( PDF ) Diversidade fenotípica e genotípica de Staphylococcus spp. coagulase negativos não-epidermidis isolados de Hemoculturas de Pacientes do Complexo Hospitalar Santa Casa de Porto Alegre

Download PDF

ads:

PROGRAMA DE PÓS-GRADUAÇÃO EM CIENCIAS MEDICAS

Dissertação de Mestrado

Diversidade fenotípica e genotípica de

Staphylococcus spp. coagulase

negativos não-epidermidis isolados de

Hemoculturas de Pacientes do

Complexo Hospitalar Santa Casa de

Porto Alegre

Carina Secchi

Biblioteca Paulo Lacerda de Azevedo

2007

ads:

Livros Grátis

http://www.livrosgratis.com.br

Milhares de livros grátis para download.

PROGRAMA DE PÓS-GRADUAÇÃO EM CIENCIAS MEDICAS

Dissertação de Mestrado

Diversidade fenotípica e genotípica de

Staphylococcus spp. coagulase

negativos não-epidermidis isolados de

Hemoculturas de Pacientes do

Complexo Hospitalar Santa Casa de

Porto Alegre

Carina Secchi

Orientador: Pedro Alves d’Azevedo

Biblioteca Paulo Lacerda de Azevedo

2007

Área de concentração: Métodos diagnósticos e Epidemiologia das Doenças

ads:

S444d

Secchi, Carina

Diversidade fenotípica e genotípica de staphylococcus spp. coagulase

negativos não – epidermidis isolados de hemoculturas de pacientes do

Complexo Hospitalar Santa Casa de Porto Alegre / Carina Secchi ; orient.

Pedro Alves d’Azevedo. Porto Alegre: 2007.

140 fls.

Dissertação (Mestrado). Fundação Faculdade Federal de Ciências Médicas de

Porto Alegre. Programa de Pós-Graduação em Ciências Médicas. Área de

concentração: Métodos diagnósticos e epidemiologia das doenças.

1. Staphylococcus coagulase - negativos. 2. Cefoxitina. 3. Oxacilina.

4. Resistência bacteriana. 5. Detecção de biofilme. I. d’Azevedo, Pedro Alves.

II. Título

CDD 6l6.929 7

CDU 6l4.4

Ruth Oliveira. CRB10 / 501

Bibliotecária

AGRADECIMENTOS___________________________________________________

Ao Prof. Pedro Alves d’Azevedo pela sua orientação, no qual foi possível melhorar

meus conhecimentos científicos, e por todos os seus conselhos, incentivos, cobranças

necessárias e amizade desenvolvida durante a realização do trabalho.

A colega Ana Lucia de Souza Antunes, pelo seu carinho, dedicação e apoio

demonstrados durante toda a execução do trabalho, uma parceria fiel para todas as horas,

sem a qual este não teria findado no tempo devido. Também gostaria de agradecer ao

colega Leandro Réus Rodrigues Perez, pelo coleguismo, amizade e apoio durante os

experimentos realizados.

As colegas de pós-graduação Juliana Caierão e Silvana Vargas Superti pelo

incentivo, coleguismo e apoio na execução do trabalho e tradução do artigo científico.

As colegas do laboratório Maria Beatriz, Rosângela, Mara e Sandra pelo carinho,

amizade e apoio técnico.

As bolsistas, Ananda Cristine Galvão e Letícia Ganassini pelo suporte técnico

durante a realização do trabalho.

Ao meu chefe, Dr. Vlademir Vicente Cantarelli, pelo exemplo de dedicação a

ciência e incentivo a busca de novos conhecimentos.

Aos colegas do Setor de Bacteriologia do Laboratório Weinmann, em especial as

analistas Teresa Brodt e Bianca Cavalcante pelo apoio, amizade e profissionalismo nos

momentos de ausência.

Aos colegas do setor de Biologia Molecular do Laboratório Weinmann, Fabiana de

Souza Pereira, Lila P. Maciel, Diogo Pilger, Luciano Pereira dos Santos e Lisiane Turatti

pelo apoio técnico na realização da técnica da PCRs.

Ao Dr. Julio Roberto Diehl, pelo apoio técnico, permitindo a realização dos testes

genotípicos no setor de Biologia Molecular do Laboratório Weinmann.

A Profa. Dra Kátia Regina dos Santos pela doação da cepa ATCC biofilme positivo.

Ao prof. Cícero Armídio Gomes Dias e a Profa Dra. Ana Paula Frazon pelo apoio

na realização da técnica da PCRs.

A todos que de uma forma ou outra auxiliaram a realização deste trabalho.

SUMÁRIO

RESUMO……………………………………………………………….………………07

ABSTRACT....................................................................................................................09

INTRODUÇÃO..............................................................................................................11

REVISÃO DA LITERATURA......................................................................................15

Aspectos Gerais do Gênero

Staphylococcus

..................................................................15

Epidemiologia.................................................................................................................16

Patogenicidade................................................................................................................19

Resistência aos antimicrobianos.....................................................................................23

Caracterização Fenotípica...............................................................................................29

Caracterização Genotípica..............................................................................................31

REFERÊNCIAS BIBLIOGRÁFICAS...........................................................................34

JUSTIFICATIVAS DO ESTUDO.................................................................................43

OBJETIVOS DO ESTUDO...........................................................................................44

Geral...............................................................................................................................44

Específicos.....................................................................................................................44

DELINEAMENTO DO ESTUDO................................................................................45

HIPÓTESES DO ESTUDO...........................................................................................45

ARTIGOS PRINCIPAIS DO ESTUDO........................................................................46

ARTIGO I: Coagulase-negative staphylococci: identification and detection

of methicillin resistance…………………......................................................................47

ARTIGO II:

Detection of biofilm production in non-epidermidis

coagulase-negative

Staphylococcus

spp.

isolates...........................................................63

CONSIDERAÇÕES FINAIS.........................................................................................75

PERSPECTIVAS...........................................................................................................75

ANEXO I…...................................................................................................................76

Staphylococcus epidermidis

: a simple phenotypic method for identification…...…….77

ANEXO II……………………………………………………………………………..91

Evaluation of oxacillin and cefoxitin disks for detection of resistance in Coagulase

Negative Staphylococci ……………………………..….….……….………........….....92

ANEXO III……………………………………………………………………..…….104

Detection of biofilm production in

Staphylococcus

spp. isolates by the Congo Red

agar test …………………………………………………………...……….….............105

ANEXO IV…………………………………………………………………………...117

Bacteremias of Coagulase-Negative staphylococci (CoNS) in Intensive Care Unit in

hospital geral of São Paulo city, SP, Brasil……………………………….....……......118

ANEXO V……………………………………………………………………………128

Bacteremia por

Rhodococcus equi

em paciente com síndrome da

imunodeficiência adquirida: relato de caso...................................................................129

ANEXO VI...................................................................................................................136

Identification and Detection of Methicilin Resistance among Coagulase-

negative Staphylococci Others than

S.epidermidis

……………….……………..…....137

Staphylococcus hominis

subsp

. novobiosepticus

Strains Causing Nosocomial

Infection in Brazil………………………………………..……………….......….........138

ANEXO VII..................................................................................................................139

APROVAÇÃO COMITÊ DE ÉTICA...........................................................................140

RESUMO______________________________________________________________

Staphylococcus

spp. coagulase-negativos (SCoN) têm emergido como patógenos,

principalmente, em ambiente hospitalar, em surtos nosocomiais e em infecções

relacionadas a cateteres. Além de se tornarem importantes reservatórios de genes de

resistência, podem contribuir na formação de biofilme na superfície de dispositivos

médicos (biomateriais) o que pode levar a septicemia e colonização dos implantes. A

identificação correta das espécies, bem como a detecção da resistência a oxacilina, não é

tarefa de fácil execução pelos laboratórios clínicos, em função da diversidade de espécies

de SCoN e da provável expressão heterogênea de resistência neste grupo de bactérias. O

objetivo deste estudo foi identificar espécies de

Staphylococcus

coagulase-negativos

não-

epidermidis (SCoNne) e comparar o uso do disco de cefoxitina (30 µg) com o disco de

oxacilina (1

g), ágar diluição com oxacilina e a detecção do gene

mecA

, bem como

detectar a presença de biofilme por método genotípico (detecção dos genes

icaA

icaD

) e

comparar com a detecção de biofilme por teste fenotípico em CRA (ágar Congo red) nestes

isolados. Um total de 238 amostras de SCoNne provenientes de hemoculturas foram

avaliadas, com identificação de 16 diferentes espécies, sendo que a resistência a oxacilina

foi detectada em 71% das amostras através da detecção do gene

mecA

. Comparando o

método de disco difusão para cefoxitina, oxacilina e ágar diluição (MIC da oxacilina) com

a detecção do gene

mecA

, a sensibilidade dos todos os métodos foi de 100%, com

especificidade de 100% para disco difusão cefoxitina, 91% para disco difusão oxacilina e

88% para ágar diluição. A detecção do gene

icaA

foi observada em 13 amostras envolvendo

as espécies:

S. capitis-capitis, S. capitis urealyticum, S. hominis-hominis

S. caprae

sendo

que nenhum isolado apresentou o gene

icaD.

O teste fenotípico de produção de biofilme no

CRA foi observado em três amostras dentre as positivas, sendo que destas, os resultados de

apenas duas amostras de

S. capitis-capitis

mostraram concordância entre os métodos

avaliados. Os resultados deste experimento mostraram o bom desempenho do disco de

difusão de cefoxitina, uma técnica de fácil execução nos laboratórios clínicos, para

detecção de resistência a oxacilina e a baixa sensibilidade entre os métodos de detecção de

biofilme (presença dos genes

icaA

and

icaD

e colônias positivas no CRA) em amostras de

SCoNne.

Palavras-chaves:

Staphylococcus

coagulase-negativos, cefoxitina, oxacilina, resistência

bacteriana, detecção de biofilme.

ABSTRACT___________________________________________________________

The coagulase-negative staphylococci (SCoN) have emerged as important nosocomial

pathogens, associated with outbreaks and catheter related infections. Besides if they turn

important reservoirs of resistance genes, these can contribute in the biofilm formation in the

surface of medical devices (biomaterials) what can take the septicemia and colonization of

the implants. The correct identification of species and the detection of oxacillin-resistance

are not easy task to be made by clinical laboratory, once there are several different species

of coagulase-negative Staphylococci and the expression of oxacillin resistance is not

always homogeneous.

The aim of this study was to identify isolates of coagulase-negative

other

than

Staphylococcus epidermidis

(SCoNne) and to compare the use of cefoxitin disk (30

with oxacillin disk (1 µg), agar dilution of oxacillin and gene

mecA

detection as well as to

detect the biofilm presence for genotypic method (

icaA

and

icaD

genes) and to compare

with the biofilm detection by phenotypic test in CRA (Congo red agar) in these strains. A

total of 238 SCoNne, isolates from blood cultures, was identified with 16 different species

and the oxacillin resistance was detected in 71% of isolates (

mecA

gene detection by PCR).

Comparing the three methods evaluated (cefoxitin disk difusion, oxacillin disk difusion and

agar dilution) with the presence of

mecA

gene, all methods presented sensitivity of 100%.

The specificity of cefoxitin disk diffusion was 100% while oxacillin disk presented a

specificity of 91% and the agar dilution presented a specificity of 88%. The detection of the

gene

icaA

was observed in 13 strains, involving the species:

S. capitis-capitis, S. capitis

urealyticum, S. hominis-hominis

S. caprae.

The

icaD

gene was not detected in any isolate.

The phenotypic biofilm production test carried out by CRA was positive in only three

samples, however, only two

S. capitis-capitis

samples showed concordance among the two

methods evaluated. In our study, the use of the cefoxitin disk showed to be a useful tool to

detection of oxacilin resistance in samples of SCoN others than the

S. epidermidis

. The

biofilm results showed a low sensitivity among the biofilm detection methods (presence of

the

icaA

and

icaD

genes and positive colonies in the CRA) for SCoNne samples.

Keywords: Coagulase-negative staphylococci, cefoxitin, oxacillin, bacterial resistance,

biofilm detection.

INTRODUÇÃO___________________________________________________________

O gênero

Staphylococcus

é amplamente distribuído na natureza, podendo ser

encontrado no homem colonizando pele e mucosas, em uma relação simbiótica ou benigna

com o seu hospedeiro. Entretanto, os microrganismos podem desenvolver um potencial

patogênico quando ocorre acesso aos demais tecidos do hospedeiro, principalmente através

de traumas que provoquem a ruptura da barreira cutânea. As espécies mais comumente

associadas ao homem são

Staphylococcus aureus, Staphylococcus epidermidis,

Staphylococcus capitis, Staphylococcus caprae, Staphylococcus sacharolyticus,

Staphylococcus warneri, Staphylococcus pasteuri, Staphylococcus haemolyticus,

Staphylococcus hominis, Staphylococcus lugdunensis, Staphylococcus auricularis,

Staphylococcus saprophyticus, Staphylococcus cohnii, Staphylococcus xylosus

Staphylococcus simulans

(BANNERMAN, 2003).

Staphylococcus aureus

(espécie coagulase-positiva) tem maior importância em

infecções humanas sendo considerado mais patogênico deste gênero estando relacionado

com morbidade e mortalidade (BANNERMAN, 2003). Os

Staphylococcus

coagulase-

negativos (SCoN) estão entre as bactérias mais frequentemente isoladas nos laboratórios de

microbiologia clínica (KLOOS & BANNERMAN, 1994). A capacidade dos SCoN

causarem infecções tem sido melhor evidenciada nas últimas décadas, principalmente, em

infecções nosocomiais e naquelas associadas ao uso de dispositivos médicos como

válvulas, próteses e cateteres (POYART

et al

. 2001). Os SCoN possuem a habilidade de

produzir biofilme, uma substância polisacarídica que coloniza e infecta biomateriais como

cateteres vasculares, podendo levar o paciente a importantes infecções como bacteremia

(SCHULIN & VOSS, 2001; ARCIOLA

et al

. 2001a). Estudos de vigilância epidemiológica

produzem importantes informações sobre a prevalência de patógenos responsáveis por

bacteremia e índices de resistência aos antimicrobianos no mundo (MARSHALL

et al.

1998; SADER

et al

. 2003; BIENDENBACH

et al.

2004; POTTUMARTHY

et al.

2005).

Dentre estes, o SENTRY (

The SENTRY Antimicrobial Surveillance Program

)

tem

monitorado a prevalência de bacteremia em diversos países desde 1997 (BIENDENBACH

et al.

2004). De acordo com levantamento de dados realizado por este programa, durante o

período de 1997 a 2002, envolvendo países da América do Norte, América Latina e Europa,

os SCoN, juntamente com

Staphylococcus aureus

Escherichia coli

foram os patógenos

mais frequentemente isolados em hemoculturas nas três regiões estudadas. As taxas de

prevalência entre os SCoN foram de 11,5% na América do Norte, 13,3% na América Latina

e 14,6% na Europa e quando relacionados ao diagnóstico primário, os SCoN foram os

patógenos mais isolados de hemoculturas entre neonatos prematuros (BIENDENBACH

. 2004).

A identificação das espécies de SCoN vem ganhando importância nos laboratórios

clínicos e os métodos empregados devem permitir que a identificação seja realizada de

forma rápida e acurada, a fim de predizer o potencial patogênico da espécie isolada. A

identificação fenotípica das espécies de SCoN, baseados em provas bioquímicas manuais

ou automatizadas, continua ser uma técnica demorada, cara e com baixa acurácia (SKOW

et al

. 2005). Métodos genotípicos de identificação, baseados na detecção de genes espécie-

específicos utilizando a reação em cadeia da polimerase (PCR), vêm sendo testados a fim

de identificar com maior rapidez e acurácia as diferentes espécies de SCoN (MARTINEAU

et al

. 2001; HEIKENS

et al

., 2005; LAYER

et al

., 2006).

O aumento da resistência aos antimicrobianos, em SCoN, tem sido demonstrada em

hospitais do mundo todo, inclusive no Brasil, com taxas de resistência a oxacilina variando

de 50 a 80%, dependendo da espécie isolada e da região estudada (MARSHALL

et al.

1998; HUSSAIN

et al.

2000; FERREIRA

et al

. 2003, PALAZZO & DARINI, 2006). O

tratamento das infecções por SCoN pode ser um problema terapêutico, pois muitos isolados

clínicos desenvolvem resistência a múltiplos antibióticos, sendo que estes microrganismos

podem atuar como reservatórios de genes de resistência no ambiente hospitalar (MONSEN

et al

. 1998). Amostras resistentes a oxacilina apresentam resistência cruzada para toda a

classe dos β-lactâmicos incluindo cefalosporinas e carbapenêmicos, aumentando desta

forma o uso de glicopeptídeos em terapias empíricas e profiláticas (GOLDSTEIN

et al

2004; NUNES

et al

. 2006). A resistência a oxacilina em SCoN é resultado da produção de

uma proteína ligadora de penicilina (PBP2a) adicional, codificada pelo gene

mecA,

que

possui baixa afinidade pelos agentes

-lactâmicos, dessa forma, diversos estudos têm sido

realizados a fim de detectar corretamente a expressão heterogênea desta resistência

(CHAMBERS, 1997; FREBOURG

et al.

, 1998; HUSSAIN

et al

., 2002; FERREIRA

et al

2003; SWENSON

et al

., 2005). Métodos fenotípicos, para detectar a resistência a oxacilina,

podem ser inadequados para SCoN, apesar do uso de uma padronização internacional, o

CLSI (

Clinical and Laboratory Standards Institute

), nos laboratórios clínicos

(CHAMBERS, 1997, PALAZZO & DARINI, 2006). Desta forma, o padrão-ouro de

detecção de resistência a oxacilina é o gene

mecA

, detectado

por PCR ou pela técnica de

aglutinação em látex do seu produto (PBP2a). Em 2004, o CLSI recomendou o uso do

disco de cefoxitina como um marcador da resistência a oxacilina em

Staphylococcus

spp. e,

desde então, muitos experimentos tem sido realizados para avaliar o uso dos discos de

cefoxitina (30

g) e oxacilina (1

g) em comparação com o gene

mecA

em amostras de

Staphylococcus

spp

(NCCLS, 2004; POTTUMARTHY

et al

. 2005).

A correta identificação das espécies de SCoN, bem como, a avaliação da resistência

a oxacilina e a detecção da produção de biofilme, são desafios dos laboratórios clínicos, que

procuram métodos alternativos para melhor caracterizar espécies de SCoN de forma rápida

e confiável.

REVISÃO DA LITERATURA_______________________________________________

ASPECTOS GERAIS DO GÊNERO Staphylococcus spp.

Os estafilococos são cocos Gram positivos, pertencentes a família

Micrococaceae

do gênero

Staphylococcus

spp., que ocorrem isolados, aos pares, em tétrades ou

aglomerados (tipo “cacho de uva”), imóveis, não formadores de esporos, não-capsulados,

geralmente catalase positiva e anaeróbios facultativos

(BANERMANN, 2003).

O gênero

Staphylocococcus

é composto por aproximadamente 38 espécies e 17

subespécies, metade das quais são nativas do ser humano (KLOOS & BANERMANN,

1994; HEIKENS

et al.

2005). A grande maioria destas espécies pertence ao grupo dos

Staphylococcus

spp. coagulase-negativos (SCoN) que representam o maior componente da

microbiota da pele e das mucosas humanas (KRAUSE

et al

2003; MINTO

et al

. 1999).

Entretanto, espécies relacionadas com animais, também podem ser encontradas no homem

devido ao contato direto com estes (KLOOS & BANNERMAN, 1994). Geralmente, os

SCoN, têm uma relação benigna ou simbiótica com seu hospedeiro, entretanto podem se

transformar em patógenos se houver um rompimento da barreira cutânea do hospedeiro,

ocasionado por traumas, inoculação por agulhas ou implantação de equipamentos médicos

(HEIKENS

et al.

2005). Este grupo de bactérias tem emergido como causa importante do

aumento de infecções sanguíneas, estando associado com significativa morbidade e

mortalidade (BANERMANN, 2003; DIAS,

et al.

2004; RUHE

et al.

2004),

As infecções nosocomiais por SCoN estão relacionadas, principalmente, com

neonatos, com pacientes imunocomprometidos e com aqueles que possuem implantação de

dispositivos médicos (biomateriais) como cateteres intravasculares, marcapasso

transvenoso, válvula cardíaca, prótese articular entre outros (LOUIE

et al

. 2001;

GHOSHAL

et al

. 2004; RUHE

et al

. 2004).

EPIDEMIOLOGIA

Historicamente, o

S. aureus

era considerado um patógeno oportunista, enquanto os

SCoN como microrganismos não-patogênicos devido a sua natureza ubíqua e relativa baixa

virulência (KLOOS & SCHLEIFER, 1975; PFALLER & HERWALDT, 1988). Numerosos

estudos, envolvendo os SCoN, evidenciam que este grupo de bactérias pode causar uma

variedade de infecções de importância médica, principalmente infecções nosocomiais

(PFALLER & HERWALDT, 1988; POYART

et al

. 2001; MARTINEAU

et al

. 2001;

HEIKENS

et al

. 2005; LAYER

et al.

2006). Infecções nosocomiais são a maior causa de

morbidade e mortalidade nos EUA, principalmente em pacientes imunocomprometidos,

visto que são mais susceptíveis a infecções por microrganismos, inclusive pelos que

normalmente não causam infecções em indivíduos imunocompetentes (EMORI &

GAYNES, 1993). Estima-se que aproximadamente 30% de todas as infecções nosocomiais

e 50% das septicemias estão relacionadas com o gênero

Staphylococcus

spp. (SKOW

et al

2005). Além disso, o ambiente hospitalar propicia aos microorganismos a aquisição de

resistência aos antimicrobianos, o que complica o tratamento das infecções e eleva a

permanência do paciente no hospital, bem como, os custos com a internação (EMORI &

GAYNES, 1993).

Em um levantamento epidemiológico na América Latina realizado através do

programa SENTRY no período de 1997 a 2000, em isolados de hemoculturas, foi

observada a prevalência de 13,9 % de SCoN e 21,3% de

S. aureus.

Os índices de resistência

a oxacilina foram de 75,3% em SCoN e 30,6% em

S. aureus

. Todos os isolados de

Staphylococcus

spp. foram susceptíveis a vancomicina e linezolida, embora os SCoN

apresentassem reduzida susceptibilidade a teicoplanina e quinupristin/dalfopristin (SADER

et al.

2003). Em um estudo realizado em hospitais do Rio de Janeiro, Brasil, por Ferreira

. (2003), foi mostrado que a resistência a oxacilina em SCoN, isolados de diversos

materiais clínicos, foi de 67,8% no período de 1994 a 2000. Caierão

et al

. (2004), em um

estudo realizado em um hospital de Porto Alegre, Brasil, encontraram uma porcentagem de

69,1% de resistência a oxacilina em SCoN isolados de hemoculturas. Pallazzo & Darini

(2006) avaliaram amostras de SCoN, isoladas de diversos materiais clínicos em um hospital

de Ribeirão Preto, Brasil, encontrando uma porcentagem de 53% de resistência a oxacilina.

Os SCoN representam um grupo heterogêneo de microrganismos, a espécie mais

prevalente em infecções humanas é o

S. epidermidis

, patógeno que está envolvido com

bacteremia, endocardite, infecções de feridas cirúrgicas, trato urinário, sistema nervoso

central, infecções relacionadas com diálise peritonial e próteses médicas (JEONG

et al.

2002; SHARMA

et al.

2001; VUONG & OTTO, 2002; HEIKENS

et al

. 2005). O

haemolyticus

é a segunda espécie entre SCoN mais isolada em infecções humanas,

implicado em endocardite, septicemia, peritonite, meningites, infecções do trato urinário,

feridas, ossos e articulações (BANERMANN, 2003). O

S. saprophyticus

é um patógeno

oportunista, geralmente, associado a infecções do trato urinário especialmente em mulheres

jovens sexualmente ativas. Esta espécie pode também estar envolvida com uretrites em

homens, prostatites, infecções de ferida cirúrgica, septicemia (PATEL

et al.

2000, SECHI

et al

. 1999) e meningite em crianças (HERVÁS

et al.

1994).

S. lugdunensis

foi descrito primeiramente por Freney

et al.

(1988), apresentando

características muito mais parecidas com

S. aureus,

no que diz respeito a natureza rápida e

agressiva da infecção (PATEL

et al.

2000; HELLBACHER

et al.

2006). Ambas as

espécies,

S lugdunensis e S. aureus

, parecem compartilhar os mesmos fatores de virulência

(MATEO

et al.

2005).

S. lugdunensis

é uma espécie raramente encontrada como

contaminante/colonizante, portanto o seu isolamento tem importância como um verdadeiro

patógeno (POUTANEN & BARON, 2001), sendo relacionado a infecções de pele e tecidos

moles (EBRIGHT

et al

. 2004), artrite, bacteremia, infecções associadas ao uso de cateter e

próteses, infecções urinárias e respiratórias, peritonite, abscessos cerebrais, osteomielite

crônica e endocardite (SCHNITZLER

et al.

1998; HAILE

et al.

2002). As regiões

perianais, inguinais e peitorais podem ser os locais de colonização do

S. lugdunensis

(MATEO

et al.

2005; HELLBACHER

et al.

2006).

S. warneri

já foi descrito em casos de osteomielite vertebral e infecções do trato

urinário (KLOOS & BANERMANN, 1994), endocardites e bacteremia (CENTER

et al

2003). Outro componenete deste grupo, o

S. hominis

já foi descrito em endocardite,

peritonite, septicemia, infecções urinárias e artrite (CENTER

et al.

2003). Recentemente

uma nova subespécie de

S. hominis,

S. hominis subsp. novobiosepticus,

foi isolada em

bebês prematuros internados no Centro de Tratamento Intensivo Neonatal da cidade de

Madri, Espanha, causando bacteremia (CHAVES

et al.

2005).

Espécies menos prevalentes de SCoN como

S. simulans

S. capitis

S. schleiferi,

S. sciuri, S. caprae, S. cohnii, S. auricularis, S. xylosus, S. equorum

podem causar uma

série de infecções em humanos como por exemplo: septicemia, infecções urinárias,

endocardite, abscessos, infecções de próteses, osteomielite entre outros (MALES

et al

1985; PFALLER & HERWALDT, 1988; KAWAMURA

et al.

1998; KAMALESH &

ASLAM, 2000; CALVO

et al.

2000; COUTO

et al.

2000; RAZONABLE

et al.

2001; EIFF

et al

. 2002; DAKIÉ

et al

. 2005).

Tendo em vista o exposto acima, tem se tornado importante a identificação acurada

das espécies de SCoN para definir seu significado clínico e sua relação patógeno-

hospedeiro, bem como, a realização de um controle da emergência e disseminação da

multiresistência entre estes microrganismos, principalmente, no ambiente hospitalar

(JONES, 2001; HEIKENS

et al

. 2005; POYART

et al

. 2001).

