR occurs as a result of pre-formation of antibodies and complement
activation and it can cause irreversible vascular damage and cellular necrosis
(Lazzerechi et al., 2000). Some authors consider the pig as the best organ donor
because of various reasons: their organs have anatomical and physiological
similarities to human organs, they have short reproductive cycle and large number of
33
offspring at a time, they can be maintained with a high level of hygiene at relatively
low cost, and they are a domesticated species (Lazzerechi et al., 2000; Niemann and
Kues, 2003). Despite these advantages, it is still necessary to avoid the HAR that
occurs in xenotransplants from pigs to humans. In the attempt to avoid this problem,
some groups have developed transgenic pigs (hDAF) expressing species-specific
complement activation system inhibitors (Lazzerechi et al.,2000) as well as HLA-DP
and HLA-DQ pigs, which, being more similar in the HLA-II system leads to decrease
in allotransplant rejection (Tu et al.,2003; An et al.,2004; Pohajdak et al.,2004). Other
points to be considered include the differences in growth and life span between
humans and pigs, and the potential for disease transmission from the xenotransplant
to the recipient. Preventing the potential transfer of pathogenic microorganism,
especially of porcine endogenous retrovirus (PERV) is a major prerequisite in the use
of pig organs as xenotransplants (Niemann, 2001). Production of pigs under
specified pathogen-free conditions is not totally effective in eliminating the risk of
infection by PERVs. To reduce the release of PERVs by porcine transplants, a new
approach, using synthetic short interfering RNAs (siRNAs) corresponding to different
parts of the viral genes gag, pol, and env, was applied by Karlas et al., (2004). This
strategy was efficient in the suppression of PERV replication. Moreover, the use of
cells or organs from transgenic pigs producing short hairpin RNAs (shRNAs) should
increase the safety of xenotransplants (Karlas et al., 2004).
Another group of animals with the potential as organ donors is fish. For
example, a group of Canadian investigators has produced transgenic tilapia in which
the islets of β cells in the Brockmann body synthesize human insulin. These
transgenic fish could serve as donors of islets for xenotransplants, even in the
encapsulated form (immunoisolated), because they display higher hypoxia resistance
than mammals (Pohajdak et al., 2004). It should also be considered that the costs for
producing SPF animals and the collection of the islets from tilapias would be much
lower compared to swine. Furthermore, the potential for transmission of xenozoonotic
infections is lower with transplanted fish cells because of the larger phylogenetic
distance between teleosts and humans.
34
Applications as models for disease process
Analysis of disease processes and questions related to developmental biology
require more elaborated models than those involving the expression or knock out, of
one or more genes (Ryding et al., 2001). Nevertheless, genetically modified
laboratory animals provide a powerful approach for studying gene expression and
regulation, and allow the direct examination of structure-function and cause-effect
relationships in pathophysiological processes and development (Fan and Watanabe,
2003; Kimura-Yoshida et al., 2004). However, it is necessary to direct the expression
to a specific tissue and to control the levels of expression.
The use of DNA microinjection to produce transgenic animals to serve as
human disease models is not practical or meaningful since, this method does not
offer any control over the number of copies integrated and the sites in the genome
where integration takes place (Petters and Sommer, 2000). On the other hand, Chen
et al., (2004) demonstrated that foreign DNA could effectively be introduced into the
cells of cornea, retina and lens of birds through electroporation of the eggs.
Electroporation offers a faster and easier way to manipulate gene expression during
embryo development (Chen et al., 2004).
The animal commonly used as the model for studying human disease process
is the mouse (Giraldo and Montoliu, 2001; Guglielmi et al., 2003). Diseases studied
using the mouse model include sickle cell anemia, amyotrophic lateral sclerosis,
chronic hypertension, retinal degeneration, osteogenesis imperfecta, cystic fibrosis,
mitochondrial cardiomyopathy and neurodegenerative disease, Werner syndrome,
rhodopsin mutations and retinitis pigmentosa, melanoma, Alzheimer’s disease,
prostate cancer and atherosclerosis (Shapiro et al.,1995; Petters and Sommer, 2000;
Karnani and Kairemo, 2003; German and Eisch, 2004; Venkateswaran et al.,2004).
However, other organisms as rabbits, cows, pigs, and fish can potentially be used to
model human diseases (Duverger et al., 1996; Bõsze et al., 2003; Fan and
Watanabe, 2003). Transgenic rabbits expressing human genes have been used as
models for arterioscleroses, cardiovascular disease, acquired immune diseases
(AIDS), and cancer (Duverger et al., 1996; Fan and Watanabe, 2003).
The generation and analyses of transgenic animals carrying different
constructs that lead to different phenotypes will be among the initial steps to the
35
understanding of the relationship between different genes and the role of each one in
the development of the organisms.
Perspectives
The search for new strategies that improve animal transgenesis could
potentially promote significant advances in basic and applied biology. This possibility
and the potential for economic benifit have stimulated the development of a new
industry. As a result, different methods to improve the efficiency of production of
transgenic animals are constantly being tested.
Microinjection has made significant progress in transgenic research, and it will
continue to be the method of choice until efficient mass gene transfer techniques (for
example, SMGT, TMGT, and cell line transfection) become available. The application
of methodologies that improve mass gene transfer techniques, such as lipofection
and electroporation, in transgenic research is still in its developmental stage. Further
tests of these methods using a wider range of organisms may provide more
information on their suitability for use in gene transfer, routinely.
The use of transgenic animal models, together with the actual molecular
biology tools, will help to identify the role of specific genes in molecular, biochemical,
physiological and endocrine events in development and disease processes in
animals and humans. Parallel advances in the localization and characterization of
genes that control quantitative traits will contribute to the understanding of the
variability of transgenic products generally encountered when these techniques are
applied to livestock production. Significant improvements have been achieved in
transgenic animal generation in the past few decades. However, for some species, a
more efficient and low cost production system needs to be developed.
36
Reference
An J, Li ZL, Huang WM, Huang WJ, Li J. 2004. Expression of human tissue-type
plasminogen activator in cow mammary gland. Di Yi Jun Yi Da Xue Xue Bao, 24:546-
552.
Arezzo F. 1989. Sea urchin sperm as a vector of foreign genetic information. Cell
Biol, 13:391-394.
Auerbach AB. 2004. Production of functional transgenic mice by DNA pronuclear
microinjection. Acta Biochim Pol, 51:9-31.
Baldassarre H, Wang B, Kafidi N, Gauthier M, Neveu N, Lapointe J, Sneek L,
Leduc M, Duguay F, Zhou JF, Lazaris A, Karatzas CN. 2003. Production of
transgenic goats by pronuclear microinjection of in vitro produced zygotes derived
from oocytes recovered by laparoscopy. Theriogenology, 59:831-839.
Baldassarre H, Wang B, Keefer CL, Lazaris A, Karatzas CN. 2004 State of the art
in the production of transgenic goats. Reprod Fertil Dev, 16:465-470.
Bawden CS, Powell BC, Walker SK, Rogers GE. 1998. Expression of a wool
intermediate filament keratin transgene in sheep fibre alters structure. Transgenic
Res, 7:273-87.
Blanchard KT, Boekelheide K. 1997. Adenovirus-mediated gene transfer to rat
testis in vivo. Biol Reprod, 56:495-500.
Bodo S, Gocza E, Revay T, Hiripi L, Carstea B, Kovacs A, Bodrogi L, Bosze Z.
2004. Production of transgenic chimeric rabbits and transmission of the transgene
through the germline. Mol Reprod Dev, 68:435-440.
Bordignon V, Keyston R, Lazaris A, Bilodeau AS, Pontes JH, Arnold D, Fecteau
G, Keefer C, Smith LC. 2003. Transgene Expression of Green Fluorescent Protein
and Germ Line Transmission in Cloned Calves Derived from In Vitro-Transfected
Somatic Cells. Biol Reprod, 68: 2013-2023.
Bõsze Z, Hiripi L, Carnwath JW, Niemann H. 2003. The transgenic rabbit as model
for human diseases and as a source of biologically active recombinant proteins.
Transgenic Res, 12: 541-553.
Brackett BG, Baranska W, Sawichi W and Koprowski H. 1971. Uptake of
heterologous genome by mammalian spermatozoa and its transfer to ova through
fertilization. Proc Natl Acad Sci, 68: 353-357.
37
Brem G, Hartl P, Besenfelder U, Wolf E, Zinovieva N, Pfaller R. 1994. Expression
of synthetic cDNA sequences enconding human insulin-like growth factor-1 (IGF-I) in
the gland of transgenic rabbits. Gene, 149:351-355.
Brink MF, Bishop MD, Pieper FR. 2000. Developing efficient strategies for the
generation of transgenic cattle which produce biopharmaceuticals in milk.
Theriogenology, 53:139-148.
Brophy B, Smolenski G, Wheeler T, Wells D, L'Huillier P, Laible G. 2003. Cloned
transgenic cattle produce milk with higher levels of beta-casein and kappa-casein.
Nat Biotechnol, 21:157-62.
Campbell KH, McWhir J, Ritchie WA, Wilmut I. 1996. Sheep cloned by nuclear
transfer from a cultured cell line. Nature, 380:64-66.
Carballada R, Esponda P. 2001. Regulation of foreign DNA uptake by mouse
spermatozoa. Exp Cell Res, 262: 104–113.
Carter, D.A. 2004. Comprehensive strategies to study neuronal function in
transgenic animal models. Biol Psychiatry, 55: 785-788.
Celebi C, Auvray P, Benvegnu T, Plusquellec D, Jegou B, Guillaudeux T. 2002.
Transient transmission of a transgene in mouse offspring following in vivo
transfection of male germ cells. Mol Reprod Dev, 62:477-82.
Celebi C, Guillaudeux T, Auvray P, Vallet-Erdtmann V, Jegou B. 2003. The
making of "transgenic spermatozoa”. Biol Reprod, 68:1477-1483.
Chang K, Qian J, Jiang M, Liu YH, Wu MC, Chen CD, Lai CK, Lo HL, Hsiao CT,
Brown L, Bolen J Jr, Huang HI, Ho PY, Shih PY, Yao CW, Lin WJ, Chen CH, Wu
FY, Lin YJ, Xu J, Wang K. 2002. Effective generation of transgenic pigs and mice by
linker based sperm-mediated gene transfer. BMC Biotechnol, 2:1-13.
Chen YX, Krull CR, Reneker LW. 2004. Targeted gene expression in the chicken
eye by in ovo electroporation. Mol Vis, 10:874-883.
Clark AJ, Bissinger P, Bullock DW, Damak S, Wallace R, Whitelaw CB, Yull F.
1994. Chromosomal position effects and the modulation of transgene expression.
Reprod Fertil Dev, 6:589-98.
Clark J. Whitelaw B. 2003. A future for transgenic livestock. Nat Genet, 4:825-833.
Collares T, Macedo M Jr, Menin A, Brito D, Manzke, VHB, Bastos R, Moreira,
HLM, Dellagostin O, Deschamps JC. 2004. Evaluation of sperm activity of Rhamdia
quelen (jundiá) after different treatments to insert foreign DNA. In Abstracts of the
15
th
International Congress Animal Reproduction, 2004, Porto Seguro, Brazil. Porto
38
Seguro: ICAR. pp.527.
Cook JT, Mcniven MA, Richardzon GF, Sutterlin AM. 2000. Growth rate, body
composition and feed digestibility/conversion of growth-enhanced transgenic Atlantic
salmon (Salmo salar). Aquaculture, 188:15-32.
Costa C, Solanes G, Visa J, Bosch F. 1998. Transgenic rabbits overexpressing
growth hormone develop acromegaly and diabetes mellitus. FASEB J, 12: 1455-
1460.
Deschamps JC, Lucia Jr T, Corrêa MN, Macedo Jr M, Rheingantz MGT. 2000.
Otimização da eficiência do processo de produção animal a partir do uso de
biotécnicas reprodutivas. Rev Bras Reprod Anim, 24:21-29.
Devlin RH, Yesaki TY, Biagi CA, Donaldson EM, Swanson P, Chan WK. 1994.
Extraordinary salmon growth. Nature, 371:209-210.
Du SJ, Gong Z, Fletcher GL, Shears MA, King MJ, Idler DR, Hew CL. 1992.
Growth enhancement in transgenic Atlantic salmon by the use of na “all-fish” chimeric
growth hormone gene construct. Biotechnology, 10:176-180.
Dupuy AJ, Clark K, Carlson CM, Fritz S, Davidson AE, Markley KM, Finley K,
Fletcher CF, Ekker SC, Hackett PB, Horn S, Largaespada DA. 2002. Mammalian
germ-line transgenesis by transposition. Proc Natl Acad Sci, 99:4495–4499.
Duverger N, Viglietta C, Berthou L, Emmanuel F, Tailleux A, Parmentier-Nihoul
L, Laine B, Fievet C, Castro G, Fruchart JC, Houbebine LM, Denefie P. 1996.
Transgenic rabbits expressing human apolipoprotein - AI in the liver. Arterioscler
Thromb Varc Biol, 16:1424-1429.
Dyck MK, Gagne D, Ouellet M, Senechal JF, Belanger E, Lacroix D, Sirard MA,
Pothier F. 1999. Seminal vesicle production and secretion of growth hormone into
seminal fluid. Nat Biotechnol, 17:1087-1090.
Dyck MK, Lacroix D, Pothier F, Sirard MA. 2003. Making recombinant proteins in
animals different systems, different applications. Trends Biotechnol, 21:394-399.
Fan J, Watanabe T. 2003. Transgenic rabbits as therapeutic protein bioreactors and
human disease models. Pharmacol Ther, 99:261-82.
Gagne M, Pothier F, Sirard MA. 1995. The use of electroporated bovine
spermatozoa to transfer foreign DNA into oocytes. Meth Mol Biol, 48:161-166.
Gandolfi F. 2000. Sperm-mediated transgenesis. Theriogenology, 53:127-37.
German DC, Eisch AJ. 2004. Mouse models of Alzheimer's disease: insight into
treatment. Rev Neurosci, 15:353-369.
39
Gerrits RJ, Lunney JK, Johnson LA, Pursel VG, Kraeling RR, Rohrer GA,
Dobrinsky JR. 2005. Perspectives for artificial insemination and genomics to
improve global swine populations. Theriogenology, 63:283-299.
Gibbs PD, Schmale MC. 2000. GFP as a Genetic Marker Scorable Throughout the
Life Cycle of Transgenic Zebra Fish. Mar Biotechnol, 2:107-125.
Giordano R, Magnano AR, Zaccagnini G, Pittoggi C, Moscufo N, Lorenzini R
and Spadafora C. 2000. Reverse transcriptase activity in mature spermatozoa of
mouse. J Cell Biol, 148:1107-1113.
Giraldo P, Gimenez E, Montoliu L. 1999. The use of yeast artificial chromosomes in
transgenic animals: expression studies of the tyrosinase gene in transgenic mice. J.
Genet Anal, 15:175–178.
Giraldo P, Montoliu L. 2001. Size matters: use of YACs, BACs and PACs in
transgenic animals. Transgenic Res, 10:83-103.
Giraldo P, Rival-Gervier S, Houdebine LM, Montoliu, L. 2003. The potential
benefits of insulators on heterologous constructs in transgenic animals. Transgenic
Res, 12:751-755.
Glasser SW, Eszterhas SK, Detmer EA, Maxfield MD, Korfhagen TR. 2005. The
murine SP-C promoter directs type II cell-specific expression in transgenic mice. Am
J Physiol Lung Cell Mol Physiol, 288:625-632. Epub 2004 Dec 3.
Golovan SP, Meidinger RG, Ajakaiye A, Cottrill M, Wiederkehr MZ, Barnehy DJ,
Plante C, Pollard JW, Fan MZ, Hayes MA, Laursen J, Hjorth JP, Hacker RR,
Phillips JP, Forsberg CW. 2001. Pigs expressing salivary phytase produce low-
phosphorus manure. Nat Biotechnol, 19:741-745.
Gong Z, Wan H, Tay TL, Wang H, Chen M, Yan T. 2003. Development of
transgenic fish for ornamental and bioreactor by strong expression of fluorescent
proteins in the skeletal muscle. Biochem Biophys Res Commun, 308:58-63.
Gordon JW, Scangos GA, Plotkin DJ, Barbosa JA and Ruddle FH. 1980. Genetic
transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad
Sci, 77:7380–7384.
Grabhera C, Henricha T, Sasadob T, Arenza A, Wittbrodta J, Furutani-Seiki M.
2003. Transposon-mediated enhancer trapping in medaka. Gene, 322:57–66.
Guglielmi L, Le Bert M, Truffinet V, Cogne M, Denizot Y. 2003. Insulators to
improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse
models. Biochem Biophys Res Commun, 307:466-71.
40
Hinits Y, Moav B. 1999. Growth performance studies in transgenic Cyprinus carpio.
Aquaculture, 173: 285-296.
Hodges CA, Stice S. 2003. Generation of bovine transgenics using somatic cell
nuclear transfer. Reprod. Biol. Endocrinol., 1:81
Hofmann A, Kessler B, Ewerling S, Weppert M, Vogg B, Ludwig H, Stojkovic M,
Boelhauve M, Brem G, Wolf E, Pfeifer A. 2003. Efficient transgenesis in farm
animals by lentiviral vectors. EMBO Rep, 4:1054-1060.
Hofmann A, Zakhartchenko V, Weppert M, Sebald H, Wenigerkind H, Brem G,
Wolf E, Pfeifer A. 2004. Generation of transgenic cattle by lentiviral gene transfer
into oocytes. Biol Repro, 71:405-409.
Horn C, Jaunich B, Wimmer EA. 2000. Highly sensitive, fluorescent transformation
marker for Drosophila transgenesis. Dev Genes Evol, 210:623-629.
Houdebine LM. 2002a. Animal transgenesis: recent data and perspectives.
Biochimie, 84:1137–1141.
Houdebine LM. 2003. Animal transgenesis and cloning. West Sussex, UK: Wiley &
Sons.
Houdebine, LM. 1994. Production of pharmaceutical proteins from transgenic
animals J Biotechnol, 34:269-287.
Houdebine, LM. 2000. Transgenic animal bioreactors. Transgenic Res, 9:305–320.
Houdebine, LM. 2002b. The methods to generate transgenic animals and to control
transgene expression. J Biotechnol, 98:145–160.
Houdebine, LM. 2002c. Transgenesis to improve animal production. Liv Prod Sci,
74: 255–268.
Hsiao CD, Tsai HJ. 2003. Transgenic zebrafish with fluorescent germ cell: a useful
tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev Biol,
262: 313–323.
Hu R, Zhang S, Xu Q, Tu C. 2004. A convenient method for the identification and
expression of eukaryotic genes. Biotechnol Appl Biochem, 39:307-312
Hwang G, Muller F, Rahman MA, Williams DW, Murdock PJ, Pasi KJ, Goldspink
G, Farahmand H, Maclean N. 2004. Fish as bioreactors: transgene expression of
human coagulation Factor VII in fish embryos. Mar Biotechnol, Apr 29. (Epub ahead
of print).
41
Ivics Z, Izsvak Z. 2004. Transposable elements for transgenesis and insertional
mutagenesis in vertebrates: a contemporary review of experimental strategies. Meth
Mol Biol, 260:255-276.
Jesuthasan S, Subburaju S. 2002. Gene transfer into zebrafish by sperm nuclear
transplantation. Dev Biol, 242:88-95.
Kang JH, Yoshizaki G, Homma O, Strussmann CA, Takashima F. 1999. Effect of
an osmotic differential on the efficiency of gene transfer by electroporation of fish
spermatozoa. Aquaculture, 173: 297-307.
Karatzas CN. 2003. Designer milk from transgenes clones. Nat Biotechnol, 21:183-
183.
Karlas A, Kurth R, Denner J. 2004. Inhibition of porcine endogenous retroviruses by
RNA interference: increasing the safety of xenotransplantation. Virology, 325:18-23.
Karnani P, Kairemo K. 2003. Targeting endothelial growth with monoclonal
antibodies against Tie-1 kinase in mouse models. Clin Cancer Res, 9:3821-3826
Katoh M, Ayabe F, Norikane S, Okada T, Masumoto H, Horike S, Shirayoshi Y,
Oshimura M. 2004. Construction of a novel human artificial chromosome vector for
gene delivery. Biochem Biophys Res Commun, 321:280-290.
Kawakami K, Takeda, H., Kawakami, N., Kobayashi, M., Matsuda, N., and
Mishina M. 2004. A transposon-mediated gene trap approach identifies
developmentally regulated genes in Zebrafish. Dev Cell, 7:133–144
Keefer CL. 2004. Production of bioproducts through the use of transgenic animal
Models. Anim Reprod Sci, 82/83: 5–12.
Kerr DE, Wellnitz O. 2003. Mammary expression of new genes to combat mastitis. J
Anim Sci, 3:38-47.
Khoo HW, Ang LH, Lim JHB, Wong V. 1992. Sperm cells as vectors for introducing
foreign DNA into the zebrafish. Aquaculture, 107:1–19.
Khoo HW. 2000. Sperm-mediated gene transfer studies on zebrafish in Singapore.
Mol Reprod Dev, 56:278-280.
Kim MY, Ahn KY, Lee SM, Koh JT, Chun BJ, Bae CS, Lee KS, Kim KK. 2004. The
promoter of brain-specific angiogenesis inhibitor 1-associated protein 4 drives
developmentally targeted transgene expression mainly in adult cerebral cortex and
hippocampus. FEBS Letter, 566:87-94.
Kimura-Yoshida C, Kitajima k, Oda-Ishii I, Tian E, Suzuki M, Yamamoto M,
Suzuki T, Kobayashi M, Aizawa S, Matsuo I. 2004. Characterization of the
42
pufferfish Otx2cis-regulators reveals evolutionarily conserved genetic mechanisms
for vertebrate head specification. Development, 131:57-71
Kojima Y, Sasaki S, Umemoto Y, Hashimoto Y, Hayashi Y, Kohri K. 2003. Effects
of adenovirus mediated gene transfer to mouse testis in vivo on spermatogenesis
and next generation. J Urol, 170:2109-2114.
Lai L, Prather RS. 2002. Progress in producing knockout models for
xenotransplantation by nuclear transfer. Ann Med, 34:501-506.
Lander ES, Linton LM, Birren B, Nusbaum C et al., 2001. Initial sequencing and
analysis of the human genome. Nature, 409:860-921.
Lavitrano M, Camaioni A, Fazio VM, Dolci S, Farace MG, Spadafora C. 1989.
Sperm cells as vectors for introducing foreign DNA into eggs: genetic transformation
of mice. Cell, 57:717-723.
Lavitrano M, Forni M, Bacci ML, Di Stefano C, Varzi V, Wang H, Seren E. 2003.
Sperm mediated gene transfer in pig: Selection of donor boars and optimization of
DNA uptake. Mol Reprod Dev, 64:284-291.
Lavitrano M, Maione B, Forte E, Francolini M, Sperandio S, Testi R, Spadafora
C. 1997. The interaction of sperm cells with exogenous DNA ± a role of CD4 and
major histocompatibility complex class II molecules. Exp Cell Res, 233:56-62.
Lazzereschi D, Forni M, Cappello F, Bacci ML, Stefano C Di, Marfe´ C, Giancotti
P, Renzi L, Wang HJ, Rossi M, Della Casa G, Pretagostini R, Frati G, Bruzzone
P, Stassi G, Stoppacciaro A, Turchi V, Cortesini R, Sinibaldi P, Frati L,
Lavitrano M. 2000. Efficiency of Transgenesis Using Sperm-Mediated Gene
Transfer. Transplant Proc, 32:892–894.
Limonta JM, Castro FO, Martinez R, Puentes P, Ramos B, Aguilar A, Lleonart
RL, Fuente J. 1995. Transgenic rabbits as bioreactors for the production of human
growth hormone. J Biotechnol, 40: 49-58.
Lin CY, Chen YH, Lee HC, Tsai HJ. 2004. Novel cis-element in intron 1 represses
somite expression of zebrafish myf-5. Gene, 334:63-72.
Lindenbaum M, Perkins E, Csonka E, Fleming E, Garcia L, Greene A, Gung L,
Hadlaczky G, Lee E, Leung J, MacDonald N, Maxwell A, Mills K, Monteith D,
Perez CF, Shellard J, Stewart S, Stodola T, Vandenborre D, Vanderbyl S,
Ledebur HC Jr. 2004 A mammalian artificial chromosome engineering system (ACE
System) applicable to biopharmaceutical protein production, transgenesis and gene-
based cell therapy. Nucleic Acids Res, 32:e172.
43
Linney E, Hardison NL, Lonze, BE, Lyons S, DiNapoli L. 1999. Transgene
expression in Zebrafish: A comparison of retroviral-vector and DNA-injection
approaches Dev Biol, 213: 207–216.
Lu J-K, Fu B-H, Wu J-L, Chen TT. 2002. Production of transgenic Silver Sea Bream
(Sparus sarba) by different gene transfer methods. Mar Biotechnol, 4: 328-337.
Lubon H, Paleyanda RK, Velander WH, Drohan WN. 1996. Blood proteins from
transgenic animal bioreactors. Transfus Med Ver,10:131-143.