PATOGENICIDADE

A aquisição de infecção por SCoN é facilitada pela presença de alguns fatores de risco,

tais como: quebra da barreira muco-cutânea do hospedeiro, estado de imunossupressão e

idade (idosos e neonatos), que somados à implantação de dispositivos médicos aumentam a

susceptibilidade do indivíduo a infecção (RUPP & ARCHER, 1994).

A capacidade dos SCoN de colonizar tecidos e desenvolver infecções está relacionada

ao seu poder de aderência aos biomateriais que compõem os dispositivos médicos. Fatores

de virulência são descritos, principalmente, para as espécies de

S. epidermidis

S. aureus

mas outros SCoN também podem produzir estes mesmos fatores (CAMPOCCIA

et al.

006). A produção de “slime” ou biofilme, um composto extracelular mucóide de natureza

polissacarídica, é considerado o principal fator de virulência dos SCoN. Formado durante a

fase estacionária do crescimento, permite o acúmulo (agregação) das células bacterianas e

maior aderência e persistência destas na superfície dos dispositivos médicos. Além disso,

atua como uma barreira física à ação do sistema imunológico e aos antimicrobianos

(KLOOS & BANNERMANN, 1994; ARCIOLA

et al.

2002).

O mecanismo pelo qual os SCoN atacam os biomateriais e elaboram o biofilme tem

sido caracterizado por muitos pesquisadores como um processo complexo e com muitos

passos onde a relevância de cada componente ainda requer maior investigação (SILVA

al.

2002). O processo de formação do biofilme ocorre em duas etapas: primeiro passo - um

ataque inicial da bactéria a superfície plástica inerte (biomaterial) ou material protéico do

hospedeiro presente no plástico (a adesão direta a superfície do material está relacionada a

uma proteína celular de superfície -autolisina- codificada pelo gene

atlE

); segundo passo –

formação de biofilme, que inclui a agregação celular e o acúmulo deste em multicamadas

com maior aderência e persistência na superfície dos dispositivos médicos ou nas células do

hospedeiro, sendo mediada pelos produtos do operon

ica

(O’GARA & HUMPHREYS,

2001; VUONG & OTTO, 2002; MORETRO

et al.

2003). A ativação do lócus

ica

que

contém um operon com os genes

ica

ADBC, desencadeia a síntese da adesina polisacarídica

intercelular (PIA), principal componente do biofilme, responsável pela adesão célula a

célula. A PIA consiste em um polímero linear

-1,6 glicosaminoglicano codificado pelo

lócus intercelular de adesão e em particular pelo gene

icaA.

Apenas a expressão do gene

icaA

induz a baixa atividade enzimática, porém a co-expressão dos genes

icaA

com

icaD

leva a um significativo aumento na atividade enzimática da proteína sendo relatado como a

expressão fenotípica total do polisacarídeo capsular (ARCIOLA

et al.

2001). O papel dos

genes

icaB, icaC

icaR

(regulador) não está bem estabelecido (O’GARA &

HUMPHREYS, 2001; GÖTZ, 2002).

Alguns experimentos têm mostrado que a bactéria que cresce dentro do biofilme,

geralmente, exibe uma maior resistência aos antimicrobianos por baixa difusão ou falha na

penetração destes no biofilme, apesar de susceptibilidade demonstrada

in vitro

através de

métodos convencionais. Outros fatores que podem justificar o aumento na resistência aos

antimicrobianos são: baixo crescimento bacteriano dentro do biofilme pela limitação de

nutrientes, indução das características fenotípicas do biofilme com ativação do mecanismo

de efluxo de drogas e alteração da composição protéica da membrana celular (ARCIOLA

al.

2001; ARCIOLA

et al.

2005).

Nos EUA, artroplastias totais de joelho e quadril caracterizam aproximadamente meio

milhão de intervenções a cada ano. Com este grande número de pacientes com implantes

ortopédicos, o risco de infecção, estimado em 0,5 a 5% do total de próteses, deve ser

considerado relevante pela suas sérias conseqüências (CAMPOCCIA

et al.

2006). Os

SCoN são causadores de 15 a 37,5% de infecções pós-artroplastias, sendo que o

epidermidis

é a principal espécie responsável por estas infecções e por outras

relacionadas com articulações e ossos. Existem alguns relatos de outras espécies de SCoN

também relacionadas com este tipo de infecção, como

S. caprae, S. lugdunensis,

S. simulans

S. hominis e S. haemolyticus

(SIVADON

et al.

2005, CAMPOCCIA

et al.

2006).

No tratamento clínico das infecções por

Staphylococcus

spp. após cirurgias de

implantação de próteses, a rápida identificação de propriedades virulentas das bactérias é

crucial na tomada de decisão entre o uso de antimicrobianos ou tratamentos cirúrgicos. Às

vezes, a remoção da prótese e a recolocação de uma prótese nova representam a única

opção para erradicar definitivamente as infecções severas (ARCIOLA

et al.

2001;

CAMPOCCIA

et al.

2006). Os SCoN são os principais microorganismos capazes de

produzir colonização ou de infectar cateteres vasculares nos quais podem levar a

bacteremia, podendo ser uma importante complicação em pacientes hematológicos,

hemodialisados e naqueles internados em unidades de tratamento intensivo onde o uso de

cateteres é parte do tratamento médico (SCHULIN & VOSS, 2001). Saginur

et al.

(2006)

demonstraram o aumento da resistência aos antimicrobianos em amostras de

Staphylococcus

obtidas em biofilme em relação a bactérias sob forma livre. Rifampicina,

vancomicina e ácido fusídico foram os antibióticos mais comumente incluídos em

combinações ativas contra

Staphylococcus

produtores de biofilme. Em outro experimento, a

eritromicina, rifampicina e tetraciclina apresentaram maior efeito que a vancomicina,

clindamicina, cefalotina, teicoplanina e ofloxacina em isolados clínico de

S. epidermidis

produtores de biofilme. Estes estudos salientam a relevância do teste de susceptibilidade na

presença de biofilme e o potencial dano do uso indiscriminado da monoterapia com

vancomicina, inadequada frente a infecções com microrganismos produtores de biofilme

(AMORENA

et al.

1999; MONZÓN

et al.

2001).

O método qualitativo mais utilizado para detecção de biofilme, principalmente em

S. epidermidis

, é o teste em placa de ágar Congo red (CRA) descrita por Freeman

et al

(1989). A análise direta das colônias formadas neste meio permite o reconhecimento das

amostras produtoras de biofilme ou PIA-positivas (colônias pretas no ágar vermelho) das

não-produtoras de biofilme (colônias bordô/vermelhas). A correta classificação do teste

qualitativo pode ser dificultada pelo caráter subjetivo de avaliação cromática do observador

(ARCIOLA

et al

. 2001). Novos métodos moleculares têm sido empregados na avaliação da

produção de biofilme, como por exemplo a técnica de PCR, através da detecção dos

principais genes envolvidos,

icaA e icaD,

pertencentes ao operon

ica

(ARCIOLA

et al

2001a; ARCIOLA

et al.

2002). A correlação entre a detecção genotípica dos genes

icaA

icaD

e a formação de colônias biofilme-positivas no CRA tem sido demonstrada

principalmente em amostras de

S. epidermidis

(ARCIOLA

et al.

2001).

Outros fatores de virulência em potencial, relacionados aos SCoN, podem ser melhor

estudados como: exoproteínas, hemolisinas, citotoxinas, deoxitibonuclease, fibrinolisina,

proteinase e lipase-esterase. Similaridade entre exoproteínas produzidas por

S. aureus,

S. epidermidis, S. haemolyticus

S. saprophyticus

sugerem que este pode ser um

importante fator de virulência em infecções humanas (PFALLER & HERWALDT, 1988).

RESISTÊNCIA AOS ANTIMICROBIANOS

O aumento da complexidade dos pacientes que requerem hospitalização, da idade da

população e do uso de dispositivos médicos tem elevado o risco de bacteremia. O

tratamento de pacientes com bacteremia vem se tornando cada vez mais complicado em

uma era com aumento de resistência aos antimicrobianos entre diferentes patógenos.

Levantamentos epidemiológicos mostraram taxas de mortalidade em pacientes com

bacteremia de 17,5% em adultos, 14% em pacientes pediátricos e entre 20 a 40% entre

pacientes idosos (LEIBOVICI

et al.

1995; WEINSTEIN

et al.

1997; WISPLINGHOFF

al.

2003). O uso de agentes antimicrobianos tende a exercer uma pressão seletiva na

população bacteriana o que promove a emergência de microrganismos resistentes e

predispõe o paciente à colonização por estes. Geralmente, a resistência dos microrganismos

aos antimicrobianos também está relacionada com o aumento do uso de drogas

imunossupressoras e procedimentos invasivos como resultados de novos avanços

tecnológicos (EMORI & GAYNES, 1993). Outro fator que contribui com o aumento da

resistência é o tratamento médico empírico, que pode levar a uma terapia antimicrobiana

inadequada com pobres resultados clínicos (BIENDENBACH

et al.

2004).

Embora, geralmente não seja considerado um fator de virulência, a multirresistência

é uma das principais características observadas entre amostras clínicas de SCoN e tem

incluído além da resistência a oxacilina e conseqüentemente resistência a todos

lactâmicos, a resistência a aminoglicosídeos, clindamicina, cloranfenicol, eritromicina,

tetraciclina, trimetoprim/sulfametoxazol e quinolonas (PFALLER & HERWALDT, 1988;

SANTOS

et al.

1997). Os primeiros surtos de

S. aureus

oxacilina-resistentes ocorreram em

hospitais europeus no início dos anos 60 (OLIVEIRA

et al.

2002). Desde então, amostras

S. aureus

e SCoN resistentes a oxacilina têm sido isoladas em todo mundo, tanto no

ambiente hospitalar quanto fora dele, principalmente, em pacientes com doenças crônicas e

usuários de drogas injetáveis (HACKBART & CHAMBERS, 1989; CHAMBERS, 1997).

S. epidermidis

S. haemolyticus

são espécies que apresentam mais freqüentemente

resistência a oxacilina entre os isolados clínicos de SCoN (FERREIRA

et al

. 2002).

Recentemente, foram descritas infecções ocasionadas por

S. aureus

resistentes a

meticilina adquiridos na comunidade (CA-MRSA), que causam infecções de pele e tecidos

moles, furunculoses e abscessos, podendo causar pneumonias necrotizantes, estando mais

relacionados com populações jovens que não apresentaram fatores de risco para infecções

nosocomiais (RIBEIRO

et al.

2005). Recentes relatos de isolados de CA-MRSA

demonstraram que estes são geneticamente distintos do MRSA, associado infecções

nosocomiais (HA-MRSA), apresentando freqüentemente fatores de virulência diferentes do

HA-MRSA, como o gene Panton-Valentine Leucocidin (PVL) associado a infecções de

pele. Em adição, a resistência a meticilina é conferida pelo cassete cromossômico mec

(SCCmec) tipo IV ou V diferentes do tipo I e II encontrados no HA-MRSA (PATEL

et al.

2006).

Semelhante ao que acontece com o

S. aureus

, a resistência a oxacilina entre os

SCoN tem aumentado nos últimos anos. Estima-se que dependendo da espécie, 50 a 80%

das amostras isoladas de SCoN, em diversos países, são

mecA

positivas, ou seja, resistentes

a oxacilina (MARSHALL

et al.

1998; HUSSAIN

et al.

2000; FERREIRA

et al

. 2003,

PALAZZO & DARINI, 2006). Muitos dos SCoN adquirem genes de resistência devido a

plasmídeos (DNA extra-cromossômico) ou através de elementos genéticos móveis

(transposons), representando uma via importante de transmissão de determinantes de

resistência para outros gêneros e espécies, justificando a importância dos SCoN como

reservatórios de genes de resistência (ARCHER & NIEMEYER, 1994). A resistência a

oxacilina está associada com a produção de uma única PBP que não está presente em

amostras de

Staphylococcus

spp.

suscetíveis a oxacilina. Esta proteína induzível (PBP2a ou

PBP2’) é produzida em amostras de

Staphylococcus

spp. meticilina resistentes, possuindo

baixa afinidade aos

-lactâmicos, sendo codificada pelo gene

mecA

(HACKBARTH &

CHAMBERS, 1989; MAES

et al

. 2002). A origem do gene

mecA,

tem sido atribuída a um

espécie de SCoN, o

S. sciuri,

possivelmente por uma evolução de um gene ancestral

homólogo ao

mecA,

com 88% de similaridade na seqüência de aminoácidos das PBP2a

(CHAMBERS, 1997; JUUTI

et al

. 2005; DAKIÉ

et al.

2005). O gene

mecA

produzido

por um elemento genético móvel de DNA,

staphylococcal cassette chomosome mec

(SCCmec) com 21 a 67 kb que integram o cromossomo da resistência a meticilina em

aureus

(MRSA) em um único local (

attBscc

) localizado próximo ao seu local de replicação

(HANSSEN

et al.

2004). Cinco tipos de elementos SCCmec, contendo diferentes

combinações de

mecA

, de seus reguladores e genes recombinantes específicos, vem sendo

caracterizados em alguns estudos (HANSSEN et al. 2004; JUUTI et al. 2005), sendo que o

mecanismo responsável pela transferência do gene

mecA

não é conhecido, porém

evidências suportam uma transferência horizontal entre espécies de SCoN para

S. aureus

também entre diferentes gêneros de bactérias Gram-positivas (HANSSEN

et al

. 2004).

A resistência a oxacilina pode ser de difícil detecção por métodos fenotípicos

devido à sua expressão heterogênea (heteroresistência), onde a maioria das células

apresenta susceptibilidade a baixas concentrações do antimicrobiano

-lactâmico, com

apenas uma pequena parcela da população bacteriana (1 UFC em 10

UFC) crescendo em

concentrações elevadas da droga. Este tipo de resistência é mais comum em SCoN do que

S. aureus

e pode levar a liberação de resultados falso-negativos quando utilizados

métodos convencionais para determinação da susceptibilidade à oxacilina (CHAMBERS,

1997; GRADELSKI

et al

. 2001; HUSSAIN

et al.

2002; GHOSHAL

et al

. 2004). A

expressão fenotípica da resistência a oxacilina pode variar dependendo das condições de

crescimento do microrganismo (ex. temperatura, osmolaridade, meio de cultura

suplementado com NaCl ou sacarose), dessa forma, pode gerar problemas aos métodos de

avaliação deste antimicrobiano, apesar do uso de uma padronização internacional como o

CLSI pelos laboratórios clínicos (PALAZZO & DARINI, 2006).

Na avaliação da resistência a oxacilina, os métodos moleculares de detecção do

gene

mecA

através da

PCR, são considerados padrão-ouro, sendo utilizados,

principalmente, em laboratórios de pesquisa devido ao custo e/ou o uso de equipamentos

especializados (MAES

et al.

2002; BANNERMANN, 2003). Um método alternativo de

rápida execução na detecção da resistência a oxacilina é a detecção da produção da PBP2a

através do teste comercial de aglutinação em látex. Este método tem demonstrado boa

correlação com o da detecção do gene

mecA

(LOUIE

et al.

2001; HUSSAIN

et al.

2002).

Embora, o PCR seja considerado o melhor método para detectar resistência dos

Staphylococcus

a oxacilina, alguns estudos têm demonstrado discrepâncias em amostras

que não carregam o gene

mecA

, porém, mostram resistência a oxacilina (VELASCO

et al

2005; PALAZZO & DARINI 2006). O baixo nível de resistência a oxacilina nos

Staphylococcus mecA

negativos pode ser resultado da modificação ou hiperprodução de

PBPs normais. A expressão da resistência a oxacilina pode ser mediada por β-lactamase, no

qual, quando hiperproduzida pode hidrolisar o anel

-lactâmico das penilicinas e a levar a

alterações nas PBPs (PBPs 1, 2 e 4) outras que a PBP2a (TENOVER

et al.

1999;

PETINAKI

et al

. 2002).

Outro método alternativo na detecção da resistência a oxacilina, é o teste de triagem

em ágar contendo oxacilina que pode ser utilizado em laboratórios clínicos. Caierão

et al

(2004) avaliaram diferentes concentrações de oxacilina (0,6 e 4

g/mL) no teste de triagem

em ágar. A concentração de 4

g/mL de oxacilina resultou em especificidade de 100% para

os SCoN quando correlacionada com a presença ou ausência do gene

mecA.

O método fenotípico de disco de difusão (DD) é amplamente utilizado nos

laboratórios clínicos para detecção de resistência aos antimicrobianos. A fim de obter

resultados mais precisos, na detecção da resistência a oxacilina em

Staphylococcus

spp., o

CLSI em 2004, recomendou o uso de disco de difusão de cefoxitina (30 µg) para melhor

predizer a resistência a oxacilina nestes isolados

(POTTUMARTHY

et al.

2005) A

cefoxitina, uma cefamicina, é mais potente indutora do sistema regulador do gene

mecA

que as penicilinas. Alguns grupos de estudo têm observado melhores resultados de testes

com disco de cefoxitina correlacionando-a com a presença do gene

mecA

do que com disco

de oxacilina entre isolados de

Staphylococcus

spp

(FERNANDES

et al.

2005; SWENSON

& TENOVER, 2005; VELASCO

et al

. 2005),

Infecções por

Staphylococcus

spp

susceptíveis a oxacilina são mais efetivamente

tratadas com antimicrobianos β-lactâmicos do que com vancomicina devido a sua alta

atividade intrínseca, melhor concentração nos tecidos, baixa incidência de efeitos

colaterais, rápida ação bactericida e baixo custo terapêutico. Entretanto, o uso inicial de

vancomicina, como terapia empírica, parece ser uma prática comum aos clínicos

(GHOSHAL

et al.

2004). Dessa forma, a detecção rápida e acurada da resistência a

oxacilina em

Staphylococcus

spp.

é um importante guia para tratar infecções severas

(LOUIE et al 2001; STEPANOVIC

et al.

2006).

Os SCoN que se apresentam como resistentes a oxacilina, geralmente, são

susceptíveis aos glicopeptídeos (vancomicina e teicoplanina). Entretanto, atualmente, os

SCoN já mostraram fenótipos de susceptibilidade reduzida e de resistência aos

glicopeptídeos. O mecanismo de resistência aos glicopeptídeos em

Staphylococcus

spp. não

é totalmente entendido. A maioria dos estudos é focada em

S. aureus

, demonstrando um

complexo mecanismo relacionado a mudanças que afetam a parede da célula bacteriana

(espessamento) evitando que moléculas de vancomicina alcancem os sítios de síntese dos

peptideoglicanos (NUNES

et al.

2006). O gene

vanA

envolvido na resistência aos

glicopeptídeos em

Enterococcus

spp. não tem sido associado com a resistência a

vancomicina em

Staphylococcus

spp.,

apesar de três isolados de VRSA portadores do gene

vanA

já terem sido isolados nos EUA (PALAZZO

et al.

2005).

Apesar do amplo uso de vancomicina, a maioria dos SCoN tem permanecido

susceptível as concentrações séricas deste antimicrobiano, entretanto, o mecanismo de

resistência já foi relatado em isolados de

S. epidermidis, S. haemolyticus

S. hominis

S. warneri e S. sciuri

como sendo similar ao descrito em amostras VISA e hetero-VISA

(STEPANOVIC

et al.

2006; NUNES

et al.

2006). A emergência da resistência a

teicoplanina em SCoN tem sido reportada antes da resistência a vancomicina, podendo a

teicoplanina ser considerada um marcador da heteroresistência a vancomicina em

Staphylococcus

spp. (BOISSON

et al.

2002; NUNES

et al.

2006; STEPANOVIC

et al.

2006). O mecanismo de resistência a vancomicina em SCoN pode ser atribuída a seleção de

subpopulações, uma composta de bactérias susceptíveis a vancomicina e teicoplanina e

outra composta de um pequeno número de bactérias com variável grau de resistência aos

glicopeptídeos (PALAZZO

et al.

2005; NUNES

et al.

2006). A exposição individual a

glicopeptídeos e β-lactâmicos, em associação com a história prévia de hospitalização e

pneumonia pode ser um fator de risco para desenvolvimento de resistência aos

glicopeptídeos (TACCONELLI

et al

. 2001; CENTER

et al

. 2003).

CARACTERIZAÇÃO FENOTÍPICA

Staphylococcus

spp. podem ser identificados por uma variedade de características

fenotípicas convencionais ou moleculares (BANERMANN, 2003). A identificação

convencional das espécies e subespécies de SCoN é realizada a partir da combinação de um

grupo de testes laboratoriais como: morfologia colonial, resistência ou susceptibilidade a

certos antimicrobianos, produção de hemólise, análise da atividade enzimática sobre

diferentes substratos e produção de ácido a partir de diferentes carboidratos

(BANERMANN, 2003).

A preocupação de identificar corretamente as espécies de

Staphylococcus

spp.

coagulase-negativos pelos laboratórios clínicos tem aumentado nos últimos tempos.

Entretanto, o método convencional proposto por Kloss & Schleifer (1975) e modificado por

Bannerman (2003) é trabalhoso e demorado, sendo que a exata identificação das espécies

não é tarefa fácil, pois as provas bioquímicas utilizadas para identificação, apresentam

muitas vezes características similares entre as diferentes espécies. Muitos laboratórios

clínicos utilizam rotineiramente sistemas comerciais para identificar as espécies de SCoN,

entretanto, estes podem não incluir em seus bancos de dados todas as espécies de

Staphylococcus

spp. gerando resultados que variam de 50 a 95% na identificação das

amostras (KAWAMURA

et al.

1998; POYART

et al

. 2001; DE PAULIS

et al

. 2003).

Resultados discrepantes entre os sistemas convencionais de identificação e os sistemas

automatizados mais conhecidos e disponíveis no mercado, MicroScan (Dade Behring,

Deerfield, IL, USA) e VITEK (bioMérieux, Marcy L’Etoile, France), são relatados para

espécies menos freqüentemente isoladas de SCoN, já para espécies com maior freqüência

de isolamento e com maior relevância clínica como

S. epidermidis e S. haemolyticus

sistemas têm performances similares aos métodos convencionais (CAIERÃO

et al

. 2006).

Métodos convencionais ou sistemas comerciais de identificação além de possuírem

uma baixa acurácia (50 a 70%), precisam de maior tempo de incubação para obter os

resultados esperados. O custo, o tempo e a baixa acurácia na identificação das espécies

pode resultar na decisão de alguns laboratórios não identificarem os SCoN a não ser que

sejam considerados clinicamente significantes (POYART

et al

. 2001; SKOW

et al

. 2005).

A realização de testes fenotípicos simples e de fácil execução é um desafio nos

laboratórios clínicos. Esquemas simplificados de identificação já foram descritos por

muitos autores, como Lindsay & Riley (1991) que utilizaram discos impregnados com o

medicamento Desferal

(Ciba-Geigy), composto de mesilato de desferroxamina B, um

sideróforo utilizado como agente quelante de ferro, para realização de um teste simples de

identificação de SCoN baseado na técnica de disco de difusão. Como resultado, no teste de

disco de difusão, houve a susceptibilidade ou formação de halo apenas nas espécies de

epidermidis e S. hominis,

sendo que os demais SCoN foram resistentes a desferrioxamina.

Ieven

et al.

(1995) propôs um esquema simples de identificação de SCoN

envovendo duas etapas: a primeira avaliando a produção de urease, fermentação da trealose

e fosfatase alcalina com leitura em 4hs e a segunda, quando necessária, utilizando testes

complementares como a descarboxilação da ornitina, crescimento em anaerobiose e

suscetibilidade a novobiocina e fosfomicina. Desta forma, o esquema identificou 97,7% dos

isolados com resultados semelhantes aos métodos convencionais e comerciais

comparativos. Monsen

et al

. (1998) propuseram um painel de testes no qual foi avaliado:

produção de urease e

-galactosidade, fementação de maltose, manose, trealose, manitol,

sacarose e ribose, testes de suscetibilidade a furazolidona, desferroxamina, polimixina B,

novobiocina e bacitracina. Este esquema identificou 96,9% das espécies quando comparado

a método convencional ou sistemas comerciais.

Métodos fenotípicos de avaliação de resistência aos antimicrobianos em

Staphylococcus

envolvem principalmente a detecção de resistência a oxacilina e são

recomendados pelo CLSI os seguintes testes para SCoN: teste de difusão em ágar (Kirby-

Bauer) com utilização de discos de oxacilina (1

g) e cefoxitina (30

g) com leitura após

24hs de incubação a 35°C e interpretação dos halos obtidos conforme “breakpoints”

padronizados; determinação da concentração inibitória mínima (CIM) através da técnica de

microdiluição ou diluição em ágar para oxacilina com leituras conforme “breakpoints” do

CLSI. O teste de triagem em ágar Mueller Hinton suplementado com NaCl e oxacilina é

recomendado apenas para amostras de

S. aureus

(NCCLS, 2003; CLSI, 2005 e 2006).

Sistemas comerciais automatizados, como VITEK ou Microscan, podem ser

utilizados na avaliação de resistência a oxacilina em SCoN com excelente especificidade,

entretanto, estes podem perder em sensibilidade e acurácia na detecção de isolados com

resistência heterogênea a oxacilina principalmente em SCoN (CHAMBERS, 1997;

FREBOURG

et al.

1998; JAFFE

et al.

2000).

CARACTERIZAÇÃO GENOTÍPICA

Métodos genotípicos, baseados na análise dos produtos de PCR derivados de

seqüências de DNA específicas, têm sido desenvolvidos para a identificação das espécies

dos SCoN, mostrando maior estabilidade e rapidez (POYART

et al

. 2001; FUJITA

et al

2005). O uso de alvos moleculares (de ácidos nucléicos) aumenta a sensibilidade e

especificidade da técnica e podem ser uma alternativa na identificação acurada das espécies

de SCoN. Vários genes tem sido pesquisados, como o 16S rRNA, gene conservado

presente no cromossomo de todas as bactérias, o gene que codifica o tRNA da região

intergênica (ITS-PCR), o gene

sodA,

o qual codifica uma proteína superóxido dismutase

(manganês- dependente), o gene

tuf

, que codifica o alongamento do fator Tu envolvido na

formação da cadeia peptídica e é parte do ribossomo, além de outros genes como, o gene

hsp60,

o gene

fem,

o gene

rpoB,

gene gap

(POYART

et al.

2001; COUTO

et al.

2001;

DRANCOURT & RAOULT 2002; HEIKENS

et al.

2005; LAYER

et al.

2006).

Poyart

et al.

(2001) avaliaram o uso do gene

sodA

, na identificação 40 espécies de

SCoN. Os resultados obtidos mostraram que o gene

sodA

pode constituir um alvo com

melhor poder discriminatório em relação a diferenciação das espécies relacionadas do que o

16S rRNA. A limitação do método, assim como gene

hsp60,

foi não discriminar as espécies

no nível de subespécies. Martineau

et al.

(2001) desenvolveram um método de

identificação de SCoN baseados na reação de PCR específica para

Staphylococcus

tendo

como alvo o gene

tuf.

Os resultados mostraram ser altamente sensíveis e específicos,

principalmente, paras as cinco sondas espécie-específicas desenvolvidas neste estudo:

S. aureus, S. epidermidis,

S. haemolyticus, S. hominis

S. saprophyticus.

Heikens

et al

. (2005) avaliaram 57 amostras de SCoN através de métodos

fenotípicos de identificação das espécies com os sistemas comerciais API Staph ID

(bioMérieux) e Sistema Automatizado BD Phoenix (Becton Dickinson, Franklin Lakes, NJ,

USA) comparados com métodos genotípicos envolvendo sequenciamento de amplicons das

seqüências dos

Staphylococcus

16S rRNA e genes

tuf

sodA.

Os resultados dos métodos

fenotípicos de identificação indicaram que os resultados do API Staph ID foram mais

confiáveis do que os obtidos nos sistema BD Phoenix, já os métodos genotípicos,

mostraram superioridade aos fenotípicos na identificação das espécies de SCoN. O

sequenciamento do gene 16S rRNA apresentou poder discriminatório limitado para as

espécies de

Staphylococcus

em comparação com o gene

tuf

que apresentou um melhor

desempenho na identificação destas espécies. Skow

et al.

(2005) desenvolveram um

método de identificação de SCoN baseado na técnica de PCR em tempo-real (Real time-

LightCycler, Roche, Indianápolis, IN, USA) que permitiu distinguir várias espécies de

Staphylococcus

spp. através de um único perfil da curva de fusão (melt curve) de cada

espécie. A obtenção dos resultados ocorreu em apenas 2 horas, sendo avaliado um total de

110 amostras que mostraram 98% de identificações corretas por PCR em tempo real

quando comparados com 79% do sistema comercial API Staph ID (bioMérieux). O uso do

PCR em tempo real, apesar do alto custo e da necessidade de equipamentos específicos,

demonstrou ser um método rápido e acurado para identificação de

Staphylococcus

que pode

ser utilizado diretamente dos isolados clínicos incluindo amostras de sangue e outros sítios

estéreis.

Métodos moleculares também são utilizados para detectar genes de resistência

específicos e quando associados com métodos fenotípicos têm contribuído para o

entendimento da genética de resistência antimicrobiana e da disseminação dos

determinantes de resistência (BIENDENBACH

et al.

2004). O método genotípico

considerado como padrão-ouro na detecção de resistência a oxacilina em

Staphylococcus

a detecção do gene

mecA

, através da reação de PCR que consiste na amplificação de um

fragmento deste gene, a partir de seqüências de oligonucleotídeos complementares

(CHAMBERS, 1997).

REFERÊNCIAS BIBLIOGRÁFICAS_________________________________________

AMORENA, B. et al. Antibiotic susceptibility assay for

Staphylococcus aureus

in biofilms

developed

in vitro.

J. Antimicrob. Chemother

, v. 44, p. 43-55, 1999.

ARCHER, G.L.; NIEMEYER, D.M. Origin and evolution of DNA associated with

resistance to methicillin in staphylococci.

Trends Microbiol,

v. 2, p. 325-34, 1994.

ARCIOLA, C.R. et al. A Rapid PCR Method for the detection of Slime-producing Strains

Staphylococcus epidermidis

and

S. aureus

in periprosthesis Infections.

Diagn. Mol.

Pathol

, v. 10, p. 130-137, 2001.

ARCIOLA, C.R. et al. Presence of

icaA

and

icaD

Genes and Slime production in a

Collection of

Staphylococcal

Strains from Catheter-Associated infections.

J. Clin.

Microbiol

, v. 39, p. 2151-2156, 2001a.

ARCIOLA, C.R. et al. Detection of slime production by means of an optimized Congo red

agar plate test based on a colourimetric scale in

Staphylococcus epidermidis

clinical isolates

genotyped for

ica

locus.

Biomaterials

, v. 23, p. 4233-4239, 2002.

ARCIOLA, C.R. et al. Antibiotic resistance in exopolysaccharide-forming

Staphylococcus

epidermidis

clinical isolates from orthopaedic implant infections.

Biomaterials,

v. 26, p.

6530-6535, 2005.

BANERMANN, T. L.

Staphylococcus, Micrococcus

and other catalase-positive cocci that

grow aerobically. In Murray P.R., Baron E.J., Jorgensen, J. H.; Pfaller, M.A. and Yolken,

R. H. (Ed).

Manual of Clinical Microbiology

. Eight Edition. Washington, DC: ASM Press,

v. 1, p. 384-404, 2003.

BIEDENBACH, D.J.; MOET, G.J.; JONES, R.N. Occurrence and antimicrobial resistance

pattern comparisons among bloodstream infection isolates from the SENTRY antimicrobial

Surveillance program (1997-2002).

Diagn. Microb. Infect

Dis

, v. 50, p. 59-69, 2004.

BOISSON, K. et al. Characterization of coagulase-negative Staphylococci isolated from

blood infections: Incidence, Susceptibility to Glycopeptides and Molecular Epidemiology.

Eur. J. Clin. Microbiol. Infect. Dis,

v. 21, p. 660-665, 2002.

CAIERÃO, J. et al. Evaluation of phenotypic methods for methicillin resistance

characterization in coagulase-negative staphylococci (CNS).

J. Med. Microbiol

, v.53, p.

1195-1199, 2004.

CAIERÃO, J. et al. Automated systems in the identification and determination of

methicilin resistance among coagulase-negative S

taphylococci

Mem. Inst. Oswaldo Cruz,

v. 10, p. 277-279, 2006.

CALVO, J. et al. Osteomyelitis caused by

S. scheileferi

and evidence of misindentification

of this staphylococcus species by an automated bacterial identification system.

J. Clin.

Microbiol

, v. 38, p.3887-3889, 2000.

CAMPOCCIA, D.; MONTANARO, L.; ARCIOLA, C. R. The significance of infection,

related to orthopedic devices and issues of antibiotic resistance.

Biomaterials,

v. 27, p.

2331-2339, 2006.

CENTER, et al. Decreased vancomycin susceptibility of coagulase-negative staphylococci

in a neonatal intensive care unit evidence of spread of S. warneri. J. Clin. Microbiol, v. 41,

p. 4660-4665, 2003.

CHAMBERS, H.F. Methicillin resistance in Staphylococci molecular and biochemical

basis and clinical implications.

Clin. Microbiol. Rev

, v. 10, p. 781-791, 1997.

CHAVES, F. et al. Nosocomial spread of a

Staphylococcus hominis subsp. novobiosepticus

strain causing sepsis in a neonatal intensive care unit

. J. Clin. Microbiol,

v. 43, p. 4877-

4879, 2005.

CLINICAL AND LABORATORY STANDARDS INSTITUTE. (CLSI).

Performance

Standards for Antimicrobial Susceptibility Testing

. Fifteenth Informational supplement.,

M100-S15. Clinical and Laboratory Standards Institute, Wayne, PA., 2005.

CLINICAL AND LABORATORY STANDARDS INSTITUTE. (CLSI).

Performance

Standards for Antimicrobial Disks Susceptibility Tests; Approved Standard –Ninth Edition.

M2-A9. Clinical and Laboratory Standards Institute, Wayne, PA, 2006.

COUTO, I. et al. Molecular characterization of

S. sciuri

strains isolated from humans.

Clin. Microbiol

, v. 38, p. 1136-1143, 2000.

COUTO, I. et al. Identification of clinical staphylococcal isolates from humans by internal

transcribed spacer PCR.

J. Clin. Microbiol,

v. 39, p. 3099-3103, 2001.

DAKIÉ, I. et al. Isolation and Molecular characterization of

Staphylococcus sciuri

in the

hospital Environment.

J. Clin. Microbiol,

v. 43, p. 2782-2785, 2005.

De PAULIS, A N. et al. Five-test simple scheme for species level identification of

clinically significant coagulase-negative Staphylococci.

J. Clin. Microbiol

, v. 41, p. 1219-

1224, 2003.

DIAS, C. A. et al. Use of a novel selective medium to detect methicilin-resistant

Staphylococcus aureus

in colonized patients of an intensive care unit.

Infection Control and

Hospital Epidemiology,

v. 25, p. 130-132, 2004.

DRANCOURT, M.; RAOULT, D.

rpo B

Gene Sequence-Based identification of

Staphylococcus

species.

J. Clin. Microbiol

, v. 40, p. 1333-1338, 2002.

EBRIGHT, J.; PENUGONDA, N.; BROWN, W. Clinical experience with

Staphylococcus

lugdunensis

bacteremia: a retrospective analysis.

Diagnostic Microbiology and Infectious

Disease

, v. 48, p. 17-21, 2004.

EIFF, VON C.; PETERS, G.; HEILMANN, C. Pathogenesis of infections due to coagulase-

negative staphylococci.

The Lancet Infect Dis.

v. 2, p. 677-685, 2002.

EMORI, T.G.; GAYNES, R.P. An overview of nosocomial infections, including the role of

the microbiology laboratory.

Clin. Microbiol. Rev

, v. 6, p. 428-442, 1993.

FERNANDES, C.J.; FERNANDES, L. A.; COLLIGNON, P. Cefoxitin resistance as a

surrogate marker for detection the detection of methicilin-resistant

Staphylococcus aureus

J. Antim. Chem

. v. 55, p. 506-510, 2005.

FERREIRA, R. B. R. et al. Simultaneous detection of the

mec A

and

ileS

-2 genes in

coagulase-negative staphylococci isolated from Brazilian hospitals by multiplex PCR.

Diagn. Microbiol. Infec. Dis,

v. 42, p. 205-212, 2002.

FERREIRA, R.B.R. et al. Coagulase-negative Staphylococci: comparison of phenotypic

and genotypic oxacilin sucseptibility tests and evaluation of the Agar screening test by

using different concentration of oxacilin.

J. Clin. Microbiol

, v. 41, p. 3609-3614, 2003.

FREBOURG, N.B. et al. Comparison of ATB staph, rapid ATB staph, Vitek and E–test

methods for detection of oxacilin heteroresistance in Staphylococci possessing

mecA.

Clin. Microbiol,

36, p. 52-57, 1998.

FREEMAN, D.J.; FALKINER, F.R.; KEANE, C.T. New method for detecting slime

production by coagulase negative staphylococci.

J. Clin. Pathol,

v. 42, p. 872-874, 1989.

FRENEY, J. et al.

Staphylococcus lugdunensis sp. nov.

and

Staphylococcus schleiferi sp

nov.,

two species from human clinical specimens.

Int. Syst. Bacteriol

. v. 38, p. 168-172,

1988.

FUJITA, S-I. et al. Rapid identification of staphylococcal strains from positive-testing

blood culture bottles by internal transcribed spacer PCR Followed by Microchip Gel

Electrophoresis.

J. Clin. Microbiol,

43, p. 1149-1157, 2005.

GHOSHAL, U. et al. A comparative evaluation of phenotypic and molecular methods for

the detection of oxacillin resistance in coagulase-negative staphylococci.

J. Infect.

Chemother

, v.10, p. 86-89, 2004.

GOLDSTEIN, F.W. et al. False synergy between vancomycin and ß-lactams against

glycopeptides-intermediate

Staphylococcus aureus

(GISA) caused by inappropriate testing

methods.

Clin. Microbiol. Infec,

v. 10, p. 332-348, 2004.

GOTZ, F.

Staphylococcus

and biofilms.

Molecular Microbiology,

v. 43, p. 1367-1378,

2002.

GRADELSKI, E. et al. Correlation between genotype and phenotypic categorization of

staphylococci based on methicillin susceptibility and resistance.

J. Clin. Microbiol

, v. 39, p.

2961-2963, 2001.

HACKBARTH, C.; CHAMBERS, H. Methicillin-resistant staphylococci: genetics and

mechanisms of resistance.

Antimicrobial Agents and Chemotherapy,

v. 33, p. 991-994,

1989.

HAILE, D.T. et al. Frequency of isolation of Staphylococcus lugdunensis in consecutive

urine cultures and relationship to urinary tract infection.

J. Clin. Microbiol

, v. 40, p. 654-

656, 2002.

HANSSEN, A.M.; KJELDSEN, G.; SOLLID, J.U.E. Local variants of Staphylococcal

cassette chromosome

mec

in sporadic methicillin-resistant

Staphylococcus aureus

and

methicillin-resistant coagulase-negative Staphylococci: Evidence of Horizontal gene

transfer?

Antimicrobial Agents and Chemotherapy,

v. 48, p. 285-296, 2004.

HEIKENS, E. et al. Comparison of Genotypic and Phenotypic methods for Species-level

identification of Clinical Isolates of coagulase-negative Staphylococci.

J. Clin. Microbiol

v. 43, p. 2286-2290, 2005.

HELLBACHER, C.; TORNQVIST, E.; SODERQUIST, B.

Staphylococcus lugdunensis

clinical spectrum, antibiotic susceptibility, and phenotypic and genotypic patterns of 39

isolates.

Clinical Microbiology and Infection

, v. 12, p. 43-49, 2006

HERVÁS, J.A. et al. Sepsis and meningitis caused by methicillin-resistant

Staphylococcus

saprophyticus.

Clinical Microbiology Newsletter

, v. 16, p. 71-72, 1994

HUSSAIN, Z et al. Correlation of oxacilin MIC with mecA gene carriage in coagulase-

negative staphylococci.

. J

Clin. Microbiol,

v. 38, p. 752-754, 2000.

HUSSAIN, Z. et al. Detection of methicillin resistance in primary blood culture isolates of

coagulase-negative staphylococci by PCR, slide agglutination, disk diffusion, and a

commercial method

. J

Clin. Microbiol,

v. 40, p. 2251-2253, 2002.

IEVEN, M. et al. Rapid and economical methods for species identification of clinically

significant coagulase-negative Staphylococci.

J. Clin. Microbiol,

v. 33, p. 1060-1063, 1995.

JAFFE, R.I. et al. Rapid extraction from and direct identification in clinical samples of

Methicilin-resistant Staphylococci using the PCR.

J. Clin. Microbiol,

v. 38, p. 3407-3412,

2000.

JEONG, J. et al. Early screening of oxacillin-resistant

Staphylococcus aureus

and

Stpahylococcus epidermidis

from blood culture.

J. Korean Med. Sci

, v. 17, p. 168-172,

2002.

JONES, R.N. Global aspects of antimicrobial resistance among key bacterial pathogens.

Results from the 1997-1999 SENTRY Antimicrobial Program.

Clin Infect Dis

, v.32 n.2

p.S81-S156, 2001.

JUUTI, K. et al. The

pls

Gene Found in Methicillin-resistant

Staphylococcus aureus

Strains is Common in clinical Isolates of

Staphylococcus sciuri.

J. Clin. Microbiol

, v. 43, p.

1415-1419, 2005.

KAMALESH, M.; ASLAM, S. Aortic endocarditis due to

Staphylococcus capitis

Echocardiography, v. 17, p. 685-687, 2000.

KAWAMURA, Y. et al. Distribuition of

Staphylococcus

Species among human clinical

specimens and emended description of Staphylococcus

caprae

J. Clin. Microbiol

, v. 36, p.

2038-2042, 1998.

KLOOS, W.E.; SCHLEIFER, K.H. Simplified scheme for routine identification of human

Staphylococcus

species.

J. Clin. Microbiol,

v. 1, p. 82-88, 1975.

KLOOS, W.; BANNERMAN, T.L. Update and clinical significance of coagulse-negative

staphylococci.

Clin. Microbiol. Rev,

v. 7, p. 117-140, 1994.

KRAUSE, R. et al. Molecular Typing of coagulase-negative Staphylococcal blood and skin

culture isolates to differentiate between bacteremia and contamination.

Eur. J. Microbiol.

Infect Dis,

v. 22, p. 760-763, 2003.

LAYER, F. et al. Comparative study using various methods for identification of

Staphylococcus

species in clinical specimens.

J. Clin. Microbiol,

v. 44, p. 2824-2830, 2006.

LEIBOVICI, l. et al. Departmental consumption of antibiotic drugs and subsequent

resistance: A quantitative link.

J. Antimicrob Chemoter

v.48, p. 535-540, 2001.

LINDSAY, J.A; RILEY, T.V. Susceptibility to desferrioxamine: a new test for the

identification of

Staphyloccus epidermidis. J. Med. Microbiol.

v. 35, p. 45-48, 1991.

LOUIE, L. et al. Evaluation of a latex agglutination test (MRSA-screen) for detection of

oxacillin resistance in coagulase-negative staphylococci.

J. Clin. Microbiol

, v. 39, p. 4149-

4151, 2001.

MAES, N. et al. Evaluation of a triplex PCR assay to discriminate

Staphylococcus aureus

from coagulase-negative Staphylococci and determine methicilin resistance from blood

culture.

J. Clin. Microbiol

, v. 40, p. 1514-1517, 2002.

MALES, B.M.; BARTHOLOMEW, W.R.; AMSTERDAM, D.

Staphylococcus simulans

septicemia in a patient with chronic osteomyelitis and pyarthrosis.

J. Clin. Microbiol,

21, p. 255-257, 1985.

MARTINEAU, F. et al. Development of PCR Assay for Identification of Staphylococci at

Genus and species Levels.

J. Clin. Microbiol,

v. 39, p. 2541-2547, 2001.

MARSHALL, S. et al.

Staphylococcus aureus

and Coagulase-negative Staphylococci from

Blood stream Infections: frequency of occurrence, antimicrobial susceptibility and

moleuclar (

mecA

) characterization of oxacilin resistance in the SCOPE Program.

Diagn

Microbiol Infect Dis,

v30, p.205-214, 1998.

MATEO, M. et al. Genotypic versus phenotypic characterization whit respect to

susceptibility and identification, of 17 clinical isolates of Staphylococcus lugdunensis, J.

Antimicrobiol Chemother,

v. 56, p. 287-291, 2005.

MINTO, E. et al. Identification and medical importance of coagulase-negative

staphylococci species.

Rev. Paul. Med

, v. 117, p. 175-178, 1999.

MONSEN, T. et al. An inexpensive and reliable method for routine identification of

staphylococcal species.

Eur. J. Clin. Microbiol Infect. Dis

, v. 17, p. 327-335, 1998.

MONZÓN, M. et al. Synergy of different antibiotic combinations in biofilms of

Staphylococcus epidermidis

J. Antimicrobiol Chemother,

48, p. 793-801, 2001.

MORETRO, T et al. Biofilm formation and the presence of the intercellular adhesion locus

ica

among staphylococci from food and food processing environments.

Applied and

Environmental Microbiol

, v. 69, p. 5648-5655, 2003.

NATIONAL COMITEE FOR CLINICAL LABORATORY STANDARDS. (NCCLS)

Methods for Diluition Antimicrobial Susceptibility Tests for Bacteria that grow

Aerobically; Approved Standards

. Sixth Edition. M7-A6. Clinical and Laboratory

Standards Institute, Wayne, PA, 2003

NATIONAL COMITTEE FOR CLINCAL LABORATORY STANDARDS. (NCCLS).

Performance Standards for Antimicrobial Susceptibility Testing.

Fourteenth Informational.

supplement, M100-S14. Clinical and Laboratory Standards Institute, Wayne, PA, 2004.

NUNES, A.P.F. et al. Heterogeneous resistance to vancomycin in

Staphylococcus

epidermidis, Staphylococcus haemolyticus and Staphylococcus warneri

clinical strains:

characterisation of glycopeptide susceptibility profiles and cell wall thickening.

Int. J.

Antim. Agents

, v. 27, p. 307-3015, 2006.

O’GARA, J.; HUMPRHREYS, H.

Staphyloccus epidermidis

biofilms: importance and

implications

. J. Med. Microbiol

, v. 50, p. 582-587, 2001.

OLIVEIRA, D.C.; TOMASZ, A.; LENCASTRE, H. Secrets of success of a human

pathogen: molecular evolution of pandemic clones of meticilin-resistant

Staphylococcus

aureus. The Lancet Infect Dis

, v. 2, p. 180-189, 2002.

PALAZZO, I.C.V.; ARAUJO, M.L.C.; DARINI, A.L.C. First report of vancomycin-

resistant Staphylococci isolated from healthy carriers in Brazil.

J. Clin. Microb

, v. 43, p.

179-185, 2005.

PALAZZO, I.C.V.; DARINI, A.L.C. Evaluation of methods for detecting oxacillin

resistance in coagulase-negative staphylococci including cefoxitin disc diffusion.

FEMS

, v.

257, p. 299-305, 2006.

PATEL, R. et al. Frequency of isolation of

Staphylococcus lugdunensis

among

Staphylococal Isolates Causing Endocarditis: a 20-Year Experience. J. Clin. Microbiol, v.

38, p. 4262-4263, 2000.

PATEL, M. et al. Prevalence of inducible clindamycin resistance among Community and

Hospital-Associated

Staphylococcus aureus

isolates.

J. Clin. Microbiol,

v. 44, p. 2481-

2484, 2006.

PETINAKI, E. et al. Presence of

mec

Genes and Overproduction of Beta-Lactamase in the

Expression of Low-Level Methicilin Resistance among Staphylococci.

Chemotherapy,

48, p. 174-181, 2002.

PFALLER, M.A.; HERWALDT, L.A. Laboratory Clinical and Epidemiological Aspects of

Coagulase-negative Staphylococci.

Clin. Microbiol. Rev,

v. 1, p. 281-299, 1988.

POTTUMARTHY, S.; FRITSCHE, T.R.; JONES, R.N. Evaluation of alternative disk

diffusion methods for detecting

mecA

-mediated oxacillin resistance in a international

collection of staphylococci: Validation report from the SENTRY Antimicrobial

Surveillance Program.

Diag. Microbiol. Infec. Dis,

v. 51, p. 57-62, 2005.

POUTANEN, S.M.; BARON, E. J.

Staphylococcus lugdunensis

: A Notably Distinct

Coagulase-Negative

Staphylococcus. Clinical Microbiology Newsletter,

v. 23, p. 147-150,

2001.

POYART, C. et al. Rapid and Accute Species-Level identification of Coagulase-Negative

Staphylococci

by using the

sodA

Gene as a Target.

J. Clin. Microbiol,

v. 39, p. 4296-4301,

2001.

RAZONABLE, R.R. et al. Vertebral Ostemyelitis and Prosthetic Joint Infection Due to

Staphylococcus simulans

Mayo Clin. Proc,

v. 76, p. 1067-1070, 2001.

RIBEIRO, A. et al. First report of with community-acquired methicillin-resistant

Staphylococcus aureus

in South America.

J. Clin. Microbiol,

v. 43, p. 1985-1988, 2005.

RUHE, J. et al. Non-epidermidis coagulase-negative staphylococcal bacteremia: clinical

predictors of true bacteremia.

Eur. J. Microbiol. Infect. Dis,

23, p. 495-498, 2004.

RUPP, M.E.; ARCHER, G.L. Coagulase-negative staphylococci: pathogens associated with

medical progress.

Clin. Infect. Dis

, v. 19, p. 231-245, 1994.

SADER, H.S. et al. The SENTRY participants Group (Latin America). Four-year

evaluation of frequency of occurrence and antimicrobial susceptibility patterns of bacteria

from bloodstream infections in Latin American medical centers.

Diagnostic Microbiol.

Infect. Dis

, v. 44, p. 273-280, 2003.

SAGINUR, R. et al. Multiple combination bactericidal testing of Staphylococcal biofilms

from implant-associated infections.

Antimicrob. Agents and Chemother,

v. 50, p. 55-61,

2006.

SANTOS, K.R.N. et al. Surgical site infection: rates, etiology and resistance patterns to

antimicrobials among strains isolated at Rio de Janeiro University Hospital

. Infection

, v.

25, p. 217-220, 1997.

SCHULIN, T.; VOSS, A. Coagulase-negative staphylococci as a cause of infections related

to intravascular prosthetic devices; limitations of present therapy.

Clinical Microbiology

and Infection,

7, p. 1-7, 2001.

SCHNITZLER, N. et al.

Staphylococcus lugdunensis:

Report of a Case of Peritonitis and

an Easy-to-Perform Screening Strategy

. J. Clin. Microbiol,

v. 36, p. 812-813, 1998.

SECHI, L.A. et al. Molecular characterization and antibiotic susceptibilities of ocular

isolates of

Staphylococcus epidermidis

J. Clin. Microbiol

, v. 37, p. 3031-3033, 1999.

SHARMA, M. et al. Molecular Analysis of Coagulase-Negative Staphylococcus Isolates

from Blood Cultures: Prevalence of Genotypic Variation and Polyclonal Bacteremia.

CID,

v. 33, p. 1317-1323, 2001.

SILVA, G.D.I. et al. The

ica

Operon and Biofilm Production in Coagulase-Negative

Staphylococci

associated with Carriage and Disease in a Neonatal intensive Care Unit.

Clin. Microbiol

, v. 40, p. 3821-388, 2002.

SIVADON, V. et al. Use of Genotypic identification y sod A Sequencing in a prospective

study to Examine the Distribuition of Coagulase-Negative

Staphylococcus

Species among

Strains Recovered during Septic orthopedic Surgery and Evaluate Their Significance.

Clin. Microbiol,

43, p. 2952-2954, 2005.

SKOW, A et al. Species-level identification of Staphylococcal isolates by Real-Time PCR

and Melt Curve Analysis

. J. Clin. Microbiol

, v. 43, p. 2876-2880, 2005.

STEPANOVIC, S. et al. Evaluation of phenotypic and molecular methods for detection of

oxacillin resistance in members of the

Staphylococcus sciuri

Group.

J. Clin. Microbiol,

44, p. 934-937, 2006.

SWENSON, J.M.; TENOVER, F.C. Results of disk diffusion testing with Cefoxitin

correlate with presence of

mec A

Staphylococcus spp. J. Clin. Microiol,

v. 43, p. 3818-

3823, 2005.

TACCONELLI, E. et al. Glycopeptide resistance among coagulase-negative staphylococci

that cause bacteremia: epidemiological and clinical findings from a case-control study.

Clin. Infect. Dis

, v. 33, p. 1628-1635, 2001.

TENOVER, F.C. et al. For the NCCLS

Staphylococcus

Working Group.

Methods for

Improved Detection of Oxacillin Resistance in Coagulase-negative Staphylococci: Results

of Multicenter Study.

J. Clin. Microbiol,

v. 37, p. 4051-4058, 1999.

VELASCO, D. et al. Evaluation of different methods for detecting methicillin (oxacillin)

resistance in

Staphylococcus aureus. J. Clin. Chem,

55, p. 379-382, 2005.

VUONG, C.; OTTO, M.

Staphylococcus epidermidis

infections.

Microbes and Infection,

v. 4, p. 481-489, 2002.

WEINSTEIN, MP et al. The clinical significance of positive blood cultures in the 1990s: A

prospective comprehensive evaluation of the microbiology, epidemiology and outcome of

bacteremia and fungemia in adults.

Clin Infect Dis

, v. 24, p. 584-602, 1997.

WISPLINGHOFF, H et al. Nosocomial bloodstream infections in pediatric patients in

United States hospitals: Epidemiology, clinical features and susceptibilities.

Pediatr Infect

Dis

v. 22, p. 686-691, 2003.