Lye RJ, Hinton BT. 2004. Technologies for the study of epididymal-specific genes.
Mol Cell Endocrinol, 216: 23-30.
Maclean N, Rahman MA, Sohm F, Hwang G, Iyengar A, Ayad H, Smith A,
Farahmand H. 2002. Transgenic tilapia and the tilapia genome. Gene, 295:265-277.
Maga EA, Sargent RG, Zeng H, Pati S, Zarling DA, Oppenheim SM, Collette NM,
Moyer AL, Conrad-Brink JS, Rowe JD, BonDurant RH, Anderson GB, Murray
JD. 2003. Increased efficiency of transgenic livestock production. Transgenic Res,
12:485-496.
Majumder P, Cai HN. 2003. The functional analysis of insulator interactions in the
Drosophila embryo. Proc Natl Acad Sci, 100:5223–5228.
Martínez R, Arenal A, Estrada MP, Herrera F, Huerta V, Vázquez J, Sánches T,
Fuente J. 1999. Mendelian transmission, transgene dosage and growth phenotype in
transgenic tilapia (Oreochromis hornorum) showing ectopic expression of
homologous growth hormone. Aquaculture, 173:271-283.
McCreath KJ, Howcroft J, Campbell KH, Colman A, Schnieke AE, Kind AJ. 2000.
Production of gene-targeted sheep by nuclear transfer from cultured somatic cells.
Nature, 405:1066-1069.
Montoliu, L. 2002 Gene transfer strategies in animal transgenesis. Cloning and stem
Cells, 4:39-46
Morales R, Herrera MT, Arenal A, Cruz A, Hernández O, Pimentel R, Guillén I,
Martínes R, Estrada MP. 2001. Tilapia chromossomal growth hormone gene
expression accelerates growth in transgenic zebrafish (Danio rerio). EJB Electronic J
Biotechnol, 4: 53-58.
Moreira PN, Giraldo P, Cozar P, Pozueta J, Jimenez A, Montoliu L, Gutierrez-
Adan A. 2004. Efficient generation of transgenic mice with intact yeast artificial
chromosomes by intracytoplasmic sperm injection. Biol Reprod, 71:1943-1947.
44
Morita T, Yoshizaki G, Kobayashi M, Watabe S, Takeuchi T. 2004. Fish eggs as
bioreactors: the production of bioactive luteinizing hormone in transgenic trout
embryos. Transgenic Res, Published online, 29 April.
Nagashima H, Fujimura T, Takahagi Y, Kurome M, Wako N, Ochiai T, Esaki R,
Kano K, Saito S, Okabe M, Murakami H. 2003. Development of efficient strategies
for the production of genetically modified pigs. Theriogenology, 59:95-106.
Nam YK, Park JE, Kim KK, Kim DS. 2003. A rapid and simple PCR-based method
for analysis of transgenic fish using restricted amount of fin tissue. Transgenic Res,
12:523-525.
Niemann H, Kues W.A. 2003. Application of transgenesis in livestock for agriculture
and biomedicine. Anim Reprod Sci, 79:291-317.
Niemann H. 2001. Current status and perspectives for the generation of transgenic
pigs for xenotransplantation. Ann Transplant, 6:6-9.
Noble MS, Rodriguez-Zas S, Cook JB, Bleck GT, Hurley WL, Wheeler MB. 2002.
Lactational performance of first-parity transgenic gilts expressing bovine alpha-
lactalbumin in their milk. J. Anim Sci, 80:1090–1096.
Oberle V, de Jong G, Drayer JI, Hoekstra D. 2004. Efficient transfer of
chromosome-based DNA constructs into mammalian cells. Biochim Biophys Acta,
1676:223– 230
Paleyanda RK, Velander WH, Lee TK, Scandella DH, Gwazdauskas FC, Knight
JW, Hoyer LW, Drohan WN, Lubon H. 1997. Transgenic pigs produce functional
human factor VIII in milk. Nat Biotechnol. 1997 15:971-975.
Palmiter RD, Brinster RL, Hammer RE, Trumbauer ME, Rosenfeld MG, Birnberg
NC, Evans RM. 1982. Dramatic growth of mice that develop from eggs microinjected
with metallothionein-growth hormone fusion genes. Nature, 300: 611–615.
Parker MH, Birck-Wilson E, Allard G, Masiello N, Day M, Murphy KP, Paragas V,
Silver S, Moody MD. 2004. Purification and characterization of a recombinant
version of human alpha-fetoprotein expressed in the milk of transgenic goats. Protein
Expr Purif, 38:177-183.
Petitclerc D, Attal J, Théron MC, Bearzotti M, Bolifraud P, Kann G, Sinnakre MG,
Pointu H, Puissant C, Houdebine LM. 1995. The effects of various introns and
transcription terminators on the efficiency of expression vectors in various cultured
cell lines and in the mammary gland of transgenic mice. J Biotech, 40:169-178.
45
Petters RM, Sommer JR. 2000. Transgenic animals as models for human disease.
Transgenic Res, 9:347-351.
Pinkert, C. 2002. Transgenic animal technology. Pinkert, CA: Academic Press.
Pohajdak B, Mansour M, Hrytsenko O, Conlon JM, Dymond LC, Wright JR.
2004. Production of transgenic tilapia with Brockmann bodies secreting [desThrB30]
human insulin. Transgenic Res, 13:313-323.
Rahman MA, Maclean N. 1999. Growth performance of transgenic tilapia
containging an exogenous piscine growth hormone gene. Aquaculture, 173:333-346.
Recillas-Targa F, Valadez-Graham V, Farrell CM. 2004. Prospects and implications
of using chromatin insulators in gene therapy and transgenesis. Bioessays, 26:796-
807.
Rieth A, Pothier F, Sirard MA. 2000. Electroporation of bovine spermatozoa to carry
DNA containing highly repetitive sequences into oocytes and detection of
homologous recombination events. Mol Reprod Dev, 57:338-345.
Rocha A, Ruiz S, Estepa A, Coll JM. 2004. Application of inducible and targeted
gene strategies to produce transgenic fish: a review. Mar Biotechnol, 6:118-127.
Rottmann OJ, Antes R, Hofer P, Maierhofer G. 1991. Liposome mediated gene
transfer via spermatozoa into avian egg cells. J Anim Breed Genet, 109: 64-70.
Rottmann OJ, Antes R, Hofer P, Sommer B, Wanner G, Gorlach A, Grummt F,
Pirchner F. 1996. Liposomemediated gene transfer via sperm cells high transfer
efficiency and persistence of transgenes by use of liposomes and sperm cells and a
murine amplification element. J. Anim. Breed. Genet. 113: 401-11.
Rutovitz J, Mayer S. 2002. Genetically Modified and Cloned Animals. All in a Good
Cause? GeneWatch reports. 95p. (www.genewatch.org)
Ryding ADS, Sharp MGF, Mullins JJ. 2001. Conditional transgenic technologies. J
Endocrinol, 171: 1–14.
Ryoo ZY, Kim MO, Kim KE, Bahk YY, Lee JW, Park SH, Kim JH, Byun SJ,
Hwang HY, Youn J, Kim TY. 2001. Expression of recombinant human granulocyte
macrophage-colony stimulating factor (hGM-CSF) in mouse urine. Transgenic Res,
10:193-200.
Sasaki S, Kojima Y, Kubota H, Tatsura H, Hayashi Y, Kohri K. 2000. Effects of the
gene transfer into sperm mediated by liposomes on sperm motility and fertilization in
vitro Hinyokika Kiyo, 46:591-595.
46
Sato M, Ishikawa A, Kimura M. 2002. Direct injection of foreign DNA into mouse
testis as a possible in vivo gene transfer system via epididymal spermatozoa. Mol
Reprod Dev, 61:49-56.
Schon C, Koster M, Knochel W. 2004. A downstream enhancer is essential for
Xenopus FoxD5 transcription. Biochem Biophys Res Commun, 325:1360-1366.
Sciamanna I, Barberi L, Martire A, Pittoggi C, Beraldi R, Giordano R, Magnano
AR, Hogdson C, Spadafora C. 2003. Sperm endogenous reverse transcriptase as
mediator of new genetic information. Biochem Biophys Res Commun, 312:1039-
1046.
Sciamanna I, Piccoli S, Barberi L, Zaccagnini G, Magnano AR, Giordano R,
Campedelli P, Hodgson C, Lorenzini R, Spadafora C. 2000. DNA dose and
sequence dependence in sperm-mediated gene transfer. Mol Reprod Dev, 56:301-
305.
Shapiro JR, Mcbride DJ Jr, Fedarko NS. 1995. OIM and related animal models of
osteogenesis imperfecta. Connect Tissue Res, 31:265-268.
Shemesh M, Gurevich M, Harel-Markowitz E, Benvenisti L, Shore LS, Stram Y.
2000. Gene integration into bovine sperm genome and its expression in transgenic
offspring. Mol Reprod Dev, 56:306–308.
Sillence MN. 2004. Technologies for the control of fat and lean deposition in
livestock. Vet. J, 167:242-57.
Sin FY, Walker SP, Symonds JE, Mukherjee UK, Khoo JG, Sin IL. 2000.
Electroporation of salmon sperm for gene transfer: Efficiency, reliability, and fate of
transgene. Mol Reprod Dev, 56:285-288.
Smith KR. 2002. The role of sperm-mediated gene transfer in genome mutation and
evolution. Med Hypotheses, 59: 433–437.
Spadafora C. 1998. Sperm cells and foreign DNA: a controversial relation.
BioEssays, 20:955-964.
Spadafora C. 2002. Sperm-mediated gene transfer: pratical implications of a
biological process. Transgenic Res, 11:82-83.
Sparrow DB, Latinkic B, Mohun TJ. 2000. A simplified method of generating
transgenic Xenopus. Nucleic Acids Res, 28:E12.
Sperandio S, Lulli V, Bacci ML, Forni M, Maione B, Spadafora C and Lavitrano
ML. 1996. Sperm mediated DNA transfer in bovine and swine species. Anim.
Biotechnol. 7:59–77.
47
Strobl JS, Thomas MJ. 1994. Human growth hormone. Pharmacol Rev, 46:1-34.
Symonds JE, Walker SP, Sin FYT. 1994. Electroporation of salmon sperm with
plasmid DNA: evidence of enhanced sperm DNA association. Aquaculture 119;313-
27.
Thomson AJ, Marques MM, McWhir J. 2003. Gene targeting in livestock.
Reproduction Suppl, 61:495-508.
Tu CF, Lee JM, Sato T, Dai HC, Lee FR, Yang CK, Tsuji K, Lee CJ. 2003.
Expression of HLA-DQ Genes in Transgenic Pigs. Transplantation Proc, 35:513–515
van Berkel PH, Welling MM, Geerts M, van Veen HA, Ravensbergen B,
Salaheddine M, Pauwels EK, Pieper F, Nuijens JH, Nibbering PH. 2002. Large
scale production of recombinant human lactoferrin in the milk of transgenic cows. Nat
Biotechnol. 20:484-487.
Van Cott KE, Butler SP, Russell CG, Subramanian A, Lubon H, Gwazdauskas
FC, Knight J, Drohan WN, Velander WH. 1999. Transgenic pigs as bioreactors: a
comparison of gamma-carboxylation of glutamic acid in recombinant human protein
C and factor IX by the mammary gland. Genet Anal. 15:155-160.
Venkateswaran V, Fleshner NE, Sugar LM, Klotz LH. 2004. Antioxidants block
prostate cancer in lady transgenic mice. Cancer Res, 15:5891-5896.
Wall RJ. 1999. Biotechnology for the production of modified and innovative animal
products: transgenic livestock bioreactors. Liv Prod Sci, 59:243-255.
Walsh G. 2003. Pharmaceutical biotechnology products approved within the
European Union. Eur J Pharm Biopharm, 55:3–10.
Wang B, Baldassarre H, Tao T, Gauthier M, Neveu N, Zhou JF, Leduc M,
Duguay F, Bilodeau AS, Lazaris A, Keefer C, Karatzas CN. 2002. Transgenic
goats produced by DNA pronuclear microinjection of in vitro derived zygotes. Mol
Reprod Dev, 63:437-443.
Wang HJ, Lin AX, Chen YF. 2003. Association of rabbit sperm cells with exogenous
DNA. Anim Biotechnol. 14:155-165.
Wheeler MB, Bleck GT, Donovan SM. 2001. Transgenic alteration of sow milk to
improve piglet growth and health. Reproduction Suppl, 58:313-24.
Wheeler MB. 2003. Production of transgenic livestock: promise fulfilled. J Anim Sci,
81(suppl 3):32-7.
48
Whitelaw CB, Radcliffe PA, Ritchie WA, Carlisle A, Ellard FM, Pena RN, Rowe J,
Clark AJ, King TJ, Mitrophanous KA. 2004. Efficient generation of transgenic pigs
using equine infectious anaemia virus (EIAV) derived vector. FEBS, 571:233-236.
Whitelaw CBA, Archibald AL, Harris S, McClenaghan M, Simons JP, Clark AJ.
1991. Targeting expression to the mammary gland: intronic sequences can enhance
the efficiency of gene expression in transgenic mice. Transgenic Res, 1:3-13.
Willadsen S. 1986. Nuclear transplantation in sheep embryos. Nature, 320: 63-65.
Withelaw CBA. 2004. Transgenic livestock made easy. TRENDS in Biotechnology,
22: 157-159.
Wolf E, Schernthaner W, Zakhartchenko V, Prelle K, Stojkovic M, Brem G. 2000.
Transgenic technology in farm animals: progress and perspectives. Exp Physiol
85:615-625.
Wright, G. Carver A, Cottom D, Reeves D, Scott A, Simons P, Wilmut I, Garner I,
Colman A. 1991.High level expression of active human α-1-antitrypsin in the milk of
transgenic sheep. Biotechnology, 9:830–834.
Wu GM, Nose K, Mori E, Mori T. 1990. Binding of foreign DNA to mouse sperm
mediated by its MHC class II structure. Am J Reprod Immunol, 24:120-126.
Yao S, Osborne CS, Bharadwaj RR, Pasceri P,Sukonnik T, Pannell D, Recillas-
Targa F, West AG, Ellis J. 2003. Retrovirus silencer blocking by the cHS4 insulator
is CTCF independent. Nucleic Acids Res, 31:5317-5323.
Yonezawa T, Furuhata Y, Hirabayashi K, Suzuki M, Takahashi M, Nishihara M.
2001. Detection of transgene in progeny at different developmental stages following
testis-mediated gene transfer. Mol Reprod Dev. 60:196-201.
Yoshizaki G, Takeuchi Y, Sakatani S, Takeuchi T. 2000. Germ cell-specific
expression of green fluorescent protein in transgenic rainbow trout under the control
of the rainbow trout vasa-like gene promoter. Int J Dev Biol, 44:323–326.
Zhao J, Liu B, Ren WZ, Zhang SF, Yu L, Li YP, Qiao GL, Hu RL, Yin Z. 2003.
Production of transgenic mice by in vivo spermatogonia-mediated gene transfer. Shi
Yan Sheng Wu Xue Bao, 36:197-201.
49
3 ARTIGO 2 (Revisão Bibliográfica)
Brazilian Journal of Animal Reproduction., v.31. n.4, p.xx-xx, Nov/Dez 2007
Animais transgênicos biorreatores
(Transgenic animal bioreactors)
Tiago Collares
1*
, Fabiana Kömmling Seixas
1
; Vinícius Farias Campos
1
, Paulo
Varoni Cavalcanti
1
, João Carlos Deschamps
1
.
1
Laboratório de Biotécnicas da Reprodução Animal, Centro de Biotecnologia –
Universidade Federal de Pelotas, Campus Universitário, s/nº · Caixa Postal 354 ·
96010-900 Pelotas, RS. * e-mail: tc[email protected]
50
Resumo
Conhecimentos de biologia molecular aplicados à reprodução animal têm
proporcionado uma revolução em ciência aplicada nos últimos anos. A utilização de
ferramentas de bioinformática, clonagem gênica, manipulação de gametas e
embriões, bem como, purificações de proteínas de fluídos biológicos, têm permitido
este avanço significativo. Esta revisão aborda princípios e métodos na geração de
animais transgênicos biorreatores e os principais fluídos biológicos utilizados.
Palavras-chave: Animais transgênicos; biorreatores; biologia molecular;
Abstract
Knowledge of molecular biology applied to the animal reproduction has provided a
revolution in applied science in the last years. The use of bioinformatic tools, gene
cloning, gametes and embryo manipulation, and purification of proteins from
biological fluid, have allowed this significant progress. This review approaches
principles and methods in the generation of transgenic animal bioreactors and main
biological fluids in use.
Key-word: Transgenic animal; bioreactors; molecular biology;
51
Introdução
Na década de 80, foram demonstradas as primeiras tentativas de geração de
animais transgênicos, incluindo camundongos, ovelhas, coelhos e porcos com
potencial de expressão protéica exógena (Gordon et al.,1980; Gordon & Ruddle,
1981; Palmiter et al.,1982; Hammer et al.,1985). Desde então, a produção de
diversas proteínas recombinantes de interesse farmacêutico tem sido descrita em
animais transgênicos gerados por ferramentas da biologia molecular em conjunto
com biotécnicas reprodutivas avançadas.
A utilização de animais transgênicos como biorreatores, representa uma
alternativa promissora para possibilitar o crescimento necessário à terapêutica,
através da produção de proteínas recombinantes de elevado valor biológico à saúde
humana. A rápida expansão e crescimento da biotecnologia, nos recentes anos,
proporcionaram a expressão de uma variada gama de polipepitídeos em diferentes
sistemas biológicos de produção, dirigidos principalmente à saúde humana (Wall,
1999; Houdebine, 2000; Andersen & Krummen, 2002; Keefer, 2004; Collares et al.,
2005; Dunn et al.,2005).
Embora muitas proteínas terapêuticas humanas sejam, atualmente,
produzidas em fermentadores microbiológicos, usando técnicas de DNA
recombinante, é nítido que o processamento microbiano não se mostra adequado
para um grande número de proteínas bioativas. Isso ocorre devido à incapacidade
das bactérias realizarem reações de modificações pós-sintéticas, requeridas para a
atividade biológica plena. Diante disso, para a síntese de uma série de proteínas de
interesse terapêutico, há a pertinência do uso de células animais, para que as
modificações pós-traducionais adequadas sejam realizadas. A glicosilação, por
exemplo, normalmente é requerida para a atividade biológica das proteínas. Este é o
caso para hormônios gonadotróficos, fatores da coagulação e para anticorpos. Além
disso, a glicosilação mostra-se essencial para a estabilidade de muitas proteínas na
circulação sangüínea (Dyck et al., 2003).
Linhagens de células de mamíferos são capazes de realizar as complexas
modificações pós-traducionais. É importante considerar que os fatores de
coagulação recombinantes têm sido produzidos através de cultivo de células de rim
de hamster, sendo transfectadas por vetores contendo o gene de interesse. Porém,
o cultivo de células modificadas de mamíferos apresenta um custo significativamente
52
elevado ao produto final - proteína recombinante - quando comparado à produção
em alguns modelos de biorreatores animal (Niemann et al.,1999; Fan & Watanabe,
2003).
Diversos tecidos e fluidos corporais de mamíferos demonstram potencial para
produção de proteínas exógenas por engenharia genética animal e, mais
recentemente, em ovos de peixes biorreatores (Hwang et al., 2004; Morita et al.,
2004; Yoshizaki et al., 2005). É importante registrar que um dos mais promissores
avanços para a produção em larga escala de proteínas recombinantes tem sido a
secreção de proteínas recombinantes no leite de mamíferos transgênicos. Isto tem
sido relatado para uma série de proteínas, sejam em vacas, cabras, ovelhas, porcas,
coelhas ou camundongos (Houdebine, 2002b).
O uso de peixes transgênicos, como biorreatores, também tem demonstrado
ser uma alternativa viável para produção de proteínas recombinantes em modelos
de baixo custo: (1) tempo de geração curto; (2) custo comparativamente baixo; (3)
fácil manutenção dos estoques; (4) produção em larga escala dos animais
geneticamente modificados através de SMGT - Sperm Mediated Gene Transfer; (5)
transmissão de vírus e prions não são conhecidas até o momento entre peixes e
humanos (Morita et al., 2004; Hwang et al., 2004; Caelers et al., 2005).
O uso comercial de aves transgênicas, por exemplo, está direcionado para
duas grandes áreas. A primeira é o desenvolvimento da galinha para atuar como um
biorreator na produção de proteínas exógenas em claras de ovos e, a segunda, é a
manipulação de características de produção. Nesta última, o mais provável uso da
transgênese seria a obtenção de aves resistentes a doenças. Várias metodologias
vêm sendo utilizadas para acessar e manipular o genoma de aves em diferentes
estágios do desenvolvimento, incluindo: i) a manipulação direta das gônadas; ii) a
modificação dos espermatozóides; iii) a manipulação do zigoto; iv) a manipulação de
embriões no momento da postura; v) a transfecção de células-tronco embrionárias
ou células germinativas primordiais modificadas (Mozdziak & Petitte, 2004b;
Mozdziak & Petitte, 2004a; Lillico et al., 2005; Ivarie, 2006).
Esta revisão pretende abordar as principais metodologias de geração de
animais transgênicos e os principais fluidos biológicos utilizados como biorreatores
de proteínas de interesse.
53
Estratégias de gerar animais transgênicos
O DNA constitui-se em uma macromolécula que não apresenta propriedades
que facilitem sua entrada nas células. Métodos mecânicos ou físico-químicos
devem, por isso, ser implementados para permitir a incorporação de DNA em células
in vitro ou in vivo.
Os embriões são células relativamente raras e o método mais eficiente para a
transferência de genes em células cultivadas tem sido a microinjeção. A
microinjeção de DNA no pró-núcleo de embriões de uma célula foi o primeiro método
a ser utilizado para DNA não viral. Proposto por Gordon et al., (1980) em
camundongos e disseminado para três outros mamíferos (coelhos, suínos e ovelhas)
ainda nos anos 80 (Hammer et al.,1985), esse método obteve pouco progresso, mas
ainda é utilizado com sucesso em várias espécies até os dias atuais. Esta técnica
requer que numerosos embriões estejam disponíveis para a microinjeção e que
sejam transferidos cirurgicamente para fêmeas receptoras. Os embriões são
geralmente obtidos por superovulação, e as fêmeas receptoras estarão prontas para
receber embriões exógenos, após cruzamento com machos vasectomizados ou
após tratamento hormonal de acordo com a espécie. Os embriões de uma célula são
transparentes em camundongos, ratos e coelhos. Eles são opacos em suínos, em
cabras, em ovelhas e em vacas devido à presença de glóbulos de lipídios. Os
embriões devem, então, ser centrifugados a 10.000 g para concentrar os lipídios em
um lado do embrião, permitindo a visualização do pró-núcleo para microinjeção do
DNA exógeno. Neste sentido, uma série de detalhes deve ser levada em
consideração na eleição de modelos biológicos transgênicos biorreatores (Keefer,
2004).
Não mais do que 1.000 cópias de DNA exógeno devem ser injetadas em
embriões de camundongos, sendo que mais de 5.000 cópias podem ser injetadas
em embriões de coelhos e suínos, com o aumento de produtos transgênicos. Um
cuidado particular deve ser tomado ao preparar DNA para ser microinjetado levando
em consideração seu grau de pureza. Isto pode ser obtido pela separação do inserto
do plasmídeo em um gel de agarose de alta concentração na ausência de brometo
de etídio. O DNA pode então ser purificado do gel de agarose, usando microcolunas
disponíveis. Nas manipulações com embriões, é preferível o uso de água purificada.
Para grandes fragmentos de DNA, como cromossomos artificiais (BAC e YAC), a
54
separação do inserto deve ser feita em agarose, utilizando-se campo pulsátil. A
agarose é então digerida por agarase e a fração é extensivamente dialisada numa
membrana de nylon usando um tampão rico em poliamida (Giraldo & Montoliu,
2001).
O DNA exógeno introduzido no pró-núcleo é altamente mitogênico. Isto induz
à morte de uma grande proporção de embriões (30% ou mais). Rearranjos
desconhecidos do genoma e mutações também ocorrem no sítio de integração. A
produção média de transgênese após microinjeção de DNA no pró-núcleo, é de 2%
para camundongos (Palmiter et al.,1982; Montoliu et al., 2004;), 0,1 a 0,5% para
suínos (Nagashima et al.,2003), 0,01 a 0,1% em cabras e ovelhas (Baldassarre et
al., 2003; Keefer, 2004) e ainda mais baixo para vacas (Niemann et al., 2005).
Em vertebrados inferiores e invertebrados e, geralmente, em espécies
ovíparas, os ovos são envolvidos por uma casca, e a célula contém uma grande
quantidade de vitelo. Neste sentido, os pró-núcleos não são visíveis e a injeção de
DNA pode ser melhor obtida no citoplasma, após transpassar a casca. Cerca de 10
6
– 20x10
6
cópias dos genes exógenos são injetados no citoplasma, de acordo com a
espécie, para otimizar a transgênese (Houdebine, 2002b).
Os genomas de lentivírus têm sido descritos como forma alternativa. Isto
permite a integração do gene exógeno não somente em células em multiplicação,
como fazem os vetores de retrovírus convencionais, mas também em células que
não estão se dividindo. Além disso, os vetores lentivirais podem incorporar até 9 kpb
de DNA exógeno e, por razões desconhecidas, estes vetores integrados são menos
suscetíveis à extinção do gene do que vetores de retrovírus convencionais. A
eficiência desses novos vetores também tem sido aumentada pelo uso de envelopes
de VSV (vírus da estomatite vesicular), que reconhece fosfolipídios da membrana
plasmática e não receptores específicos. Além do mais, as partículas de retrovírus,
contendo envelopes de VSV podem ser concentradas através de centrifugação,
mantendo sua capacidade de infectar células. Esses novos vetores podem assim
infectar qualquer tipo celular, incluindo embriões, com uma alta eficiência. Tal
instrumento foi implementado pela primeira vez com embriões de camundongo e foi
estendido e descrito para aves (Mizuarai et al., 2001; Koo et al., 2004;), suínos
(Hofmann et al., 2003; Lunney, 2007), bovines (Hofmann et al., 2004; Ewerling et al.,
2006;) e ovinos (Robl et al., 2007).
55
Em relação à transferência gênica em massa, os espermatozóides parecem
ser as células mais apropriadas. Os diferentes métodos baseados no uso de
espermatozóides são conhecidos como espermatotransgênese ou SMGT (Sperm
Mediated Gene Transfer) (Lavitrano et al.,1989). Experimentos conduzidos há mais
de uma década têm demonstrado que a incubação de espermatozóides isolados,
seguida por fertilização in vitro, originou camundongos transgênicos (Lavitrano et al.,
1989). Esse método, relativamente simples, apresentou eficiência em peixes, aves,
camundongos, coelhos e bovinos (Lavitrano et al., 1989; Shemesh et al., 2000;
Chang et al.,2002; Celebi et al., 2003; Collares et al., 2005) (Fig1.). Um complexo de
DNA transfectante, injetado nos túbulos seminíferos de camundongos, permitiu o
nascimento de camundongos transgênicos em um número aceitável (Muramatsu et
al., 1997; Sato et al., 1999). Espermatogônias podem ser extraídas dos testículos,
transfectadas com DNA exógeno in vitro, selecionadas e implantadas nos testículos
de um animal pré-tratado (Dupuy et al., 2002; Takeuchi et al., 2002).
Um fator inibitório específico (IF-1) da reação de ligação do DNA foi
identificado no fluído seminal de mamíferos e na superfície da membrana de
espermatozóide de espécies menos desenvolvidas, por exemplo, ouriço-do-mar, que
não possui fluído seminal. IF-1 é uma glicoproteína, cuja efetividade inibitória está
ligada ao componente polissacarídeo. De fato, a habilidade do IF-1 em inibir a
ligação do DNA pode ser completamente eliminada pela pré-incubação com
glicosidases. O IF-1 liga-se ao segmento sub-acrossomal da cabeça do
espermatozóide, ou seja, a mesma localização celular alvejada pelo DNA exógeno,
e pode exercer seu efeito inibitório tanto em espermatozóides heterólogos quanto
em homólogos. Assim sendo, o IF-1 exerce um importante papel natural, atuando
como uma barreira e protegendo os espermatozóides epididimais da entrada de
moléculas exógenas indesejáveis que poderiam comprometer a integridade do
espermatozóide e a identidade genética da futura progênie (Magnano et al., 1998;
Spadafora, 1998; Chang et al., 2002;).
Por outro lado, a ligação de DNA exógeno aos espermatozóides parece ser
mediada por uma classe de proteínas espermáticas, com peso molecular de 30-35
kDa, localizadas na membrana celular do espermatozóide. Com base em estudos de
ligação do DNA, essas proteínas atuam verdadeiramente como substratos à ligação
de DNA, formando complexos estáveis com o DNA. É através destas proteínas que
o DNA exógeno liga-se à cabeça dos espermatozóides maduros, sendo que 15 a
56
22% do DNA ligado tornam-se posteriormente internalizado no núcleo do
espermatozóide (Carballada & Esponda, 2001). Por autoradiografia, a internalização
nuclear do DNA exógeno ocorre de forma ampla e, aparentemente, envolve a
maioria do núcleo espermático após 2 horas de incubação. A autoradiografia
ultraestrutural de seções de espermatozóides de epidídimo de ratos, de ejaculados
de bovinos e de espermatozóides lavados após incubação com DNA marcado,
indica que o DNA exógeno é internalizado no núcleo e transferido à cromatina do
espermatozóide (Rieth et al., 2000; Wang et al., 2003).
Tais observações sugerem que a internalização nuclear do DNA exógeno não
é uma transferência passiva ou desordenada (ou seja, como a difusão), mas ao
contrário, é regulada através de etapas bem definidas. Acredita-se que as moléculas
de DNA exógeno interagem com proteínas de ligação ao DNA (DBP) na superfície
do espermatozóide, quando não inibidas na presença do IF-1 do fluído seminal. A
formação de complexos protéicos DNA / DBP então ativa a internalização mediada
por CD4. Neste ponto, o complexo DNA / DBP / CD4 penetra na membrana nuclear
e, através dos poros nucleares, alcança a matriz nuclear, onde o DNA é dissociado
do complexo DBP / CD4 e liberado, em contato íntimo com o DNA cromossômico do
espermatozóide: aqui ele pode ser integrado ou retido como DNA epissômico
(Lavitrano et al.,2006; Lavitrano et al.,1997; Smith & Spadafora, 2005)
Uma das funções endógenas que eram desconhecidas do espermatozóide,
mas que foi revelada após a interação com moléculas ácidas nucleares exógenas é
a atividade da transcriptase reversa (RT - Reverse Transcriptase) (Giordano et al.,
2000; Sciamanna et al., 2003).
Originalmente, acreditava-se que uma RT não telomérica estava associada
somente com a replicação de retrovírus. Mais tarde, descobriu-se que sua
codificação é realizada por duas grandes classes de elementos repetidos em
genomas de eucariotos superiores: retroposons como os da família LINE (Long
Interspersed Nuclear Element) e retrovírus endógenos. Essas famílias de
seqüências repetidas são coletivamente indicadas como retroelementos. A RT não
telomérica possui a função principal no mecanismo de retrotransposição destes
elementos; se a RT endógena possui outros papéis fisiológicos em células
eucarióticas, é uma questão em aberto (Sciamanna et al., 2003; Beraldi et al.,2006).
Dados recentes do seqüenciamento do genoma humano e dos murinos
demonstram que uma quantidade de 45% do genoma humano e 37% do genoma
57
murino são compostos por retroelementos. Isto sugere que a RT endógena pode ter
participado e pode ainda estar participando em um papel de contínuo
remodelamento e rearranjo dos genomas. Embora um papel fisiológico para a RT
endógeno ainda não tenha sido claramente definido, um aumento nas evidências
sustentam a idéia de que essa enzima é responsável por numerosas alterações
genômicas e é uma das maiores forças que determinam à evolução (Spadafora,
1998; Spadafora, 2004)
Atualmente, níveis elevados de atividade RT têm sido observados em anexos
embrionários, como placenta, e em tumores; em contraste nenhum, ou níveis muito
baixos de expressão de RT, são típicos de células diferenciadas. A única exceção
conhecida a essa regra é o epidídimo de camundongo no qual, em contraste, a RT é
altamente expressa (Smith & Spadafora, 2005).
Experimentos utilizando diferentes plasmídeos, apresentando três genes
repórters distintos, demonstram uma elevada eficiência nas taxas de transgênese
utilizando SMGT para gerar suínos transgênicos. Os animais gerados a partir da
inserção de múltiplos genes são denominados de multi-transgênicos (Webster et al.,
2005).
É importante considerar que o sucesso na geração de animais transgênicos
através da SMGT, depende diretamente das relações entre concentração de DNA/
concentração espermática; pureza do DNA; morfologia e proporção de DNA
exógeno (circular:linear) e; adjuvantes de transfecção (DMSO, DMA, Lipossomos)
(Sciamanna et al., 2000; Li et al., 2006; Shen et al., 2006). A Tab. 1 demonstra os
principais eventos em SMGT.
Outra metodologia bastante interessante e utilizada em transferência gênica
in vivo, é a TMGT (Testis Mediated Gene Transfer). A transferência de genes,
mediada pelos testículos, pode ser considerada como uma variação simplificada do
SMGT, visto que não requer procedimentos de FIV, nem de transferência de
embriões (TE). Camundongos e coelhos transgênicos foram produzidos por monta
natural de fêmeas selvagens com machos pré-injetados com DNA exógeno, puro ou
complexado com lipossomas, dentro de seus ductos deferentes (Sato et al., 2002;
Sato et al., 1999; Yonezawa et al., 2001); (Hibbitt et al.,2006; Shen et al.,2006). Em
aves essa técnica foi demonstrada viável através de injeções intra-testiculares de
DNA exógeno (Arima et al., 2001).
58
O DNA exógeno pode ser transfectado em células-tronco ou em células
somáticas que são selecionadas e introduzidas em embriões. Os animais resultantes
são quiméricos e mosaicos para o transgene (McCreath et al., 2000). Algumas das
células germinativas contêm o transgene, que é então transmitido para a progênie. A
transferência gênica por transferência nuclear utilizando células-tronco em
camundongos é um método menos eficiente do que a clássica microinjeção. Essa
técnica laboriosa está, então, restrita à modificação de genes que requerem
recombinação homóloga e knockout. No entanto, resultados obtidos em bovinos,
ovinos, caprinos e suínos, demonstram que a maioria dos animais clonados a partir
de células somáticas expressa o transgene (Lai & Prather, 2002; Nagashima et al.,
2003; Bordignon et al., 2003).
Independente da metodologia utilizada na geração do exemplar transgênico é
importante considerar a construção gênica que se pretende inserir no genoma
hospedeiro. A integração aleatória pode levar ao desarranjo e inativação do gene
hospedeiro. Além disso, a expressão do transgene é freqüentemente submetida à
ação dos elementos regulatórios vizinhos dos genes hospedeiros (Houdebine,
2002b). Nesse sentido, é altamente desejável direcionar a integração do gene
exógeno. Isto pode ser obtido utilizando-se diferentes métodos.
A introdução de genes exógenos através do sistema Cre-LoxP ou o cognato
Flp-FRT teoricamente pode direcionar para qualquer região do genoma. Para
alcançar este objetivo, o DNA exógeno deve ser flanqueado por duas seqüências
exatamente iguais à região almejada do genoma hospedeiro. Esse protocolo é
correntemente utilizado para inativar seletivamente genes hospedeiros. Mais de
5.000 genes foram assim eliminados em camundongos. Essa metodologia é
conhecida como knockout gênico (Kos, 2004; Wolf & Woodside, 2005).
A recombinação homóloga necessária para direcionar o gene é muito menos
freqüente do que a recombinação ilegítima que leva à integração aleatória. As
células nas quais as substituições de genes ocorreram, devem ser selecionadas e
devem ter mantido sua capacidade de gerar organismos vivos, através da formação
de animais quiméricos ou clonados. Alguns experimentos conduzidos com células
de cultivo transfectadas, bem como com animais transgênicos, contribuíram para
identificar promotores capazes de expressar genes exógenos em tipos específicos
de células e tecidos, sob a ação de indutores específicos. O seqüenciamento
completo do genoma de vários animais, bem como de fragmentos de DNA para
59
avaliar expressão gênica, está provendo aos cientistas um número cada vez maior
de promotores de genes para direcionar a expressão exógena a tecidos e fluidos
biológicos de interesse (Bell et al., 2001; Kues & Niemann, 2004; Li et al., 2006).
A especificidade de uma região promotora pode ser parcial, se elementos
regulatórios essenciais, localizados a longa distância, não estiverem presentes nas
construções gênicas. Além disso, a expressão do transgene é freqüentemente
modulada pela presença, em suas proximidades, de enhancers de genes endógenos
(Houdebine, 2004; Montoliu et al., 2004). O mesmo transgene pode, assim, ter
vários padrões de expressão nas diferentes linhagens de animais transgênicos. Isto
pode reduzir a relevância dos modelos experimentais. No melhor dos casos, tais
artefatos podem, fortuitamente, gerar situações fisiológicas inesperadas, que
revelem funções desconhecidas de um gene.
Animais transgênicos como biorreatores
Técnicas utilizando bactérias como modelos biológicos de biorreatores,
demonstraram características importantes: fácil manipulação e por apresentarem um
crescimento em qualquer escala. Porém, suas habilidades em relação a
modificações pós-traducionais são significativamente limitadas. Determinados
sistemas eucarióticos, como alguns fungos fermentativos, fungos filamentosos e
algas unicelulares, podem ser produzidos em larga escala sendo capazes de
realizarem modificações pós-traducionais necessárias a muitas proteínas
complexas. No entanto, esses sistemas estão frequentemente limitados em relação
a sua habilidade celular em simular os padrões do processamento de proteínas
humanas de interesse. Inclusive, podem gerar produtos recombinantes com
propriedades indesejáveis, como imunogenicidade ou ausência de bioatividade
protéica (Dyck et al., 2003).
Sistemas celulares de insetos são usados geralmente em escala laboratorial,
tendo alguns destes demonstrado um significativo rendimento na produção de
proteínas recombinantes (Tomita et al., 2003). Por outro lado, apresentam um
padrão de glicosilação diferenciado em relação ao realizado por células de
mamíferos e peixes.
O cultivo de células de mamíferos foi uma alternativa interessante para
resolver os problemas dos padrões diferenciados na execução das modificações
60
pós-traducionais. Entretanto, quando esse sistema é transportado a propósitos de
produção em larga escala, torna o custo extremamente alto, inviabilizando a
produção de proteínas recombinantes neste sistema (Niemann et al., 2005).
Com base nesse resumo de características biológicas ou econômicas, surgiu
uma alternativa em potencial, apesar de ainda ter de cruzar muitas barreiras
reguladoras: a produção de animais transgênicos como modelos de biorreatores de
proteínas com elevado valor biológico. Tal processo é oneroso, mas a relação custo
- benefício mostra-se favorável, pois após o animal ser produzido, pode reproduzir-
se e propagar o gene de interesse a sua progênie, de acordo com os princípios
mendelianos básicos (Wall et al., 2000).
A possibilidade de animais transgênicos expressarem proteínas em
determinados órgãos, utilizando-se promotores tecido-específicos, torna-os viáveis
como biorreatores de proteínas de importância biomédica. Animais de produção
podem servir como biofábricas na produção em larga escala de proteínas expressas
na urina ou no leite. O isolamento de proteínas expressas nos fluidos corporais
apresenta vantagens sobre os tecidos, pois estes são constantemente produzidos e
aquelas são facilmente recuperadas, quando comparado aos tecidos (Wheeler et
al., 2003).
Algumas proteínas complexas como proteína C, fatores da coagulação (FVII,
FVIII e FIX), hemoglobina, transferrina, antitrombina, albumina e alfa 1-antitripsina,
hormônio do crescimento humano (GH) entre outras, têm sido produzidas em
diferentes fluidos corporais de animais geneticamente modificados (Niemann et al.,
1996; Kerr et al., 1998; Niemann et al., 1999; Ryoo et al., 2001; Kim et al., 2006). O
que parece determinar o sucesso da expressão gênica é limitado por fatores pós-
traducionais, e esses fatores são dependentes do potencial tecidual das células do
biorreator de eleição (Montoliu et al., 2004). A Tab. 2 resume os principais eventos
e estudos ao longo das últimas décadas em transgênese animal
Os principais fluidos biológicos utilizados pela engenharia genética animal
são: leite, urina, sangue, plasma seminal, fluidos de insetos, claras de ovos de aves,
ovas e embriões de peixes.
61
Leite
A abordagem mais bem-sucedida até agora para a produção de proteínas
recombinantes em animais transgênicos, utiliza animais de fazenda, como vacas,
ovelhas, cabras ou porcas, com o gene clonado ligado ao promotor da β-
lactoglobulina do animal. Esse promotor é ativo no tecido mamário, o que significa
que a proteína será secretada no leite (Bodrogi et al., 2006).
Diversos estudos têm demonstrado que o tecido mamário pode ser o sítio de
produção de uma variedade de proteínas recombinantes de interesse farmacêutico,
independente da complexidade das moléculas (Andersen & Krummen, 2002;
Houdebine et al., 2002; Dyck et al., 2003; Houdebine, 2004). A Fig. 2 demonstra, de
forma esquemática, o princípio de geração deste modelo de biorreação.
Alguns autores consideram a produção de proteínas recombinantes no leite
um dos melhores modelos de biorreatores animal pela praticidade de obter grandes
volumes de leite para extração do produto biológico de interesse e pelo sistema de
produção leiteiro já estabelecido no mundo (Wheeler et al., 2003; Houdebine, 2005).
A glândula mamária apresenta uma série de vantagens, visto que as
proteínas do leite não circulam no corpo do animal; as proteínas como κ-caseína e
β-lactoglobulina são expressas em abundância e exclusivamente na glândula
mamária. Assim, proteínas heterólogas podem ser expressas nas glândulas
mamárias, clonando seus respectivos genes em vetores que contenham promotores
e elementos regulatórios dos genes que codificam para proteínas no leite
(Houdebine et al., 2002; Houdebine, 2004; Bodrogi et al.,2006).
Diversos trabalhos utilizando como modelos de biorreatores, vacas (Hyvonen
et al., 2006a; Hyvonen et al., 2006b), ovelhas (Niemann et al., 1999), cabras
(Baldassarre et al., 2003), porcas (Park et al., 2006) e camundongas transgênicas
(Yu et al., 2006) têm sido realizados, direcionando a expressão de uma gama
significativa de genes de interesse. Por exemplo, os fatores VIII e IX da coagulação
sangüínea humana, alfa 1-antitripsina foram produzidos no leite de ovelhas
transgênicas; o ativador de plasminogeno humano ativo biologicamente, no leite de
cabras transgênicas; e a proteína C com atividade anticoagulante e a hemoglobina
humana, no leite de porcas transgênicas.
Estratégias utilizando construções com vetores de expressão, contendo o
promotor da β-lactoglobulina (beta-Lac) de ovino, fusionado ao cDNA do FVIII, com
62
íntrons do gene de murino metalotionina (MtI) tem sido utilizadas. Geralmente essas
construções são usadas para gerar animais fundadores os quais transmitem o
transgene de forma mendeliana para a F1. A proteína recombinante (FVIII) pode ser
detectada no leite das fêmeas ovinas da F1 em concentrações de 4-6 ng/ml de leite
(Houdebine, 2005).
A produção do FIX no leite também foi demonstrado, utilizando o promotor,
éxon 1, íntron 1 e éxon 2 do gene beta caseína de cabra, fusionado ao cDNA hFIX,
para produzir fundadores transgênicos por microinjeção e transferência de embriões
em camundongas. A expressão no leite das camundongas foi de 52.9 mg/l e com
alta atividade biológica em testes in vitro de coagulação. Nesse estudo, ainda foi
possível observar que o transgene integrou em diferentes cromossomos dos
camundongos (Huang et al., 2005).
Esses estudos com moléculas biológicas complexas demonstram que a
glândula mamária pode servir de biorreator à produção de proteínas recombinantes
bioativas. Isso se deve à maquinaria do tecido mamário ser capaz de realizar
modificações pós-traducionais complexas como glicosilação e carboxilação (Lindsay
et al.,2004; Mikus et al.,2001). Alguns estudos têm demonstrado a viabilidade na
produção de anticorpos recombinantes no leite (Pollock et al.,1999; Houdebine,
2002a;).
Por outro lado, a produção de proteínas recombinantes no leite de vacas está
limitada não somente ao intervalo entre o nascimento e a primeira lactação, como
ainda a natureza descontínua da lactação, bem como o tempo e aos altos custos e
investimentos para manter animais de elevada performance leiteira. Em ovelhas e
porcas, a produção de proteínas de interesse no leite parece ser uma alternativa
mais barata, mas o número de animais necessários para a mesma produção
adquirida em modelos bovinos é bem maior. Apesar de a glândula mamária
apresentar um elevado potencial de produzir proteínas bioativas, acaba por
promover a toxicidade dessas moléculas à saúde do animal biorreator (Van Cott et
al., 1999; Van Cott et al., 2001; Dyck et al., 2003).
O uso da tecnologia de transgênicos em cabras, apenas foi reportado em
aplicações farmacológicas, por exemplo, o uso de cabras transgênicas como
biorreatores para a produção de proteínas recombinantes valiosas, de interesse
farmacêutico e biomédico. Neste sentido, as cabras oferecem uma vantagem
significativa sobre as ovelhas, visto que são eficientes produtoras de leite (500 a
63
1000 litros de leite por lactação) e, comparadas com as vacas, oferecem menor
custo de manutenção, maturidade sexual mais cedo e menor comprimento de
gestação (Baldassarre et al., 2003). É estipulado que os custos para produzir uma
vaca transgênica por microinjeção pronuclear é de US$ 546.000, comparado com
US$ 60.000 para produzir uma ovelha/cabra transgênica. Portanto, cabras são
animais próprios para a produção de proteínas recombinantes requeridas em várias
centenas de quilogramas por ano, enquanto vacas transgênicas seriam mais
apropriadas para proteínas requeridas em grandes quantidades, como albumina
sérica humana, com uma demanda estimada de várias toneladas métricas por ano
(Baldassarre et al., 2004).
Um dado importante a ser discutido relaciona-se à questão da expressão
ectópica, ou seja, quando se usam promotores de expressão de glândula mamária,
espera-se que a expressão dos genes de interesse se dê nessas células (Palmer et
al., 2003). No entanto, quando se empregam promotores de espécies diferentes,
mesmo sendo para o mesmo gene, bem como moléculas de cDNA, parece que
certos fatores de transcrição e a presença de seqüências nos íntrons, influenciam,
de certa forma, à expressão. Estudos têm demonstrado que muitos desses
problemas podem ser superados com a utilização de cromossomos artificiais (Duch
et al., 2004; Epinat et al., 2003).
Resumidamente, a produção de proteínas no leite é limitada por uma série de
fatores: i) presença de proteínas líticas que hidrolisam as proteínas heterólogas de
interesse; ii) alto custo para gerar e manter vacas, cabras e ovelhas transgênicas; iii)
alto custo de purificação protéica do leite em função do número elevado de
proteínas; bem como risco de transmissão de partículas virais presente em
enfermidades compartilhadas entre mamíferos. Neste sentido, outros fluidos
biológicos têm sido revisados como potencial uso como biorreator (Kues & Niemann,
2004; Houdebine, 2005; Niemann et al., 2005).
Urina
A expressão de proteínas na urina surge como uma alternativa interessante,
visto que proteínas produzidas neste sistema poderiam ser coletadas logo após o
nascimento, de ambos os sexos e durante toda vida do animal transgênico (Zhu et
al., 2003). A baixa concentração de proteínas e lipídeos presentes na urina facilita o
64
processo de purificação. Trabalhos recentes têm demonstrado o direcionamento da
expressão para os rins e para a bexiga, produzindo uma variada gama de proteínas
recombinantes humanas como: eritropoietina (Zbikowska et al., 2002; Kwon et al.,
2006), α
1
-antitripsina (Zbikowska et al.,2002), hormônio do crescimento (Zhu et al.,
2003), fator de necrose tumoral (TNF-α) (Zhu et al., 2004) e fator estimulante de
macrófagos (Ryoo et al., 2001; Kim et al., 2006).
(Kerr et al., 1998) determinaram o direcionamento da expressão gênica do
hormônio do crescimento humano, pelo promotor uroplakin II, ao urotélio da bexiga
de camundongos. Foi possível detectar na urina desses animais, até 500 ng/ml de
hormônio do crescimento humano, permanecendo constantes por 8 meses. Um
pequeno rebanho de gado com 200 animais transgênicos, onde cada um produza
aproximadamente 20 litros por dia de urina, com 0,5 mg/ml de proteína
recombinante, poderia produzir aproximadamente 300 gramas em 1 ano. O
uroplakin é um gene expresso exclusivamente no epitélio da bexiga. Isso permite
utilizar o promotor desses genes, uroplakin II, e fusionar a ele genes de interesse
que possam ser produzidos em bexigas de animais maiores como vacas (Zhu et al.,
2004).
Em outro estudo, também com camundongos transgênicos, foi possível
expressar fatores estimulantes de granulócitos humanos (hGM-CSF), na urina,
através do promotor uroplakin II. Foram constatadas expressões gênicas não só no
urotélio da bexiga, como também nos ureteres dos animais. A concentração
detectada foi de até 180 ng/ml do hGM-CSFe ainda com proliferação de monócitos,
determinando com que a proteína recombinante estivesse bioativa. Esta, sem
dúvida, foi a primeira demonstração de atividade biológica ativa produzida na urina
de um indivíduo transgênico (Ryoo et al., 2001; Kim et al., 2006; Kwon et al., 2006).