JUSTIFICATIVA DO ESTUDO_____________________________________________

A rápida emergência e disseminação de bactérias resistentes a numerosos

antimicrobianos têm aumentado nas últimas décadas, principalmente no ambiente

hospitalar, havendo assim uma necessidade de monitorar os microrganismos envolvidos.

A importância dos SCoN como patógenos nosocomiais tem induzido a um maior

interesse na sua caracterização detalhada e no desenvolvimento de métodos mais acurados

para distinguir espécies e para classificá-los epidemiologicamente. Os SCoN possuem alto

índice de resistência a oxacilina, desta forma é importante distinguir entre os isolados

sensíveis e resistentes a oxacilina devido à emergência da resistência a vancomicina pelos

Enterococcus

spp.

e recentemente também pelos

Staphylococcus

spp

O perfil de

multirresistência aos antimicrobianos, entre os SCoN resistentes a oxacilina, refletem o

aumento da pressão seletiva pelo uso indiscriminado de antimicrobianos e confirmam o

papel destes como reservatórios de genes de resistência que podem ser transferidos paras

outras espécies.

A capacidade das bactérias de produzir uma substância chamada adesina

polissacarídica intercelular (PIA), levando a formação de biofilme, representa um

importante fator de virulência em SCoN associado ao uso de biomateriais, contribuindo

assim, para uma maior resistência aos antimicrobianos pela baixa penetração destes no

biofilme.

Devido ao aumento da resistência a oxacilina em SCoN, estudos que melhor

definam técnicas mais sensíveis, específicas e de fácil execução na detecção desta

resistência, se fazem necessários para realizar o correto diagnóstico clínico-laboratorial e

para o controle das infecções hospitalares, bem como a investigação de fatores de

virulência envolvidos neste gênero bacteriano.

OBJETIVOS DO ESTUDO_________________________________________________

OBJETIVO GERAL

• Identificar as espécies de

Staphylococcus

coagulase-negativos

não-epidermidis

(SCoNne) e caracterizar o perfil de susceptibilidade aos antimicrobianos de amostras

provenientes de isolados de hemoculturas de pacientes do Complexo Hospitalar Santa

Casa de Misericórdia de Porto Alegre entre o período de 2002 a 2004.

OBJETIVOS ESPECÍFICOS

• Identificar SCoNne de hemoculturas através de métodos fenotípicos e genotípicos.

• Determinar a susceptibilidade de amostras de SCoNne aos antimicrobianos através do

teste de disco de difusão de acordo com os padrões do CLSI.

•

Determinar e comparar a susceptibilidade de amostras de SCoNne através dos testes de

disco de difusão, ágar diluição e detecção do gene

mecA.

ADBC

•

Analisar a presença dos genes

icaA

icaD

em amostras de SCoNne associadas com a

formação de biofilme.

• Comparar a identificação dos genes

icaA

icaD

de amostras de SCoNne com o teste

qualitativo de formação de PIA em meio de ágar Congo red (CRA).

DELINEAMENTO DO ESTUDO____________________________________________

•

Estudo transversal de amostras consecutivas de hemoculturas com enfoque

diagnóstico.

HIPÓTESES DO ESTUDO__________________________________________________

• O uso do disco de cefoxitina para detecção de resistência a oxacilina em SCoN não-

epidermidis têm correlação com a presença do determinante genético (gene

mec A

•

O método de qualitativo de detecção da presença de biofilme (CRA) tem correlação

com a detecção genotípica dos genes

icaA

icaD

em SCoN não-epidermidis.

ARTIGOS PRINCIPAIS DO ESTUDO________________________________________

ARTIGO I________________________________________________________________

Coagulase-negative staphylococci non-epidermidis: identification and detection of

methicillin resistance

Running tittle: Resistance in staphylococci

Carina Secchi

1 3

Ana Lúcia de Souza Antunes

Leandro Reus Rodrigues Perez

Vlademir Vicente Cantarelli

3,4

Pedro Alves d’Azevedo

Será submetido para publicação no “

Diagnostic Microbiology and Infectious Disease

”.

Pós-Graduação em Ciências Médicas, Fundação Faculdade Federal de Ciências Médicas

de Porto Alegre, Rs, Brasil

Departamento de Microbiologia e Parasitologia, Fundação Faculdade Federal de Ciências

Médicas de Porto Alegre, RS, Brasil

Laboratório Weinmann, Porto Alegre, RS, Brasil

Centro Universitário Feevale, NH, RS, Brasil

Corresponding author:

Prof. Dr. Pedro Alves d’Azevedo

Rua Sarmento Leite 245/211 – Porto Alegre, RS, Brazil

Cep: 90050-170

Fone/Fax: + 55-051- 33039000 -217

e-mail: [email protected]

Abstract

The coagulase-negative staphylococci (SCoN) have emerged as important nosocomial

pathogens, associated with outbreaks and catheter related infections and becoming

important reservoir of genes of resistance. The correct identification of species and the

detection of oxacillin-resistance are not easy task to be made by clinical laboratory, once

there are several different species of coagulase-negative Staphylococci and the expression

of oxacillin resistance is not always homogeneous. The NCCLS (2004) presented a new

methodology to detect, by disk-diffusion agar, the oxacillin-resistance using a cefoxitin

disk (30 µg). The aim of this study was to evaluate the proposed methodology, comparing it

with oxacillin disk (1 µg), agar dilution (MIC of oxacillin) and gene

mecA

detection in

isolates of coagulase-negative

other

than

Staphylococcus epidermidis

(SCoNne). A total of

490 SCoN were evaluated, being 238 SCoNne, with 16 different species. The oxacillin-

resistance was detected in 71% of isolates (

mecA

gene detection by PCR). Comparing the

three methods evaluated (cefoxitin- disk difusion, oxacillin disk-difusion and agar dilution)

with the presence of

mecA

gene, all methods presented 100% fo sensitivity. The specifity of

cefoxitin disk-diffusion was 100% while oxacillin- disk presented a specificity of 91 % and

the agar dilution (oxacillin MIC) presented a specificity of 88%. The cefoxitin disk showed

the same sensitivity with better specificity than oxacillin- disk in the detection of oxacillin-

resistance

mecA

gene mediated in SCoNne isolates. Discrepancies between the oxacillin

disk-difusion or the agar dilution and the gene

mecA

detection were detected in 9 isolates,

all of them belonging to

S. sciuri, S. saprophyticus and S. cohnii cohnii species.

The results

of this study showed a good performance of cefoxitin disk, an easy method to be used in the

clinical laboratories to detect the oxacillin-resistance in Staphylococci.

Key-words: coagulase-negative

Staphylococcus,

cefoxitin, oxacillin,

mecA

gene,

susceptibility diagnostic.

Introduction

Coagulase negative staphylococci (SCoN) are common pathogens of blood stream,

being frequently related to nosocomial infections, especially in neonates and

immunocompromised patients, usually involving medical devices as catheteres and

prosthesis (Rupp & Archer, 1994, Marshall, et al., 1998; Campoccia, et al., 2006). In a

study performed by SENTRY program, in American hospitals, from 1997 to 2001, the

SCoN were between the most common organisms isolated in blood stream infections

(Pottumarthy et al., 2005).

The correct identification of species of SCoN had achieved importance in the

clinical laboratories, considering that several species have been recognized as potential

pathogens, especially in the nosocomial setting (Layer et al., 2006).

Although

Staphylococcus epidermidis

accounts for the majority of infections caused

by SCoN, many others species have been identified in association with human infections,

for example,

S. lugdunensis

has been associated with native valve endocarditis with high

mortality and

S. haemolyticus

is recognized as important nosocomial pathogens that may

exhibit stains multiresistant including reduced susceptibility to vancomycin (Patel et al.,

2000; Couto et al., 2001; Nunes et al., 2005).

Methicillin-resistant staphylococci are considered an important agent of nosocomial

infections and have been recovered frequently in hospitals throughout the world, including

Brazilian Hospitals (Ferreira et al, 2002). In a study performed by Sader et al (2004), the

authors showed that 80% of SCoN recovered from blood In Latin America were oxacillin

resistant. Methicillin-resistant SCoN (MRSCoN) produce an additional penicillin-binding

protein (PBP), named PBP2a. This protein encoded by

mecA

gene has a lower affinity than

PBP2, resulting in resistance to beta-lactamics agents (Chambers, 1997).

The phenotypic expression of methicillin resistance in many strains tend to be

heterogeneous, with levels according to growth conditions and nature of beta-lactamics

agents used (Chambers, 1997). Susceptibility testing by phenotypic methods can be

problematic in the detection of methicillin resistance in SCoN, despite the “Clinical and

Laboratory Standards Institute” (CLSI) standardized recommendations, used in the clinical

laboratories (Chambers, 1997; Palazzo & Darini, 2006). It is known that the heterogeneus

expression of resistance can be problematic to phenotypic methods used in the clinical

laboratories. For this reason, the gene

mecA

detection by PCR is able to detect this

heterogeneous expression and than is considered the gold standard in methicillin resistance

detection in

Staphylococcus spp

. (Skov et al., 2005; Swenson et al., 2005).

To obtain a better accuracy on the detection of this resistance, the NCCLS (2004)

recommended that clinical laboratory should use cefoxitin disk (30

g) tests as a marker for

detection of oxacillin resistance in

Staphylococcus spp.

(Pottumarthy et al., 2005). Several

studies have been performed to evaluate the results obtained with the utilization of cefoxitin

and oxacillin disks and the correlation with the presence of the

mec

A gene in

Staphylococcus

spp. (Fernandes et al, 2005; Swenson et al., 2005; Velasco et al, 2005). The

aim of this study was to evaluate the performance of cefoxitin disk test (30

g), comparing

with oxacillin disk (1

g), agar dilution (MIC of oxacillin) and gene

mecA

detection in

isolates of coagulase-negative

Staphylococcus

non-epidermidis (SCoNne).

Material and methods

Bacterial isolates:

A total of 238 samples of ScoNne were analyzed, starting from a

collection of 490 samples of SCoN of Laboratory of Gram-positive Cocci of the

FFFCMPA, stored in Skim Milk (Difco, Detroit) at temperature of – 20°C. The samples

were obtained of collected blood cultures in a consecutive way, among from 2002 to 2004,

in the Complexo Hospitalar Santa Casa, Porto Alegre, RS, Brasil. The quality control of

tests was done using

Staphylococcus aureus

ATCC 25923,

Staphylococcus aureus

ATCC

33591,

S. epidermidis

ATCC 12228 of the American Type Culture Collection (ATCC).

Identification of isolates

: To identification of the strains to the species level the isolates

were cultured in agar Tryptic Soy Agar (Oxoid, UK) supplemented with 5% sheep blood

for 24hs at 35°C, where colony morphology, hemolysis production and purity were

evaluated. Subsequently, phenotypic tests were evaluated by the conventional method

proposed by Kloss & Bannerman (1994) and modified by Banermann (2003) that consist of

a set of biochemical tests that determine the utilization of coagulase, catalase, alkaline

phospatase, ornithine decarboxylase, urease, PYR (pyrrolidinyl-β-naphthylamide

hydrolysis), acid production from carbohydrates (trehalose, mannitol, mannose, sucrose,

maltose, lactose, cellobiose). Anaerobic growth in thioglicolate and susceptibilities to

novobiocin, polymyxin B, bacitracin, desferrioxamine e fosfomycin using disk diffusion

tests were performed. (Antunes et al.

in press

The samples that presented results variables in the phenotypic tests identification or in

order to confirm less frequent species, they were submitted to an automated method of

identification (Microscan Walkway; Dade Behringer, Deerfield, IL, USA). The automated

results with low percentage in the identification of the species, they were submitted to

determination of the sodA gene by PCR amplification and sequencing with specific primers

according to Poyart et al, (2001).

Disk diffusion test:

A suspension were adjusted to a 0.5 McFarland standard for each

sample to perform the disk diffusion tests on Mueller-Hinton agar plates (Difco,

Laboratories, Detroit, Mich) with cefoxitin (30

g) and oxacillin (1

g) disks (Oxoid,

Basingstoke, UK), according to the criteria recommended by CLSI (2005). The plates were

incubated at 35° C and screened after 24h.

Agar diluition test (MIC) to oxacillin

: A suspension were adjusted to a 0.5 McFarland

standard for each sample, diluted at 1:10 in saline solution and inoculated on Mueller-

Hinton agar plates supplemented with 2% NaCl by using Steers replicator. The

concentrations of 0.125 a 4 µg/mL of oxacillin (Sigma Chemical Co, St. Louis, USA) was

used for determination of MIC oxacillin. The plates were incubated at 35° C and screened

after 24h.

Detection of

mecA

gene (PCR):

Staphylococcal DNA was extracted by guanidine

isothiocyanate solution (Invitrogen, Carlsbad, USA) and the

mecA

gene was detected by

PCR with specific primers: mecA

: 5’ TGG CTA TCG TGT CAC AAT CG, mecA

: 5’

CTG GAA CTT GAG CAG AG (Vannuffel et al, 1998). A positive result was indicated by

the presence of a 310-bp amplified DNA fragment, which was revealed by electrophoresis

on 1.5% agarose gel under ultraviolet light by the addition of ethidium bromide.

Slide latex agglutination test:

Detection of PBP2a was performed by latex agglutination test

Slidex MRSA Detection (bioMérieux, l’Etoile, France) following the manufactures

instructions. This test was performed only for samples that showing discrepant results

between cefoxitin and oxacillin by the proposed tests.

Results

A total of 490 isolates of SCoN were avaliated in the study. From these, 238

(48.5%) were identified as ScoNne. The most frequent organism was

S. haemolyticus

42%

(100/238), followed by

S. hominis-hominis

29.4% (70/238) and

S. warneri

7.5% (18/238).

The prevalence of the species of SCoN non-epidermidis and the presence of

mecA

gene are

showed in Table 1. Different phenotypic methods were employed to the identification of

SCoN, including morphology of the colonies, antimicrobial resistance, hemolysis

production, enzymatic activity in different substrates and acid production from

carbohydrates. The tests were followed by 24h, 48h, 72h to 7 days at 35ºC, identifying 238

strains of SCoNne. The most prevalent specie,

S. haemolyticus,

was easily identified by a

simple scheme using the hemolisis production, PYR test and urea and mannose proves. The

Microscan Walkway system was employed to confirm the biochemical identification of

25% (60/238) strains. In 3% (8/238) of these isolates, the

sodA gene

was also detected.

The

mecA

gene was detected in 71% (169/238) of isolates of ScoNne. Concordance

between cefoxitin disk, oxacillin disk and agar dilution was achieved in 96% (229/238)

strains. However, in 4% (9/238) of isolates discrepancies between the phenotypic methods

and the

mecA

gene detection was observed (Table 2). Disagreement between oxacillin disk

test and

mecA

gene detection was observed in 2.5% (6/238) of the total of isolates

evaluated.

The cefoxitin disk showed both sensitivity and specificity of 100%. The oxacillin

disk also showed a sensitivity of 100%, but a specificity of 91%. The sensitivity of agar

dilution was 100%, with a specificity of 88%. When the results obtained in the disk

diffusion test using cefoxitin or oxacillin and the results of the minimal inhibitory

concentrations of oxacillin obtained by agar dilution are compared, we realize that all of

them presented the same sensibility. The specificity, VPP and VPN, however, the results

were better with the cefoxitin disk (Table 3).

Among the species that showed discrepancies between the tests, susceptibility to

cefoxitin disk with resistance with oxacillin disk was observed in 44% (4/9) isolates of

sciuri

, all of them presenting negative results in PCR for

mecA

gene

Oxacillin resistance

was observed in three of these isolates and oxacillin susceptibility in one of them by agar

dilution test. Resistance to oxacillin was observed in 33% (2/6) isolates of

S. saprophyticus

by agar dilution test. The result of PCR to

mecA

gene was negative in these isolates, which

presented susceptibility to cefoxitin and oxacillin by disk diffusion. Seventy-five percent

(3/4) of the isolates identified as

S. cohnii-cohnii

that

showed not harbour the

mecA

gene by

PCR, had results of oxacillin disk and/or agar dilution in disagreement. Two of these

isolates were resistant to oxacillin by disk and agar diluition and one of them was resistant

only by agar dilution. All of them were susceptible by cefoxitin disk. The results obtained

with others species were in concordance between the methods evaluated (Table 2).

Discussion

The cefoxitin disk test was proposed as an option to the detection of oxacillin

resistance mediated by

mecA

gene, considering that many laboratories do not have the latex

agglutination test available nor a PCR technique either to use in routine. The cefoxitin disk

test was first proposed by Mougeot et al. (2001), who described a sensitivity of 97% in the

detection of oxacillin resistance

mecA

gene mediated in

Staphylococcus aureus.

Earlier

studies point out the cefoxitin disk as a helpful tool in the detection of oxacillin resistance

S. aureus

, with sensitivity of 100% (Felten et al., 2002; Cauwelier et al., 2004; Velasco

et al., 2005; Fernandes et al., 2005). Swenson et al. (2005) compared cefoxitin disk test to

PCR and described high sensitivity (99%) and high specificity (96%) of this method to

predict the

mecA

gene presence in

S. aureus

and ScoN.

Our study showed a sensitivity and specificity of 100% in the cefoxitin disk when

compared to

mecA

gene detection by PCR, with better performance than the others

phenotypic methods evaluated (oxacillin disk and oxacillin MIC). We evaluated in our

study a higher number of isolates of SCoNne than others performed in Brazil and it is

important to consider the high rates of resistance to oxacillin by PCR (71%) in these

isolates, despite the fact that the earlier studies also included isolates of

S. epidermidis

(Ferreira et al., 2003; Caierão et al., 2004; Palazzo & Darini, 2006). Perez et al (in press)

detected the presence of

mecA

gene in 79% of 176 isolates evaluated, including

epidermidis.

In study, between the isolates of SCoNne, 100 isolates were identified as

haemolyticus,

with 91% presenting result of PCR to

mecA

gene positive. These results are

in agreement with the literature that show

S. haemolyticus

and

S. epidermidis

as the most

frequent species associated with antimicrobial agent’s resistance (Ferreira et al., 2002;

Nunes et al., 2005).A study performed by Palazzo & Darini (2006) described a sensitivity

of 92.5% to both cefoxitin and oxacillin disk tests, while describe a specificity of 98.6% to

cefoxitin disk and 96% to oxacillin disk. In this study, six isolates showed a false negative

result in the cefoxitin disk test (five isolates of

S. epidermidis

and one isolate of

S. caprae

Perazzi et al. (2006) showed a sensitivity of cefoxitin disk (84%) lower than that obtained

in the oxacillin disk (87%), in a study performed with isolates of SCoN others than

saprophyticus. The specificity of cefoxitin disk was 100%.

Pottumarthy et al. (2005) demonstrated the presence of 3% of very major errors in

the cefoxitin disk test and 4% in the oxacillin disk test. In our study we only found major

error (false-resistance) with oxacillin disk in 2.5% of isolates, on

S. sciuri, S. saprophyticus

and

S. cohnii-cohnii

species.

Detection of oxacillin resistance in SCoN is a challenge to clinical laboratories due the

fact that a considerable number of false negative results can be attributed to heterogeneous

resistance to oxacillin expressed by this organism (Tenover et al., 1999; Ferreira et al.,

2003; Caierão et al., 2004; Palazzo & Darini, 2006). The cefoxitin disk test is considered a

better predictor for resistance than oxacillin, especially when the heteroresistance to

oxacillin is present. This is explained by the fact that the cefoxitin has a strong ability to

induce the PBP2a and also has a high affinity for PBP4, a protein involved in the resistance

Staphylococcus

spp. Nine isolates showed discrepancies between the results of oxacillin

resistance of phenotypic methods. Several species were involved:

S. sciuri, S.

saprophyticus, S. cohnii-cohnii.

Similar results were

described by Louie et al, (2001),

where species of SCoN others than

S. epidermidis

, like

S. saprophyticus, S. cohnii, S.

warneri, S. capitis, S. lugdunensis

and

S. xylosus

showed discrepancies between phenotypic

and genotypic results.

These organisms, although less frequent in the laboratory routine, could be more

affected by the lower specificity of the disk diffusion test using oxacillin e/or the agar

dilution oxacillin test (Hussain et al., 2000; Louie et al., 2001). According to NCCLS

(2001), the disk diffusion test with oxacillin is not recommended to

S. saprophyticus

, once

the majority of isolates

mecA

negative could express resistance by phenotypic methods.

The isolates of

S. saprophyticus

evaluated in our study showed concordance between

cefoxitin/oxacillin disk diffusion and

mecA

gene detection. The agar dilution, however,

showed a poor concordance with the

mecA

gene, once two isolates were resistant to

oxacillin by agar dilution (MICs de 0.5 µg).

Studies performed to detect resistance in

Staphylococcus spp

. have demonstrated

discrepancies between the phenotypic methods and the gold-standard, especially in ScoN

(Tenover et al., 1999; Ferreira et al., 2003; Palazzo & Darini, 2006). False positive results

(isolates resistant that do not harbor the

mecA

gene) can be associated with the

hiperproduction of β-lactamases, resulting in the hydrolysis of beta-lactamic agent and

changes in the PBPs others than PBP2a (Tenover et al., 1999). Total concordance between

the latex agglutination test for PBP2a and

mecA

gene detection by PCR was observed in

isolates that showed false resistance with the oxacillin disk diffusion or dilution. The

PBP2a test was performed with and without induction according to Louie et al, (2001) and

Hussain et al, (2002), respectively. An identical result was observed with the different

methods. When we analyze the false positive results obtained with the agar dilution (Table

2), we can see that eight isolates showed MICs of 0.5 µg/mL (low level of resistance or

borderline resistance). This strains are characterized by presenting oxacillin resistance

between 0.5 e 2.0

g/mL, near to the breakpoint for resistance (Chambers, 1997; Swenson

et al., 2005).

The species identification by conventional or commercial methods, in addition to

have a low accuracy (50 a 70%), are more troublesome and require more incubation time to

obtain the expected results (Poyart et al, 2001). From the total of isolates included in this

study, 75% (178/238) were identified only by phenotypic methods and 25% by a

commercial method. Molecular methods based on the analysis of products from PCR have

been developed to SCoN identification, presenting more stability and quickness (Poyart et

al, 2001; Fujita et al, 2005). Species more difficult to identify by phenotypic methods or

commercial methods as S. caprae e S. equorum were identified by PCR and sodA gene

sequencing. Although only 3% (8/38) of isolates had been identified by s

odA,

the

concordance between this method and the commercial one was 62.5% (5/8).

In conclusion, despite the phenotypic methods (manual or automated) being

troublesome and time consuming, they are the most used at clinical laboratories considering

that they are, on the other hand, of easy approach and performance. Molecular methods of

identification of SCoN are still restricted to research laboratories and must be employed

specially among less prevalent species.

The cefoxitin disk test (30

g) showed the same sensitivity and better specificity

than the oxacillin disk (1

g) to detection of oxacillin resistance

mecA

gene mediated in

isolates of SCoNne. Despite the best performance of cefoxitin disk the concomitant use of

cefoxitin (30

g) and oxacillin (1

g) could, at moment, be employed in the clinical

laboratory routine, to reduce the mistake in the detection of oxacillin resistance, restricting

the PCR or agglutination test to PBP2a to solve discrepancies between the disk tests.

Acknowledgment:

We are grateful to Laboratory of Gram-positive Cocci of the FFFCMPA team for phenotypic

methods and to Bacteriologia/Biologia Molecular Sections of Laboratório Weinmann for

commercial and molecular tests. This study had the support of Coordenação de Aperfeiçoamento de

Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e

Tecnológico (CNPq), and Fundação Faculdade Federal de Ciências Médicas de Porto Alegre

(FFFCMPA).

References

Antunes ALS, Secchi C, Reiter KC, Perez LRR, Freitas A.L.P, d’Azevedo P.A.

taphylococcus epidermidis

: a simple phenotypic method for identification.

(in press)

Banermann T.

(2003)

Staphylococcus, Micrococcus

and other catalase-positive cocci that

grow aerobically. In: Murray PR, Baron EJ, Jorgensen JH, Pfaller MA and Yolken RH

(Eds).

Manual of Clinical Microbiology

. 8th. Washington, DC:American Society for

Microbiology Press.

Caierão J, Musskopf M, Roesch E, Superti S, Dias C, dAzevedo P.

(2004). Evaluation

of phenotypic methods for methicilin resistance characterization in coagulase-negative

staphylococci (CNS).

J Med Microbiol.

53(Pt 12):1195-1199.

Campoccia D, Montanaro L, Arciola CR

. (2006). The significance of infection, related to

orthopedic devices and issues of antibiotic resistance.

Biomaterials

27:2331-2339.

Cauwelier B, Gordts B, Descheemaeecker P, Van Landuyt H.

(2004). Evaluation of

disk diffusion method with cefoxitin (30

g) for detection of methicilin-resistant

Staphylococcus aureus. Eur J Clin Microbiol Infect Dis.

23:389-392.

Chambers HF.

(1997). Methicilin Resistance in Staphylococci: molecular and biochemical

basis and clinical implications.

Clin Microbiol Rev.

10:781-791

Clinical and Laboratory Standards Institute/NCCLS.

(2005).

Performance standards for

antimicrobial susceptibility testing. Fifteenth informational supplement. CLSI/NCCLS

document M100-S15. Clinical and Laboratory Standards Institute, Wayne, PA.

Couto I, Pereira S, Miragaia M, Sanches IS, Lencastre H.

(2001). Identification of

Clinical Staphylococcal isolates from humans by internal transcribed spacer PCR.

J. Clin

Microbiol

39:3099-3103.

Felten A, Grandry B, Lagrange PH, Casiro I.

(2002). Evaluation of three techniques for

detection of Low Level methicilin-resistant

Staphylococcus aureus

(MRSA); a Disk

Diffusion Method with Cefoxitin and Moxalactam, Vitek 2 System, and the MRSA-Screen

látex Agglutination Test.

J. Clin Microbiol

. 40:2766-2771.

Fernandes CJ, Fernandes LA, Collignon P.

(2005). Cefoxitin resistance as a surrogate

marker for detection the detection of methicilin-resistant

Staphylococcus aureus

Antimicrob Chemother

55:506-510.

Ferreira RBR, Nunes APF, Kokis VM, Krepsky N, Fonseca LS, Bastos MCF, Marval

MG, Santos KR N.

(2002). Simultaneous detection of the

mec A

and ileS-2 genes in

coagulase-negative staphylococci isolated from Brazilian hospitals by multiplex PCR.

Diagn Microbiol Infect Dis.

42:205-212.

Ferreira R, Iorio N, Malvar K, Nunes A, Fonseca L, Bastos C, Santos

KRN (2003).

Coagulase-negative Staphylococci: comparison of phenotypic and genotypic oxacillin

sucseptibility tests and evaluation of the Agar screening test by using different

concentration of oxacillin..

J Clin. Microbiol

, 41: 3609-3614.

Fujita SI, Senda Y, Iwagami T, Hashimoto T.

(2005). Rapid identification of

Staphylococcal Strains from positive-testing blood, culture bottles by internal transcribed

spacer PCR followed by microchip gel electrophoresis.

J. Clin. Microbiol

43: 1149-1157.