A uromodulina é a proteína mais abundante encontrada na urina de
mamíferos. Na tentativa de utilizar o promotor do gene dessa proteína, foram
desenvolvidos alguns trabalhos para dirigir a expressão ao tecido alvo. Tal proteína
é produzida e liberada até 200 mg/dia na urina de mamíferos placentários. O
promotor GUM, um fragmento clonado do promotor do gene da uromodulina de
cabras, dirigiu a expressão do gene repórter GFP aos rins de camundongos
transgênicos e com excreção eventual na urina das proteínas recombinantes. No
entanto, para o sistema biológico ser atrativo a aplicações comerciais, os níveis de
expressão devem estar entre 0.5 a 1 g/l de urina. Secreções de 65 µg/ml de alfa 1-
65
antitripsina em urinas de camundongos foram alcançadas, utilizando o promotor
humano da uromodulina (Huang et al., 2005).
A produção de proteínas recombinantes em sistema urinário promove um
grande avanço na questão de geração de animais transgênicos como modelos
biológicos de biorreatores, mas alguns fatores, desconhecidos até o momento,
limitam essa produção em larga escala. No entanto, algumas vantagens podem ser
destacadas como: presença de pouca quantidade de lipídeos e proteínas; alta
produção diária do fluido biológico; eliminação voluntária; além disso, a coleta do
material não necessariamente é invasiva; há facilidade de purificação das proteínas
recombinantes; o animal transgênico, neste modelo, poderia ser usado ao longo de
toda sua vida, como biorreator animal desde o nascimento (Foubister, 2004).
Plasma Seminal
O plasma seminal também tem sido considerado um local em potencial para
secreção de proteínas recombinantes em animais transgênicos. O sêmen é um
abundante fluido biológico em algumas espécies; além disso, de um modo geral
tem-se facilidade na obtenção. O interesse na obtenção de proteínas recombinantes
a partir do plasma seminal provém de alguns pontos como, por exemplo: grande
capacidade de produção de proteínas sendo contínua através de toda a vida do
animal; bem como pela eficiência no processo de modificações pós traducionais das
proteínas recombinantes (Houdebine, 2002b).
De forma geral, o sêmen suíno, por exemplo, apresenta 30 mg de proteína
por ml de sêmen; já o ejaculado de reprodutores, dessa espécie, pode produzir 200-
300 ml de sêmen em média, produzindo um total de 6-9 g de proteína por
ejaculação. Outro ponto interessante, é que a secreção nesses tecidos é
exclusivamente exócrina, minimizando o risco da atividade biológica da proteína
recombinante em ser prejudicial ao hospedeiro; isso pode ocorrer em outros
modelos de biorreatores como na urina de animais geneticamente modificados
(Houdebine, 2005).
Sob outro aspecto, a geração de animais transgênicos, como biorreatores,
produzindo proteínas recombinantes no sêmen, pode apresentar algumas limitações
devido ao conhecimento científico a respeito de seqüências regulatórias e
promotores que dirigem a expressão para as glândulas sexuais masculinas ser
66
ainda limitado. Conseqüentemente o isolamento e a caracterização dessas proteínas
são oportunos, a fim de determinar os genes que estão sendo expressos
naturalmente nos tecidos sexuais masculinos. Um número limitado de trabalhos
científicos tem sido descritos nessa linha de investigação, por outro lado, há um
vasto campo a ser explorado para dirigir a expressão gênica exógena e estabelecer
esse modelo de biorreação interessante. Um modelo bastante pertinente é o plasma
seminal de peixes.
O modelo mais estudado até o momento, em relação à produção de proteínas
em plasma seminal, é o suíno. O trabalho inédito, publicado na revista Nature, em
1999 pelo grupo canadense do renomado pesquisador Dr. François Pothier,
demonstrou claramente a produção de suínos transgênicos que expressavam, no
sêmen, o hormônio do crescimento humano (hGH). O grande ganho científico de tal
experimento foi demonstrado pela utilização do promotor específico do gene P12 de
camundongos fusionado ao gene hGH, dirigindo a expressão para vesícula seminal
de suínos. As concentrações obtidas de hGH foram de 0.5 mg/ml de sêmen (Dyck et
al.,1999). A produção de tal concentração protéica exógena foi imediatamente
atrativa à indústria farmacêutica (Dyck et al., 2003). No entanto, a manutenção dos
animais reprodutores geneticamente modificados ainda elevaria o custo do produto
final. A fim de promover novas estratégias de direcionamento da expressão gênica,
novos modelos e tecidos têm sido estudados. Nosso grupo vem trabalhado para
dirigir a expressão às células de Sertoli através de diversos promotores sintéticos
que estamos construindo.
O isolamento e caracterização das proteínas CRISP no final da década de 90,
promoveram uma interessante estratégias de direcionamento a ejaculados de
mamíferos, no entanto estas publicações passaram desapercebidas (Schwidetzky et
al.,1997). Essas proteínas, produzidas por células do epidídimo de camundongos
denominadas de CRISP-1 (cysteine-rich secretory protein-1) voltaram a ser alvo de
estudo de seus promotores gênicos com a finalidade de direcionamento da
expressão gênica ao sêmen (Klemme et al., 1999; Roberts et al., 2001; Roberts et
al., 2006).
Outro ponto significativo a ser considerado, refere-se ao processo de
purificação do produto de interesse, onde parece ser menos complexo do que os
aplicados a outros fluidos como leite e ovos de aves. Os processos de purificação
apresentam a tendência de evoluírem juntamente com as demais técnicas de
67
biologia molecular, não sendo um problema em longo prazo. No entanto,
características celulares intrínsecas aos tecidos candidatos a biorreatores, como
habilidade de executar modificações pós-traducionais, são fundamentais na eleição
dos modelos biológicos de expressão de proteínas recombinantes de alto valor
biológico (Gabril et al., 2002; Scieglinska et al., 2004).
Sangue
A possibilidade de isolamento de proteínas recombinantes em sangue de
suínos transgênicos tem sido explorada com a proposta de produzir hemoglobina
humana nesses animais (Janne et al.,1994). A proximidade morfofisiológica, entre a
espécie humana e suína, permite que manipulações genéticas na espécie suína
tenham significativas contribuições à biomedicina. Todavia, o sangue não tem
demonstrado ser um bom modelo de fluido corporal para produção de proteínas
recombinantes bioativas, devido ao efeito negativo e invasivo que essas moléculas
podem causar à saúde do modelo biológico utilizado (Lubon et al., 1996).
O soro, o qual coleta secreções de diversos tecidos, pode ser uma fonte
interessante de proteínas recombinantes. A alfa-1-antitripsina humana, por exemplo,
é uma glicoproteína de 52 kDa produzida principalmente pelos hepatócitos e tem
sido obtida em altos níveis, a partir de soro de coelhos transgênicos. Uma limitação
observada, nesse caso, é a dificuldade de purificação da proteína recombinante e
separação das demais proteínas endógenas presentes no fluido. A substituição de
genes endógenos por genes humanos, através da recombinação homóloga, tem
sido sugerida para solucionar esse problema. Anticorpos recombinantes foram
também detectados em sangue de suínos e coelhos geneticamente modificados.
Porém, esses estavam presentes em baixa concentração e hibridizados a cadeias
de anticorpos endógenos (Houdebine, 2000; Houdebine, 2002a).
Na realidade, o fluido sangüíneo apresenta uma complexidade biológica muito
significativa. Diversos componentes sangüíneos, principalmente protéicos, sofrem
mudanças conformacionais e funcionais já no tecido sangüíneo, o que torna esse
ambiente muito adverso à produção de proteínas recombinantes. Entretanto, já foi
demonstrado ser possível produzir proteínas recombinantes nesse fluido importante
a todos os demais sistemas do organismo (Niemann et al., 2005).
68
Clara de ovos de aves domésticas
A clara do ovo contém 60% de albumina, sendo que deste percentual 88% é
água e 11% são proteínas. A albumina é bioquimicamente simples, as principais
proteínas presentes em 60g de albumina são a ovoalbumina, ovotransferrina,
ovomucoide e a lisozima, que são as mais abundantes (54%, 12% , 12% e 3,4%
respectivamente) (Lillico et al., 2005).
Os ovos de galinhas contêm cerca de 4 gramas de proteínas, onde mais da
metade é produzida pelo gene da albumina, neste sentido, a região promotora do
gene da ovoalbumina é de grande interesse para o direcionamento da produção de
biofármacos recombinantes (Harvey et al.,2002; Ivarie, 2003; Harvey & Ivarie, 2003;
Ivarie, 2006;).
A produção de proteínas farmacêuticas em ovos pode ter vantagens
significativas para o direcionamento específico de drogas incluindo, uma apropriada
maquinaria para a glicolisação, baixo custo quando comparado à cultura de células
ou sistemas de mamíferos transgênicos em larga escala e o ovo é um ambiente
estéril. A produção de proteínas humanas, a partir de galinhas pode ser o método de
escolha para algumas proteínas que são tóxicas para os mamíferos (Harvey et al.,
2002).
Esforços para o desenvolvimento de modificações genéticas em aves têm
sido dirigidos não só pela importância das aves, bem como, para um modelo de
estudo do desenvolvimento destes vertebrados, e ainda mais, pela intrigante
possibilidade da produção de proteínas terapêuticas humanas nos ovos de aves
transgênicas (Lillico et al., 2005). Desenvolver aves geneticamente modificadas
biorreatoras, possibilita a diminuição dos riscos de veiculação de patógenos
interespecíficos, devido a sua grande distância filogenética em relação aos humanos
(Ivarie, 2003). Outra grande vantagem do uso de ovos de aves para a produção de
drogas protéicas é a semelhança entre o padrão de glicosilação das proteínas de
aves e de humanos, visto que alguns pacientes desenvolvem anticorpos contra
epítopos de açúcares exógenos de drogas manufaturadas em outros animais
transgênicos. As aves prometem um baixo custo para a alta produção de
biofármacos humanos através dos ovos modificados por engenharia genética (Ivarie,
2006).
69
A geração de aves transgênicas permanece como uma tarefa difícil, cujo
sucesso é ainda limitado. Salienta-se que a microinjeção de genes isolados na
célula embrionária, através de desenvolvimento in vitro representa uma
possibilidade. Por sua vez, o uso de células ES, para gerar aves quiméricas,
evidencia-se um método com elevado potencial. O interesse desses protocolos
ainda permanece limitado em razão de os genes exógenos não serem transmitidos
para a progêne na maior parte dos casos descritos (Etches et al.,1993; Etches,
2001). Vetores retrovirais têm sido muito estudados. Quando injetados perto de
células germinais primordiais de embriões de galinhas em desenvolvimento, tais
elementos são integrados no genoma, e os genes exógenos são encontrados na
progênie. Essas ferramentas recentes têm conduzido à produção de proteínas
exógenas em ovo branco de galinhas transgênicas. Considerando que uma única
galinha pode produzir 330 ovos por ano, e cada ovo branco apresenta,
naturalmente, 4 g de proteína, tal fenômeno tornaria esse sistema altamente
competitivo (Perry & Sang, 1993; Mozdziak et al., 2003; Mozdziak & Petitte, 2004b).
Os promotores gênicos ovoalbumina, ovomucóide e ovotransferrina têm sido
alvo de nosso grupo em estudos de direcionamento para produção de proteínas em
claras de ovos. Seqüências regulatórias do gene da lisosima parecem mediar a
secreção de proteínas exógenas neste biorreator (Lampard & Gibbins, 2002).
Várias metodologias vêm sendo utilizadas para acessar e manipular o
genoma de aves em diferentes estágios do desenvolvimento. Um destes métodos é
o uso de espermatozóides para carrear os genes para dentro do ovo no momento da
fertilização, através da SMGT, com a possibilidade de posterior integração do
mesmo no genoma do embrião (Hasebe et al.,1998). Este método é uma alternativa
muito atraente, visto que evitaria manipulações mais complexas. Nessa técnica, uma
construção de DNA é ligada aos espermatozóides e o sêmen é usado para
inseminar uma fêmea fértil em pico de postura. O espermatozóide, que fertiliza o ovo
com sucesso, carrega o transgene de interesse para dentro do ovo, e este
incorpora-se ao embrião e às aves nascidas. Neste aspecto, a ave doméstica é uma
candidata ideal para a produção eficiente de proteínas terapêuticas devido aos
seguintes fatores: i) o custo para alimentar uma galinha é mais baixo quando
comparado à alimentação de outros animais domésticos; ii) o ambiente do ovo é
naturalmente estéril (o que permite uma vida longa da proteína recombinante sem
que haja perda da atividade); iii) uma grande quantidade de proteína pode ser
70
produzida por ovo (50 mg ou mais); e iv) um grande número de ovos é produzido por
fêmea por ano (mais de 300 ovos por fêmea/ano) (Mozdziak & Petitte, 2004a).
Embriões e ovas de peixes
Embriões de peixes têm apresentado notáveis vantagens como modelos de
biorreatores, quando comparados com outros modelos de animais domésticos
transgênicos. Os produtos recombinantes derivados de ovas e embriões de peixes
promovem mais segurança em questões de saúde humana, pois até o momento não
foram descritos potenciais patógenos que desencadeassem zoonoses significativas
em humanos (Hwang et al., 2004).
Esse sistema de expressão de proteínas apresenta diversas vantagens: i)
proteínas podem ser produzidas de forma rápida e com baixo custo; ii) fácil
manutenção dos estoques; iii) podem ser sintetizadas proteínas recombinantes a
baixas temperaturas; iv) produção em larga escala dos animais geneticamente
modificados através de SMGT - Sperm Mediated Gene Transfer; (Collares et
al.,2005) v) a transmissão de vírus e prions, não ser conhecido até o momento, entre
peixes e humanos; vi) a maquinaria celular disponível ao complexo protéico
recombinante sofrer modificações pos-traducionais (PTMs).
O grupo japonês de pesquisa, coordenado pelo Dr. Goro Yoshizaki, tem
demonstrado a produção de gfLH (goldfish luteinizing hormone), utilizando, como
biorreatores, embriões de trutas com 4 dias de idade. O vetor de expressão
contendo o cDNA de gfLH foi microinjetado em ovas de truta arco-íris e, após 4 dias
de incubação a 10 ºC, foram selecionados os embriões transgênicos e obtida a
proteína recombinante glicosilada. A proteína purificada foi capaz de estimular a
produção de testosterona em fragmentos testiculares de goldfish, em ensaios de
atividade biológica. Esse estudo foi o primeiro a demonstrar a produção, com
sucesso, de gonadotrofinas recombinantes biotivas em peixes ciprinídios (Morita et
al., 2004). Os resultados desse grupo de pesquisa demonstraram que embriões de
trutas apresentam potenciais como biorreatores na produção de proteínas
recombinantes funcionais. É importante destacar que não só o hormônio luteinizante
(LH) como uma variedade de proteínas de interesse terapêutico, poderia ser
produzida por esse sistema. Sem dúvida, um caminho alternativo parece ter sido
traçado.
71
Outro grupo de destaque, coordenado pelo Dr. Norman Maclean, da
Universidade de Southampton, UK, tem demonstrado, em diversos trabalhos na
linha de transgênese de peixes, possibilidades surpreendentes de modificações
genéticas. Em um de seus trabalhos mais recentes, demonstrou a expressão do
fator VII da coagulação sangüínea humana em ovas de 3 espécies de peixes
(Clarias gariepinus, Oreochromis niloticus e Danio rerio). Nos ovos, foram
microinjetados construções circulares, contendo o promotor do CMV
(citomegalovírus) fusionado ao gene FVII. Esse grupo demonstrou a possibilidade de
expressar proteínas de interesse biofarmacêutico em ovas fertilizadas e não
fertilizadas, bem como, em estágios mais avançados do desenvolvimento, como em
embriões e em larvas de peixes. Pode ser destacado que cerca de 1800 ovos de
tilápias microinjetados podem produzir 4.5 mg do FVII da coagulação recombinante
(Hwang et al., 2004). Esses resultados demonstram que peixes podem ser
ferramentas interessantes, como modelo biológico de biorreator, para produção de
proteínas terapêuticas humanas recombinantes, através da transgenia animal.
Ambos os grupos de trabalho demonstraram alternativas do modelo de
biorreator, tanto para aqüicultura, através da produção de LH, para indução do
desenvolvimento gonadal, como para biomedicina, através da produção de fatores
da coagulação importantes no tratamento das hemofilias. Os animais transgênicos
foram gerados a partir de microinjeção em embriões.
Custo de produção de animais transgênicos como biorreatores
O custo de produção de um animal gerado por técnicas de biologia molecular
e reprodução animal avançada são muito relativos, e ainda, as informações
disponíveis provêm de laboratórios de pesquisas e de empresas que não estão à
vontade em divulgar seus custos de produção. No entanto, alguns dados disponíveis
são extremamente interessantes.
O tempo de fabricação do produto final, somado ao custo capital e de
produção estão a favor dos animais transgênicos, em relação ao cultivo de células
de mamíferos, geneticamente modificadas. Por exemplo, se fôssemos construir um
biorreator baseado em células de mamíferos, para produção de 10.000 litros de uma
determinada proteína, fabricada com facilidade por estas células, levar-se-iam de 3 a
5 anos e o custo seria de 250 a 500 milhões de dólares. Uma fazenda modelo
72
destinada à produção de animais transgênicos, como biorreatores para mesma
produção em leite, depende, é claro, da proteína de interesse, apresenta um custo
geral de 80 milhões de dólares, levando em consideração os processos de
purificação protéica. Para produção de 50 kg de uma proteína genérica, tem-se o
custo de US$942/g em cultivo de células de mamíferos. Já, em modelos de
biorreatores animal como no leite, por exemplo, esse custo é de US$700/g (Wall,
1999; Houdebine, 2000; Niemann & Kues, 2000; Niemann & Kues, 2003; Niemann et
al., 2005).
Salienta-se que a rápida expansão e crescimento da biotecnologia, nos
recentes anos, proporcionaram a expressão de uma variada gama de proteínas em
diferentes sistemas biológicos de produção, dirigido à saúde humana. Uma linha
importante a ser considerada é a produção de hemoderivados: fatores da
coagulação humana; eritropoetina e antitrombina III. Se considerarmos a produção
desses fatores sangüíneos, bem como de outras proteínas complexas bioativas, em
sistemas de biorreatores animais (leite, sêmen, urina e clara de ovos) poderíamos
ter um avanço significativo nos processos de produção em larga escala, com custos
menores e, consequentemente, valores menores ao produto final comercializado.
Aplicações comerciais dos animais transgênicos biorreatores
As primeiras fazendas farmacêuticas de animais transgênicos, como
biorreatores, foram estabelecidas por empresas biotecnológicas como
Pharmaceutical Proteins Ltd (PPL) na Escócia; Genzyme Transgenics, nos Estados
Unidos; Gene Pharming Europe, na Holanda; Bioprotein, na França; Nexia
Biotechnologies, no Canadá, entre outras (Houdebine, 2005; Niemann et al., 2005).
Sem dúvida, no final da década de 90, foi observada uma tendência à formação de
diversas empresas no ramo da engenharia genética animal e biotecnologia
avançada. Muitas delas acabaram fundindo-se e criando mega empresas no setor
de produção de fármacos. Outras, já grandes, durante esse processo criaram
empresas apêndices para realizar ensaios biológicos e prospecção futura da
viabilidade do negócio.
Enfatiza-se que os investimentos no setor biotecnológico crescem a cada ano.
Uma variedade de espécies, como vacas, cabras, porcas, ovelhas, camundongas,
coelhas e galinhas transgênicos, estão sendo utilizadas em ensaios biotecnológicos
73
para produção de fármacos recombinantes por 20 empresas no mundo. Estimam-se
cifras ao redor de 13 bilhões de dólares por ano investidos no setor, sendo 1 bilhão
apenas na produção de anticorpos humanizados (Houdebine, 2002b; Wheeler et al.,
2003).
Considerando a vasta gama de proteínas possíveis de serem expressas em
sistemas de biorreatores animal, através de custos significativamente mais baixos,
criou-se uma corrida na busca de novas ferramentas moleculares de produção e
purificação protéica. Novos modelos biológicos, como peixes e aves vêm sendo
considerados como biorreatores em potencial e, por conseqüência, o mercado já
responde com abertura de grupos de pesquisa e empresas dispostos a estudar essa
viabilidade.
Por sua vez o domínio de novas técnicas em biologia molecular e reprodução
animal têm determinado mudanças genéticas significativas em nível molecular,
resultando em uma revolução na biologia moderna. Inclusive, o sucesso em
modificar a maquinaria gênica de organismos vivos através da engenharia genética,
promoverá a reflexão em relação a vários conceitos e a estratégias a serem
definidas em terapias futuras. A habilidade dos animais transgênicos gerados em
produzir proteínas recombinantes, biologicamente ativas, de uma maneira eficiente e
econômica, estimulou muito o interesse nessa área, tendo uma influência crescente
em saúde humana e animal, bem como em setores de produção de fármacos.
A produção de animais transgênicos, como biorreatores, evidencia-se como
um processo ainda incômodo e problemático na consolidação dessa tecnologia,
visto que a transgenia apresenta-se como uma área necessariamente
multidisciplinar, habilitando diversos campos das ciências da vida, como biologia
celular, biologia molecular, histoquímica, bioquímica, fisiologia, embriologia, genética
e reprodução animal.
Irrefutavelmente, verifica-se que os modelos animais gerados por engenharia
genética animal destinados à produção de fármacos de elevado valor biológico,
chamados de biorreatores animal, têm demonstrado ser uma alternativa potencial,
mais econômica e produtiva, comparado aos sistemas de fermentação e cultivo
celulares.
Constata-se que ensaios pré-clínicos e clínicos devem ser constantemente
realizados até o estabelecimento dos novos produtos. A questão da biossegurança e
bioética não pode ser descuidadas, devendo sempre ser consideradas no setor de
74
pesquisa e produção. O estudo dos mecanismos que dirigem a expressão gênica
aos tecidos candidatos a biorreatores devem merecer maiores atenções pela
pesquisa, visto que parecem ser a chave de grande parte do sucesso desta linha.
Por fim, o controle total da expressão gênica e a produção de proteínas
recombinantes em animais transgênicos continuarão avançando, e os produtos
gerados serão constantemente avaliados quanto à sua segurança e eficiência.
75
Tabela 1. Interação entre células espermáticas e moléculas de DNA exógeno em
várias espécies, usando protocolos diferentes.
Classes Espécies Métodos de transfecção espermática
Equinodermas
Ouriço-do-mar Incubação
Moluscos
Abalone Eletroporação
Insetos
Mosca Incubação;
Bicho-da-seda Incubação
Lucilia cuprina
Incubação
Apis mellifera
Incubação
Peixes
Carpas Incubação
Eletroporação
African catfish Eletroporação
Tilápia Eletroporação
Zebrafish Eletroporação
Salmão Eletroporação
Loach Eletroporação
Anfíbios Xenopus laevis
Incubação - Espermatozóide /DNA; REMI;
Aves
Galos Incubação
Eletroporação
Lipofecção
REMI; LB-SMGT;
Mamíferos
Camundongos Incubação
Lipofecção
ICSI
LB-SMGT
Coelhos Incubação
Ovinos Incubação;
Caprinos Incubação
Suínos Incubação
Eletroporação
Bubalinos Incubação
Bovinos Incubação
Eletroporação;
Humanos Incubação;
Macaco Rhesus ICSI
76
Tabela 2. Resumo dos principais eventos e estudos ao longo das últimas décadas
em transgênese animal.
Data Principais eventos
1980
Camundongos transgênicos por microinjeção
1985
Coelhos, suínos e ovelhas transgênicos por microinjeção
1985
Peixes Transgênicos por microinjeção
1987
Direcionamento da Expressão ao leite / estudos de promotores
gênicos
1988
SMGT (Sperm Mediated Gene Transfer)
1989
Aves Transgênicas por transferência de células germinativas
primordiais
1990
Ratos Transgênicos biorreatores com expressão na glândula
mamária
1991
Vacas Transgênicas biorreatores com expressão na glândula
mamária
1992
Cabras Transgênicas biorreatores com expressão na glândula
mamária
1997
Transgênese via clonagem
2000
TMGT (Testis Mediated Gene Transfer)
2001
“enviropigs”
2002
Estudos com vetores lentivirais
2003
Avanços significativos com sistemas Cre-Lox de integração genômica
2004
Estudos de regiões proximais e distais de promotores gênicos
2005
Divulgação de resultados com suínos multitransgênicos
2006
Estudos de estabilidade protéica em fluídos biológicos biorreatores
2007...
Foco em construções gênicas estáveis e em cromossomos artificiais
77
Figura 1. Esquema demonstrativo dos eventos de transferência gênica em massa
baseada em células espermáticas para gerar animais transgênicos biorretores.
78
Figura 2. Esquema de produção de proteínas recombinantes em glândula mamária
utilizando tecnologia de microinjeção em embriões de bovinos.
79
Referências bibliográficas
Andersen DC, Krummen L. Recombinant protein expression for therapeutic
applications. Curr Opin Biotechnol, v.13, p.117-123, 2002.
Arima T, Ebara F, Fujihara N. Intra-testicular injection of foreign DNA as a possible
method for the production of transgenic chicken. J Applied Animal Research, v.20,
p.65-72, 2001.
Baldassarre H, Wang B, Kafidi N, Gauthier M, Neveu N, Lapointe J, Sneek L,
Leduc M, Duguay F, Zhou JF, Lazaris A, Karatzas CN. Production of transgenic
goats by pronuclear microinjection of in vitro produced zygotes derived from oocytes
recovered by laparoscopy. Theriogenology, v.59, p.831-839, 2003.
Baldassarre H, Wang B, Keefer CL, Lazaris A, Karatzas CN. State of the art in
the production of transgenic goats. Reproduction Fertility and Development, v.16,
p.465-470, 2004.
Bell AC, West AG, Felsenfeld G. Gene regulation - Insulators and boundaries:
Versatile regulatory elements in the eukaryotic genome. Science, v.291, p.447-450,
2001.
Beraldi R, Pittoggi C, Sciamanna I, Mattei E, Spadafora C. Expression of LINE-1
retroposons is essential for murine preimplantation development. Molecular
Reproduction and Development, v.73, p.279-287, 2006.
Bodrogi L, Brands R, Raaben W, Seinen W, Baranyi M, Fiechter D, Bosze Z.
High level expression of tissue-nonspecific alkaline phosphatase in the milk of
transgenic rabbits. Transgenic Research, v.15, p.627-636, 2006.
Bordignon V, Keyston R, Lazaris A, Bilodeau AS, Pontes JHF, Arnold D,
Fecteau G, Keefer C, Smith LC. Transgene expression of green fluorescent protein
and germ line transmission in cloned calves derived from in vitro-transfected somatic
cells. Biology of Reproduction, v.68, p.2013-2023, 2003.
Caelers A, Maclean N, Hwang GL, Eppler E, Reinecke M. Expression of
endogenous and exogenous growth hormone (GH) messenger (m) RNA in a GH-
transgenic tilapia (Oreochromis niloticus). Transgenic Research, v.14, p.95-104,
2005.
Carballada R, Esponda P. Regulation of foreign DNA uptake by mouse
spermatozoa. Experimental Cell Research, v.262, p.104-113, 2001.
80
Celebi C, Guillaudeux T, Auvray P, Vallet-Erdtmann V, Jegou B. The making of
"transgenic spermatozoa''. Biology of Reproduction, v.68, p.1477-1483, 2003.
Chang K, Qian J, Jiang M, Liu YH, Wu MC, Chen CD, Lai CK, Lo HL, Hsiao CT,
Brown L, Bolen J, Jr., Huang HI, Ho PY, Shih PY, Yao CW, Lin WJ, Chen CH, Wu
FY, Lin YJ, Xu J, Wang K. Effective generation of transgenic pigs and mice by
linker based sperm-mediated gene transfer. BMC Biotechnol, v.2, p.5, 2002.
Collares T, Bongalhardo DC, Deschamps JC, Moreira HLM. Transgenic animals:
The melding of molecular biology and animal reproduction. Animal Reproduction, v.2,
p.11-27, 2005.
Duch M, Carrasco ML, Jespersen T, Hansen BD, Pedersen FS. Transgene
stability for three replication-competent murine leukemia virus vectors. Gene, v.329,
p.61-69, 2004.
Dunn DA, Kooyman DL, Pinkert CA. Transgenic animals and their impact on the
drug discovery industry. Drug Discovery Today, v.10, p.757-767, 2005.
Dupuy AJ, Clark K, Carlson CM, Fritz S, Davidson AE, Markley KM, Finley K,
Fletcher CF, Ekker SC, Hackett PB, Horn S, Largaespada DA. Mammalian germ-
line transgenesis by transposition. Proceedings of the National Academy of Sciences
of the United States of America, v.99, p.4495-4499, 2002.
Dyck MK, Gagne D, Ouellet M, Senechal JF, Belanger E, Lacroix D, Sirard MA,
Pothier F. Seminal vesicle production and secretion of growth hormone into seminal
fluid. Nature Biotechnology, v.17, p.1087-1090, 1999.
Dyck MK, Lacroix D, Pothier F, Sirard MA. Making recombinant proteins in
animals - different systems, different applications. Trends in Biotechnology, v.21,
p.394-399, 2003.
Epinat JC, Arnould S, Chames P, Rochaix P, Desfontaines D, Puzin C, Patin A,
Zanghellini A, Paques F, Lacroix E. A novel engineered meganuclease induces
homologous recombination in yeast and mammalian cells. Nucleic Acids Research,
v.31, p.2952-2962, 2003.
Etches RJ. From chicken coops to genome maps: Generating phenotype from the
molecular blueprint. Poultry Science, v.80, p.1657-1661, 2001.
Etches RJ, Carsience RS, Clark ME, Fraser RA, Toner A, Gibbins AMV.
Chimeric Chickens and Their Use in Manipulation of the Chicken Genome. Poultry
Science, v.72, p.882-889, 1993.
81
Ewerling S, Hofmann A, Klose R, Weppert M, Brem G, Rink K, Pfeifer A, Wolf E.
Evaluation of laser-assisted lentiviral transgenesis in bovine. Transgenic Research,
v.15, p.447-454, 2006.
Fan JL, Watanabe T. Transgenic rabbits as therapeutic protein bioreactors and
human disease models. Pharmacology & Therapeutics, v.99, p.261-282, 2003.
Foubister V. A 'bioreactor' for bladder cancer cells. Drug Discovery Today, v.9,
p.946-947, 2004.
Gabril MY, Onita T, Ji PG, Sakai H, Chan FL, Koropatnick J, Chin J, Moussa M,
Xuan JW. Prostate targeting: PSP94 gene promoter/enhancer region directed
prostate tissue-specific expression in a transgenic mouse prostate cancer model.
Gene Therapy, v.9, p.1589-1599, 2002.
Giordano R, Magnano AR, Zaccagnini G, Pittoggi C, Moscufo N, Lorenzini R,
Spadafora C. Reverse transcriptase activity in mature spermatozoa of mouse.
Journal of Cell Biology, v.148, p.1107-1113, 2000.
Giraldo P, Montoliu L. Size matters: Use of YACs, BACs and PACs in transgenic
animals. Transgenic Research, v.10, p.83-103, 2001.
Gordon JW, Ruddle FH. Integration and Stable Germ Line Transmission of Genes
Injected Into Mouse Pronuclei. Science, v.214, p.1244-1246, 1981.
Gordon JW, Scangos GA, Plotkin DJ, Barbosa JA, Ruddle FH. Genetic
transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad
Sci U S A, v.77, p.7380-7384, 1980.
Hammer RE, Pursel VG, Rexroad CE, Wall RJ, Bolt DJ, Ebert KM, Palmiter RD,
Brinster RL. Production of Transgenic Rabbits, Sheep and Pigs by Microinjection.
Nature, v.315, p.680-683, 1985.
Harvey AJ, Ivarie R. Validating the hen as a bioreactor for the production of
exogenous proteins in egg white. Poultry Science, v.82, p.927-930, 2003.
Harvey AJ, Speksnijder G, Baugh LR, Morris JA, Ivarie R. Expression of
exogenous protein in the egg white of transgenic chickens. Nature Biotechnology,
v.20, p.396-399, 2002.
Hasebe M, Soh T, Hattori M, Fujihara N. An attempt to produce transgenic chicken
mediating sperm cells as vectors. Journal of Applied Animal Research, v.14, p.143-
150, 1998.
Hibbitt O, Coward K, Kubota H, Prathalingham N, Holt W, Kohri K, Parrington J.
In vivo gene transfer by electroporation allows expression of a fluorescent transgene
82
in hamster testis and epididymal sperm and has no adverse effects upon testicular
integrity or sperm quality. Biol Reprod, v.74, p.95-101, 2006.
Hofmann A, Kessler B, Ewerling S, Weppert M, Vogg B, Ludwig H, Stojkovic M,
Boelhauve M, Brem G, Wolf E, Pfeifer A. Efficient transgenesis in farm animals by
lentiviral vectors. Embo Reports, v.4, p.1054-1060, 2003.
Hofmann A, Zakhartchenko V, Weppert M, Sebald H, Wenigerkind H, Brem G,
Wolf E, Pfeifer A. Generation of transgenic cattle by lentiviral gene transfer into
oocytes. Biology of Reproduction, v.71, p.405-409, 2004.
Houdebine LM. Transgenic animal bioreactors. Transgenic Res, v.9, p.305-320,
2000.
Houdebine LM. Antibody manufacture in transgenic animals and comparisons with
other systems. Curr Opin Biotechnol, v.13, p.625-629, 2002a.
Houdebine LM. The methods to generate transgenic animals and to control
transgene expression. J Biotechnol, v.98, p.145-160, 2002b.
Houdebine LM. Preparation of recombinant proteins in milk. Methods Mol Biol,
v.267, p.485-494, 2004.
Houdebine LM. Use of transgenic animals to improve human health and animal
production. Reprod Domest Anim, v.40, p.269-281, 2005.
Houdebine LM, Rival S, Pantano T, Jolivet G, Thepot D, Attal J. Transgenesis for
the study and the control of lactation. Reprod Nutr Dev, v.42, p.117-125, 2002.
Huang YJ, Chretien N, Bilodeau AS, Zhou JF, Lazaris A, Karatzas CN. Goat
uromodulin promoter directs kidney-specific expression of GFP gene in transgenic
mice. Bmc Biotechnology, v.5, 2005.
Hwang GL, Muller F, Rahman MA, Williams DW, Murdock PJ, Pasi KJ,
Goldspink G, Farahmand H, Maclean N. Fish as bioreactors: Transgene
expression of human coagulation factor VII in fish embryos. Marine Biotechnology,
v.6, p.485-492, 2004.
Hyvonen P, Suojala L, Haaranen J, von WA, Pyorala S. Human and bovine
lactoferrins in the milk of recombinant human lactoferrin-transgenic dairy cows during
lactation. Biotechnol J, v.1, p.410-412, 2006a.
Hyvonen P, Suojala L, Orro T, Haaranen J, Simola O, Rontved C, Pyorala S.
Transgenic cows that produce recombinant human lactoferrin in milk are not
protected from experimental Escherichia coli intramammary infection. Infect Immun,
v.74, p.6206-6212, 2006b.
83
Ivarie R. Avian transgenesis: progress towards the promise. Trends in
Biotechnology, v.21, p.14-19, 2003.
Ivarie R. Competitive bioreactor hens on the horizon. Trends in Biotechnology, v.24,
p.99-101, 2006.
Janne J, Hyttinen JM, Peura T, Tolvanen M, Alhonen L, Sinervirta R, Halmekyto
M. Transgenic Bioreactors. International Journal of Biochemistry, v.26, p.859-870,
1994.
Keefer CL. Production of bioproducts through the use of transgenic animal models.
Animal Reproduction Science, v.82-83, p.5-12, 2004.
Kerr DE, Liang FX, Bondioli KR, Zhao HP, Kreibich G, Wall RJ, Sun TT. The
bladder as a bioreactor: Urothelium production and secretion of growth hormone into
urine. Nature Biotechnology, v.16, p.75-79, 1998.
Kim MO, Kim SH, Lee SR, Kim KS, Min KS, Lee HT, Kim SJ, Ryoo ZY.
Transgene expression of biological active recombinant human granulocyte-colony
stimulating factor (hG-CSF) into mouse urine. Life Sciences, v.78, p.1003-1009,
2006.
Klemme LM, Roberts KP, Hoffman LB, Ensrud KM, Siiteri JE, Hamilton DW.
Cloning and characterization of the rat Crisp-1 gene. Gene, v.240, p.279-288, 1999.
Koo BC, Kwon MS, Choi BR, Lee HT, Choi HJ, Kim JH, Kim NH, Jeon I, Chang
W, Kim T. Retrovirus-mediated gene transfer and expression of EGFP in chicken.
Molecular Reproduction and Development, v.68, p.429-434, 2004.
Kos CH. Cre/loxP system for generating tissue-specific knockout mouse models.
Nutrition Reviews, v.62, p.243-246, 2004.
Kues WA, Niemann H. The contribution of farm animals to human health. Trends in
Biotechnology, v.22, p.286-294, 2004.
Kwon DN, Choi YJ, Park JY, Cho SK, Kim MO, Lee HT, Kim JH. Cloning and
molecular dissection of the 8.8 kb pig uroplakin II promoter using transgenic mice
and RT4 cells. Journal of Cellular Biochemistry, v.99, p.462-477, 2006.
Lai LX, Prather RS. Progress in producing knockout models for xenotransplantation
by nuclear transfer. Annals of Medicine, v.34, p.501-506, 2002.
Lampard GR, Gibbins AMV. Secretion of foreign proteins mediated by chicken
lysozyme gene regulatory sequences. Biochemistry and Cell Biology-Biochimie et
Biologie Cellulaire, v.80, p.777-788, 2002.
84
Lavitrano M, Busnelli M, Cerrito MG, Giovannoni R, Manzini S, Vargiolu A.
Sperm-mediated gene transfer. Reproduction Fertility and Development, v.18, p.19-
23, 2006.
Lavitrano M, Camaioni A, Fazio VM, Dolci S, Farace MG, Spadafora C. Sperm
Cells As Vectors for Introducing Foreign Dna Into Eggs - Genetic-Transformation of
Mice. Cell, v.57, p.717-723, 1989.
Lavitrano M, Maione B, Forte E, Francolini M, Sperandio S, Testi R, Spadafora
C. The interaction of sperm cells with exogenous DNA: A role of CD4 and major
histocompatibility complex class II molecules. Experimental Cell Research, v.233,
p.56-62, 1997.
Li L, Shen W, Min LJ, Dong HS, Sun YJ, Pan QJ. Human lactoferrin transgenic
rabbits produced efficiently using dimethylsulfoxide-sperm-mediated gene transfer.
Reproduction Fertility and Development, v.18, p.689-695, 2006.
Lillico SG, McGrew M, Sherman A, Sang HM. Transgenic chickens as bioreactors
for protein-based drugs. Drug Discovery Today, v.10, p.191-196, 2005.
Lindsay M, Gil GC, Cadiz A, Velander WH, Zhang CM, Van Cott KE. Purification
of recombinant DNA-derived factor IX produced in transgenic pig milk and
fractionation of active and inactive subpopulations. Journal of Chromatography A,
v.1026, p.149-157, 2004.
Lubon H, Paleyanda RK, Velander WH, Drohan WN. Blood proteins from
transgenic animal bioreactors. Transfusion Medicine Reviews, v.10, p.131-143, 1996.
Lunney JK. Advances in swine biomedical model genomics. International Journal of
Biological Sciences, v.3, p.179-184, 2007.
Magnano AR, Giordano R, Moscufo N, Baccetti B, Spadafora C. Sperm/DNA
interaction: Integration of foreign DNA sequences in the mouse sperm genome.
Journal of Reproductive Immunology, v.41, p.187-196, 1998.
McCreath KJ, Howcroft J, Campbell KHS, Colman A, Schnieke AE, King AJ.
Production of gene-targeted sheep by nuclear transfer from cultured somatic cells
(vol 405, pg 1066, 2000). Nature, v.408, p.120-+, 2000.
Mikus T, Maly P, Poplstein M, Landa V, Trefil P, Lidicky J. Expression of human
erythropoietin gene in the mammary gland of a transgenic mouse. Folia Biologica,
v.47, p.187-195, 2001.
Mizuarai S, Ono K, Yamaguchi K, Nishijima K, Kamihira M, Iijima S. Production
of transgenic quails with high frequency of germ-line transmission using VSV-G
85
pseudotyped retroviral vector. Biochemical and Biophysical Research
Communications, v.286, p.456-463, 2001.
Montoliu L, Larue L, Beermann F. On the use of regulatory regions from
pigmentary genes to drive the expression of transgenes in mice. Pigment Cell
Research, v.17, p.188-190, 2004.
Morita T, Yoshizaki G, Kobayashi M, Watabe S, Takeuchi T. Fish eggs as
bioreactors: the production of bioactive luteinizing hormone in transgenic trout
embryos. Transgenic Research, v.13, p.551-557, 2004.
Mozdziak PE, Borwornpinyo S, McCoy DW, Petitte JN. Development of
transgenic chickens expressing bacterial beta-galactosidase. Dev Dyn, v.226, p.439-
445, 2003.
Mozdziak PE, Petitte JN. Status of transgenic chicken models for developmental
biology. Dev Dyn, v.229, p.414-421, 2004b.
Mozdziak PE, Petitte JN. Status of transgenic chicken models for developmental
biology. Developmental Dynamics, v.229, p.414-421, 2004a.
Muramatsu T, Shibata O, Ryoki S, Ohmori Y, Okumura J. Foreign gene
expression in the mouse testis by localized in vivo gene transfer. Biochemical and
Biophysical Research Communications, v.233, p.45-49, 1997.
Nagashima H, Fujimura T, Takahagi Y, Kurome M, Wako N, Ochiai T, Esaki R,
Kano K, Saito S, Okabe M, Murakami H. Development of efficient strategies for the
production of genetically modified pigs. Theriogenology, v.59, p.95-106, 2003.
Niemann H, Halter R, Carnwath JW, Herrmann D, Lemme E, Paul D. Expression
of human blood clotting factor VIII in the mammary gland of transgenic sheep.
Transgenic Research, v.8, p.237-247, 1999.
Niemann H, Halter R, Espanion G, Wrenzycki C, Herrmann D, Lemme E,
Carnwath JW, Paul D. Expression of human blood clotting factor VIII (FVIII)
constructs in the mammary gland of transgenic mice and sheep. Journal of Animal
Breeding and Genetics-Zeitschrift fur Tierzuchtung und Zuchtungsbiologie, v.113,
p.437-444, 1996.
Niemann H, Kues W, Carnwath JW. Transgenic farm animals: present and future.
Revue Scientifique et Technique-Office International des Epizooties, v.24, p.285-298,
2005.
Niemann H, Kues WA. Transgenic livestock, premises and promises. Animal
Reproduction Science, v.60, p.277-293, 2000.
86
Niemann H, Kues WA. Application of transgenesis in livestock for agriculture and
biomedicine. Animal Reproduction Science, v.79, p.291-317, 2003.
Palmer CA, Lubon H, McManaman JL. Transgenic mice expressing recombinant
human protein C exhibit defects in lactation and impaired mammary gland
development. Transgenic Research, v.12, p.283-292, 2003.
Palmiter RD, Brinster RL, Hammer RE, Trumbauer ME, Rosenfeld MG, Birnberg
NC, Evans RM. Dramatic growth of mice that develop from eggs microinjected with
metallothionein-growth hormone fusion genes. Nature, v.300, p.611-615, 1982.
Park JK, Lee YK, Lee P, Chung HJ, Kim S, Lee HG, Seo MK, Han JH, Park CG,
Kim HT, Kim YK, Min KS, Kim JH, Lee HT, Chang WK. Recombinant human
erythropoietin produced in milk of transgenic pigs. Journal of Biotechnology, v.122,
p.362-371, 2006.
Perry MM, Sang HM. Transgenesis in Chickens. Transgenic Research, v.2, p.125-
133, 1993.
Pollock DP, Kutzko JP, Birck-Wilson E, Williams JL, Echelard Y, Meade HM.
Transgenic milk as a method for the production of recombinant antibodies. Journal of
Immunological Methods, v.231, p.147-157, 1999.
Rieth A, Pothier F, Sirard MC. Electroporation of bovine spermatozoa to carry DNA
containing highly repetitive sequences into oocytes and detection of homologous
recombination events. Molecular Reproduction and Development, v.57, p.338-345,
2000.
Roberts KP, Ensrud KM, Wooters JL, Nolan MA, Johnston DS, Hamilton DW.
Epididymal secreted protein Crisp-1 and sperm function. Molecular and Cellular
Endocrinology, v.250, p.122-127, 2006.
Roberts KP, Hoffman LB, Ensrud KM, Hamilton DW. Expression of Crisp-1
mRNA splice variants in the rat epididymis, and comparative analysis of the rat and
mouse Crisp-1 gene regulatory regions. Journal of Andrology, v.22, p.157-163, 2001.
Robl JM, Wang Z, Kasinathan P, Kuroiwa Y. Transgenic animal production and
animal biotechnology. Theriogenology, v.67, p.127-133, 2007.
Ryoo ZY, Kim MO, Kim KE, Bahk YY, Lee JW, Park SH, Kim JH, Byun SJ,
Hwang HY, Youn J, Kim TY. Expression of recombinant human granulocyte
macrophage-colony stimulating factor (hGM-CSF) in mouse urine. Transgenic
Research, v.10, p.193-200, 2001.
87
Sato M, Gotoh K, Kimura M. Sperm-mediated gene transfer by direct injection of
foreign DNA into mouse testis. Transgenics, v.2, p.357-369, 1999.
Sato M, Ishikawa A, Kimura M. Direct injection of foreign DNA into mouse testis as
a possible in vivo gene transfer system via epididymal spermatozoa. Molecular
Reproduction and Development, v.61, p.49-56, 2002.
Schwidetzky U, Schleuning WD, Haendler B. Isolation and characterization of the
androgen-dependent mouse cysteine-rich secretory protein-1 (CRISP-1) gene.
Biochemical Journal, v.321, p.325-332, 1997.
Sciamanna I, Barberi L, Martire A, Pittoggi C, Beraldi R, Giordano R, Magnano
AR, Hogdson C, Spadafora C. Sperm endogenous reverse transcriptase as
mediator of new genetic information. Biochemical and Biophysical Research
Communications, v.312, p.1039-1046, 2003.
Sciamanna I, Piccoli S, Barberi L, Zaccagnini G, Magnano AR, Giordano R,
Campedelli P, Hodgson C, Lorenzini R, Spadafora C. DNA dose and sequence
dependence in sperm-mediated gene transfer. Molecular Reproduction and
Development, v.56, p.301-305, 2000.
Scieglinska D, Vydra N, Krawczyk Z, Widlak W. Location of promoter elements
necessary and sufficient to direct testis-specific expression of the Hst70/Hsp70.2
gene. Biochemical Journal, v.379, p.739-747, 2004.
Shemesh M, Gurevich M, Harel-Markowitz E, Benvenisti L, Shore LS, Stram Y.
Gene integration into bovine sperm genome and its expression in transgenic
offspring. Molecular Reproduction and Development, v.56, p.306-308, 2000.
Shen W, Li L, Pan QJ, Min LJ, Dong HS, Deng JX. Efficient and simple production
of transgenic mice and rabbits using the new DMSO-sperm mediated exogenous
DNA transfer method. Molecular Reproduction and Development, v.73, p.589-594,
2006.
Smith K, Spadafora C. Sperm-mediated gene transfer: applications and
implications. Bioessays, v.27, p.551-562, 2005.
Spadafora C. Sperm cells and foreign DNA: a controversial relation. Bioessays,
v.20, p.955-964, 1998.
Spadafora C. Endogenous reverse transcriptase: a mediator of cell proliferation and
differentiation. Cytogenetic and Genome Research, v.105, p.346-350, 2004.
88
Takeuchi Y, Yoshizaki G, Kobayashi T, Takeuchi T. Mass isolation of primordial
germ cells from transgenic rainbow trout carrying the green fluorescent protein gene
driven by the vasa gene promoter. Biology of Reproduction, v.67, p.1087-1092, 2002.
Tomita M, Munetsuna H, Sato T, Adachi T, Hino R, Hayashi M, Shimizu K,
Nakamura N, Tamura T, Yoshizato K. Transgenic silkworms produce recombinant
human type III procollagen in cocoons. Nature Biotechnology, v.21, p.52-56, 2003.
Van Cott KE, Butler SP, Russell CG, Subramanian A, Lubon H, Gwazdauskas
FC, Knight J, Drohan WN, Velander WH. Transgenic pigs as bioreactors: a
comparison of gamma-carboxylation of glutamic acid in recombinant human protein
C and factor IX by the mammary gland. Genetic Analysis-Biomolecular Engineering,
v.15, p.155-160, 1999.
Van Cott KE, Lubon H, Gwazdauskas FC, Knight J, Drohan WN, Velander WH.
Recombinant human protein C expression in the milk of transgenic pigs and the
effect on endogenous milk immunoglobulin and transferrin levels. Transgenic
Research, v.10, p.43-51, 2001.
Wall RJ. Biotechnology for the production of modified and innovative animal
products: transgenic livestock bioreactors. Livestock Production Science, v.59,
p.243-255, 1999.
Wall RJ, Paleyanda RK, Foster JA, Powell A, Rexroad C, Lubon H. DNA
preparation method can influence outcome of transgenic animal experiments. Animal
Biotechnology, v.11, p.19-32, 2000.
Wang HJ, Lin AX, Chen YF. Association of rabbit sperm cells with exogenous DNA.
Animal Biotechnology, v.14, p.155-165, 2003.
Webster NL, Forni M, Bacci ML, Giovannoni R, Razzini R, Fantinati P, Zannoni
A, Fusetti L, Dalpra L, Bianco MR, Papa M, Seren E, Sandrin MS, Mc Kenzie IFC,
Lavitrano M. Multi-transgenic pigs expressing three fluorescent proteins produced
with high efficiency by sperm mediated gene transfer. Molecular Reproduction and
Development, v.72, p.68-76, 2005.
Wheeler MB, Walters EM, Clark SG. Transgenic animals in biomedicine and
agriculture: outlook for the future. Animal Reproduction Science, v.79, p.265-289,
2003.