Hussain Z, Stoakes L, Massey V, Diagre D, Fitzgerald V, El Sayed S, Lannigan R.

(2000). Correlation of oxacillin MIC with

mec

A gene carriage in Coagulase-negative

Staphylococci.

J Clin Microbiol

, 38:752-54.

Hussain Z, Stoakes L, John MA, Garrow S, Fitzgerald V. (

2002). Detection of

methicilin in primary blood cultures isolates of Coagulase-negative Staphylococci by PCR,

Slide Agglutination, Disk Diffusion, and a commercial method.

J Clin Microbiol

, 40: 2251-

2253.

Kloos, W.; Bannerman, T.L.

(1994). Update and clinical significance of coagulse-

negative staphylococci.

Clin. Microbiol. Rev,

v. 7, p. 117-140.

Layer F, Ghebremedhin B, Moder KA, König W, König B.

(2006). Comparative study

using various methods for identification of Staphylococcus species in clinical specimens.

Clin Microbiol

, 44: 2824-2830.

Louie L, Majury A, Goodfellow J, Louie M, Simor AE.

(2001). Evaluation of a latex

agglutination test (MRSA-screen) for detection of oxavilin resistance in coagulase-negative

staphylococci.

J Clin Microbiol

, 39; 4149-4151.

Mougeot C, Guillaumat-Tailliet J, Libert JM

. (2001). Staphylococcus aureus: nouvelle

detection de la résistance ontrinseque par la méthode de diffusion.

Pathol Biol

. 49:199-204.

Marshall AS, Wilke WW, Pfaller MA, Jones RN.

(1998). Staphylococcus aureus and

Coagulase-Negative Staphylococci from blood stream infections: frequency of occurrence,

antimicrobial susceptibility, and molecular (

mecA

) characterization of oxacillin resistance

in the SCOPE Program.

Diagn Microbiol Infect

Dis,

30: 205-214.

National Committe for Clinical Laboratory Standards.

(2001). Performance standards

for antimicrobial susceptibility testing. Eleventh informational supplement. NCCLS

document M100-S11. National Comitte for Clinical Laboratory Standards, Wayne, Pa.

National Committe for Clinical Laboratory Standards.

(2004). Performance standards

for antimicrobial susceptibility testing. Fourteenth informational supplement. NCCLS

document M100-S14. National Comitte for Clinical Laboratory Standards, Wayne, Pa

Nunes APF, Teixeira LM, Iorio NLP, Bastos CCR, Fonseca LS, Souza-Padrón T,

Santos KRN.

(2006) Heterogeneous resistance to vancomycin in

Staphylococcus

epidermidis, Staphylococcus haemolyticus and Staphylococcus warneri

clinical strains:

characterisation of glycopeptide susceptibility profiles and cell wall thickening.

Int J

Antimicrob Agents

. 27: 307-3015.

Nunes APF, Teixeira LM, Bastos CCR, Silva MG, Ferreira RBR, Fonseca LS, Santos

KRN.

(2005) Genomic characterization of oxacilin-resistant

Staphylococcus epidermidis

and

Staphylococcus haemolyticus

isolated from Brazilian medical centres.

Journal of

Hospital Infection

59:19-26.

Palazzo ICV & Darini ALC.

(2006). Evaluation of methods for detecting oxacillin

resistance in coagulase-negative staphylococci including cefoxitin disc diffusion.

FEMS

Microbiol Lett

, 257: 299-305.

Patel R, Piper KE, Rouse M, Uhl JR, Cockerill III FR, Steckelber JM.

(2000).

Frequency of isolation of

Staphylococcus lugdunensis

among Staphylococcal isolates

causing endocarditis: a 20-years experience.

J. Clin Microbiol

38: 4262-4263.

Perazzi R, Fermepin MR, Malimovka A, García SD, Orgambi M, Vay C A., Torres R,

Famiglietti A MR.

(2006). Accuracy of cefoxitin disk testing fro characterization of

oxacillin resistance mediated by Pecicilin-Binding Protein 2a in coagulase-negative

Staphylococci.

J. Clin Microbiol

44:3634-3639.

Perez LRR, Antunes ALS, Barth AL, d’Azevedo PA.

Variations of agar screen for

detection on methicilin resistance in staphylococci: focus on cefoxitin.

Eur J Clin Microb

Infect Dis (in press)

Pottumarthy S, Fritsche TR, Jones RN

. (2005)

Evaluation of alternative disk diffusion

methods for detecting

mec A

-mediated oxacillin resistance in an international collection of

staphylococci: Validation report from the SENTRY Antimicorbial Surveillance Program

Diagn Microbiol Infect

Dis

. 51:57-62.

Poyart C, Quesne G, Boumaila C, Trieu-Cuot P.

(2001). Rapid and Accute Species-

Level identification of Coagulase-Negative

Staphylococci

by using the

sodA

Gene as a

Target. J. Clin Microbiol 39: 4296-4301.

Rupp ME & Archer GL

(1994). Coagulase-negative staphylococci: pathogens associated

with medical progress.

Clin Infect Dis

, 19:231-245.

Sader HS, Jones RN, Gales A.C, Silva JB, Pignatari AC.

(2004). SENTRY

Antimicrobial Surveillance Program Report: Latin American and Brazilian Results for 1997

trough 2001.

Braz J Infect Dis;

8: 25-79.

Skov R, Syth R, Larsen AR, Frimodt-Moller N, Kahlmeter G

. (2005). Evaluation of

cefoxitin 5 and 10 ug discs for the detection of methicilin resistance in staphylococci.

Antimicrob Chemother

13:1-5.

Swenson JM, Tenover FC and Cefoxitin disk Study Group

. (2005). Results of disk

diffusion testing with Cefoxitin correlate with presence of

mec A

Staphylococcus spp. J.

Clin Microbiol.

43:3818-3823.

Tenover FC, Jones RN, Swenson JM, Zimmer B, McAllister S, Jorgensen JH for the

NCCLS Staphylococcus Working Group.

Methods for Improved Detection of Oxacillin

Resistance in Coagulase-negative

Staphyloccci:

Results of Multicenter Study.

J. Clin

Microbiol

. 37:4051-4058.

Vannuffel P, Gigi J, Ezzedine H, Vandercam B, Delmme M, Wanters G, Gala JL

(1998). Specific detection of methicilin resistant Staphylococcus species by multiplex PCR

J. Clin Microbiol

. 33:2864-2867.

Velasco D, Tomas MM, Cartelle M, Beceiro A, Perez A, Molina F, Moure R,

Villanueva R, Bou G.

(2005). Evaluation of differet methods for detecting methicilin

(oxacillin) resistance in

Staphylococcus aureus. J Antimicrob Chemother.

55: 379-382.

Table 1. Occurence of the mecA gene among 238 SCoNne isolates

Species Occurrence

N %

Isolates mecA Pos

N %

Isolates mecA Neg

N %

S. haemolyticus 100 42.0 91 91.0 9 9.0

S. hominis-hominis 70 29.4 53 76.0 17 24.0

S. warneri 18 7.6 7 39.0 11 61.0

S. capitis-capitis 9 3.7 1 11.0 8 89.0

S. sciuri 9 3.7 1 11 .0 8 89.0

S. saprophyticus 6 2.5 4 67.0 2 33.0

S. hominis novobiosepticus 6 2.5 5 83.0 1 17.0

S. capitis urealyticus 5 2.1 2 40.0 3 60.0

S. cohnii cohnii 4 1.6 0 0. 0 4 100.0

S. xylosus 3 1.3 3 100.0 0 0.0

S. cohnii urealyticus 3 1.3 1 33.0 2 67.0

S. lugdunensis 1 0.4 0 0.0 1 100.0

S. simulans 1 0.4 1 100.0 0 0.0

S. auricularis 1 0.4 0 0.0 1 100.0

S. caprae 1 0.4 0 0.0 1 100.0

S. equorum 1 0.4 0 0.0 1 100.0

Total 238 100 169 71.0 68 29.0

Table 2.Discrepant results between nine SCoNne isolates, mecA and latex (PBP2a) negative, by

phenotypic methods (DD and MIC)

Species Isolate

number

Cefoxitin

Oxacillin

Agar dilution

(MIC µg/mL)

Error

S. sciuri 224 S R 0.5 (R) Major

S. sciuri 247 S R 0.5 (R) Major

S. sciuri 201 S R 0.5 (R) Major

S. sciuri 216 S R 0.25 (S) Major

S. saprophyticus 327 S S 0.5 (R) Major

S. saprophyticus 633 S S 0.5 (R) Major

S. cohnii cohnii 226 S S 0.5 (R) Major

S. cohnii cohnii 244 S R 0.5 (R) Major

S. cohnii-cohnii 605 S R 0.5 (R) Major

R: resistant, S: susceptible

Table 3. Sensitivity, Specificity and positive and negative predictive values for phenotypic methods in

comparison with the results of PCR for detection of oxacillin resistance among SCoNne

DD Cefoxitin

N %

DD Oxacillin

N %

MIC Oxacillin

N %

Sensitivity 169/169 100 169/169 100 169/169 100

Specificity 69/69 100 63/69 91 61/69 88

VPP 169/169 100 169/175 97 169/177 95

VPN 69/69 100 69/69 100 69/69 100

Accuracy 238/238 100 232/238 97 230/238 97

ARTIGO II_______________________________________________________________

Detection of biofilm production in non-epidermidis coagulase-negative Staphylococcus

spp. isolates

Carina Secchi

1,3

Ana Lúcia de Souza Antunes

Leandro Reus Rodrigues Perez

Vlademir Vicente Cantarelli

3, 4

Pedro Alves d’Azevedo

1 2

Será submetido para publicação no “

Journal of Medical Microbiology

”.

Programa de Pós-Graduação em Ciências Médicas da Fundação Faculdade Federal de

Ciências Médicas de Porto Alegre (FFFCMPA), RS, Brasil

1, 2

Departamento de Microbiologia e Parasitologia da Fundação Faculdade Federal de

Ciências Médicas de Porto Alegre (FFFCMPA), RS, Brasil

Weinmann Laboratório de Porto Alegre, RS, Brasil

Centro Universitário Feevale, NH, RS, Brasil

Mail Address:

Prof. Pedro Alves d’Azevedo

Rua Sarmento Leite 245/211 – Porto Alegre, RS, Brazil

Cep [Zip Code]: 90050-170

Phone/Fax: + 55-051- 33039000

E-mail: [email protected].br

Abstract:

The

Staphylococcus

spp. has been related to nosocomial infections and biofilm production

on the surface of medical implants (biomaterials), which may lead to septicemia. Although

the main species involved in the biofilm formation be

S. epidermidis

and

S. aureus

, also

other coagulase-negative

Staphylococcus

spp. (SCoN) may be related. The purpose of this

study was compare the detection of the icaA and icaD genes by PCR in 238 Staphylococcus

coagulase-negative non-epidermidis samples (SCoNne) derived from blood cultures with

biofilm detection by Congo red agar test (CRA). Our study detected the presence of the

icaA

gene in 13 samples involving the species:

S. capitis-capitis, S. capitis urealyticum, S.

hominis-hominis

and

S. caprae.

The

icaD

was not detected in any isolate

The phenotypic

biofilm production test carried out by CRA was positive in only three samples, however,

only two

S. capitis-capitis

samples showed concordance among the two methods evaluated.

Our results showed a low sensitivity among the biofilm detection methods in SCoNne

samples.

Key-words: Biofilm,

Staphylococcus

spp., blood cultures.

Introduction:

The coagulase-negative

Staphylococcus

(SCoN) has become an important cause of

hospital infections, being among the bacteria most frequently isolated in clinical

laboratories (von Eiff et al, 2002).

The SCoN are widely distributed on the human skin surface, constituting the

commensal skin bacteria.

epidermidis

is the species most frequently isolated among the

SCoN, being most commonly related to colonization and infections due to the use of

medical devices like catheters, valves and prostheses (O’Gara & Humphreys, 2001).

Although the

S. epidermidis

and the

S. aureus

cause most of the infections related to

medical implants, also

S. hominis

and

S. haemolyticus

may be related to this type of

infection beside other related species (Cramton et al, 1999; Campoccia et al, 2006).

The bacterium adhesion to the biomaterials surface represents a fundamental step

towards the development of infections related to implants. Among the various mechanisms

involving the bacterium adherence, the production of an extracellular polysaccharide

substance called slime or biofilm seems to have a relevant role in the adhesion and

colonization of artificial materials, becoming the SCoN main virulence factor (Arciola et al,

2001; Arciola et al, 2002). The biofilm is formed in two phases: first step – initial bacterial

attach to the biomaterial being related to a surface cellular protein (autolysin) codified by

the atlE gene, second step – biofilm formation, which includes the cellular aggregation and

the biofilm accumulation in multilayers, resulting in an increased adherence and persistence

on the medical devices surface, which is mediated by the

ica

operon products (O’Gara &

Humphreys, 2001; Moretro et al, 2003).

The

ica

locus activation, containing the

ica

ADBC operon, triggers the polysaccharide

intercellular adhesin synthesis (PIA), the main biofilm component, which consists in a

linear

-1,6 glycosaminoglycan polymer codified by the intercellular adhesion locus and

particularly by the

icaA

gene

When induced isolatedelly, the

icaA

gene expression in only

a low enzymatic activity, but the co-expression of

icaA

with

icaD

genes results in a

significant increase of the enzymatic activity, being reported as the total phenotypic

expression of the capsular polysaccharide (Arciola, et al, 2001). The roles of the

icaB

and

icaC

genes are not well established. Another gene, called

icaR

, may be involved in the

regulation of the structural gene

ica

(O’Gara & Humphreys, 2001). The biofilm formation

may act as a physical barrier to the immune system action and to the antimicrobial agents

(Arciola et al, 2002; Moretro et al, 2003).

The biofilm production by the SCoN may be detected by different methods (Fitzpatrick

et al, 2005). The Christensen method is based on the quantitative measurement of bacterial

adherence to plastic surfaces (Christensen et al, 1985). However, this method ca not to

detect a low biofilm production and the results can be affected by medium variation

(Freeman et al, 1989). Alternative method is the qualitative biofilm detection using the

Congo red agar (CRA), which is a highly nutritive culture medium, able to detect the

production of polysaccharide intercellular adhesin (PIA) through the visualization of color

variations produced by the bacteria in this medium (Freeman et al, 1989). The detection of

the

icaA

and

icaD

genes by PCR, mainly in isolates of

S. epidermidis

and

S. aureus

, has

shown to be a fast and highly specific method in the biofilm detection, which may be used

in the laboratorial routine (Arciola et al, 2001a; Arciola et al, 2002). The correlation

between the detection of

icaA

and

icaD

genes by PCR and the formation of biofilm-positive

colonies in the CRA has been shown in

S. epidermidis

samples

(Arciola et al, 2001).

The treatment of infections related to medical devices may be hampered by the

limitation of the usual antimicrobial agents, which act against the planktonic bacteria (free-

living) and not against bacteria in biofilm. The bacteria in biofilm are intrinsically more

resistant to antimicrobial agents for several reasons, including diffusion limitation, altered

metabolic activity, biofilm formation stages and microenvironmental conditions

(Fitzpatrick et al, 2005).

The purpose of this study was to compare the presence of the

icaA

and

icaD

genes in non-

epidermidis coagulase-negative

Staphylococcus

samples (SCoNne) isolated from blood

cultures with the biofilm detection phenotypic test in CRA.

Material and methods:

Samples:

238 SCoNne samples were evaluated from a collection of 490 CoNS samples of

the FFFCMPA Gram-positive Cocci laboratory, preserved in Skim Milk (Difco, Detroit) at

-20°C. The samples were taken from blood cultures collected in a consecutive manner,

between 2002 and 2004, at the Complexo Hospitalar Santa Casa Porto Alegre, RS, Brazil.

Quality Control:

S. epidermidis

ATCC 35984 was used as positive control and

S. epidermidis

ATCC 12228 was used as negative control.

Bacterial identification:

For the class and species identification, the samples were grown in

Tryptic Soy Agar (Oxoid, UK) supplemented with 5% sheep blood for 24hs at 35°C, after

which the colonial morphology, hemolysis production and purity were observed. In order to

identify the

Staphylococcus

spp. species, manual phenotypic tests were carried out

according to the conventional method proposed by Kloss & Banermann (1994) and

modified by Banermann (2003). Samples not identifiable by this method and less frequent

(rare) species were further submitted to an automated method of identification (Microscan

Walkway; Dade Behringer, Deerfield, IL) and/or to PCR technique with

sodA

gene

sequencing with specific

primers

(Poyart et al, 2001).

Detection of the

icaA

and

icaD

genes through the PCR:

the DNA from the samples was

extracted with guanidine isothiocyanate (Invitrogen, Carlsbad, USA) to lyse the bacteria

followed by ethanol precipitation. The detection of the

icaA

and

icaD

genes was performed

in a multiplex PCR reaction, using the following primers:

icaA

: 5’-

ACAGTCGCTACGAAAAGAAA and 5’ GGAAATGCCATAATGACAAC, with

amplification of 103pb, and

icaD

: 5’-ATGGTCAAGCCCAGACAGAG and 5’-

CGTGTTTCAACATTTAATGCAA, with amplification of 198pb. The primers used to

determine the presence of the

ica

operon,

icaA

and

icaD

genes, were based on the

epidermidis

sequence

The amplification products were visualized under a UV light after

the addition of ethidium bromide following the electrophoresis in agarose gel at 3.0%

(Arciola et al, 2003).

Biofilm production in CRA

: The biofilm production was evaluated through the direct

inoculation of the isolates in CRA. CRA plates were prepared by adding 0.8g of Congo red

and 36g of sucrose (both from Sigma, Missouri, USA) for 11g of BHI agar (Oxoid,

Basingstoke, Hampshire, England). The plates were incubated for 24h at 35°C and,

subsequently, for additional 24h at room temperature. The interpretation of the results was

the following: red or wine colonies were considered as biofilm-negative, black or almost

black colonies were considered as biofilm-positive (Freeman et al, 1989; Arciola et al,

2002).

Results:

A total of 238 SCoNne samples were identified and evaluated including the

following species:

S. haemolyticus

(100/238),

S. hominis-hominis

(70/238),

S. warneri

(18/238),

S. capitis-capitis

(9/238),

S. sciuri

(9/238),

S. saprophyticus

(6/238),

S. hominis novobiosepticus

(6/238),

S. capitis-urealyticus

(5/238),

S. cohnii-cohnii

(4/238),

S. xylosus

(3/238),

S. cohnii-urealyticus

(3/238). Other isolates that presented only one

sample of each species were: S. lugdunensis, S. simulans, S. auricularis, S. caprae and

S. equorum

The primers were evaluating for the amplification of bacterial DNA from 16

SCoNne species. No PCR product was obtained from the

S. haemolyticus, S. warneri, S.

saprophyticus, S. hominis-novobiosepticus, S. cohnii, S. sciuri, S. xylosus, S. lugdunensis, S.

simulans, S. auricularis, S. equorum

samples

However, 13 samples presented a positive PCR result for the

icaA

gene (7

capitis-capitis

samples, 3

S. capitis urealyticum

samples, 2

S. hominis-hominis

samples and

S. caprae

sample) The phenotypic test of biofilm production in the CRA was visualized

in three samples (2

S. capitis-capitis

samples and one

S. warneri

sample), however, only

two of the

S. capitis-capitis

samples showed the

icaA

gene concordance and the presence of

biofilm in CRA (Table 1). The two reference samples ATCC 35984 and ATCC 12228

presented positive (black colonies) and negative (red colonies) results in the CRA,

respectively, as expected.

Discussion:

Bacterial infections related to medical device implants became an important issue in

the modern medicine (Arciola et al, 2002). The use of medical prostheses increase the risk

of infections by commensal skin bacteria, particularly SCoN, where the prosthesis

colonization can occur at the moment of the surgery or in the post-operative period (Frank

et al., 2004). Arciola et al. (2002, 2003) showed 100% of concordance between the biofilm

production, detected in the CRA, and the presence of the

icaA and icaD

genes isolated from

infections caused by

S. epidermidis

associated to biomaterials.

In our study, 13 SCoNne samples presented the

icaA

gene and were identified as

capitis-capitis

S. capitis-urealyticum

S. hominis-hominis

and

S. caprae

, but only two

S. capitis-capitis

samples showed a concordance between the two proposed methods

(presence of

icaA

and characteristic growth in the CRA medium). No sample showed the

presence of the

icaD

gene.

Silva et al (2002), in samples of neonate blood culture, showed that the

icaA, icaB,

icaC

and

icaD

genes were found in

S. epidermidis

. None of them were found in the

S. haemolyticus, S. hominis, S. warneri

and

S. auricularis

species. However, 12 of 29

capitis strains yielded a positive PCR result for the icaC and icaD genes, suggesting that a

homolog of the

S. epidermidis

operon exists in some members of this species. Biofilm

production by CRA was expressed by

S. epidermidis, S. capitis

and

S. hominis

strains.

Also, Frank et al. (2004) showed the presence of the

icaA

gene in samples derived

from materials of medical prostheses involving the

S. epidermidis, S.caprae/capitis, S.

pasteuri

and

S. saprophyticus

species

However, the

icaA

gene was not observed in any

other SCoN species

Allignet et al. (2001) performed the

S. caprae

samples sequencing and

showed the presence of the

icaA, icaB, icaC

and

icaD

genes with 68% of similarity to the

S. epidermidis

and

S. aureus

species

indicating that the biofilm can contribute to the

caprae

virulence, protecting the bacteria against the antimicrobial agents as well as in

epidermidis.

The quantitative evaluation of biofilm formation on a polymer surface was

performed in

S. sciuri

samples, showing that the biofilm formation can be considered a

virulence factor to this bacteria (Stepanovic et al, 2001).

Moretro et al. (2003) detected the presence of biofilm through a quantitative method

in the

S. capitis, S. cohnii, S. epidermidis

and

S. saprophyticus

samples isolated from

industrially processed foods. Although the a correlation between biofilm production and the

presence of the

icaA

gene

not all the SCoN positive for the

ica

operon produced biofilm,

mainly in the case of

S. epidermidis

, indicating that an additional mechanism may be

involved in the biofilm formation. In this same study, the

icaA

gene was partially

sequenced in some

Staphylococcus

spp

species, being found in many clusters. Although

the similarity among the

icaA

sequences

in the different samples, have not always been

consistent in relation to the 16SrDNAs, indicating that the

icaA

gene was horizontally

transferred (Moretro et al, 2003).

According to Gerke et al. (1998), the PIA and the intercellular adherence formation

in vivo

depends on the

icaD

gene

in addition to the

icaA

and

icaC

genes

form a complex

in the bacterial membrane in a coordinate way. Cramton et al (1999) detected the

icaA

gene

among SCoNne like

S. capitis, S. auricularis

and

S. lugdunensis,

showing that the

ica

locus

is preserved in some members of the specie, suggesting that the intercellular adherence is

mediated by the

ica

locus and may be a general phenomenon conserved among

Staphylococcus spp.

In our study, the detection of biofilm by the phenotypic assay (CRA) proved to be

difficult and prone to subjective interpretations, mainly due to the variation of the colors

(red, bordeaux, almost black and black) obtained by directly inoculating the samples onto

the culture medium. To improve the biofilm detection by this method, colonies suspected to

be positive for biofilm production in the original plates, and/or positive for the

icaA

gene,

were subcultured to a new CRA plate, with a standardized 0.5 MacFarland inoculum using

the Steers replicator (Figure 1), which resulted in a better view of colors for reading and

interpretation of results.

In conclusion, the results obtained in this study showed a low sensitivity among the

biofilm detection methods (presence of the

icaA

and

icaD

genes and positive colonies in the

CRA) for SCoNne. In the evaluation of 238 SCoNne samples derived from positive blood

cultures, none of the species showed the presence of the

icaD

gene and only 13 samples,

involving four different SCoNne species, showed the presence of the

icaA

gene. The

primers

used in the genotypic biofilm detection in SCoNne may have contributed to the

low detection rate of these genes, since they were based on sequences found in

epidermidis

, well known biofilm-producing specie.

Despite few studies involving the biofilm detection through the

ica

operon genes

and their products (PIA) in SCoNne species, the presence of the

icaA

gene in

Staphylococcus

species other than

S. epidermidis

and

S. aureus

supports the idea that the

ica

locus may have a general function in this species survival in a variety of environments

(Cramton et al, 1999). Experiments that taking in account the quantitative detection of

biofilm as well as other virulence factors among the SCoNne are presented as alternative

methods of pathogenicity evaluation and must also be investigated.

Acknowledgments:

We are grateful to Laboratory of Gram-positive Cocci of the FFFCMPA team for phenotypic

methods and to Bacteriologia/Biologia Molecular Sections of Laboratório Weinmann for

commercial and molecular tests. This study had the support of Coordenação de Aperfeiçoamento de

Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e

Tecnológico (CNPq), and Fundação Faculdade Federal de Ciências Médicas de Porto Alegre

(FFFCMPA). The authors are grateful to Dra. Kátia Regina Netto dos Santos of the Institute of

Microbiology Professor Paulo Goés of the Universidade Federal do Rio de Janeiro, Brasil, for their

collaboration in kindly providing the S. epidermidis ATCC 35984 strain used as control.

References:

Allignet, J; Aubert, S; Dyke, KGH, Solh, N.

2001. Staphylococcus caprae strains carry

determinants known to be involved in pathogenicity: a gene enconding an autolysin-

binding fivronectin and

ica

operon involved in biofilm formation.

Infect and Immun

69:712-718.

Arciola, CR; Baldassari, L; Montanaro, L

. 2001. Presence of

icaA

and

icaD

genes and

slime production in a collection of Staphylococcal strains from catheter-associated

infections.

J. Clin. Microbiol.

39:2151-2156.

Arciola, CR; Collamati, S; Donati, E; Montanaro, L

. 2001. A Rapid PCR method for

Detection of Slime-producing Strains of

Staphylococcus epidermidis and S. aureus

periprosthesis infections.

Diagn Mol Pathol.

10:130-137.

Arciola, CR; Campoccia, D; Gamberini, S; Cervellati, M; Donati, E.; Montanaro, L.

2002. Detection of slime production by means of an optimized Congo red agar plate test

based on a colourimetric scale in

Staphylococcus epidermidis

clinical isolates genotyped

for

ica

locus.

Biomaterials

, 23:4233-4239.

Arciola, CR; Campoccia, D; Gamberini, S; Donati, ME; Baldassari, L; Montanaro, L

2003. Occurrence of

ica

genes for slime synthesis in a collection of

Staphylococcus

epidermidis

strains from orthopedic prosthesis infections. Acta Orthop Scand. 74:617-621.

Banermann, T.

Staphylococcus, Micrococcus

and other catalase-positive cocci that grow

aerobically. 2003. p. 384-404. In: Murray P.R., Baron E.J., Jorgensen, J. H.; Pfaller, M.A.

and Yolken, R. H. (ed).

Manual of Clinical Microbiology

. 8 ed. American Society for

Microbiology.

Campoccia, D; Montanaro, L; Arciola, CR.