Wolf SE, Woodside KJ. Transgenic and gene knock-out techniques and burn
research. Journal of Surgical Research, v.123, p.328-339, 2005.
89
Yonezawa T, Furuhata Y, Hirabayashi K, Suzuki M, Takahashi M, Nishihara M.
Detection of transgene in progeny at different developmental stages following testis-
mediated gene transfer. Molecular Reproduction and Development, v.60, p.196-201,
2001.
Yoshizaki G, Tago Y, Takeuchi Y, Sawatari E, Kobayashi T, Takeuchi T. Green
fluorescent protein labeling of primordial germ cells using a nontransgenic method
and its application for germ cell transplantation in salmonidae. Biol Reprod, v.73,
p.88-93, 2005.
Yu Z, Meng Q, Yu H, Fan B, Yu S, Fei J, Wang L, Dai Y, Li N. Expression and
bioactivity of recombinant human lysozyme in the milk of transgenic mice. Journal of
Dairy Science, v.89, p.2911-2918, 2006.
Zbikowska HM, Soukhareva N, Behnam R, Chang R, Drews R, Lubon H,
Hammond D, Soukharev S. The use of the uromodulin promoter to target
production of recombinant proteins into urine of transgenic animals. Transgenic
Research, v.11, p.425-435, 2002.
Zhu HJ, Zhang ZQ, Zeng XF, Wei SS, Zhang ZW, Guo YL. Cloning and analysis of
human UroplakinII promoter and its application for gene therapy in bladder cancer.
Cancer Gene Therapy, v.11, p.263-272, 2004.
Zhu XH, Cheng J, Huang LW, Gao J, Zhang ZT, Pak J, Wu XR. Renal tubule-
specific expression and urinary secretion of human growth hormone: a kidney-based
transgenic bioreactor. Transgenic Research, v.12, p.155-162, 2003.
90
4 ARTIGO 3
Artigo formatado segundo as normas da revista Transgenic Research
Sperm-mediated gene transfer in South American Silver
Catfish (Rhamdia quelen)
Tiago Collares
1
*; Vinicius Farias Campos
1
; Paulo Varoni Cavalcanti
1
; Fabiana
Kömmling Seixas
1
; Luciano da Silva Pinto
1
; Heden Luiz Marques Moreira
1
,
Sérgio
Renato Noguez Piedras
1
; Luis Fernando Fernandes Marins
2
; Odir Antônio
Dellagostin
1
; João Carlos Deschamps
1
1
Centro de Biotecnologia (Cenbiot) – Universidade Federal de Pelotas, Pelotas –RS
/Brazil;
2
Departamento de Ciências Fisiológicas; Fundação Universidade Federal de Rio
Grande, Rio Grande, RS /Brazil
*Correspondence to: Tiago Collares, Centro de Biotecnologia – Universidade Federal
de Pelotas, Caixa Posta 354 · CEP 96010-900, Pelotas – RS / Brazil, E-mail:
Phone: +55 53 32757588
Fax: +55 53 32757551
Article type: Original paper
Running title: Sperm-mediated gene transfer in Silver Catfish
91
Abstract
We have been interested in developing convenient mass gene transfer methods for
producing transgenic Silver Catfish (Rhamdia quelen) to be used as bioreactor for
biopharmaceuticals industry. An alternative strategy to generate transgenic animals
consists of introducing foreign DNA into male gametes before the fertilization
process. However, sperm of each species has its own particularities and biologic
characteristics, which influence the success of mass DNA transfer methods. Our
objective was to evaluate different SMGT methods for obtaining transgenic Silver
Catfish. Five different treatments for incorporation of foreign DNA (a plasmid DNA
containing the GFP reporter gene), plus a control group were used: 1)
dehydrated/rehydrated (DR), 2) dehydrated/rehydrated/electroporated (DRE), 3)
electroporated (E), 4) incubated with seminal plasma (INC); and 5) incubated in the
absence of seminal plasma (INCSP). Reproductive variables such as sperm motility,
time of activity duration (TAD), fertilization rate (FR), hatching rate (HR) and sperm
morphology were also evaluated for all treatments. The motility rate did not differ
significantly among DRE (90%) and the other treatments, including the control
(76.7±5.7%). In DR treatment, motility rate did not differ from the control and the E
treatment did not differed from the INCSP treatment. The TAD rate was higher in the
control group (217±9s). The TAD rate of DRE (171±8s) did not differing from the DR
(178±17s) treatment. INCSP obtained the lower rate, demonstrating the importance
of the seminal plasma for maintenance of the motility. However, FR and hatching
rates in the INCSP, INC and E treatments did not differ (P>0.05) among them, but
differed from the DRE, DR and control groups. The rates of embryo GFP expression
were: DRE – 63%; DR – 44%; E – 34%; INC 8% and INCSP 38%. The PCR positivity
rates for the presence of the transgene were: DRE - 60%; DR – 40%; E – 25%; INC
5%; and INCSP 25%. There was no significant difference (P>0.05) among DRE and
DR, E and DR, E and INCSP for embryo GFP expression and PCR positivity rates.
These results suggest that Rhamdia quelen sperm cells can be manipulated in order
to obtain transgenic fish in large scale. Osmotic shock or removal of seminal plasma
can increase the rate of transgenic embryos. There is no need for using
electroporation or microinjection equipments for this species.
92
Keywords: sperm; Silver Catfish; transgenic animal; osmotic differential;
electroporation;
1. Introduction
The Silver Catfish (Rhamdia quelen) is a teleost species from the Siluridae
family and is an important species for aquaculture in temperate and subtropical
climates. Silver catfish occurs from Southern Mexico to Central Argentina, and
husbandry of this species is spreading towards Southern Brazil. Fish farmers are
interested in the culture of this species because of its growth rate, omnivorous
feeding habit, high fertilization and hatching rates, and good acceptance by the
consumers (Barcellos et al., 2001; Barcellos et al., 2006; Bolognesi da Silva and
Barcellos 2006). This species of freshwater fish presents interesting biological
characteristics for studies of animal transgenesis due to its potential use as a
bioreactor for the pharmaceutical industry (Borges et al., 2005).
Transgenic animal production has various applications, including generation of
animals with better or improved performance (Caelers et al., 2005), animals as
models for studies (Fan and Watanabe 2003; Houdebine 2005), animals for the
production of proteins of pharmacological interest (Houdebine 1994; Harvey and
Ivarie 2003; Dyck et al., 2003; Hwang et al., 2004; Baldassarre et al., 2007), animals
for the production of organs for transplant (xenotransplants) (Lavitrano et al.,
1999;Lai and Prather 2002;Niemann et al., 2005;Houdebine 2006; Webster et al.,
2005; Smolenski et al., 2007) and animals for gene expression and regulation -
promoters and coding sequences studies (Giraldo and Montoliu 2001; Montoliu et al.,
2004; Houdebine 2002; Moreira et al., 2007). However, the optimization of the
efficiency of the process of animal production depends on the improvement and
success of the reproductive biotechnical advances (Moreira et al., 2007).
The microinjection technique results in high success rates in mice, but it is not
an efficient method when applied to livestock (Lavitrano et al., 2006). In fish, gene
transfer can be achieved most reliably by microinjection into the cytoplasm of
fertilized eggs. However, the hard chorion and/or the opaqueness of the eggs in
many species render the method of microinjection tedious and time-consuming, if not
altogether impractical for single-generation mass production (Kang et al., 1999).
A logical alternative strategy to generate transgenic animals consists of
introducing foreign DNA into male gametes before the fertilization process (Lavitrano
93
et al., 1989; Spadafora 1998; Sciamanna et al., 2003). Since 1989, a new method for
the production of transgenic animals has been available, namely sperm-mediated
gene transfer (SMGT), based on the intrinsic ability of sperm cells to bind and
internalize exogenous DNA molecules and to transfer them into the oocyte at
fertilization (Lavitrano et al., 1989;Maione et al., 1998;Lavitrano et al., 2006). Several
reliable methods to produce transgenic animals utilize the male genome. After
penetration into oocyte, sperm DNA undergoes dramatic conformational changes
that could represent a great opportunity for exogenous DNA to be integrated in the
zygote genome (Zannoni et al., 2006). The utilization of sperm cells with foreign
DNA, followed by in vitro or in vivo fertilization, has generated transgenic mice
(Beraldi et al., 2006), rabbits (Wang et al., 2003), pigs (Lavitrano et al., 2003), cows
(Shemesh et al., 2000; Coward et al., 2007), chicken (Nakanishi and Iritani 1993) and
fish (Khoo et al., 1992; Sarangi et al., 1999; Kang et al., 1999; Lu et al., 2002; Lu et
al., 2002; Wang et al., 2004) among others.
Catfish and tilapias are too sensitive to microinjection and hence must be
subjected to alternate methods of gene introduction like electroporation and sperm-
mediated transfer (Pandian and Marian 1994). Naturally, aquatic animals produce a
huge number of sperm cells what is and advantage for SMGT techniques. However,
sperm from each species shows biological particularities, determining the success or
failure of the SMGT technique and there are evidences that indicate that DNA uptake
by the spermatozoa is a very specific and highly regulated phenomenon (Carballada
and Esponda 2001). Therefore, the main objective of this study was to evaluate the
potential of Silver Catfish sperm submitted to SMGT comparing osmotic differential
and/or electroporation and incubation in presence or absence of seminal plasma as
means of increasing the rate of transgenic embryos.
2. Materials and Methods
2.1 pCBA-GFP and pCMV-GFP vectors preparation
In this study, two vectors for eukaryotic cells expression were used, pCBA-
GFP, which carries the carp β-actin promoter fused to the GFP (Green Fluorescent
Protein) and directs the gene expression mainly to the muscular tissue, and pCMV-
GFP vector (Clontech®), which carries the cytomegalovirus (CMV) promoter and
94
promotes GFP expression in various tissues, but mainly in the nervous system. The
described plasmids were used to transform competent E. coli DH5α cells, previously
prepared for heat shock transformation, and submitted to large scale DNA extraction
using the Perfectprep Plasmid Maxi kit (Eppendorf, Germany®). pCMV-GFP was
digested with ApaL1 restriction enzyme and pcBA-GFP, with SpeI. These linearized
vectors were used as exogenous DNA to transfect Silver Catfish sperm cells. The
exogenous DNA concentration used was 25 µg/ml for pCMV-GFP eukaryotic
expression vector and 5 µg/ml for pcBA-GFP, which were simultaneously co-
transfected, in a total of 30 µg/ml.
2.2 Gametes collection and manipulation
The experiments were conducted using six adult male Silver Catfish with
average body weight of 534 g and average total length of 38 cm. Animals were
maintained at the UFPel Aquaculture Station, in 500 L fiber tanks with closed water
circulation. Human chorionic gonadotrophin (hCG) at 400 UI/kg was used for
inducing artificial spermiation. After 8 h of induction, semen was collected by
immobilizing and blinding the animals with a humidified towel to avoid stress and
injuries. The urogenital papilla was dried with paper towel to reduce the possibility of
contamination with water, feces or urine and the consequent sperm activation with
NaCl – 50 mOsm/kg. Semen was aspired with graduated syringes (5.0 ml), stored in
15 ml Falcon tubes properly identified, and maintained at 8 ºC during transportation
to the Federal University of Pelotas Biotechnology Center, where the treatments
were performed.
Immediately after collection, 5 µl of fresh semen from each fish was placed in
slides and tested for sperm activation by fluid contamination using an optical phase
contrast microscope (200x). Considering that sperm in non-contaminated fresh fish
semen are non-motile, the samples exhibiting no sperm motility were considered
adequate for the experiments.
To access female gametes and perform in vitro fertilization, three female Silver
Catfish were induced with 800 UI of hCG/kg of live weight. The average corporal
weight of the females used in this experiment was 1120 g and the average total
length was 44 cm. After 12 h of hormonal induction, the eggs were collected in plastic
buckets by hand stripping, synchronized with the sperm manipulation treatments.
95
2.3 Sperm diluents
Three diluents with different osmotic pressures (isosmotic, hyperosmotic and
hyposmotic) were used. The ejaculates collected from the 6 male donors were
evaluated by sperm osmolarity using a Wescor 5500 pressure osmometer before
sperm dilution. The isosmotic solution was based on catfish sperm diluents, often
used in fish sperm cryopreservation processes (Christensen and Tiersch 1997).
These diluents present osmotic pressure of approximately 300 mOsm/kg, similar to
the average of the donor ejaculates showed in previous trials (305 mOsm/kg), not
allowing sperm activation after dilution.
Semen samples were stored in 1.5 ml microtubes and incubated at 5 ºC.
Catfish diluents were used under different osmotic pressures; hyperosmotic (595
mOsm/kg), isosmotic (305 mOsm/kg), and hyposmotic (125 mOsm/kg).
Sperm samples were submitted to five treatments: treatment 1 – dehydration
and rehydration (DR), treatment 2 – dehydration, rehydration and electroporation
(DRE), treatment 3 – only electroporation (E), treatment 4 - incubation with seminal
plasma (INC); and treatment 5- incubation in the absence of seminal plasma (INCSP)
and control, which consisted of fresh semen samples diluted in isosmotic media
without exogenous DNA. Dehydrated sperm was obtained by incubation in
hyperosmotic (595 mOsm / Kg) Catfish diluents, for 1 h at 5 ºC. For rehydration, the
dehydrated sperm was mixed with an equal volume of hyposmotic (125 mOsm/kg)
Catfish diluents, containing foreign DNA, yielding a medium isosmotic to the original
seminal fluid at about 320 mOsm/kg. Dehydrated/rehydrated sperm samples were
submitted to electroporation. It was conducted with 3.0V capacitance, 200 ohms, and
2.5 kV for all electropored samples using the MicroPulser Electroporator (Bio-rad®,
USA). INC treatment was accomplished by incubation at a 1:1 (Sperm:isosmotic
medium DNA complex) for 1 h at 5 ºC. INCSP treatment was washed by
centrifugation (500 × g for 10 min at 5 ºC) for removal of the seminal plasma. The
pellet was quickly and gently dissolved in isosmotic medium DNA complex. There
was no sperm activation of the sperm cells during the dilutions. For sperm activation,
NaCl – 50 mOsm/kg - activation solution (AS) was used at 1:10 (semen:AS)
proportion, allowing sperm motility and time of activity duration (TAD) analyses, both
performed in optical phase contrast microscope (200x).
96
2.4 Sperm morphology
Due to the reduced dimension of Silver Catfish sperm observed at the optical
microscope, the sperm morphology of the proposed treatments was performed by
scan electronic microscopy to evaluate sperm integrity and to determine the cellular
dimensions of the spermatozoa of this species. The samples were processed
according to Castro (2002).
2.5 In vitro fertilization
After treatment, semen samples were transported from the UFPel
Biotechnology Center to the UFPel Aquaculture Station to perform in vitro fertilization
under controlled systems. At the station, sperm motility (SM) and time of activity
duration (TAD) analyses after treatment and transport were measured.
Previously induced females were extruded for collection of eggs. These were
weighted and split in glass plates for fertilization with the sperm from each treatment.
Approximately 9,000 eggs were used in each treatment (3,000 eggs per repetition),
totalizing 54,000 eggs. Three thousand eggs were mixed with 1 ml of treated semen,
homogenized with a glass stick and then activated with 150 ml of activation solution
(NaCl 50 mOsm/kg). After fertilization, eggs were maintained in submersed
incubators, in pools with water properly controlled for standard temperature for the
Silver Catfish embryo development (23 ºC), pH (7.6), CO
2
(0.5%), alkalinity (21%),
and oxygen saturation (75%).
2.6 Gene expression
The hatching larvae were maintained in properly controlled pools for 96 h post-
hatching. After 100 h of embryo development, the animals measuring approximately
0.8 cm were evaluated for GFP gene expression in fluorescence microscope. Ninety
animals per treatment were evaluated. All animals that presented any variable
degrees of expression during fluorescence analysis were considered positive for
GFP.
97
2.7 PCR and sequencing of the PCR product
Twenty animals of each treatment were randomly selected for genomic DNA
extraction. DNA was obtained by PureLink™ Genomic DNA Purification Kit
(Invitrogen®, USA).
Polymerase chain reaction (PCR) was performed in a final volume of 25 µl
containing 2.5 µL of 10x buffer, 0.5 µl of 10 mM dNTP, 150 ng of each primer, 0.5 µl
(1 unit) of Platinum® Taq DNA Polymerase High Fidelity (Invitrogen®, USA), 0.5 µl of
50 mM MgCl
2
, 18 µl of Milli-Q water and 2 µl of containing 100 ng of template DNA.
GFP-specific oligonucleotides (5'- CGGGACTTTCCAAAATGTCG -3' and 5'-
GAAGATGGTGCGCTCCTGGA -3') to amplify a 500-base pair (bp) fragment were
used. PCR reactions were carried out in an Eppendorf (Mastercycler gradient)
thermocycler programmed for an initial denaturation step (2 min at 94 °C) followed by
30 cycles of 1 min at 94 °C, 1 min at 50 °C, and 1 min at 72 °C. The last cycle was
followed by a final incubation of 7 min at 72 °C. The samples were then stored at 4
°C until used. Amplified fragments were analyzed by standard horizontal
electrophoresis on 1% agarose gels in TBE buffer (10 mM Tris-borate, 1 mM EDTA,
pH 8.0) at 100 V. The DNA bands were stained with 0.5 µg/ml ethidium bromide as
previously described (Sambrook et al., 1989). Control samples containing all reaction
components except DNA were always used to test that no self amplification or DNA
contamination occurred. PCR products were treated with ExoSap (GE Healthcare,
USA) or gel purified using GFX PCR DNA purification kit (GE Healthcare, USA) and
sequenced as described bellow. Sequences of PCR products were determined using
the DYEnamic ET terminators sequencing kit (GE Healthcare, USA) following the
protocol supplied by the manufacturer. Sequencing reactions were then analyzed in a
MegaBACE 500 automatic DNA sequencer (GE Healthcare, USA). Each PCR
product was sequenced four times in both directions using the same primers
previously used to amplify the GFP gene and listed above.
The quality of DNA sequences was checked and overlapping fragments were
assembled using BioEdit package and Vector NTI 8.0, AlignX and ContigExpress
(InforMax, Inc.). Assembled sequences with high quality were aligned using
CLUSTALX, with default gap penalties. Homologies analyses were performed with
the NCBI database and BLAST program.
98
2.8 Statistical analysis
ANOVA was used to evaluate the effects of treatments in sperm motility (SM),
time of activity duration (TAD), fertilization rate (FR), and hatching rate (HR), followed
by Duncan test for means comparison (SAS Institute Inc., Cary, NC). Fisher Exact
Tests and Pearson's Chi-Square were used to evaluation gene expression and PCR
positivity rates. Differences were considered to be statistically significant at the 95%
confidence level (P<0.05). Pearson correlation coefficients among variables were
tested.
3. Results
3.1 Sperm Motility
The DRE treatment resulted in motility parameters higher than the control
treatment (p<0.05). It is probably a reflex of the osmotic differential plus the
electroporation that promoted a reorganization of the plasmatic membrane with
activation of sodium and potassium pumps, stimulating sperm motility and cell
activity. Motility in DR treatment did not differ from the control group, but differed
when compared to other groups. Electroporation group demonstrated significant loss
of the motility compared to the control, DR and DRE, however, there was no
difference when compared to incubation treatments in the presence or absence of
seminal plasma and foreign DNA. We could observe that the removal of proteins of
the seminal plasma, as well as other seminal constituents, promoted a significant
loss of motility in the INCSP group (p<0.05). Based on Pearson correlation
coefficients, it was possible to observe a significant correlation between motility x
TDA and motility x IFV, but not between motility and hatching rate (HR). This
demonstrates that other factors can influence the HR, besides the presence of
foreign DNA.
3.2 Time of Activity Duration (TAD)
The time of activity duration, in other words, the time in which the spermatozoa
remains motile, is important because it is the length of time that the spermatozoa
99
interacts with female gametes during the fertilization process. Statistical analyses for
this parameter separated the treatments in five significantly different groups (Table
1). The TAD for the control group (217.0±9.0s) was higher than the other treatments
(p<0.05). DR and DRE treatments did not differ, demonstrating that the
electroporation process increases the motility, when used with differential osmotic,
but it does not influence the time of activity duration when compared to the DR
treatment. Electroporation (E) treatment was significantly higher when compared to
the INC and INCSP treatments, however significantly lower than the DR, DRE and
control treatments. The lower TAD rate (44.6±5.5s) was observed for the INCSP
treatment. Removal of the constituents of the seminal plasma promotes loss of
energy source to maintain sperm motility. It was possible to observe a significant
correlation between TDA x motility, TDA x IFV and TDA x HR (Table2).
3.3 in vitro Fertilization rate (FR)
Statistical analyses for FR parameter separated the treatments in three
significantly different groups (Table1). DRE treatment (90.3±0.58%) did not differ
from the control (89.0±5.29%) but it differed from the other treatments. The DR
treatment resulted in a lower FR (78.0±2.65%) than the DRE and control treatments
but, it was significantly higher when compared to other treatments that did not differ
among themselves (E=64.6±5.03%; INC=65.3±4.16% and INC SP=69.6±0.58%).
Table 2 shows significant correlation between FR and motility. However, the control
treatment did not differ from the DRE treatment although motility rates were
significantly different (p<0.05). The cause of this effect might be a cellular exhaustion
resulting from the increment given by the osmotic differential plus the electroporation.
3.4 Hatching Rate (HR)
The embryo HR is the percentage of embryos emerging from fertilized eggs.
For this parameter it was observed two groups with a significant statistical difference.
Control, DR and DRE treatments did not differ among them but they differed from E,
INC and INCSP treatments that did not differ among them (Table1). Hatching rates
increased when an osmotic differential was applied on sperm cells, showing that
electroporation is not necessary to increase this rate. Incubation of sperm cell/DNA,
100
in the presence or absence of seminal plasma, in isosmotic conditions, demonstrates
the same effect for this parameter. Pearson correlation coefficients among tested
variables demonstrated that HR presents a significant correlation only with TAD
(r=0.85), indicating that the duration of the sperm activity can determine the success
of the eggs HR, regardless the presence of foreign DNA (Table 2). The low
correlation between FR and HR (r=0.59) can be a reflex of the interference in gene
regulation of the embryonic development caused by the foreign DNA or the effect of
manipulation carried out in the gametes.
3.5 Sperm morphology
Morphology data, not previously published, that characterize the morphology
of Rhamdia quelen spermatozoa were measured: head with diameter of 1 µm and
length of 2 µm - tail with diameter of 120 nm and length of 20 µm. The presence of
acrosome was not observed in these cells. Sperm morphology demonstrated
agglutination of cell in the electroporation (E) and INCSP treatments not observed in
other treatments (Figure 1), but without loss of integrity for all treatments.
It was observed sperm pathologies acceptable in 20% for all samples
analyzed. This results of procedures for the sperm manipulation and injury caused by
the treatments. However, this did not affect the fertilization processes of each
treatment.
3.6 Gene expression, PCR and sequencing analyses
All treatments were capable of generating animals with different degrees of
transient GFP expression in muscle and/or nervous tissues, except for the control
treatment. A total of 44% (40/90) and 63% (57/90) of transgenic fish from DR and
DRE treatments were observed, respectively. This treatments did not differ
significantly (P>0.05) demonstrating that electroporation did not promote increase in
the expression rate. In addition, DR treatment did not differ from the E treatment
(34% - 31/90), indicating that only the osmotic differential can promote the influx of
foreign DNA and to determine the same expression rate, therefore it is not necessary
the use of electroporation equipments. INCSP treatment resulted in an expression
rate (38% - 34/90) that did not differ from the E treatment, demonstrating that the
101
removal of biological constituents of the seminal plasma can determine an increment
in the incorporation of foreign DNA without the need of sophisticated equipments.
The treatment with the lower expression rate was the incubation with seminal plasma
(INC), with 8% (7/90) of the animals expressing GFP. This event can be explained by
the presence of inhibiting proteins and DNAses in the seminal plasma (data not
demonstrated).
PCR analysis confirmed the presence of the transgene in DNA extracted from
different groups, except for the control group. All control DNA samples were
negative. The PCR product, corresponding to 500 bp of the pCMV-GFP vector
sequence, was detected in 8 of 20 (40%), 12 of 20 (60%), 5/20 (25%), 1 of 20 (5%)
and 5 of 20 (25%) fish from DR, DRE, E, INC and INC SP treatments, respectively.
Foreign DNA was not detected in any of the twenty control fish examined. The
difference of PCR positivity rate between DR and DRE, as well as between E and
INC SP, and DR and E were not significant (p>0.05), but it was highly significant
(p<0.05) between DRE and E (Table1). PCR products obtained from the different
treatments were confirmed by sequencing.
4. Discussion
In this study we showed that Rhamdia quelen spermatozoa can be
successfully manipulated to generate transgenic fish, after applying an osmotic
differential folloed by electroporation or not, or through short incubation with foreign
DNA in the presence or absence of seminal plasma. However, important statistical
differences were observed for all treatments. We demonstrated that mass gene
transfer is possible through sperm rehydrated in the presence of foreign DNA.
Kang et al., (1999) did not pursue the in vitro fertilization of eggs with
nonelectroporated sperm rehydrated in the presence of DNA and therefore they
cannot ascertain if an osmotic differential per se could be used to produce transgenic
fish. The approach reported here, which uses only sperm, is simple and more
practical for mass production, since a larger number of gametes can be treated at
one time just by osmotic differential. The fluorescence microscopy, PCR and
sequencing analysis results showed that the transgene entered the offspring cells in
all treatments. This agrees with observations on other animal species and supports
the idea that animal spermatozoa can be easily transfected in vitro (Lavitrano et al.,
102
1989; Khoo et al., 1992; Spadafora 1998; Gandolfi 1998; Khoo 2000; Lavitrano et al.,
2006; Hoelker et al., 2007). However, it is important to consider that the success of
transfection with foreign DNA seems to be a characteristic own DNA, of the
concentration, of the linear and/or circular proportion forms (Sciamanna et al., 2000;
Shen et al., 2006; Hoelker et al., 2007).
The current study could not distinguish animal-to-animal variation in transgene
expression and sperm potential as has been described previously (Alderson et al.,
2006). In the other hand, in vitro evidence suggests that sperm cell are able to
acquire DNA and RNA molecules present in the medium (Gandolfi 1998; Magnano et
al., 1998; Giordano et al., 2000) but in natural condition this has not been
demonstrated.
The sperm mediated gene transfer has strong interference from the presence
or absence of seminal plasma proteins (Lavitrano et al., 1997; Lavitrano et al., 2006).
In this study it was possible to observe that, through the results of reproductive
parameters. It has been demonstrated that the presence of seminal plasma protein is
important for maintenance of the sperm quality in fish. However, we did not pursue
the in vitro fertilization of eggs with sperm without seminal plasma submitted to the
osmotic differential. It is conceivable that removal of proteins that block the entrance
of foreign DNA and reestablishment of sperm motility by the osmotic differential could
favor transfection rates.
Transgenic fish offer an alternative to rodents as vertebrate laboratory
animals. The use of fish in certain research areas can significantly reduce the
exploitation of mammals, decrease costs and speed the research process. In
addition, fish can be useful for monitoring potential health hazards associated with
exposure to chemicals in the aquatic environment (Houdebine and Chourrout 1991;
Lu et al., 2002; Hwang et al., 2004; Morita et al., 2004; Caelers et al., 2005; Hu et al.,
2006; Yazawa et al., 2006). In this sense it is important to establish new transfer
techniques in mass for genes of interest that are important in studies of molecular
ecology and biotechnology (Hu et al., 2006).
The adequate use of transfected fish sperm could probably generate large
numbers of transgenic larvae and this is an important step for the future
pharmaceutical biotechnology industry that will use transgenic animal as a bioreactor
of recombinant proteins. Transgenesis methods utilizing the male gamete as a vector
103
of exogenous DNA have been developed; their efficiency could suggest a protection
mechanism of exogenous DNA from degradation.
In summary, we have demonstrated the GFP could be introduced into Silver
Catfish by SMGT. Not only, by electroporation and by osmotic differential treatment
but, also sperm incubation in absence or presence of seminal plasma.
Acknowledgements
This work was supported by the Brazilian Government through CNPq and
CAPES. We are grateful to Dr. Luis Antônio Suíta de Castro, Laboratório de
Microscopia Eletrônica / Embrapa Clima Temperado – RS/Brazil.
104
Table1. Averages of the treatments for the analyzed variables.
Treatments Motility(%) TAD (s) FR (%) HR (%) GFP(%) PCR (%)
Control 76.6±5.77 b 217.0±9.00 a 89.0±5.29 a 90.0±0 a 0 (0/90)d 0 (0/20)c
DR 80.0±0 b 179.6±17.50 b 78.0±2.65 b 90.0±0 a 44 (40/90)ab 40 (8/20)ab
DRE 90.0±0 a 171.3±8.08 b 90.3±0.58 a 88.3±2.89 a 63 (57/90)a 60 (12/20)a
E 56.6±5.77 cd 91.3±7.09 c 64.6±5.03 c 73.3±5.77 b 34 (31/90)b 25 (5/20)b
INC 53.2±5.77 d 65.0±5.00 d 65.3±4.16 c 73.3±2.89 b 8 (7/90)c 5 (1/20)c
INC SP 63.2±5.77 c 44.6±5.51 e 69.6±0.58 c 71.6±2.89 b 38 (34/90)b 25 (5/20)b
Treatments: (DR) dehydrated/rehydrated; (DRE) dehydrated/rehydrated/electroporated; (E) electroporated; (INC)
sperm incubation with seminal plasma; (INCSP) sperm incubation in the absence of seminal plasma. Parameters:
sperm motility; (TAD) time of activity duration; (FR) fertilization rate; (HR) hatching rate; (GFP) embryo GFP
expression and (PCR) PCR positivity rate.
a,b,c,d,e
differ significantly (P<0.05) in the same column.
105
Table 2 – Pearson correlation coefficients among tested variables
Motility HR FR
TAD
0.7994 * 0.8507 * 0.8720 *
FR
0.9196 ** 0.5984 ns -------------------
HR
0.6202 ns ----------------- -------------------
ns: did not differ significantly; * P < 0.05; ** P < 0.01;
Parameters: sperm motility; (TAD) time of activity duration; (FR) in vitro fertilization rate; (HR) hatching rate;
106
Figure1.
Sperm morphology demonstrated agglutination of cell but without loss of
integrity for all treatments. Treatments: (DR) dehydrated/rehydrated; (DRE)
dehydrated/rehydrated/electroporated; (E) electroporated; (INC) sperm incubation
with seminal plasma; (INCSP) sperm incubation in the absence of seminal plasma.
107
References
Alderson J, Wilson B, Laible G, Pfeffer P, L'Huillier P (2006) Protamine sulfate
protects exogenous DNA against nuclease degradation but is unable to improve the
efficiency of bovine sperm mediated transgenesis. Animal Reproduction Science
91:23-30.
Baldassarre H, Hockley DK, Dore M, Brochu E, Hakier B, Zhao X, Bordignon V
(2007) Lactation performance of transgenic goats expressing recombinant human
butyryl-cholinesterase in the milk. Transgenic Res
Barcellos LJG, Kreutz LC, Quevedo RM (2006) Previous chronic stress does not alter
the cortisol response to an additional acute stressor in jundia (Rhamdia quelen, Quoy
and Gaimard) fingerlings. Aquaculture 253:317-321.
Barcellos LJG, Woehl VM, Wassermann GF, Quevedo RM, Ittzes I, Krieger MH
(2001) Plasma levels of cortisol and glucose in response to capture and tank
transference in Rhamdia quelen (Quoy & Gaimard), a South American catfish.
Aquaculture Research 32:121-123.
Beraldi R, Pittoggi C, Sciamanna I, Mattei E, Spadafora C (2006) Expression of
LINE-1 retroposons is essential for murine preimplantation development. Molecular
Reproduction and Development 73:279-287.
Bolognesi da Silva L, Barcellos LJG (2006) Alternative species for traditional carp
polyculture in southern South America: Initial growing period. Aquaculture 255:417-
428.
Borges A, Siqueira DR, Jurinitz DF, Zanini R, do Amaral F, Grillo ML, Oberst ER,
Wassermann GF (2005) Biochemical composition of seminal plasma and annual
variations in semen characteristics of jundia Rhamdia quelen (Quoy and Gaimard,
Pimelodidae). Fish Physiology and Biochemistry 31:45-53.
108
Caelers A, Maclean N, Hwang GL, Eppler E, Reinecke M (2005) Expression of
endogenous and exogenous growth hormone (GH) messenger (m) RNA in a GH-
transgenic tilapia (Oreochromis niloticus). Transgenic Research 14:95-104.
Carballada R, Esponda P (2001) Regulation of foreign DNA uptake by mouse
spermatozoa. Experimental Cell Research 262:104-113.
Castro, L,A,S (2002) Processamento de amostras para microscopia eletrônica de
varredura. Embrapa Série Documentos, CPACT. Pelotas, RS., v. 93, p. 1-37.
Christensen JM, Tiersch TR (1997) Cryopreservation of channel catfish
spermatozoa: effect of cryoprotectant, straw size, and formulation of extender.
Theriogenology 47:639-645.
Coward K, Kubota H, Parrington J (2007) In vivo gene transfer into testis and sperm:
Developments and future application. Archives of Andrology 53:187-197.
Dyck MK, Lacroix D, Pothier F, Sirard MA (2003) Making recombinant proteins in
animals - different systems, different applications. Trends in Biotechnology 21:394-
399.
Fan JL, Watanabe T (2003) Transgenic rabbits as therapeutic protein bioreactors
and human disease models. Pharmacology & Therapeutics 99:261-282.
Gandolfi F (1998) Spermatozoa, DNA binding and transgenic animals. Transgenic
Research 7:147-155.
Giordano R, Magnano AR, Zaccagnini G, Pittoggi C, Moscufo N, Lorenzini R,
Spadafora C (2000) Reverse transcriptase activity in mature spermatozoa of mouse.
Journal of Cell Biology 148:1107-1113.
Giraldo P, Montoliu L (2001) Size matters: Use of YACs, BACs and PACs in
transgenic animals. Transgenic Research 10:83-103.
109
Harvey AJ, Ivarie R (2003) Validating the hen as a bioreactor for the production of
exogenous proteins in egg white. Poultry Science 82:927-930.
Hoelker M, Mekchay S, Schneider H, Bracket BG, Tesfaye D, Jennen D, Tholen E,
Gilles M, Rings F, Griese J, Schellander K (2007) Quantification of DNA binding,
uptake, transmission and expression in bovine sperm mediated gene transfer by RT-
PCR: Effect of transfection reagent and DNA architecture. Theriogenology 67:1097-
1107.
Houdebine LM (2006) Transgenic interventions on xenotransplantation. Biofutur 32-
37.
Houdebine LM (2005) Use of transgenic animals to improve human health and
animal production. Reproduction in Domestic Animals 40:269-281.
Houdebine LM (1994) Production of pharmaceutical proteins from transgenic
animals. J Biotechnol 34:269-287.
Houdebine LM (2002) The methods to generate transgenic animals and to control
transgene expression. J Biotechnol 98:145-160.
Houdebine LM, Chourrout D (1991) Transgenesis in fish. Experientia 47:891-897.
Hu W, Wang YP, Zhu ZY (2006) A perspective on fish gonad manipulation for
biotechnical applications. Chinese Science Bulletin 51:1-7.
Hwang GL, Muller F, Rahman MA, Williams DW, Murdock PJ, Pasi KJ, Goldspink G,
Farahmand H, Maclean N (2004) Fish as bioreactors: Transgene expression of
human coagulation factor VII in fish embryos. Marine Biotechnology 6:485-492.
Kang JH, Yoshizaki G, Homma O, Strussmann CA, Takashima F (1999) Effect of an
osmotic differential on the efficiency of gene transfer by electroporation of fish
spermatozoa. Aquaculture 173:297-307.
110
Khoo HW (2000) Sperm-mediated gene transfer studies on zebrafish in Singapore.
Molecular Reproduction and Development 56:278-280.
Khoo HW, Ang LH, Lim HB, Wong KY (1992) Sperm Cells As Vectors for Introducing
Foreign Dna Into Zebrafish. Aquaculture 107:1-19.
Lai LX, Prather RS (2002) Progress in producing knockout models for
xenotransplantation by nuclear transfer. Annals of Medicine 34:501-506.
Lavitrano M, Busnelli M, Cerrito MG, Giovannoni R, Manzini S, Vargiolu A (2006)
Sperm-mediated gene transfer. Reproduction Fertility and Development 18:19-23.
Lavitrano M, Camaioni A, Fazio VM, Dolci S, Farace MG, Spadafora C (1989) Sperm
Cells As Vectors for Introducing Foreign Dna Into Eggs - Genetic-Transformation of
Mice. Cell 57:717-723.
Lavitrano M, Forni M, Bacci ML, Di Stefano C, Varzi V, Wang HJ, Seren E (2003)
Sperm mediated gene transfer in pig: Selection of donor boars and optimization of
DNA uptake. Molecular Reproduction and Development 64:284-291.
Lavitrano M, Maione B, Forte E, Francolini M, Sperandio S, Testi R, Spadafora C
(1997) The interaction of sperm cells with exogenous DNA: A role of CD4 and major
histocompatibility complex class II molecules. Experimental Cell Research 233:56-62.
Lavitrano M, Stoppacciaro A, Bacci ML, Forni M, Fioretti D, Pucci L, Di Stefano C,
Lazzereschi D, Rughetti A, Ceretta S, Zannoni A, Rahimi H, Moioli B, Rossi M, Nuti
M, Rossi G, Seren E, Alfani D, Cortesini R, Frati L (1999) Human decay accelerating
factor transgenic pigs for xenotransplantation obtained by sperm-mediated gene
transfer. Transplantation Proceedings 31:972-974.
Lu JK, Fu BH, Wu JL, Chen TT (2002) Production of transgenic silver sea bream
(Sparus sarba) by different gene transfer methods. Marine Biotechnology 4:328-337.
111
Magnano AR, Giordano R, Moscufo N, Baccetti B, Spadafora C (1998) Sperm/DNA
interaction: Integration of foreign DNA sequences in the mouse sperm genome.
Journal of Reproductive Immunology 41:187-196.
Maione B, Lavitrano M, Spadafora C, Kiessling AA (1998) Sperm-mediated gene
transfer in mice. Molecular Reproduction and Development 50:406-409.
Montoliu L, Larue L, Beermann F (2004) On the use of regulatory regions from
pigmentary genes to drive the expression of transgenes in mice. Pigment Cell
Research 17:188-190.
Moreira PN, Pozueta J, Perez-Crespo M, Valdivieso F, Gutierrez-Adan A, Montoliu L
(2007) Improving the generation of genomic-type transgenic mice by ICSI.
Transgenic Research 16:163-168.
Morita T, Yoshizaki G, Kobayashi M, Watabe S, Takeuchi T (2004) Fish eggs as
bioreactors: the production of bioactive luteinizing hormone in transgenic trout
embryos. Transgenic Research 13:551-557.
Nakanishi A, Iritani A (1993) Gene-Transfer in the Chicken by Sperm-Mediated
Methods. Molecular Reproduction and Development 36:258-261.
Niemann H, Kues W, Carnwath JW (2005) Transgenic farm animals: present and
future. Revue Scientifique et Technique-Office International des Epizooties 24:285-
298.
Pandian TJ, Marian LA (1994) Problems and Prospects of Transgenic Fish
Production. Current Science 66:635-649.
Sarangi N, Mandall AB, Bandyopadhyay AK, Venugopal T, Mathavan S, Pandian TJ
(1999) Electroporated sperm mediated gene transfer in Indian major carps. Asia-
Pacific Journal of Molecular Biology and Biotechnology 7:151-158.
Sciamanna I, Barberi L, Martire A, Pittoggi C, Beraldi R, Giordano R, Magnano AR,
Hogdson C, Spadafora C (2003) Sperm endogenous reverse transcriptase as
112
mediator of new genetic information. Biochemical and Biophysical Research
Communications 312:1039-1046.
Sciamanna I, Piccoli S, Barberi L, Zaccagnini G, Magnano AR, Giordano R,
Campedelli P, Hodgson C, Lorenzini R, Spadafora C (2000) DNA dose and
sequence dependence in sperm-mediated gene transfer. Molecular Reproduction
and Development 56:301-305.
Shemesh M, Gurevich M, Harel-Markowitz E, Benvenisti L, Shore LS, Stram Y (2000)
Gene integration into bovine sperm genome and its expression in transgenic
offspring. Molecular Reproduction and Development 56:306-308.
Shen W, Li L, Pan QJ, Min LJ, Dong HS, Deng JX (2006) Efficient and simple
production of transgenic mice and rabbits using the new DMSO-sperm mediated
exogenous DNA transfer method. Molecular Reproduction and Development 73:589-
594.
Smolenski RT, Forni M, Maccherini M, Bacci ML, Slominska EM, Wang HJ, Fornasari
P, Giovannoni R, Simeone F, Zannoni A, Frati G, Suzuki K, Yacoub MH, Lavitrano M
(2007) Reduction of hyperacute rejection and protection of metabolism and function
in hearts of human decay accelerating factor (hDAF)-expressing pigs. Cardiovascular
Research 73:143-152.
Spadafora C (1998) Sperm cells and foreign DNA: a controversial relation. Bioessays
20:955-964.
Wang HJ, Lin AX, Chen YF (2003) Association of rabbit sperm cells with exogenous
DNA. Animal Biotechnology 14:155-165.
Wang XL, Hu JJ, Pan J, Ma ZJ, Ke B, Zhang QQ, Bao ZM (2004) Polyethylenimine
promotes sperm-mediated transgene and oligonucleotide delivery in abalone Haliotis
discus hannai. Journal of Shellfish Research 23:1123-1127.
113
Webster NL, Forni M, Bacci ML, Giovannoni R, Razzini R, Fantinati P, Zannoni A,
Fusetti L, Dalpra L, Bianco MR, Papa M, Seren E, Sandrin MS, Mc Kenzie IFC,
Lavitrano M (2005) Multi-transgenic pigs expressing three fluorescent proteins
produced with high efficiency by sperm mediated gene transfer. Molecular
Reproduction and Development 72:68-76.
Yazawa R, Hirono I, Aoki T (2006) Transgenic zebrafish expressing chicken
lysozyme show resistance against bacterial diseases. Transgenic Research 15:385-
391.
Zannoni A, Spinaci M, Bernardini C, Bacci ML, Seren E, Mattioli M, Forni M (2006)
DNase I activity in pig MII oocytes: implications in transgenesis. Reproduction
131:461-468.
114
5 ARTIGO 4
Artigo formatado segundo as normas da revista
Molecular Reproduction and Development
Sperm mediated gene transfer (SMGT) in chicken using
foreign DNA/DMSO or DNA/DMA complex
Tiago Collares
1
*; Fabiana Kömmling Seixas
1
; Paulo Varoni Cavalcanti
1
; Vinicius
Farias Campos
1
; Marta Gonçalves Amaral
1
; Thomaz Lucia Jr
1
.; Denise Calisto
Bongalhardo
1
; Odir Antônio Dellagostin
1
; João Carlos Deschamps
1
1
Centro de Biotecnologia (Cenbiot) – Universidade Federal de Pelotas, Pelotas –RS
/Brazil;
*Correspondence to: Tiago Collares, Centro de Biotecnologia – Universidade Federal
de Pelotas, Caixa Posta 354 · CEP 96010-900, Pelotas – RS / Brazil, E-mail:
Phone: +55 53 32757588
Fax: +55 53 32757551
Article type: Original article
Running title: Sperm-mediated gene transfer in Gallus gallus
115
Abstract
The development of transgenic technology has given researchers a powerful tool to
examine biological effects and the possibility of generating transgenic animals in
mass by SMGT. Therefore, the main objective of this study was to evaluate the
potential of rooster sperm submitted to SMGT, using dimethylsulfoxide (DMSO) or
dimethylacetamide (DMA) in semen supplemented with DNA (pEGFP) after
successive sperm washes. Semen was collected from 8 males kept individually in
cages and used to make seminal pool divided into four groups for artificial
insemination: Treatment I – Control (washed semen without DNA); Treatment II –
Control (washed semen with DNA); Treatment III – DMSO (washed semen incubated
with DNA plus 3% of DMSO) and Treatment IV – DMA (washed semen incubated
with DNA plus 3% of DMA). Sperm motility and vigor was evaluated at each step of
semen preparation. For fertility tests, 16 females were allocated into four groups (four
females each). The parameters of semen quality used to monitor the influence of the
process of washing on the potential for fertility decreased with every washing step
(p<0.05). Results indicated that the spermatozoa were able to uptake the foreign
DNA which was confirmed by PCR analyses. Fresh ejaculated sperm mixed with
pEGFP-DMSO or pEGFP-DMA complex, were used to artificially inseminate each of
four laying hens. Only one out of 81 newly hatched chicks from pEGFP-DMSO
treated group demonstrated GFP expression. However, PCR analyses demonstrated
the presence of foreign DNA in 38% (18/47) from pEGFP-DMSO group and 19%
(3/16) from pEGFP-DMA (p<0.05). The sequencing of the PCR product confirmed
the presence of the GFP gene in all treatments and samples analyzed. This study
suggests that SMGT is a powerful tool for generating transgenic chickens in mass.
Key-words: transgenic chicken; gene transfer; SMGT; DMSO gene transfer; DMA
gene transfer;
116
Introduction
Although many human therapeutic proteins are currently produced in microbial
fermenters using recombinant DNA techniques, it is obvious that microbial
processing is not suitable for a large number of bioactive proteins due to bacterial
inability to carry out post-synthetic modification reactions required for full biological
activity (Houdebine, 2002). This disadvantage does not apply to animal cell
bioreactors that can generate biologically fully active entities, yet the use of large-
scale animal cell cultures for production purposes is prohibitively expensive. With the
advent of transgenic technology, the production of valuable human pharmaceuticals
in large farm animals (pig, sheep, goat, dairy cattle, fish and chicken) has become
more and more attractive as a high-quantity, low-cost alternative (Janne et al., 1994;
Limonta et al., 1995; Kerr et al., 1998; Dyck et al., 1999; Baldassarre et al., 2003;
Dyck et al., 2003; Harvey et al., 2002; Hwang et al., 2004; Lillico et al., 2005; Ivarie,
2006).
A more powerful tool for developmental biology research than the chick
chimera system would be to have lines of transgenic chickens expressing reporter
genes that are readily available to the research community (Etches, 2006). However,
avian transgenic technology has been fraught with technical difficulties, and
transgenic chickens expressing reporter genes have only recently been developed
(Mozdziak and Petitte, 2004; Ivarie, 2006). Because of their unique physiological
characteristics and genetic attributes, birds are considered to be one of the most
suitable organisms for acting as transgenic bioreactors and experimental models (
Sang, 2004; Lillico et al., 2005).
Manipulation of the oocyte or zygote is possible and may become more useful
if the frequency of integration of microinjected gene constructs is increaded. This
method could also underpin the development of nuclear transfer in the chick, a
method that is used as a route to transgenesis in livestock species with success
(Baldassarre et al., 2003; Bordignon et al., 2003; Niemann and Kues, 2007).
However, few works have been presented using the SMGT technique, (Gavora et al.,
1991; Nakanishi and Iritani, 1993; Hasebe et al., 1998; Yang et al., 2004; Lee et al.,
2006).
The possibility of using viral vectors to make transgenic birds was recognized
very early in the development of transgenic technologies (Koo et al., 2004). This
117
easy access to the precursors of the gametes was also recognized as a possible
route to transgenesis: development of this method requires optimization of the
Primordial Germ Cells (PGC) isolation and transfer process, genetic modification of
the PGCs before transfer and manipulation of the recipient to allow a greater
contribution to the germ line of donor-derived PGCs (Perry and Sang, 1993; Sang,
2004; Etches, 2006). However, the rate of germ-line chimera production is very low in
these methods (Aritomi and Fujihara, 2000).
A practical approach was also proposed to produce transgenic chimeric
chickens using blastodermal cells (BCs). Using the fresh BCs, the best rate of
phenotypic chimeras was 26.0% expressed foreign GFP (Yan et al., 2005). However,
the hen's reproductive system has unique characteristics which have imposed
limitations on the use of established methods for artificial gene transfer.
An alternative strategy to generate transgenic animals in mass with low cost
consists of the introduction of foreign DNA into male gametes before the fertilization
process (Lavitrano et al., 1989; Spadafora, 1998; Sciamanna et al., 2003; Smith and
Spadafora, 2005). Studies have demonstrated that sperm cells bind and internalize
exogenous DNA, giving them the dual function of acting as a vector for transmitting
not only their own but also exogenous DNA. Sperm cells harboring the gene of
interest can be used by in vitro fertilization or by artificial insemination for generation
of multi-transgenic animals by SMGT (Spadafora, 2004;Webster et al., 2005).
The main objective of this study was to evaluate the potential of rooster sperm
submitted to SMGT using dimethyl sulfoxide (DMSO) or dimethyl acetamide (DMA) in
semen supplemented with DNA (pEGFP) after successive sperm washes.
Materials and methods
pEGFP vector preparation
In this study, commercial eukaryotic cells expression was used, pEGFP-N1-GFP
(Clontech®), which presents the CMV promoter fused to the GFP (Green Fluorescent
Protein). Cytomegalovirus (CMV) immediate early promoter is a powerful promoter
frequently used for driving the expression of transgenes in mammalian cells. The
described plasmids were used to transform competent E. coli DH5α cells, previously
prepared for heat shock and submitted to large scale DNA extraction using the
118
Perfectprep Plasmid Maxi kit (Eppendorf, Germany®). The exogenous DNA
concentration used was 60 µg /400 µl (150 ng/µl).
Animals
A total of 24 animals in reproductive period were used (8 roosters and 16 hens).
The animals were maintained in individual cages in the Central Animal House of the
Federal University of Pelotas (UFPel), with photoperiod controlled for 15 hours light.
All males were maintained in temperature-controlled facilities.