2006. the significance of infection related to

orthopedic devices and issues of antibiotic resistance.

Biomaterials

. 27:2331-2339.

Christensen, GD; Simpson, WA; Younger, JJ; Baddour, LM; Barret, FF; Melton,

DM; Beachey, WH.

1985 Adherence of coagulase-negative Staphylococci to plastic tissue

culture plates: a quantitative model for the adherence of Staphylococci to medical devices.

J. Clin Microbiol

. 22:996-1006.

Cramton, SE; Gerke, C; Schnell, NF; Nichols, WW; Gotz, F.

1999. The intercellular

adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm

formation.

Infect Immun.

57:5427-5433.

Fitzpatrick, F; Humphreys, H; O’Gara, JP.

2005. The genetics of staphylococcal

biofilm formation-will a greater understanding of pathogenesis lead to a better management

of device-related infection?

Clin Microbiol Infection

11:967-973.

Frank, KL; Hanssen, AD; Patel, R.

2004.

icaA

is not a useful diagnostic marker fro

prosthetic joint infection.

J. Clin Microbiol

. 42:4846-4849.

Freeman, DJ; Falkiner, FR; Keane, CT.

1989. New method for detecting slime

production by coagulase negative staphylococci. J Clin Pathol. 42:872-874.

Gerke, C; Kraft, A; Submuth, R; Schweitzert, O.

1998. Characterization of the N-

acetylglucosaminyltranferase activity involved in the biosynthesis of the Staphylococcus

epidermidis polysaccharide intercellular adhesin.

. Biological Chemistry

. 273:18586-18593.

Kloos, WE & Bannerman, TL.

1994. Update on Clinical Significance of Coagulase-

negative Staphylococci.

Clin Microbiol. Rev

. 7:117-140.

Moretro, T; Hermansen, L; Holck, AL; Sidhu, MS; Rudi, K.

2003. Biofilm formation

and the presence of the intercellular adhesion locus ica among staphylococci from food and

food processing environments.

Applied and Environmental Microbiol.

69:5648-5655.

O’Gara, J and Humphreys, H

. 2001.

Staphylococcus epidermidis

biofilms: importance

and implications.

J. Med. Microbial

. 50:582-587.

Poyart, C; Quesne, G; Boumaila, C; Trieu-Cuot, P.

2001. Rapid and Accute Species-

Level identification of Coagulase-Negative

Staphylococci

by using the

sodA

Gene as a

Target. 39(12), 4296-4301.

Silva, GDI; Kantzanou, M; Justice, A; Massey, RC; Wilkinson, AR; Day, NPJ;

Peacock, SJ.

2002. The

ica

operon and biofilm production in coagulase-negative

staphylococci associated with carriage and disease in a neonatal intensive care unit.

J. Clin

Microbiol

40:382-388.

Stepanovic, S; Vukovic, D; Trajkovic, V; Samardzie, T; Cupic, M; Svabic-Vlahovic,

2001. Possibel virulence factors of Staphylococus sciuri.

FEMS Microbiol

Letters

.199:47-53.

Von Eiff, C; Peters, G; Hellmann, C.

2002. Pathogenesis of infections due to coagulase-

negative staphylococci.

The Lancet Infec Diss

. 2:677-685.

Table 1. Occurrence of the

icaA

and

icaD

genes and biofilm production in CRA

among 238

non-epidermidis SCoN samples:

Species No.

icaA/icaD

CRA 24hs CRA 48hs

S. capitis capitis

331 +/- Red Red

S. capitis capitis

381 +/- Red Red

S. capitis capitis

552 +/- Almost Black Black

S. capitis capitis

599 +/- Red Red

S. capitis capitis

601 +/- Red Red

S. capitis capitis

649 +/- Black Black

S. capitis capitis

664 +/- Red Red

S. capitis urealyticus

487 +/- Red Red

S. capitis urealyticus

534 +/- Red Red

S. capitis urealyticus

787 +/- Red Red

S. hominis hominis

671 +/- Red Red

S. hominis hominis

712 +/- Red Red

S. caprae

519 +/- Red Red

S. warneri

558 -/- Bordeaux Almost Black

Figure 1. Congo red agar (CRA) using the Steers’ replicator.

Black colonies are positive and red colonies are negative for biofilm production.

CONSIDERAÇÕES FINAIS________________________________________________

•

As amostras SCoNne avaliadas, foram identificadas na sua maioria, 75%, por

métodos fenotípicos manuais, sendo 25% identificadas e/ou confirmadas por

método automatizado e 3% por método genotípico. As espécies mais

freqüentemente isoladas foram

S. haemolyticus, S. hominis e S. warneri.

•

O uso do disco de cefoxitina mostrou uma sensibilidade e especificidade de 100%

quando comparadas com a detecção do gene

mecA

. Na comparação entre os

métodos de avaliação da resistência a oxacilina, o disco de cefoxitina mostrou a

mesma sensibilidade e superior especificidade que o disco de oxacilina (91%) e ágar

diluição para oxacilina (88%). As taxas de resistência à oxacilina entre os SCoNne

foram de 71% pelo método de PCR, sendo o

S. haemolyticus

a espécie mais

resistente (91%).

•

Os resultados deste estudo mostraram uma baixa sensibilidade entre os métodos de

detecção da formação de biofilme (detecção dos genes

icaA

and

icaD

e colônias

positivas no meio CRA) em amostras de SCoNne.

PERSPECTIVAS__________________________________________________________

•

Nossos resultados demonstraram o bom desempenho do disco de difusão de

cefoxitina,

podendo ser utilizado na rotina laboratorial para avaliar a resistência a

oxacilina, principalmente entre os SCoNne, conforme recomendações do CLSI.

• A baixa correlação dos resultados encontrados na determinação da produção de

biofilme em SCoNne, sugere que mais pesquisas sejam desenvolvidas na busca de

outros métodos de detecção, bem como de novos marcadores de virulência para este

grupo de bactérias.

ANEXO I_________________________________________________________________

Os trabalhos a seguir foram desenvolvidos durante a realização do Mestrado.

Staphylococcus epidermidis: a simple phenotypic method for identification.

Ana Lúcia Souza Antunes

1,2

, Carina Secchi

, Keli Cristine Reiter

, Leandro Reus Rodrigues

Perez

, Ana Lúcia Peixoto de Freitas

, Pedro Alves d’Azevedo

From Fundação Faculdade Federal de Ciências Médicas de Porto Alegre, RS, Brazil

Departamento de Análises, Faculdade de Farmácia, Universidade Federal do Rio Grande do Sul,

Porto Alegre, RS, Brazil

Running title:

Staphylococcus epidermidis

: identification.

Submetido para publicação no jornal “

Journal Medical of Microbiology”

Address reprint request to Profº Pedro Alves d’Azevedo, Microbiologia da Fundação

Faculdade Federal de Ciências Médicas de Porto Alegre – FFFCMPA. Rua Sarmento Leite,

245/211, Porto Alegre, RS, 90050-170, Brazil.

Telefone: (+55) 51 33039000 Fax: (+55) 51 33098810

E-mail: [email protected]

Subject category: Diagnostics, type and identification

Abstract

The emergence of coagulase negative Staphylococcus spp (CoNS) as human pathogens as

well as reservoirs of antimicrobial resistance, increases the necessity of developing reliable methods

for identification of the most frequent species among them, to establish the pathogen-host

relationship. The conventional method proposed by Bannerman (2003) is laborious and thus not

applicable to use in clinical laboratory. Moreover, the available commercial techniques of

automation are expensive and most often provide unreliable results. The aim of this study was to

propose a method easy to perform, associated with low costs and time-consuming for identification

of Staphylococcus epidermidis. At first, 490 CoNS isolates from blood culture were identified by

Bannerman's technique. Distinct approaches resulted in the use of two disks containing each

desferrioxamine and fosfomycin. Considering susceptibility to desferrioxamine, as a major marker,

320 isolates had been selected for further investigation in this study. Bannerman's technique

identified 238 isolates as S. epidermidis, 73 as S. hominis and 9 as others SCoN, while the method

proposed in this study identified 239 S. epidermidis and 76 S. hominis. Both techniques were

compared with the tuf gene species-specific method for S. epidermidis, using Polymerase Chain

Reaction (PCR). Considering the presence of the tuf gene as a gold standard, the sensitivity

presented by Bannerman's and the method here described were 96.3% and 98.3%, respectively. The

positive predictor value of the latter was 99.2%. This method proposed has proved to be a useful

tool for identifying S. epidermidis, the most frequent CoNS isolated from blood cultures in

laboratories of clinical microbiology.

Keywords

: Staphylococcus epidermidis, identification techniques, desferrioxamine, fosfomycin,

coagulase negative Staphylococcus spp.

Abbreviations

: CoNS, Coagulase Negative Staphylococcus spp; PCR, Polymerase Chain Reaction.

Introduction

The genus Staphylococcus currently include about 40 different species (Monsen et al., 1998;

Bannerman, 2003; Cunha et al., 2004). The identification of species among the coagulase negative

Staphylococcus spp (CoNS), is not regularly made in clinical laboratories of microbiology, because

it is expensive, even with automation, and is time-consuming when carried out manually (Edwards

et al., 2001). Historically, only S. aureus was considered pathogenic, but in the last two decades,

CoNS have also emerged as significant pathogens, especially in patients with medical devices,

immunocompromised patients, and premature newborns (Wieser & Busse, 2000). S. epidermidis

appears to be the most frequent isolated species among the CoNS and is responsible for infections

associated with temporary or permanent medical devices (De Paulis et al., 2003). The most

important mechanism of pathogenicity in S. epidermidis is their ability of to form a biofilm

(Ziebuhr et al., 2006).

The emergence of CoNS as pathogens and reservoirs of antimicrobial resistance require fast

and reliable methods for their identification, and to establish the pathogen-host relationship, leading

to a better understanding of the mechanisms of pathogenicity and susceptibility profiles and more

reliable epidemiological surveys (Couto et al., 2001; Kontos et al., 2003).

The conventional method proposed by Kloos & Bannerman (1994) and modified by

Bannerman (2003) appears to be unreliable, and irreproducible in laboratory routine. Furthermore,

commercial identification systems and automated systems are not able to make a reliable distinction

between the different species of CoNS, because of the variable expression of the phenotypic

characters (Couto et al., 2001; Kontos et al., 2003; Caierão et al., 2006). Other tests, such as

enzyme electrophoresis or analysis of cellular fatty acid composition, have also failed to make a

reliable identification (Heikens et al., 2005). Therefore, methods based on sequencing of

Polymerase Chain Reaction (PCR) amplicons were valuated and compared to phenotypic

identifications of CoNS. A number of PCR amplicon-sequencing-based methods for identification

of CoNS have been reported, i.e., targeting the 16S region of the ribosomal RNA, the sodA and tuf

genes. Multiple copies of the 16S rRNA gene are present on the chromosome of most bacteria and

are better conserved than the tuf gene. But the latter is a target with a better discriminatory power to

differentiate related species. Both the sodA and tuf genes are essentially constituents of the bacterial

genome and thus are preferential for identification of Staphylococcus spp (Martineau et al., 2001;

Heikens et al., 2005).

The difficulties to identification of Staphylococcus spp using tests that evaluate acid

production has previously been reported in several works, which evaluated manual and automated

systems (Ieven et al., 1995; Cunha et al., 2004; Caierão et al., 2006). S. epidermidis and S. hominis

presents variable results in traditional biochemical tests and similar phenotypic identification.

Susceptibility to desferrioxamine, besides being of easily performance, has been described as

capable of identification of S. epidermidis (Lindsay & Riley, 1991; Lindsay et al., 1993; Mulder,

1995).

The aim of this study was to propose a method for identification of S. epidermidis combining

accuracy, rapidity and easy to perform, to allow their use in routine laboratories of clinical

microbiology. We used the phenotypic method according to Bannerman (2003) and the tuf gene

assay through PCR to evaluate the accuracy of the approach.

Methods

A total of 490 isolates, from consecutive blood cultures obtained from Jan 2002 to Jul 2004,

were used. The samples were stored in skim-milk at temperature of – 20 ºC at the Laboratory of

Gram-positive Cocci of the FFFCMPA. The quality control of the tests was done using the S.

aureus 25923, S. epidermidis 12228, and S. hominis 27844 of the American Type Culture

Collection (ATCC).

Identification of S. epidermidis: The isolates were cultured in agar supplemented with 5%

sheep blood (Tryptic Soy Agar- Oxoid, Basingstoke, England) for 24 h at 35 ºC, where colony

morphology, hemolysis production and purity were evaluated. Subsequently coagulase and catalase

tests were performed. The method proposed by Bannerman (2003) consist of a set of biochemical

tests that determine the utilization of carbohydrates such as sucrose, trehalose, maltose, mannose,

mannitol, lactose, cellobiose; and production of hemolysis; the activity of pyrrolidonyl arylamidase;

the presence of urease and ornithine decarboxylase; the resistance to novobiocin 5 µg (Oxoid

Basingstoke, England); alkaline phosphatase; and anaerobic growth in thioglycolate. Test readings

were obtained after 24 h, 48 h, and 72 h and in up to 7 days of incubation at 35 ºC. The novobiocin

susceptibility test was performed by disk diffusion in Mueller-Hinton Agar (Oxoid Basingstoke,

England).

Genotypic method through PCR: The detection of the tuf gene was according to Martineau et

al. (1996), using S. epidermidis species-specific primers 5’- ATC AAA AAG TTG GCG AAC CTT

TTC A-3’ and 5’- CAA AAG AGC GTG GAG AAA AGT ATC A-3’. Following amplification, 10

µl of DNA were electrophoreses. The primer sequence was selected because it presents 100%

ubiquity among S. epidermidis (Martineau et al., 1996).

Proposed method for identification of S. epidermidis: The following tests were performed:

susceptibility to desferrioxamine 100 µg (Desferal Novartis, Ciba-Geigy-Sandoz Basileia,

Switzerland), to fosfomycin 200 µg (Oxoid Basingstoke, England) and resistance to polymyxin B

(300 UI Oxoid Basingstoke, England). Using disk diffusion, resistance to polymyxin B, according

to Bannerman (2003), was of inhibition zone <10 mm, and according to Monsen et al. (1998) ≤16

mm. Susceptibility to fosfomycin according to Ieven et al. (1995) and Rosco diatabs diagnostic

(2000) was established as an inhibition zone >30 mm. The disks were prepared using 0.5 g

desferrioxamine diluted in 5 ml of sterile distilled water at a final concentration of 100 mg ml

-1

, and

3 µl of this suspension were used to impregnate the paper disk (Lyndsay & Riley, 1991; Lindsay et

al., 1993). The disks were maintained at –10 ºC for up to 12 months, and consistence of results was

confirmed by duplicate tests performed throughout the period of study. Susceptibility to

desferrioxamine was defined as zone ≥ 20 mm. Those isolates with borderline inhibition values for

desferrioxamine were submitted to identification through automated system MicroScan (Dade

Behring, USA).

Results and Discussion

The 490 samples were identified through the technique proposed by Bannerman (2003). The

use of susceptibility to desferrioxamine, which included all isolates identified as S. epidermidis,

allowed the selection of 320 isolates for the continuation of the study.

Using the tests proposed by Bannerman (2003) in those 320 isolates, 238 S. epidermidis and

73 S. hominis were identified, and nine isolates were classified as other CoNS (Table 1). The same

isolates were tested using the method proposed by this study and evaluating the presence of the tuf

gene for S. epidermidis through PCR. In the genotypic technique, 241 isolates presented the tuf

gene, while the proposed method identified 239 S. epidermidis (Table 2).

Among the 320 CoNS, the tuf gene for S. epidermidis was found in 241 cases, and the

proposed method identified 239 of them. In two isolates (1 S. hominis and 1 S. warneri), fosfomycin

resistance was observed despite the presence of the tuf gene. In 239 isolates identified as S.

epidermidis by the proposed method, 237 presented the tuf gene. On the other hand, four isolates

with the tuf gene were identified as S. hominis.

In the 238 isolates identified as S. epidermidis with Bannerman's method (2003), only 232

presented the tuf gene; therefore, six samples were misidentified. On the other hand, among the 82

isolates identified as S. hominis, nine were also misidentified, since they presented the tuf gene.

Evaluating polymyxin B resistance using two cut-points (Bannerman, 2003 and Monsen,

1998), resistance was detected in 100 and 275 isolates, respectively. Together with the other

biochemical and enzymatic tests, 98 isolates were identified as S. epidermidis according to

Bannerman (2003); among those, 96 isolates presented the tuf gene. It is of worth that 11 isolates

not S. epidermidis by phenotypic tests also presented tuf gene, all of them identified as S. hominis.

On the other hand, the zones proposed by Monsen et al. (1998), in conjunction with other tests

identified 235 S. epidermidis, and the tuf gene were present in 227 of them. All tests for polymyxin

B were done in duplicate, and results were discrepant in 60% of the cases.

Fosfomycin, together with the other tests, showed to be highly sensitive (99.2%) and specific

(96.2%) for the identification of these two CoNS. Susceptibility to fosfomycin was observed in

99.2% (239/241) isolates with the tuf gene and a positive predictor value of 98.8%.

The measure of the susceptibility zone to desferrioxamine showed variations even within the

same species (Table 3). Most isolates (89.7%) presented zones between 25 and 35 mm of wide.

Only three isolates presented a zone of 19 mm, which were identified by automated system

MicroScan as S. warneri (two cases) and S. hominis (one case). In the 320 isolates susceptible to

desferrioxamine, 317 presented a zone >20 mm, this value being set as cut-off point for

susceptibility to desferrioxamine. The three isolates with smaller halos presented a very close

inhibition zone (19 mm). These samples did not present the tuf gene and were submitted to

identification by the automated system MicroScan (Dade Behring, USA), with two being identified

as S. warneri and one as S. hominis. The same isolates had also presented discrepancy in the

biochemical identification and in the tests of urea and mannitol.

Considering the presence of the tuf gene as standard, the values for sensitivity and predictive

positive value were of 98.3% and 99.2% for the method here proposed while for Bannerman's

method (2003) we observed values of 96.3%. The accuracy of the method presented was 98.1%.

The method using desferrioxamine and fosfomycin disk to identify S. epidermidis among the CoNS

showed specificity of 97.5% (Table 4).

CoNS are microorganisms frequently isolated from blood cultures. Since CoNS are the

etiological agents of a series of infectious processes, identification of these microorganisms is

important for the determination of their physiopathological characteristics. Their clinical and

epidemiological importance, have led to the publication of various studies analyzing identification

methods for these bacteria (Ieven et al., 1995; Monsen et al., 1998; Bannerman 2003; De Paulis et

al., 2003). The frequency with which S. epidermidis was found ranges from 43% to 92%, depending

on the geographical region where the study was conducted (Ieven et al., 1995; Couto et al., 2001;

Vuong & Otto, 2002; De Paulis et al., 2003; Ferreira et al., 2003; Spanu et al., 2003; Cunha et

al., 2004; Caierão et al., 2006). In our study, we identified 241 samples with the tuf gene for

S. epidermidis, which corresponds to a prevalence of 49.2 % of all 490 CoNS studied.

Due to the difficulty of identification of non-coagulase positive Staphylococcus many clinical

laboratories don’t distinguing between S. epidermidis and other CoNS. Although the interpretation

of the susceptibility tests independs of this identification, the choice of the antimicrobial agent may

be influenced. For instance, even with susceptibility in vitro, the use of vancomicin is not

appropriate in treating infections due to S. epidermidis; since biofilm formation may protect the

microorganism with failure of treatment. Our proposed method to S. epidermidis identification

proved to be a useful tool. This approach using desferrioxamine and fosfomycin disks is easier,

cheap and showed the same accuracy than the conventional phenotypic method. Therefore, we can

propose our method to the routine of clinical microbiology laboratory.

In the analysis of carbohydrate fermentation we evaluated the relevant data for identification

of S. epidermidis. Fermentation of mannose and threalose have being pointed as important to

identification, but we find that, mannose did not contribute consistently to the identification of S.

epidermidis, since the response was smaller than expected. In the case of threalose, in almost half of

isolates without tuf gene gave positive results. It must be emphasized that Freney (1999) was one

that refers to the possibility of fermentation of threalose by S. epidermidis. Also, in a recent study

Caierão et al. (2006) demonstrated the failure of automated systems to evaluate the fermentation of

mannose and threalose among the CoNS.

We defined the use of Christensen's Urea Agar more appropriate than Rustigian & Stuart's

broth (data not shown). This choice was based on a sharper and faster results and the routine use of

this medium. The totality of S. epidermidis isolates (tuf gene) was positive for urease production

when Christensen's Urea Agar was used.

As regards to the tests of alkaline phosphatase and growth in anaerobiosis (Bannerman's), we

observed that while alkaline phosphatase was simple and easily executed, the visualization of

growth in anaerobiosis is not. The positive predictor and negative predictor values for alkaline

phosphatase were 96.2% and 85.4%, while to growth in anaerobiosis the values were 96.6% and

96.3% respectively. The final method of this work did not elected those two testes, although the

conventional method of Bannerman includes both of them.

Desferrioxamine is a siderophore, unavailable in disks and thus must be prepared (Lindsay &

Riley, 1991). In Lindsay & Riley's study (1991), several inhibition zones were considered to

evaluate the susceptibility to desferrioxamine. Using disks of 100 µg, these authors observed zones

>16 mm, but they concluded that any halo was meaningful. We decided that a zone >20 mm was

more exact. Desferrioxamine is an excellent marker for identification of S. epidermidis when we use

the proposed breakpoint.

About 6% of the cases (20/320) presented a double zone of inhibition, particularly in

S. epidermidis rather than in S. hominis, as previously reported by Monsen et al. (1998). Since the

other proofs indicated S. epidermidis, it was considered that the formation of internal zone should

not be considered at the moment of reading, even when the internal zone was < 20 mm. It was not

in the scope of this study to investigate the causes of this double zone.

Polymyxin B disks were also used for phenotypic identification of S. epidermidis, since this

species is resistant to this antimicrobial. Concording to our results, this variability had been reported

that the reproduction of the disk-diffusion technique is unsatisfactory (Gales et al., 2001; Sejas et

al., 2003). Due this great variability the polymyxin B disks were replaced by fosfomycin ones. This

test turned out to be imperative in the phenotypic sorting of S. epidermidis and S. homins.

Two isolates selected by the desferrioxamine disk, presented resistance to novobiocin, which

led to further analysis, since S. epidermidis and S. hominis are both susceptible to novobiocin. The

subspecies S. hominis subsp. novobiosepticus is an exception, and outbreaks have already been

reported in neonates in Spain (Chaves et al., 2005) and, more recently, in a Hospital Geral de São

Paulo (d’Azevedo et al., 2006). In this case the use of susceptibility testes such as desferrioxamine

(100 µg), fosfomycin (200 µg) and novobiocin (5 µg) disks were finding to be the best way to

identify S. epidermidis.

Based on our results, we proposed a simplified method for identification of S. epidermidis

among the SCoN. The proposed method comprises susceptibility tests to desferrioxamine (≥ 20

mm) and fosfomycin (≥ 30 mm). So, we propose that both disks should be included in the routine

susceptibility tests in laboratories of clinical microbiology (Fig. 1).

Heikens et al. (2005) demonstrated the superiority of the tuf gene for identification of CoNS

species because of its excellent discriminatory power and its high specificity, concerning the ATCC

CoNS samples and the sequences stored in the GenBank. The authors also reported the limited

discriminating power of 16S rRNA sequences for identification of CoNS species.

The use of PCR for the identification of the tuf gene supports the evidence that the proposed

phenotypic characterization can solve the problem of S. epidermidis identification. Until the

moment, all phenotypic techniques were laborious, unsatisfactory and irreproducible. The

sequencing of the tuf gene showed that S. warneri is closely related to S. epidermidis, which may

perhaps account for their occasionally similar phenotypic behavior.

In conclusion, a method using only desferrioxamine and fosfomycin disks showed great

correlation with Bannerman's method and with gen tuf. This simple, low cost system can be a useful

tool for identifying S. epidermidis that today is the most frequently CoNS isolated from blood

cultures in laboratories of clinical microbiology.

Acknowledgements

The authors wish to tank Tiza and Rosângela for their support, bacteriology of the Complexo

Hospitalar Santa Casa de Misericórdia de Porto Alegre (CHSCMPA), Fundação Faculdade Federal

de Ciências Médicas de Porto Alegre (FFFCMPA), Conselho Nacional de Desenvolvimento

Científico e Tecnológico (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível

Superior (CAPES), Brasília, Brazil.

References

Bannerman, T.L. (2003).

Staphylococcus, Micrococcus, and other catalase-positive cocci that

grow aerobically. In PR Murray, E.J., Jorgensen, M.A., Jolken (eds). Manual of Clinical

Microbiology, ASM, Washington, p. 384-404.

Caierão, J., Superti, S., Dias, C.A.G. & d’Azevedo, P.A. (2006).

Automated systems in the

identification and determination of methicillin resistance among coagulase negative staphylococci.

Mem Inst Osvaldo Cruz

101

(3), 277-279.

Chaves, F., Garcia-Álvarez, M., Sanz, F., Alba, C. & Otero, J.R. (2005).

Nosocomial spread of a

Staphylococcus hominis subsp. novobiosepticus strain causing sepsis in a neonatal intensive care

unit. J Clin Microbiol

, 4877-4879.

Couto, I., Pereira, S., Miragaia, M., Sanches, I.S. & Lencastre, H. (2001).

Identification of

clinical staphylococcal isolates from humans by internal transcribed spacer PCR. J Clin Microbiol

, 3099-3103.

Cunha, M.L.R.S., Sinzato, Y.K. & Silveira L.V.A. (2004).

Comparison of methods for the

identification of coagulase-negative staphylococci. Mem Inst Osvaldo Cruz

(8), 855-860.

D’Azevedo, P.A., Monteiro, J., Sales, T., Tranchesi, R., Pignatari, A.C.C. (2006).

Disseminação

nosocomial de Staphylococcus hominis subsp. novobiosepticus com suscetibilidade diminuída à

vancomicina em um Hospital Geral de São Paulo, SP, Brasil. VI Congresso Pan-Americano e X

Congresso Brasileiro de Controle de Infecção e Epidemiologia Hospitalar, Porto Alegre, RS, Brasil.

De Paulis, A.N., Predari, S.C., Chazarreta, C.D., Santoianni, J.E. (2003).

Five-Test Simple

Scheme for Species–Level Identification of Clinically Significant Coagulase-Negative

Staphylococci. J Clin Microbiol

, 1219-1224.

Edwards, K.J., Kaufmann, M.E., Saunders, N.A. (2001).

Rapid and accurate identification of

coagulase-negative Staphylococci by real-time PCR. J Clin Microbiol

, 3047-3051.

Ferreira, R.B.R., Iorio, N.L.P., Malvar, K.L., Nunes, A.P.F., Fonseca, L.S., Bastos, C.C.R.,

Santos, K.R.N. (2003).

Coagulase-Negative Staphylococci: Comparison of Phenotypic and

Genotypic Oxacillin Susceptibility Tests and Evaluation of the Agar Screening Test by Using

Different Concentrations of Oxacillin. J Clin Microbiol

, 3609-3614.