Semen collection
The reproductive routine of the males was maintained with two semen collections
per week, using the methodology described by (Latorre et al., 1988). Semen from 8
roosters was individually collected into conical, polystyrene sample cups and
transported to the laboratory in a Styrofoam container within 15–20 min of collection.
Sperm Washes Assay
Semen was pooled, submitted to six successive washes using Lake's diluent
(Howarth, Jr., 1983) in the proportion of 1:1 (v:v), and consecutive centrifugation
(1200 × g). To each washing a sample of 100 µL was removed for incubation with the
pEGFP vector. After 10 min of incubation at room temperature, semen was diluted
again in 1:1 (v:v) Lake’s diluent and a new centrifugation was carried out to separate
the seminal plasma from the sperm cells/DNA complex. The spermatozoa were
evaluated regarding motility in two different moments, before and after the washing
procedure.
The seminal plasma was analyzed through three different techniques:
electrophoreses in agarose gel, to evaluate the degradation of the foreign DNA by
DNAses contained in the seminal plasma; electrophoreses in SDS-PAGE, to
evaluate the seminal plasma protein profile during the successive washes; and PCR
analysis for detection of the pEGFP vector. Six washes were carried out and 20 µL
were removed for analyses.
119
A final pellet sample (5 µL of cellular fraction) resulting from the last centrifugation
was further washed 10 times in dilution of 1:20 (sperm: Lake’s diluent), seeking to
remove the pEGFP vector not adhered or internalized in the spermatozoa. After this
procedure, extraction of total DNA was performed using the PureLink kit
(Invitrogen®, Carlsbad, USA); later, these samples were submitted to PCR. All the
procedures were repeated three times.
Sperm SDS-PAGE Analyses
Semen pool samples from 8 mature healthy roosters were collected by abdominal
massage and centrifuged at 560 × g during 10 min at 4°C. Supernatant (seminal
plasma) was used in the analysis of the fresh seminal plasma profile. This trial was
important to assess the profile of seminal plasma proteins from the roosters which
would be used in the experiments of washing and SMGT. Thereafter, aliquot samples
(20 µL) were centrifuged and used to evaluate the protein profile after each washing
step.
SDS-PAGE was carried out in a TRIS buffer system. Electrophoresis was
performed in a BIO-RAD Mini-Protean 3 Cell® system using 15% bis-acrylamide
gels. Samples were stacked at 60 V for 20 min, and the separation was performed at
120 V for 70-80 min. The BenchMark Protein Ladder™ (Invitrogen®, Carlsbad, USA)
was used as molecular weight standard. Gels were stained with Coomassie Brilliant
Blue, scanned and analyzed using the TotalLab TL 100 analysis software (Nonlinear
Dynamics, UK).
Artificial Insemination (AI) and in vivo Assay
The inseminations were carried out through the technique of deep artificial
insemination, using a catheter (number 6) for the introduction of the semen 6 cm
inside the uterus of the animal (Latorre et al., 1988). A pool of semen was formed by
ejaculates with the best parameters obtained in the collection of the day, totaling a
volume of 1.6 mL. The AI samples: 60 µL of pEGFP + 12 µL of DMSO or DMA and
328 µL of Lake’s extender to final volume 400 µL (insemination dose). A sample of 1
µL of the pool was diluted in the Lake’s extender 1:500, for determining the sperm
concentration in Neubauer chamber. Average sperm concentration and volume was
120
2.80x10
6
sp/mL and 0,3 mL/rooster, respectively. Subsequently, the pool was
fractioned; 100 µL in each 1.5 mL microcentrifuge tubes. This was done to facilitate
subsequent artificial insemination. Shortly after to 2 consecutive washes using the
methodology described above, sperm was incubated with the transfectant solution at
5 °C for 10 minutes. Two transfectants were tested, 3% of DMSO (Sigma®) and 3%
of DMA (Sigma®). Two control treatments were used to evaluate the efficiency of
incorporation of pEGFP vector. Treatment I – Control (washed semen without DNA);
Treatment II – Control (washed semen with DNA); Treatment III – DMSO (washed
semen incubated with DNA plus 3%DMSO) and Treatment IV – DMA (washed
semen incubated with DNA plus 3% DMA).
Four laying hens in peak production (onset) were used for each treatment, and 7
consecutive artificial inseminations with interval of 3 days between them were
performed. Parameters of seminal quality (motility and vigor) were analyzed after
incubation.
After artificial inseminations, eggs were collected throughout the period of testing
to evaluate the rate of fertilization and hatching eggs. Eggs were separated by
treatment and incubated to hatch. All incubated eggs were submitted to evaluation
(candling) on the 10th day of incubation for clear identification of the eggs,
considered not fertilized. After 21 days of incubation hatching rate was determined.
Fertility (FR) and hatching rate (HR) were calculated as follows: FR (%) =
[(number of fertile eggs) x 100] / (number of incubated eggs); HR (%) = [(number of
chicks born) x 100] / (number of fertile eggs).
Gene expression
After birth, GFP expression was assessed through the use Googles miner’s lamp
GFsP-5 (BLS®, Hungary). A ring of identification was placed in each chick. After 20
days all animals were sacrificed and samples of liver tissue from 70% of each
treatment was used for extraction of genomic DNA. Treatment I - 41; Treatment II -
57; treatment III – 47; and treatment IV – 16 animals were randomly selected for
genomic DNA extraction by the use of PureLink™ Genomic DNA Purification Kit
(Invitrogen®, USA).
121
PCR and sequencing of the PCR product
Polymerase chain reaction (PCR) was performed in a final volume of 25 µL
containing 2.5 µL of 10x buffer, 0.5 µL of 10 mM dNTP, 150 ng of each primer, 0.5 µL
(1 unit) of Platinum® Taq DNA Polymerase High Fidelity (Invitrogen®, USA), 0.5 µL
of 50 mM MgCl
2
, 18 µL of Milli-Q water and 2 µL of containing 100 ng of template
DNA. GFP-specific oligonucleotides (5'- CGGGACTTTCCAAAATGTCG -3' and 5'-
GAAGATGGTGCGCTCCTGGA -3') to amplify a 500-base pair (bp) fragment were
used. PCR reactions were carried out in a Eppendorf (Mastercycler gradient)
thermocycler programmed for an initial denaturation step (2 min at 94 °C) followed by
30 cycles of 1 min at 94 °C, 1 min at 50 °C, and 1 min at 72 °C. The last cycle was
followed by a final incubation of 7 min at 72 °C. Samples were then stored at 4 °C
until used. Amplified fragments were analyzed by standard horizontal electrophoresis
on 1% agarose gels in TBE buffer (10 mM Tris-borate, 1 mM EDTA, pH 8.0) at 100
V. The DNA bands were stained with 0.5 µg/mL ethidium bromide as described
before (Sambrook et al., 1989). Negative control samples containing all reaction
components except DNA were always used. PCR products were treated with ExoSap
(GE Healthcare) or gel purified using GFX PCR DNA purification kit (GE Hearlthcare,
USA) and sequenced as described below. Sequences of PCR products were
determined using the DYEnamic ET terminators sequencing kit (GE Hearlthcare,
USA) following the protocol supplied by the manufacturer. Sequencing reactions
were then analyzed in a MegaBACE 500 DNA sequencer (GE Hearlthcare, USA).
Each PCR product was sequenced four times in both directions using the same
primers, previously used to amplify the GFP gene and listed above.
The quality of DNA sequences was checked and overlapping fragments were
assembled using BioEdit package and Vector NTI 8.0, AlignX and ContigExpress
(InforMax, Inc.). Assembled sequences with high quality were aligned using
CLUSTALX, with default gap penalties. Homologies analyses were performed with
the NCBI database and BLAST program.
Statistical analysis
ANOVA was used to evaluate the effect of treatments in sperm motility (SM), and
vigor. Fisher Exact Tests and Pearson's Chi-Square were used to evaluation fertility
122
rate (FR), hatching rate (HR), gene expression and PCR analyses. Differences were
considered to be statistically significant at the 95% confidence level (P<0,05).
Results
Sperm motility
The quality parameters of seminal used to monitor the influence of washing
process on the potential for fertility of semen showed decrease during the washes
(p<0.05). Figure 1 shows the average sperm motility in every washing step. The pool
of semen used in the testing of washing had an average motility of 66.6±11.5%,
reducing to an average at the end of the process of 16.6±5.7%. No statistical
difference was observed between W0 and W3 (p<0.05). This shows that there is the
potential loss of spermatic roosters after three consecutive washes. The treated
sperm were then subjected to in vivo SMGT assay and artificial insemination of laying
hens.
Seminal protein profile and interaction foreign DNA
From analysis in the polyacrylamide gel has been a sharp decline in the
concentration of bandwidth for greater representation in the seminal plasma of
roosters (72.1 kDa). This band was present in the washed samples W0, W1, W2 and
W3 (figure 2a).
The analysis of the images resulting from the agarose gel electrophoresis in
the seminal plasma of roosters after incubation with the pEGFP plasmid reveals the
presence of activity of DNases (figure 2b). In the three repetitions of the test it was
observed that there was an intense fragmentation of plasmid pEGFP after fresh
semen incubation and after the first and second washing. In the third and fourth
washing the presence of the vector (table 1) was detected. In washes W5 and W6
unable to observe the presence of the vector in the agarose gel, probably by waste
DNases still present in the plasma (figure 2b). The analysis of PCR amplification
showed a fragment of 500 bp in washes W3, W4, W5, W6 (figure 2c). The largest
number of copies was observed in the washing W3. The analysis of the PCR from
the extraction of genomic DNA showed the amplification of the same fragment (figure
2c).
123
SMGT in vivo assay
The average motility, vigor, rate of fertilization, hatching rate, percentage of
transient expression and PCR analysis are shown in table 1. There was no significant
difference (p>0.05) for the motility parameters among treatments I, II and IV,
demonstrating that no significant loss occurs by the addition of exogenous DNA or by
the addition of DMA. It can be observed that there was no significant difference
(p>0.05) between treatments for motility with incubation of pEGFP - DMSO and
pEGFP - DMA. For vigor, it was not observed significant difference among
treatments, as well as for rate of fertilization, demonstrating that the motility had no
effect on this parameter.
Regarding the hatching rate, it was not observed significant difference
between treatments (p> 0.05). Factors related to the treatment of reproductive
females may have interfered in order to minimize a probable difference between
treatments or the process of washing pre-incubation may have promoted an increase
in these cases. The percentage of animals expressing the GFP was relatively low;
newly hatched chicks, only one out of 81 from pEGFP-DMSO treated group
demonstrated GFP expression in body. This animal died after hatching the egg. But it
was not observed a high mortality by influence of the treatments.
PCR analysis revealed the presence of the vector in the genome of the
offspring of treatments II (5%), III (38%) (18/47) and IV (19%) (3/16). Treatment III
(pEGFP - DMSO) had significant effect on the treatment II and IV that did not differ
between them (table 2, figure 3). This shows that birds in SMGT succeed through the
use of DMSO or as a second alternative DMA or after incubation simple successive
washes. The sequencing of the PCR product confirmed the presence of the gene
GFP in all treatments and sample analyzed.
Discussion
The present research demonstrated for the first time, the possibility of
generating transgenic chickens from the application of SMGT using successive
sperm cells washes and incubated with DNA / DMSO or DNA / DMA complex. The
technique of SMGT is not new to birds (Gavora et al., 1991), but few studies have
124
been conducted to establish the methodology (Nakanishi and Iritani, 1993;Yang et
al., 2004). The characterization of seminal plasma proteins is critical to identify
properties and functions involved in semen physiology. In one study (Mohan et al.,
1995), a rooster seminal plasma protein that inhibits sperm motility and has
antibacterial property was identified and isolated. Therefore, the removal of certain
seminal proteins may have repercussions in various reproductive parameters. The
transfectant used in our study may have encouraged a rise in the indices for these
parameters. It was possible to show that the concentration of total protein expressed
by the protein profile decreased gradually with the increase in the number of washes.
The action of DNases of fresh seminal plasma was demonstrated by the impossibility
of amplification of GFP after 10 minutes of fresh sperm incubation with the pEGFP
vector in W0, W1 and W2.
Experiments were carried out to transform laboratory domestic chickens by
use of sperm incubated with bacterial plasmid DNA. The production of transgenic
chicken by sperm incubated in a DNA solution and producing through in artificial
insemination (AI) of the hens did not influence the fertility or hatchability of the hens'
eggs. However, no transformed progeny were detected among 470 chickens
produced by AI (Gavora et al., 1991).
A high efficient and simple transgenic technology on mice and rabbits to
transfect spermatozoa with exogenous DNA/DMSO complex to obtain transgenic
offspring, it was for the first time namely called DMSO-sperm mediated gene transfer
(Shen et al., 2006). Demonstrated also then, 36 living transgenic rabbits were
produced using the same technology, and the transgenic ratio of 56.3% was detected
using PCR and Southern blot analyses. The results were consistent with the
research on rabbits (Kuznetsov et al., 2000), however, the factors leading to this high
success rate were not known.
In another study (Alderson et al., 2006) has investigated whether protamine
sulfate can be used to improve the efficiency of bovine sperm mediated gene transfer
by protecting the pCX-EGFP vector against nuclease activity. A high proportion
(31%) of bovine spermatozoa transfected with the plasmid pCX-EGFP maintained
their motility. Using an in vitro assay, protamine sulfate protected the plasmid against
degradation by DNase I. Demonstrated using spermatozoa transfected with either
pCX-EGFP or pCX-EGFP–protamine complexes, produced PCR positive blastocysts
after SMGT. However, the use of protamine sulfate does not improve the efficiency of
125
SMGT suggesting that factors other than nuclease activity could be limiting. After
penetration into oocyte, sperm DNA undergoes dramatic conformational changes
that could represent a great opportunity for exogenous DNA to be integrated in the
zygote genome. Among the enzymes responsible for sperm remodeling, a nuclease
could be involved (Stepinska and Olszanska, 2003).
The presence of a DNase I in oocytes has not been much investigated. To
date, an immunolocalization of DNase I has been reported only in rat immature
oocytes and the presence of nuclease activities has been shown in avian oocytes
(Zannoni et al., 2006). Endonucleases are involved in the degradation of
supernumerary spermatozoa during polyspermic fertilization that is a physiological
phenomenon in the avian species (Stepinska and Olszanska, 2003). They also
hypothesize that the low efficiency of transgenic chicken production by DNA
microinjection might be related to the presence of DNase in oocytes. Furthermore, if
the DNA is protected or integrated with the sperm genome, it could promote a
solution to SMGT in chickens. Transgenesis methods utilizing the male gamete as a
vector of exogenous DNA have been developed; their efficiency could suggest a
protection mechanism of exogenous DNA from degradation.
The application of transgenic technology to domestic poultry offers an
alternative means to conventional practice for improvement of this highly productive
agricultural species and great bioreactor model. The in vitro method presented here,
which links the steps of washes with DNA/DMSO or DNA/DMA complexes, may be
useful in studying mechanisms of fertilization and differentiation in birds as well as in
obtaining transgenic birds by SMGT.
126
References
Aritomi S, and Fujihara N. 2000. Production of chicken chimeras by fusing
blastodermal cells with electroporation. Asian J Androl 2:271-275.
Baldassarre H, Wang B, Kafidi N, Gauthier M, Neveu N, Lapointe J, Sneek L, Leduc
M, Duguay F, Zhou JF, Lazaris A, and Karatzas CN. 2003. Production of transgenic
goats by pronuclear microinjection of in vitro produced zygotes derived from oocytes
recovered by laparoscopy. Theriogenology 59:831-839.
Bordignon V, Keyston R, Lazaris A, Bilodeau AS, Pontes JHF, Arnold D, Fecteau G,
Keefer C, and Smith LC. 2003. Transgene expression of green fluorescent protein
and germ line transmission in cloned calves derived from in vitro-transfected somatic
cells. Biology of Reproduction 68:2013-2023.
Dyck MK, Gagne D, Ouellet M, Senechal JF, Belanger E, Lacroix D, Sirard MA, and
Pothier F. 1999. Seminal vesicle production and secretion of growth hormone into
seminal fluid. Nature Biotechnology 17:1087-1090.
Dyck MK, Lacroix D, Pothier F, and Sirard MA. 2003. Making recombinant proteins in
animals - different systems, different applications. Trends in Biotechnology 21:394-
399.
Etches RJ. 2006. The hard cell(s) of avian transgenesis. Transgenic Research
15:521-526.
Gavora JS, Benkel B, Sasada H, Cantwell WJ, Fiser P, Teather RM, Nagai J, and
Sabour MP. 1991. An Attempt at Sperm-Mediated Gene-Transfer in Mice and
Chickens. Canadian Journal of Animal Science 71:287-291.
Harvey AJ, Speksnijder G, Baugh LR, Morris JA, and Ivarie R. 2002. Expression of
exogenous protein in the egg white of transgenic chickens. Nature Biotechnology
20:396-399.
127
Hasebe M, Soh T, Hattori M, and Fujihara N. 1998. An attempt to produce transgenic
chicken mediating sperm cells as vectors. Journal of Applied Animal Research
14:143-150.
Houdebine LM. 2002. Antibody manufacture in transgenic animals and comparisons
with other systems. Curr Opin Biotechnol 13:625-629.
Howarth B, Jr. 1983. Comparison of diluents for holding cock semen six hours at 41
C. Poult Sci 62:1084-1087.
Hwang GL, Muller F, Rahman MA, Williams DW, Murdock PJ, Pasi KJ, Goldspink G,
Farahmand H, and Maclean N. 2004. Fish as bioreactors: Transgene expression of
human coagulation factor VII in fish embryos. Marine Biotechnology 6:485-492.
Ivarie R. 2006. Competitive bioreactor hens on the horizon. Trends in Biotechnology
24:99-101.
Janne J, Hyttinen JM, Peura T, Tolvanen M, Alhonen L, Sinervirta R, and Halmekyto
M. 1994. Transgenic Bioreactors. International Journal of Biochemistry 26:859-870.
Kerr DE, Liang FX, Bondioli KR, Zhao HP, Kreibich G, Wall RJ, and Sun TT. 1998.
The bladder as a bioreactor: Urothelium production and secretion of growth hormone
into urine. Nature Biotechnology 16:75-79.
Koo BC, Kwon MS, Choi BR, Lee HT, Choi HJ, Kim JH, Kim NH, Jeon I, Chang W,
and Kim T. 2004. Retrovirus-mediated gene transfer and expression of EGFP in
chicken. Molecular Reproduction and Development 68:429-434.
Latorre JR, Harris GC, Jr., and Johnson ZB. 1988. Influence of storage container for
frozen-thawed chicken semen and frequency of insemination on fertility and its
duration. Poult Sci 67:333-335.
128
Lavitrano M, Camaioni A, Fazio VM, Dolci S, Farace MG, and Spadafora C. 1989.
Sperm Cells As Vectors for Introducing Foreign Dna Into Eggs - Genetic-
Transformation of Mice. Cell 57:717-723.
Lee YM, Jung JG, Kim JN, Park TS, Kim TM, Shin SS, Kang DK, Lim JM, and Han
JY. 2006. A testis-mediated germline chimera production based on transfer of
chicken testicular cells directly into heterologous testes. Biology of Reproduction
75:380-386.
Lillico SG, McGrew M, Sherman A, and Sang HM. 2005. Transgenic chickens as
bioreactors for protein-based drugs. Drug Discovery Today 10:191-196.
Limonta JM, Castro FO, Martinez R, Puentes P, Ramos B, Aguilar A, Lleonart RL,
and Delafuente J. 1995. Transgenic Rabbits As Bioreactors for the Production of
Human Growth-Hormone. Journal of Biotechnology 40:49-58.
Mozdziak PE, and Petitte JN. 2004. Status of transgenic chicken models for
developmental biology. Developmental Dynamics 229:414-421.
Nakanishi A, and Iritani A. 1993. Gene-Transfer in the Chicken by Sperm-Mediated
Methods. Molecular Reproduction and Development 36:258-261.
Niemann H, and Kues WA. 2007. Transgenic farm animals: an update. Reprod Fertil
Dev 19:762-770.
Perry MM, and Sang HM. 1993. Transgenesis in Chickens. Transgenic Research
2:125-133.
Sang H. 2004. Prospects for transgenesis in the chick. Mechanisms of Development
121:1179-1186.
Sciamanna I, Barberi L, Martire A, Pittoggi C, Beraldi R, Giordano R, Magnano AR,
Hogdson C, and Spadafora C. 2003. Sperm endogenous reverse transcriptase as
129
mediator of new genetic information. Biochemical and Biophysical Research
Communications 312:1039-1046.
Shen W, Li L, Pan QJ, Min LJ, Dong HS, and Deng JX. 2006. Efficient and simple
production of transgenic mice and rabbits using the new DMSO-sperm mediated
exogenous DNA transfer method. Molecular Reproduction and Development 73:589-
594.
Smith K, and Spadafora C. 2005. Sperm-mediated gene transfer: applications and
implications. Bioessays 27:551-562.
Spadafora C. 1998. Sperm cells and foreign DNA: a controversial relation. Bioessays
20:955-964.
Spadafora C. 2004. Endogenous reverse transcriptase: a mediator of cell
proliferation and differentiation. Cytogenetic and Genome Research 105:346-350.
Stepinska U, and Olszanska B. 2003. DNase I and II present in avian oocytes: a
possible involvement in sperm degradation at polyspermic fertilisation. Zygote 11:35-
42.
Webster NL, Forni M, Bacci ML, Giovannoni R, Razzini R, Fantinati P, Zannoni A,
Fusetti L, Dalpra L, Bianco MR, Papa M, Seren E, Sandrin MS, Mc Kenzie IFC, and
Lavitrano M. 2005. Multi-transgenic pigs expressing three fluorescent proteins
produced with high efficiency by sperm mediated gene transfer. Molecular
Reproduction and Development 72:68-76.
Yan HF, Lee CY, Xiao BN, Trefil P, Liu SX, Kim YY, and Wu XL. 2005. Production of
transgenic chimeric chickens using blastodermal cells. Asian-Australasian Journal of
Animal Sciences 18:158-164.
Yang CC, Chang HS, Lin CJ, Hsu CC, Cheung JI, Hwu L, and Cheng WTK. 2004.
Cock spermatozoa serve as the gene vector for generation of transgenic chicken
(Gallus gallus). Asian-Australasian Journal of Animal Sciences 17:885-891.
130
Table 1. Averages of the treatments for the analyzed variables.
Motility(%)
± SE, (n = 6)
V
igor (0-5)
± SE, (n = 6)
FR (%) HR (%) GFP(%) PCR (%)
TI 63.7±10.0 a 3.2±0.7 a 85.7(72/84)a 81.9 (59/72) a 0 (0/59) 0 (0/41)c
TII 50.70±13.5 a 3.1±0.3 a 96.7 (90/93)a 90 (81/90) a 0 (0/81) 5 (3/57)b
TIII 38.5±9.3 b 2.7±0.5 a 85.5 (71/83)a 92.9(66/71) a 1.23 (1/81) 38 (18/47)a
TIV 54.6±13.4 ab 3.5±0.5 a 58.6 (34/58)a 67.6 (23/34) a 0 (0/23) 19 (3/16)b
Treatments: Treatment I – Control (washed semen without DNA); Treatment II – Control (washed semen with
DNA); Treatment III – DMSO (washed semen incubated with 3% of DMSO) and Treatment IV – DMA (washed
semen incubated with 3% of DMA). Parameters: sperm motility; sperm vigor; fertilization rate (FR); hatching rate
(HR); embryo GFP expression (GFP) and PCR positive analyses (PCR).
a,b
differ significantly (P<0.05) in the same column.
131
Figure 1 - Average values of motility seminal ordered by the number of washes, with
respective values of standard deviation.
132
Figure 2 – W0-W6 represents the number of sperm washing. Panel A: SDS-PAGE
analysis in the polyacrylamide gel of the seminal plasma of roosters in different
washes; Panel B: agarose gel of the vector in the seminal plasma of roosters in
different washes; Panel C: agarose gel of the PCR products of the different washes;
(-) negative control (+) positive control.
133
Figure 3 - PCR analyses from chicks. Line 1 and 14: (1kb DNA ladder -
Invitrogen®); Line 2, 5 and 8; (C- reaction negative control); Line 3: (TI - Control
(animal form wash semen without DNA); Line 4: (TII – animal from wash semen with
DNA); Line , 6 and 7: (TIII – animal from pEGFP-DMSO complex); Line 9 – 12: (TIV –
animal from pEGFP-DMA complex; Line 13: (C+, positive control).
134
Figure 4 – Transgenic chick expressing GFP in body.
135
6 CONCLUSÕES
- O processo de desidratação e reidratação das células espermáticas de Silver
Catfish, bem como a incubação na presença ou na ausência de plasma seminal,
suplementado com DNA exógeno, são capazez de gerar peixes transgênicos por
SMGT;
- O processo de remoção do plasma seminal de galos após sucessivas lavagens
para remoção de DNases e incubados com DMSO-pEGFP e DMA-pEGFP, são
capazes de incrementar a transferência gênica mediada por espermatozóides e
gerar aves transgênicas;
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