Freney, J., Kloos, W.E., Hajek, V., Webster, J.A. (1999).

Recommended minimal standards for

description of new staphylococcal species. International Journal of Systematic Bacteriology 49,

489-502.

Gales, A.C. Reis, A.O., Jones, R.N. (2001).

Contemporary Assessment of Antimicrobial

Susceptibility Testing Methods for Polymyxin B and Colistin: Review of Available Interpretative

Criteria and Quality Control Guidelines. J Clin Microbiol

, 183-190.

Heikens, E.,Fleer, A., Paauw, A., Florijn, A., Fluit A.C. (2005). Comparison of genotypíc and

phenotypic methods for species-level identification of clinical isolates of coagulase-negative

Staphylococci. J Clin Microbiol

, 2286-2290.

Ieven, M., Verhoen, J., Pattyn, S.R.; Goossens, H. (1995).

Rapid and economical methods for

species identification of clinically significant coagulase-negative Staphylococci. J Clin Microbiol

33, 1060-1063.

Kloos, W.E., Bannerman, T.L. (1994)

. Update on clinical significance of coagulase-negative

staphylococci. Clin Microbiol Rev

, 117-140.

Kontos, F., Petinaki, E., Spiliopoulou, I., Maniati, M., Maniatis, A.N. (2003).

Evaluation of a

novel method base don PCR Restriction Fragment Length Polymorphism Analysis of the tuf gene

for the identification of Staphylococcus species. J Microbiol Methods 55, 465-469.

Lindsay, J.A., Riley, T.V. (1991).

Susceptibility to desferrioxamine: a new test for the

identification of Staphylococcus epidermidis. J Med Microbiol

, 45-48.

Lindsay, J.A., Aravena-Román, M.A., Riley, T.V. (1993).

Identification of

Staphylococcus epidermidis and Staphylococcus hominis from blood cultures by testing

susceptibility to desferrioxamine. Eur J Clin Microbiol Infect Dis 12, 127-131.

Martineau, F., Picardi, F.J., Roy, P.H., Ouellette, M., Bergeron, M.G. (1996). Species-specific

and ubiquitous DNA-based assays for rapid identification of Staphylococcus epidermidis. J Clin

Microbiol

, 2888-2893.

Martineau, F., Picardi, F.J.,Ke, D., Paradis, S., Roy, P.H., Ouellette, M., Bergeron, M.G.

(2001).

Development of a PCR assay for identification of Staphylococci at genus and species levels.

J Clin Microbiol 39, 2541-2547.

Monsen, T., Rönnmark, K.M., Olofsson, C., Wiström, J. (1998).

An Inexpensive and Reliable

Method for Routine Identification of Staphylococcal Species. Eur J Clin Microbiol Infect Dis

327-335.

Mulder, J.G. (1995).

A simple and inexpensive method for the identification of Staphylococcus

epidermidis and Staphylococcus hominis. Eur J Clin Microbiol Infect Dis 14, 1052-1056.

Rosco Diatabs Diagnostic Tablets for identification

(2000).

Guideline A/S Rosco.

Taastrupgaardsvej 3 DK 2630, Taastrup p. 17-31.

Sejas, L.M., Silbert, S., Reis, A.O., Sader, H.S. (2003).

Avaliação da qualidade dos discos com

antimicrobianos para testes de disco-difusão disponíveis comercialmente no Brasil. Jornal

Brasileiro de Patologia e Medicina Laboratorial 39, 27-35.

Spanu, T., Sanguinetti, M., Ciccaglione, D’Inzeo, T., Romano, L., Leone, F., Fadda, G. (2003).

Use of the Vitek 2 system for rapid identification of clinical isolates of staphylococci from

bloodstream infections. J Clin Microbiol

, 4259-4263.

Vuong, C., Otto, M. (2002).

Staphylococcus epidermidis infections (review). Microbes and

Infection 4, 481-489.

Wieser, M., Busse, H.-J. (2000).

Rapid identification of Stphylococcus epidermidis. International

Journal of Systematic and Evolutionary Microbiology

, 1087-1093.

Ziebuhr, W., Hennig, S., Eckart, M., Kränzler, H., Batzilla, C., Kozitskaya, S. (2006).

Nosocomial infections by Staphylococcus epidermidis: how a commensal bacterium turns into a

pathogen. Antimicrobial Agents 285, 514-520.

T Table 1: Results in the biochemical tests of 320 isolates of CoNS susceptible to desferrioxamine.

Species

reaction

mannitol maltose mannose sucrose trehalose lactose cellobiose urea ornithine alkaline p*

S. epidermidis pos 1 234 74 237 7 222 0 238 34 226

n= 238 neg 237 4 164 1 231 16 238 0 204 12

S. hominis pos 2 73 5 73 45 63 0 70 2 9

n= 73 neg 71 0 68 0 28 10 73 3 71 64

other CoNS pos 2 9 7 9 6 9 0 7 4 3

n= 9 neg 7 0 2 0 3 0 9 2 5 6

*alkaline phosphatase

Table 2: Prevalence of S. epidermidis

Identification Method

N / nº total %

Bannerman 238 / 490 48.6

Proposed 239 / 490 48.8

tuf 241 / 490 49.2

Table 3: Behavior of species regarding the desferrioxamine disk (100 µg)

Inhibition zone (in mm)

Species 19-24 25-29 30-35 36-41

S. epidermidis 3 63 158 17

S. hominis 2 21 48 6

S. warneri 2 0 0 0

Total = 320 7 84 206 23

Table 4: Comparison of the two phenotypic methods with the genotypic.

sensitivity specificity PPV*

Bannerman's method 96.3% 92.4% 97.5%

Proposed method 98.3% 97.5% 99.2%

* predictive positive value

Figure 1: Susceptibility test with both disks for identification of S. epidermidis

ANEXO II________________________________________________________________

Evaluation of oxacillin and cefoxitin disks for detection of resistance in

Coagulase Negative Staphylococci

Ana Lúcia Souza Antunes¹ ³

Carina Secchi¹

Keli Cristine Reiter³

Leandro Reus Rodrigues Perez¹

Ana Lúcia Peixoto de Freitas³

Pedro Alves d’Azevedo¹ ²

¹ Programa de Pós-Graduação Ciências Médicas, Fundação Faculdade Federal de Ciências

Médicas de Porto Alegre, RS, Brasil.

² Departmento de Microbiologia e Parasitologia, Fundação Faculdade Federal de Ciências

Médicas de Porto Alegre, RS, Brasil.

³ Departmento de Análises, Faculdade de Farmácia, Universidade Federal do Rio Grande

do Sul, RS, Brasil.

Submetido para publicação no jornal “

Memórias do Instituto Oswaldo Cruz

”.

Corresponding author:

Ana Lúcia Souza Antunes

Faculdade de Farmácia – UFRGS

Av. Ipiranga 2752, sala 302, Porto Alegre, RS, Brasil, 90610-000

Telefone: (+55) 51 33165412 Fax: (+55) 51 33165437

E-mail: [email protected]om

Abstract

Coagulase-negative

Staphylococcus

spp was considered nonpathogenic until the emergence

of its multiresistance and the demonstration of their participation as infectious agents. In

Brazil, oxacillin resistance may be present in over 80% of isolates, thus increasing the use

of vancomycin. Recently the Clinical and Laboratory Standards Institute (CLSI)

standardized a new method to predict oxacillin resistance in the Staphylococcus genus. The

aim of this study was to evaluate the variability among commercial disks of oxacillin (1µg)

and cefoxitin (30µg) widely used in clinical laboratories of microbiology, using oxacillin

MIC as the reference standard. Polymerase Chain Reaction (PCR) assays for the

mecA

gene

were performed in isolates with discrepant results. The use of oxacillin and cefoxitin disks

simultaneously allowed the detection of important differences, particularly, in less frequent

species such as

S. cohnii, S. warneri

and

S. sciuri

, where false resistance was observed. The

cefoxitin disk of brand 2 showed good correlation with the

mecA

gene and oxacillin MIC

(97.8%). One of the critical points in the diffusion disk test is the quality of the disks. The

use of better quality disks, according to CLSI guidelines, associated with molecular

methods lead to results that can define the best antibiotic therapy.

Keywords: CoNS,

mecA

gene, methicillin resistance, cefoxitin, susceptibility tests

Introduction

Coagulase-negative

Staphylococcus

spp (CoNS) were considered nonpathogenic

until recently, when the implication on nosocomial infections and the emergence of

multiresistance changed this picture (Beekmann et al. 2003). Hospital infections caused by

these microorganisms are responsible for high morbidity and mortality rates worldwide.

The use of empirical treatment has not contributed to reduce these infections (Frigatto et al.

2005). The emergence of CoNS populations with heterogeneous resistance to oxacillin led

to a great difficulty to detect then in clinical laboratories (Cauwelier et al. 2004). In Brazil,

oxacillin resistance may be present in over 80% of isolates in some health institutions

(Sader et al. 2001). On this account, vancomycin has been widely used in treating these

infections and it is a major cause for the emergence of glycopeptide-resistant isolates

(Oliveira et al. 2001, Nunes et al. 2006).

Recently, CLSI (2006) standardized a new method to predict resistance in

Staphylococcus

spp mediated by the

mecA

gene, through diffusion test with cefoxitin disk (30µg). Others

studies indicate that this is the best phenotypic test to predict resistance to beta-lactam

agents among CoNS (Felten et al. 2002, Pottumarthy et al. 2005). Despite the CLSI

guidelines, the detection of oxacillin resistance through phenotypic methods remains a

challenge for clinical laboratories of microbiology (Sejas et al. 2003). Several errors was

observed among the laboratories that participated in the Antimicrobial Surveillance

Program (SENTRY), suggesting non-observance of the interpretation criteria currently

recommended (Mendes et al. 2003). The quality of the antimicrobial disks affected the

results, particularly failing in detect heteroresistance, what is especially importat in the case

of oxacillin and cefoxitin, which predict susceptibility to a large group of antimicrobial

agents (Sejas et al. 2003).

The aim of this study was to evaluate two brands of oxacillin (1µg) and cefoxitin

(30µg) disks, commonly used in clinical laboratories of microbiology.

Materials and methods

1-Isolates - CoNS isolates from blood cultures, from the collection of the

Laboratory of Gram-positive Cocci of the FFFCMPA, where were maintained in “Skim-

Milk” (Difco, Detrot) at -20°C. Strains of

Staphylococcus aureus

ATCC 25923 (susceptible

to oxacillin and penicillin) and ATCC 33591 (resistant to oxacillin and penicillin) were

used as quality control.

2-Bacterial identification - The species identification was performed with the

combination of a group of laboratory tests: colony morphology; oxygen requirement;

susceptibility to novobiocin (Oxoid, UK), fosfomycin (Oxoid, UK), and desferrioxamine

(Desferal, Ciba Geigy, Switzerland); enzymatic activity of coagulase (Laborclin, Brazil),

catalase, alkaline phosphatase (phenolphthalein diphosphate, Sigma-Aldrich, Germany),

ornithine decarboxilase (Oxoid,UK), urease (Oxoid,UK) and PYR (pyrrolidinyl

arylamidase, Probac, Brazil); hemolysis production in agar supplemented with sheep blood

at 5% (Trypticasein agar, Oxoid,UK); and acid production from carbohydrates: trehalose

(Sigma-Aldrich, Germany), mannitol (Nuclear, Brazil), mannose (Vetec, Brasil), sucrose

(Vetec, Brasil), maltose (Sigma-Aldrich, Germany), lactose (Vetec, Brasil), and cellobiose

(Sigma-Aldrich, Germany).

3-Susceptibility test -

Oxacillin (1µg) and cefoxitin (30µg) disks from two different

brands widely used in clinical microbiology laboratories were tested. Strains were

cultivated in agar supplemented with sheep blood at 5% (Trypticasein agar - Oxoid, UK)

for 24h and a 0.5 Mcfarland standard suspension was prepared for each sample. The disks

diffusion tests were performed by using Mueller Hinton (Oxoid, UK) agar plates. The disks

were distributed maintaining a distance of 30 mm from one to another and of 15 mm from

the plate border. The diameters of the inhibition zones were interpreted according to the

criteria recommended by the CLSI. Mueller-Hinton agar plates (Oxoid, UK) supplemented

wiyh 2% NaCl and concentrations of 0.125 to 4 µg of oxacillin (Sigma Chemical

Company, St. Louis, MO) was used for determination of MIC for oxacillin. Steers

replicator was used to inoculate the plates that were incubated at 35ºC and screened after

24h. The presence of

mecA

gene was checked through the technique of Polymerase Chain

Reaction (PCR), according to Bignardi (1996). MRSA-slidex Latex test (bioMèrieux,

Marcy-I’Étoile, France) according to Chambers (1997) was also performed to verify

discrepant results between the disk diffusion and the MIC.

Results

A total of 302 coagulase-negative

Staphylococcus

spp. isolates were studied. Table

1 shows the distribution and resistance in each species and the table 2 shows the

percentages of oxacillin and cefoxitin resistance observed with the disks of different brands

and the percentage of oxacillin resistance MIC.

The determination of oxacillin MIC showed results that are consistent with

resistance in 91.7% (277/302) isolates. Such resistance was detected by oxacillin disk of

brand 1 in 239 cases (79.1%) and of brand 2 in 273 cases (90.4%). Using cefoxitin disks,

we observed that brand 1 showed similar results in only 149 cases (49.3%) and brand 2 in

264 cases (87.4%). The disks of brand 2 showed good correspondence between oxacillin

MIC and disk diffusion tests with both substrates (98.5% for the oxacillin disk and 97.8%

for the cefoxitin disk). However, brand 1 showed correspondence for oxacillin in 86.3% of

the isolates and in only 55.0% for cefoxitin.

Disks of oxacillin and/or cefoxitin of brand 2 failed in 13 situations, 11 cases with

MIC resistant e two susceptibles. To elucidate these results, we performed MRSA Latex

test and search the presence of

mecA

gene by PCR (Figure 1). Both tests were positive in 4

cases and negative in the other 9. Almost half of the cases (6/13) were identified as

S. sciuri

(Table 3).

Among isolates with oxacillin MIC and

mecA

gene not concordant, we observed

concordance with gene and disks of oxacillin in three cases and disks of cefoxitin in eigth

out of nine cases (Table 3).

Discussion

Detection of oxacillin resitance among CoNS isolates is dificult, mainly because it

is often heterogeneous (Chambers 1997). To overcome this problem, different methods

have been used. Several studies have demonstrated that PCR is a sensitive method;

however, most laboratories are not in a position to perform the test. Phenotypically, none of

the individual tests or combinations were able to detect all methicillin-resistant strains.

Due to the emergence of vancomycin resitance, used in oxacillin resistant isolates, it

is essencial that clinical laboratories can distinguish between oxacillin-susceptible and

oxacillin-resistant CoNS strain. Recently the CLSI advises the use of disks of cefoxitin as a

better predictor of

mecA

gene-mediated resistance in staphylococci species. Cefoxitin is a

stronger inducer of the expression of penicillin-binding protein 2a (PBP2a). Several

investigators reported that cefoxitin disk diffusion tests correlate better with the presence of

mecA than do the results of disk diffusion tests using oxacillin. Our results highlight the

importance of testing the oxacillin disks concomitant with cefoxitin disks of excellent

quality, and to make PCR when there is discrepancy.

In disk diffusion tests, the main variable not directly controled by the laboratory is

the quality of the disk. Since disk diffusion test with cefoxitin in considered to be a good

test to discriminate between resistant and susceptible isolates, laboratory is dependent of

the quality of the disk, and so, it is essencial to recopgnize that not ever they are confiable.

The most frequent CoNS species found was

S. epidermidis

, with 157 isolates (52%),

followed by

S. hominis

(56 isolates; 18.5%),

S. haemolyticus

(52 isolates; 17.2%),

S. sciuri

(10 isolates; 3.3%) and

S. warneri

(9 isolates; 3%); other species were present at a lower

rate. Concerning to oxacillin MIC, the percentage of resistance in the 3 prevalent species

was very similar, about 90%.

It is important to point out that oxacillin tests were similar with both commercial

disks, while cefoxitin results showed a great difference between the two brands. Resistance

results of oxacillin MIC and diffusion were concordant in 86.3% with oxacillin disks, and

54.2% with cefoxitin, showing a great variability among cefoxitin commercial disks.

Considering that the treatment of infections caused by

Staphylococcus

genus depends

primarily on determining whether the bacteria is a methicillin resistant

Staphylococcus

spp

(MRS) or not (Chandran & Rennie 2005), and that this is determined by the result of

susceptibility to oxacillin and cefoxitin, the high variability of the tests may lead to an

inadequate therapy. A study in the United States reported a mortality rate of 17.5% in adult

patients with bacteraemia, while patients receiving adequate antimicrobial therapy had a

lower mortality rate (Weinstein et al. 1997). False-positive resistance results account for

increased costs regarding additional clinical work, request of more cultures, and

unnecessary use of antimicrobials like vancomycin (Chandran & Rennie 2005).

The brands of the disks used for the susceptibility tests in this study are among those

most frequently used in the microbiology laboratories. It was already pointed that brand 1 is

cheaper but less reproductible (Sejas et al. 2003), while brand 2 is significantly more

expensive but with a better performance (Skov et al. 2005).

Most of the isolates (85.7%) in which there were similar results among all methods,

presented a high oxacillin MIC (≥ 4 µg/ml), making its detection easier than for isolates

with MIC values close to susceptibility levels. However, even in isolates with a high MIC

of 2 µg/ml, there was discrepancy: among 253 isolates, the oxacillin disk of brand 1

displayed less sensitivity (86.6%), than brand 2 (98.8%).The discrepant results were much

greater with cefoxitin disks, as brand 1 failed to detect 96 (34.7%) cases of resistance

detected by brand 2.

In cases of resistance with MIC ≤ 0.5 µg/ml (18 cases), oxacillin disk of brand 1

detected 55.5% of the cases, while brand 2 detected all cases. Cefoxitin disks showed a

greater discrepancy between the brands; even considering the superior results of brand 2

had in comparison to brand 1 (38% greater).This percentage is quite smaller than expected.

There was a total agreement between MIC results and disk test of brand 2 in

susceptible isolates. On the other hand, with brand 1 there were major discrepancies of false

resistance: 40% with oxacillin disks and 20% with cefoxitin disks. Even if these results do

not lead to a treatment failure, the unnecessary use of drugs other than the beta-lactam

antimicrobials, may lead to a increase of resistance.

In concordance to CLSI guidelines and the results of other studies (Swenson &

Tenover 2005, CLSI 2006), the

mecA

gene was not detected in seven isolates resistant to

oxacillin by the disk diffusion test. The cefoxitin disk showed greater sensitivity in these

isolates, an evidence of a greater correlation of this substrate and the presence of the gene.

Most of these isolates were of

S. sciuri

As the

mecA

gene is detected in most of the MRS, this is considered the best method

of resistance detection, although discrepancies have already been reported, particularly in

CoNS isolates (Swenson & Tenover 2005, Darini & Palazzo 2006). Isolates with absence

of the

mecA

gene and MIC for oxacillin >0.5 ug/ml had controversial results in disk

diffusion tests. For such uncommon staphylococcal

species as

S. cohnii cohnii

and

warneri

, this is not a surprise (Darini & Palazzo 2006, Hussain et al. 2000). Oxacillin

resistance in the absence of the

mecA

gene may be due to overproduction or overexpression

of penicillinase, or alteration of other PBPs (Caierão et al. 2004).

The disk diffusion test proposed by Kirby-Bauer in 1966 is one of the most popular

methods used in brazilian clinical laboratories. In this test the quality of the disks is crucial

(Sejas et al. 2003). Our study indicated that the use disks of good quality (brand 2) and

antimicrobial susceptibility test according to CLSI led to a reliable result, although in a few

cases only one of the disks had provided the adequate response.

In our study, the discrepancy of MIC and oxacillin disks was detected in less

frequent CoNS, showing that these species present a certain difficulty to express resistance

to oxacillin, as yet dercribed (Hussain et al. 2000; Skov et al. 2005).

Also, Frigatto et al. (2005) obtained discrepant results between oxacillin and

cefoxitin resistance using the disk diffusion method among S. epidermidis. They

emphasized the importance of testing both disks concomitantly and using molecular

techniques for confirmation of results. In our study, cefoxitin disks (brand 2) showed a

better concordance with presence of

mecA

gene (PCR) than oxacillin disks, hence the

importance of performing tests using both disks.

Although no technique alone, shows 100% of sensitivity and specificity to detect

oxacillin resistance among CoNS, the combination of disk diffusion and oxacillin MIC can

reduce errors in the detection of such resistance and while molecular techniques are suitable

for confirmation of results (Skov et al. 2005).

Microbiology laboratories require rapid, sensitive and specific techniques to

perform susceptibility tests. In the last decades, new molecular methods have been

developed and introduced in clinical laboratories of microbiology to improve the credibility

of these tests. However, for most clinical laboratories these techniques are still very

expensive and susceptibility by disk-diffusion tests is the most common method used. To

ensure the phenotypic results that will guide the antimicrobial therapy we must use

antibiogram disks of excellent quality.

Acknowledgments

The authors wish to thank the technical team of the Laboratory of Gram-positive

Cocci of the FFFCMPA. This study was supported by the following agencies: Coordenação

de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de

Desenvolvimento Científico e Tecnológico (CNPQ), Faculdade de Farmácia da

Universidade Federal do Rio Grande do Sul (UFRGS), and Fundação Faculdade Federal de

Ciências Médicas de Porto Alegre (FFFCMPA).

100

References:

Beekmann SE, Diekema DJ, Chapin KC 2003. "Effects of rapid detection of bloodstream

infections on length of hospitalization and hospital charges.

Journal of Clinical

Microbiology

41(7): 3119-25.

Bignardi GE, Woodford N, Chapman A, Johnson AP, Speller DC 1996. Detection of the

mecA

gene and phenotypic detection of resistance in

Staphylococcus aureus

isolates

with borderline or low-level methicillin resistance.

Journal Antimicrobial

Chemotherapy

37: 53-63.

Caierão J, Musskopf M, Superti S, Roesch E, Dias CG, d'Azevedo PA 2004. Evaluation of

phenotypic methods for methicillin resistance characterization in coagulase-negative

Staphylococci (CNS).

Journal of Medical Microbiology

53: 1195-1199.

Cauwelier B, Gordts B, Descheemaecker, Van Landuyt H 2004. Evaluation of a disk

diffusion method with cefoxitin (30µg) for detection of methicillin-resistant

Staphylococcus aureus.

European Journal of Clinical Microbiology

6(5): 389-92.

Chambers HF 1997. Methicillin resistance in Staphylococci: molecular and biochemical

basis and clinical implications.

Clinical Microbiology Rev

10: 781-791.

Chandran AU, Rennie R 2005. Routine antimicrobial susceptibility testing of coagulase-

negative Staphylococci isolated from blood cultures: is it necessary?

Clinical

Microbiology and Infectious Diseases

11(12): 1037-40.

Clinical and Laboratory Standards Institute (CLSI/NCCLS) 2006. Performance Standards

for Antimicrobial Susceptibility Testing - Sixteenth Informational Supplement M1000-

S16. S, Wayne, PA, USA.

Darini ALC, Palazzo ICV 2006. Evaluation of methods for detecting oxacillin resistance in

coagulase-negative Staphylococci

including cefoxitin disc diffusion.

Federation of

European Microbiological Societies

257: 299-305.

Felten A, Grandry B, Lagrange PH, Casin I 2002. Evaluation of three techniques for

detection of low-level methicillin-resistant

Staphylococcus aureus

(MRSA): a Disk

Diffusion Method with cefoxitin and moxalactam the Vitek 2 System, and the MRSA-

Screen Látex Agglutination Test.

Journal of Clinical Microbiology

40(8): 2766-2771.

Frigatto EAM, Machado AMO, Pignatari ACC, Gales AC 2005. Is the cefoxitin disk test

reliable enough to detect oxacillin resistance in coagulase-negative Staphylococci?

Journal of Clinical Microbiology

43: 2028-2029.

Mendes ER, Reis AO, Gales AC, Jones RN, Sader HS 2003. Ability of Latin America

laboratories to detect antimicrobial resistance patterns: experience of the SENTRY

Antimicrobial Surveillance Program (1997-2000).

Brazilian Journal Infectious

Diseases

7(5): 282-9.

101

Hussain Z, Stoakes L, Massey V, Diagre D, Fitzgerald V, Sayed S, Lannigan R 2000.

Correlation of oxacillin MIC with

mecA

carriage in coagulase-negative Staphylococci.

Journal of Clinical Microbiology

38(2): 752-754.

Nunes APF, Teixeira LM, Iorio NLP, Bastos CCR, Fonseca LS, Souto-Padrón T, Santos

KRN 2006. Heterogeneous resistance to vancomycin in

Staphyloccus epidermidis

Staphylococcus haemolyticus

and

Staphylococcus warneri

clinical strains:

characterization of glycopeptide susceptibility profiles and cell wall thickening.

International Journal of Antimicrobial Agents

27: 307-315.

Oliveira GA, Dell'Aquila AM, Masiero RL, Levy CE, Gomes MS, Cui L, Hiramatsu K,

Mamizuka EM 2001. Isolation in Brazil of nosocomial

Staphylococcus

aureus

with

reduced susceptibility to vancomycin.

Infection Control and Hospital Epidemiology

22(7): 443-448.

Pottumarthy S, Fritsche TR, Jones RN 2005. Evaluation of alternative disk diffusion

methods for detecting

mecA

-mediated oxacillin resistance in an international collection

of Staphylococci: validation report from the SENTRY Antimicrobial Surveillance

Program.

Diagnostic Microbiology and Infectious Disease

51(1): 57-62.

Sader HS, Gales AC, Pfaller MA, Mendes RE, Zocolli C, Barth AL, Jones RN 2001.

Pathogen frequency and resistance patterns in Brazilian hospitals: summary of results

from three years of the SENTRY Antimicrobial Surveillance Program.

Brazilian

Journal Infectious Diseases

5(4): 200-14.

Sejas LM, Silbert S, Reis AO, Sader HS 2003. Avaliação da qualidade dos discos com

antimicrobianos para testes de disco-difusão disponíveis comercialmente no Brasil.

Jornal Brasileiro de Patologia e Medicina Laboratorial

39(1): 27-35.

Skov R, Smyth R, Larsen AR, Frimodt-Møller N, Kahlmeter G 2005. Evaluation of

cefoxitin 5 and 10µg discs for the detection of methicillin resistance in Staphylococci.

Journal of Antimicrobial Chemotherapy

55: 157-161.

Swenson JM, Tenover FC 2005. Results of disk diffusion testing with cefoxitin correlate

with presence of

mecA

Staphylococcus

spp.

Journal of Clinical Microbiology

43(8):

3818-3823.

Weinstein MP, Towns ML, Quartey SM, Mirret S, Reimer LG, Parmigiani G, Reller LB

1997. The clinical significance of positive blood cultures in the 1990s: a prospective

comprehensive evaluation of the microbiology, epidemiology, and outcome of

bacteremia and fungemia in adults.

Clinical Infectious Diseases

24(4): 584-602.

102

Table 1: Prevalence and oxacillin MIC for each Staphylococcus spp

Total % resistance

Species n % (MIC)

S.epidermidis 157 52 94.2

S.hominis 56 18.5 94.3

S.haemolyticus 52 17.2 94.1

S.saprophyticus 6 2.0 83.3

S.sciuri 10 3.3 90.0

S.simulans 3 1.0 66.6

S.warneri 9 3.0 75.0

S.xylosus 2 0.7 100

S.capitis capitis 3 1.0 66.6

S.capitis ureolyticus 1 0.3 0.0

S.cohnii cohnii 2 0.7 50.0

S.cohnii urealyticum 1 0.3 100

Table 2: Resistance of coagulase-negative Staphylococcus spp

Resistance

Tested disk n / total %

Oxacillin, brand 1 239 / 302 79.1

Oxacillin, brand 2 273 / 302 90.4

Cefoxitin, brand 1 149 / 302 49.3

Cefoxitin, brand 2 264 / 302 87.4

Oxacillin MIC 277 / 302 91.7

Table 3: Results of susceptibility tests with brand 2 disks, discordant from oxacillin MIC

Isolates Gene MIC Oxacillin Cefoxitin

Species

mecA µg/ml

708 positive >4 S R

S.epidermidis

328 positive 0.5 S R

S.haemolyticus

605 positive 1.0 R S

S.haemolyticus

244 positive 0.25 R S

S.saprophyticus

322 negative >4 S S

S.epidermidis

226 negative 0.5 R S

S.cohnii cohnii

327 negative 0.5 R S

S.warneri

400 negative 0.5 S S

S.sciuri

201 negative 0.5 R S

S.sciuri

216 negative 0.5 R S

S.sciuri

202 negative 1.0 R S

S.sciuri

235 negative 1.0 R S

S.sciuri

229 negative 0.25 R S

S.sciuri

R = resistant; S= susceptible

103

Figure 1: PCR detection of

mecA

gene of 4 isolates with discrepancy regarding oxacillin

disk. Lane 1-(MW) = molecular size markers (λ 100 bp); lane 2-(CP) = positive controls:

310-bp band obtained with DNA from

S. aureus

reference strain ATCC 33591; isolates:

322 – absence of band with DNA from

S. epidermidis

; 328 - 310-bp band obtained with

DNA from

S. haemolyticus

; 400- absence of band with DNA from

S. sciuri

; 708 - 310-bp

band obtained with DNA from

S. epidermidis.

104

ANEXO III_______________________________________________________________

105

Detection of biofilm production in Staphylococcus spp. isolates by the Congo red agar

test

Ana Lúcia Souza Antunes *’ **

Leandro Reus Rodrigues Perez *

Carina Secchi *

Keli Cristine Reiter **

Letícia Filippon **

Paula Eidt Fornari **

Ana Lúcia Peixoto de Freitas **

Pedro Alves d’Azevedo *

* Programa de Pos Graduação em Ciências Médicas e Departamento de Microbiologia

e Parasitologia, Fundação Faculdade Federal de Ciências Médicas de Porto Alegre, RS,

Brasil.

** Departmento de Análises, Faculdade de Farmácia, Universidade Federal do Rio

Grande do Sul, Porto Alegre, Brasil.

Financial support: CAPES, CNPQ, UFRGS, FFFCMPA

Submetido para publicação no “

Memórias do Instituto Oswaldo Cruz

”.

Corresponding author:

Ana Lúcia Souza Antunes

Faculdade de Farmácia – UFRGS

Av. Ipiranga, 2752,sala 302, Porto Alegre, RS, Brasil, 90610-000

Telefone:(+55) 51 33165412 Fax: (+55) 51 33165437

E-mail: a[email protected]

106

Abstract

Staphylococci

are an increasing cause of bloodstream infections associated with medical

devices. The formation of biofilm, or slime, on the surface of biomaterials, required for the

establishment of infection, has also led to an increase in antimicrobial resistance. This study

evaluated the formation of biofilm in 28 isolates obtained from catheters and blood cultures

using evaluation of the phenotypic appearance of colonies in Congo red agar (CRA).

Overall, sixteen isolates (57.2%) were considered as biofilm producers. Among

S. aureus

isolates,

43.8% were considered as biofilm producers (7/16), while 12

S. epidermidis

(66.6%) were positive. Greater antimicrobial resistance was observed among biofilm-

producing

S. epidermidis

isolates, differently from

S. aureus

, in which producers of this

virulence factor showed less resistance than nonproducers. The use of CRA proved to be

practical and easily to perform in the Laboratory of Clinical Microbiology. However, a

larger number of isolates must be studied to prove its effectiveness and thus be used in

laboratory routines.

Keywords: biofilm production,

Staphylococcus

spp, implant materials, antimicrobial

resistance.

107

Introduction

Staphylococcus aureus

and

Staphylococcus epidermidis

, are important causes of

infections associated with catheters and other medical devices, such as articular prosthesis,

cardiac valves, pacemakers, contact lenses and intrauterine devices (O'Gara & Humphreys

2001,Arciola et al. 2002, Curtin et al. 2003).

S. epidermidis

is one of the most frequently agent isolated among the group of

coagulase-negative Staphylococcus (CoNS). This group is distinguished from S. aureus by

its inability to produce coagulase. Together with other staphylococci,

S. epidermidis

are

normal inhabitants of human skin and mucous membranes (O'Gara & Humphreys 2001,

Arciola et al. 2002, Donlan & Costerton 2002, Vuong & Otto 2002). The port of entry of

these microorganisms into the human body usually is an intravascular catheter (Vuong &

Otto 2002).

S. epidermidis

become one of the major infectious agents in

immunocompromised patients.

Microorganism adherence and fixation to the surface of biomaterials are the first

step for the development of device-related infections. Several mechanisms are involved in

bacterial adhesion, and the production of a natural polysaccharide extracellular substance,

the so-called biofilm (or slime), seems to play an important role. This substance mediates

adhesion to the surface acting as a matrix and allowing the bacterial cells to agglomerate

into biofilm multilayer, thus rendering the bacteria less accessible to the defense system and

to antimicrobials (Arciola et al. 2002, Hume et al. 2004). Biofilm production is frequently

observed in clinical isolates of

S. aureus

and coagulase-negative

taphylococci, especially

S. epidermidis

, isolated from catheter-associated infections (Arciola et al. 2001, 2002) .

Molecular techniques, as polymerase chain reaction (PCR), provide direct evidence

for the genetic basis of biofilm production. The synthesis of the capsular polysaccharide is

mediated by the

ica

operon

. On activation of this

operon,

a polysaccharide intercellular

adhesin (PIA) is synthesized, and this supports cell-to-cell bacterial contacts by means of a

multilayered biofilm (Arciola et al. 2001, 2002).

Treatment of nosocomial infections associated to

S. aureus

and

S. epidermidis

usually complex, due to the increased resistance against antimicrobials and the

impermeable barrier created by biofilm formation. In addition to the low diffusion or failure

of the antimicrobial to penetrate, the resistance to antimicrobials may be associated with

108

physiological alterations and low bacterial growth within the biofilm (Donlan & Costerton

2002, Vuong & Otto 2002, Curtin et al. 2003). The prevalence of methicillin-resistant

S. aureus

(MRSA) and the emergence of vancomycin-resistant isolates make treatment of

infections related to medical devices even more difficult. Oxacillin resistance encoded by

the

mecA

gene is disseminated in the

Staphylococcus

spp. As the

S. aureus

and

S. epidermidis

resistance profile are similar, so it is assumed that resistance occurring in

one species can rapidly be transferred to another (Vuong & Otto 2002). Failure of treatment

usually results in the need of device replacement, increasing risk to the patient’s health, and

also development of bacterial resistance (Monzon et al. 2002).

The most frequently test used to observe biofilm production in the laboratory of

clinical microbiology is the Congo red agar (CRA), as described by Freeman et al. (1989).

The direct analysis of the colonies in the surface of the CRA allow the recognition of

biofilm-producing (characterized by black colonies on the red agar) and non-producing

(rose/red colonies) (Freeman et al. 1989). A comparative study between the CRA test and

presence of gene

ica

by PCR technique, demonstrated concordance between both methods,

showing that the phenotypic analysis of colonies may be a reliable test that can be used

routinely in microbiology laboratories (Arciola et al. 2002).

Considering the importance of

Staphylococcus

species in hospital infections and the

importance to determine the ability of produce biofilm, this study evaluated a practical

method using the CRA, testing isolates from catheters and blood cultures. In addition,

resistance rate of these isolates were determined through diffusion disk testing, as well as

their relationship to biofilm production.

Materials and methods

1- Bacterial isolates - A total of 28 isolates were analyzed, 16 of

S. aureus

and 12 of

S. epidermidis

, isolated from catheter and blood cultures obtained from patients

hospitalized in two institutions: Hospital Mãe de Deus and Hospital de Clínicas of Porto

Alegre, south of Brazil, from August to September 2005. The identification was made by

acid production from carbohydrates, and susceptibility to desferrioxamine along with

classical tests (Monsen et al. 1998, Kloos & Bannerman 1999).

109

2- Characterization of the ability to produce biofilm - Production of biofilm from all

strains was studied by culturing each isolate in CRA (Oxoid, Basingstoke, UK). CRA

plates were prepared adding 0.8 g of CRA and 36 g of sucrose (both from Sigma, Missouri,

US) to 1l of agar trypticaseina (Oxoid, Basingstoke, UK) according by Arciola et al.

(2002). After the inoculation of a pure culture, the plates were incubated for 24h at 35ºC,

and then overnight at room temperature. A four-color scale ranging from black to red was

used. Black (B) colonies were considered as biofilm-producing, while almost black (AB)

colors were considered as indicative of a weak biofilm production activity. Conversely, red

(R) to bordeaux (BR) colonies were taken as unable to produce this virulence factor.

S. epidermidis

ATCC 35984 was used as positive control of CRA and

epidermidis

ATCC 12228 was used as negative control.

3- Antimicrobial susceptibility test - The susceptibility to 5 antimicrobial agents,

including vancomycin 30

g, oxacillin 1

g, linezolide 30

g, gentamicin 10

g, and

rifampicin 5

g disks (Oxoid), was determined by the disk diffusion method according to

the guidelines of the Clinical and Laboratory Standards Institute (CLSI

2005),

S. aureus

ATCC25923 was used as a control.

Results

Phenotypic detection of biofilm production by the CRA test - The phenotypic

production of biofilm in all isolates of the study was analyzed through observation of

colonial morphology in CRA. Definition of biofilm production was considered by

observation of the color of the colony at the end of the period of incubation (Table I).

Overall, 16 isolates (16/28) were considered as biofilm producers: 12 strong (B) and 4weak

(AB). Analyzing staphylococcal species alone, we find that among the 16

S. aureus

isolates

8 were considered as producers, and among the S. epidermidis 8 were considered

producers. Among the patients with

S. aureus

biofilm producers, five (5/8) were using

catheter in the moment of the culture, while in the 8 patients with

S. epidermidis

and

catheter we observed 6 positive cases.

Concerning to length of the incubation, we detect change in the category only in 3

cases, from nonproducer to producer. It is important to outstand, however, that the color

110

became more characteristic in other cases. We also observed that more clear results were

obtained when small amount of bacteria was used.

Antimicrobial resistance pattern - As shown in table II, the frequency of

antimicrobial resistance tested in this study depends on the antimicrobial agent. Gentamicin

resistance was greater than to other antimicrobials (78.6%). All isolates were susceptible to

vancomycin and linezolid. For oxacillin, the rate of resistance was 83.3% for

S. epidermidis

isolates and 68.8% for S. aureus.

Biofilm formation and antimicrobial resistance - Generally it was observed a greater

resistance among biofilm nonproducers. Analyzing species separately, we observed a

greater resistance among biofilm-producing

S. epidermidis

; among

S. aureus

, however,

greater resistance was detected among nonproducers of this virulence factor (Figure 1).

Discussion and Conclusions

Arciola et al. (2002) described a six-color scale to classify CRA colonies, using the

categories "very black" and "very red". In our study, however, only four colors were

considered because the differences were subtle and could lead to an inadequate

interpretation.

Concerning the technique, 48-h incubation was not found required, since in some

isolates there was alteration of the color. However, in only 3 cases this change implicates in

an alteration of category, while in the others there were only an intensification of

pigmentation. Another reading after additional 24h of incubation did not affect the results

of 20 samples, mostly being nonproducers. These situations are comparable to from those

reported as well by Arciola et al. (2001, 2002), where almost all samples were classified

after 24 hours, even that they had incubated until 72 h.

Most isolates (82%) were obtained from patients using catheters, and almost half of

them were biofilm producers. Several

S. aureus

isolates from patients using catheters were

not biofilm producers, in agreement with the reports that

S. epidermidis

is the most

frequently isolated pathogen in patients with infections associated with medical devices due

to biofilm production (Vuong & Otto 2002, Cafiso et al. 2004). On the other hand, these

data might change if the incubation time is extended (Arciola et al. 2001).

111

The oxacillin resistance rate (75%) is in agreement with the literature, since about

80% of nosocomial infections are resistant to oxacillin, a first choice antimicrobial against

microorganisms of

Staphylococcus

(Vuong & Otto 2002). At the same time, the

susceptibility to vancomycin and linezolid agrees with studies reporting that these

antimicrobials as effective against almost all

Staphylococcus spp

, despite their production

of biofilm (Monzon et al. 2001, Curtin et al. 2003, Caierao et al. 2004, Appelbaum &

Jacobs 2005) .

S. epidermidis

, resistance to the tested antimicrobials was greater in biofilm

producers, as expected. Silva et al. (2002) found no association between phenotypic

expression of biofilm based on CRA and any of the antimicrobial resistances examined, but

they reported the existence of a significant association between a series of antimicrobial

resistances (including oxacillin, rifampicin and ciprofloxacin) and the presence of

ica

genes. We found 50% of resistance to oxacillin among biofilm producers and 33% among

nonproducers in agreement to Arciola et al. (2005) that found rates of oxacillin resistance in

S. epidermidis

of 44% among biofilm producers and 34% among nonproducers. The same

authors observed a percentage of gentamicin resistance of 39% among biofilm producers

and 27% among nonproducers, similarly to our (figure I). Curtin et al (2003), also, reported

low effectiveness of gentamicin against biofilm in

S. epidermidis

isolated from catheters.

Studies on rifampicin resistance among biofilm-producing

S. epidermidis

have suggested

that the slow growth of the bacteria on the biofilm accounts for its protection against the

antimicrobial (Zheng & Stewart 2002). Despite the well-known tendency of rifampicin to

cause emergence of resistance, its efficacy against bacteria attached to biomaterials has

been clearly demonstrated. Nevertheless, there are many studies showing greater efficacy if

it is used together with other antimicrobial agents (Monzon et al. 2001, 2002). Authors

have suggested the existence of association could be indirect and mediated by the presence

of transposons. It is known that antimicrobial resistance genes are often associated to

transposons. Some transposons are flanked by insertion sequences such as IS256 that are

often associated with biofilm formation, the presence of the

icaADBC

operon, as well as

gentamicin and oxacillin resistance in the clinical strains (Arciola et al. 2005).

Surprisingly, biofilm-producing

S. aureus

isolates were more susceptible to the

tested antimicrobials than nonproducers, contradicting idea that microorganisms that form

112

biofilm would be more resistant to these drugs. Amorena et al. (1999) reported that in

S. aureus

gentamicin does not affect significantly the viability of biofilm cells. In our work,

gentamicin resistance among biofilm-producing

S. aureus

was relatively low (25%). In that

study, like ours, rifampicin showed a good response against biofilm-producing

S. aureus

isolates a result (Figure I).

There are some ideas about the mechanisms responsible for the increase of

antimicrobial resistance among biofilm producers. These include low penetration of the

antimicrobial; slow bacterial growth rate within mature biofilm because of limited

nutrients; slow growth as a general stress response initiated with the formation of biofilm;

and finally, induction of a phenotype characterized by an efflux pump and alteration of

protein membrane makeup. Specific antimicrobial characteristics, such as hydrophobic

properties, distribution, size, and water solubility could also affect their diffusion across the

biofilm matrix (Donlan & Costerton 2002, Monzon et al. 2002, Arciola et al. 2005) .

The importance of

S. epidermidis

infections is well-established and is probably

related to increased virulence due to biofilm production. Simple methods of detection of

biofilm are thus necessary. The use of CRA proved to be practical and easily to implement

at Clinical Microbiology Laboratories. However, studies using a larger number of isolates

must be carried out to demonstrate the best time of incubation of the plates and the

effectiveness use of this medium in laboratory routine.

Acknowledgments

To Dr. Kátia Regina Netto dos Santos of the Institute of Microbiology Professor

Paulo Góes of the Universidade Federal do Rio de Janeiro, Brazil, for their collaboration.

113

References

Amorena B, Gracia E, Monzón M, Leiva J, Oteiza C, Pérez M, Alabart

JL, Hernández-

Yago J 1999. Antibiotic susceptibility assay for

Staphylococcus aureus

in biofilms

developed

in vitro.

J Antimicrob Chemother

44: 43-55.

Appelbaum PC, Jacobs MR 2005. Recently approved and investigational antibiotics for

treatment of severe infections caused by Gram-positive bacteria.

Curr Opin Microbiol

8: 510-517.

Arciola CR, Baldassarri L, Montanaro L 2001. Presence of

icaA

and

icaD

genes and slime

production in a collection of staphylococcal strains from catheter-associated

infections.

Clin Microbiol

39: 2151-2156.

Arciola CR, Campoccia D, Gamberini S, Cervellati M, Donati E, Montanaro L 2002.

Detection of slime production by means of an optimised Congo red agar plate test

based on a colourimetric scale in

Staphylococcus epidermidis

clinical isolates

genotyped for

ica

locus

. Biomaterials

23: 4233-4239.

Arciola CR, Campoccia D, Gamberini S, Donati ME, Pirini V, Visai L, Speziale P,

Montanaro L 2005. Antibiotic resistance in exopolysaccharide-forming

Staphylococcus epidermidis

clinical isolates from orthopaedic implant infections.

Biomaterials

26: 6530-6535.

Cafiso V, Bertuccio T, Santagati M, Campanile F, Amicosante G, Perilli MG, Selan L,

Artini M, Nicoletti G, Stefani S 2004. Presence of the

ica

operon in clinical isolates of

Staphylococcus epidermidis

and its role in biofilm production.

Clin Microbiol Infect

10: 1081-1088.

Caierão J, Musskopf M, Superti S, Roesch E, Dias CG, d’Azevedo PA 2004. Evaluation of

phenotypic methods for methicillin resistance characterization in coagulase-negative

taphylococci

(CNS).

J Medical Microbiology

53: 1195-1199.

Clinical and Laboratory Standards Institute (CLSI) 2005. Performance Standards for

Antimicrobial Susceptibility Testing – Sixteenth Information Supplement M-S16.S 8ª

ed. Clinical and Laboratory Standards Institute, Wayne, Pennsylvania, USA, CLSI

2005.

Curtin J, Cormican M, Fleming G, Keelehan J, Colleran E 2003. Linezolid compared with

esperezolid, vancomycin, and gentamicin in an

in vitro

model of antimicrobial lock

therapy for

Staphylococcus epidermidis

central venous catheter-related biofilms

infections.

Antimicrob Agents Chemother

47 (10): 3145-3148.

Donlan RM, Costerton JW 2002. Biofilms: Survivel Mechanisms of Clinically Relevant

Microorganisms.

Clin Microbiol Rev

15 (2): 167-193.

114

Freeman DJ, Falkiner FR, Keane CT 1989. New method for detecting slime production by

coagulase-negative

staphylococci.

J Clin Pathol

42:872-874.

Hume EBH, Baveja J, Muir B, Schubert TL, Kumar N, Kjelleberg S, Griesser HJ, Thissen

H, Read R, Poole-Warren LA, Schindhelm K, Willcox MDP 2004. The control of

Staphylococcus

epidermidis

biofilm formation and in vivo infection rates by

covalently bound furanones.

Biomaterials

25: 5023-5030.

Kloos WE, Bannerman TL 1999.

Staphylococcus

and

Micrococcus

, In PR Murray, EJ

Baron, MA Pfaller, FC Tenover, RH Yolken (eds),Manual of Clinical Microbiology,

ed. American Society for Microbiology, Washington, p. 264-282.

Monsen T, Ronnmark M, Olofsson O, Wistrom J 1998. An inexpensive and reliable

method for routine identification of staphylococcal species.

Err J Clin Microbiol

17:

327-335.

Monzón M, Oteiza C, Leiva J, Amorena B 2001. Synergy of different antibiotic

combinations in biofilms of

Staphylococcus epidermidis

J Antimicrob Chemother

48:

793-801.

Monzón M, Oteiza C, Leiva J, Lamata M, Amorena B 2002. Biofilm testing of

Staphylococcus epidermidis

clinical isolates: low performance of vancomycin in

relation to other antibiotics.

Diagn Microbiol Infect Dis

44: 319-324.

O’Gara JP, Humphreys H 2001.

Staphylococcus

epidermidis

: importance and implications.

J Med Microbiol

50: 582-587.

Silva GD, Kantzanou M, Justice A, Massey RC, Wilkinson AR, Day NP, Peacock SJ 2002.

The

ica

operon and biofilm production in coagulase-negative Staphylococci

associated with carriage and disease in a neonatal intensive care unit.

J Clin Microbiol

40 (2): 382-8.

Vuong C, Otto M 2002.

Staphylococcus

epidermidis

infections.

Microbes Infect

4: 481-

489.

Zheng Z, Stewart PS 2002. Penetration of rifampin through

Staphylococcus epidermidis

biofilms.

Antimicrob Agents Chemother

46: 900-903.

115

Table I. Characterization of Staphylococcus aureus and Staphylococcus epidermidis isolates

through Congo Red Agar.

CRA Use of

Isolate

Biofilm

24h 48h Catheter

S. epidermidis

P BR AB Yes

S. epidermidis

P AB B Yes

S. epidermidis

P B B Yes

S. epidermidis

P B B Yes

S. epidermidis

P B B Yes

S. epidermidis

P B B Yes

S. epidermidis

P B B No

S. epidermidis

P B B No

S. epidermidis

N BR BR Yes

S. epidermidis

N R R No

S. epidermidis

N R R Yes

S. epidermidis

N R BR Yes

S. aureus

P B B No

S. aureus

P AB AB Yes

S. aureus

P R AB No

S. aureus

P R AB Yes

S. aureus

P B B Yes

S. aureus

P AB B Yes

S. aureus

P AB B Yes

S. aureus

P R B Yes

S. aureus

N R R Yes

S. aureus

N R R Yes

S. aureus

N BR BR Yes

S. aureus

N R R Yes

S. aureus

N BR BR Yes

S. aureus

N BR BR Yes

S. aureus

N R R Yes

S. aureus

N R R Yes

R: red; B: black; BR: bordeaux; AB: almost black; P: biofilm producer

;

N: biofilm nonproducer

116

Table II. Percentage of antimicrobial resistance among Staphylococcus epidermidis and

Staphylococcus aureus isolates

Antimicrobial

Percentage (%)

S. aureus

Oxacillin 68.8

Rifampicin 6.2

Gentamicin 75.0

S. epidermidis

Oxacillin 83.3

Rifampicin 33.3

Gentamicin 83.3

Table III. Percentage of antimicrobial resistance among CRA-positive and CRA- negative among

S. epidermidis and S. aureus isolates

CRA-positive CRA-negative

Antimicrobial

No. % No. %

Oxacillin

66.7

84.6

Rifampicin 2 13.3 3 23.1

Gentamicin

73.3

92.3

CRA-positive: biofilm producer; CRA-negative: biofilm nonproducer; No.: number of samples

Figure 1. Antimicrobial resistance rates among biofilm-producing (CRA-positive) and non-

producing (CRA- negative) in

Staphylococcus epidermidis

and

Staphylococcus aureus

isolates.

117

ANEXO IV_______________________________________________________________

118

Bacteremias of Coagulase-Negative staphylococci (CoNS) in Intensive Care Unit in

hospital geral of São Paulo city, SP, Brasil.

Bacteremias por

Staphylococcu

s spp coagulase negativos em um hospital geral na cidade de

São Paulo, SP, Brasil.

d’Azevedo, PA.

1,2

Secchi, C

Antunes, ALS

Sales, TC

Silva, FM

Tranchesi, R

Pignatari, ACC

1,3

Laboratório Especial de Microbiologia Clínica (LEMC), Disciplina de Infectologia da

Universidade Federal de São Paulo (UNIFESP), SP, Brasil.

Laboratório de Cocos Gram Positivos da Fundação Faculdade Federal de Ciências

Médicas de Porto Alegre (FFFCMPA), RS, Brasil.

Hospital 9 de Julho, São Paulo, SP, Brasil.

Laboratório Bioclínico, São Paulo, Brasil.

This study was presented in part at the 40

Congresso Brasileiro de Patologia Clínica e

Medicina Laboratorial, Curitiba, PR, 2006 (abstract).

Corresponding author:

Profº Pedro A. d’Azevedo

Laboratório Especial de Microbiologia Clínica

Rua Leandro Dupret 188 – Vila Clementino – São Paulo, SP.

Cep: 04025-010

Tel: 11 50812819

e-mail: [email protected]

119

Abstract

Coagulase negative staphylococci (CoNS), especially

S. epidermidis

have become an

important cause of bloodstream infections, during the last decades. In addition, rates of

methicillin-resistance among CoNS have increased substantially, leading to difficulties in

therapy. The objective of this study was evaluate 11 consecutives cases of bacteremias by

CoNS methicillin-resistance in hospital localized in São Paulo city, Brazil and

characterized phenotypic/genotypic this isolates. Five differents species were identified

inclued

S. epidermidis

(5),

S. haemolyticus

(3),

S. hominis

(1),

S. warneri

(1) and

S. cohnii

subsp

urealyticus

(1). Macrorestriction of DNA was realized of PFGE and analysis of

profiles second Tenover and collaborators.

A variety of PFGE profiles was observed. None

have the predominant PFGE type. These data indicated the heterogeneity of CoNS isolates

included in the study, suggesting that horizontal dissemination of these microorganisms

was not frequent in the hospital investigated.

Key words:

Coagulase negative staphylococci; methicillin-resistant; bacteremia;

identification;

PFGE (“Pulsed-Field Gel Electrophoresis”)

120

Introduction

Coagulase-negative staphylococci (CoNS) are major causes of nosocomial

bloodstream infection and have significantly high associates morbidity and mortality

mainly in patients hospitalized (Marshall et al. 1998). Members of the genera

Staphylococcus

are catalase-positive, gram-positive cocci, coagulase-negative, aerobe and

when present in human infections can show multiresistant profiles (Kloss & Bannermann

1999, Szewczyk & Rozalska 2000). These strains may constitute a dangerous reservoir of

resistance genes in a hospital (Szewczyk & Rozalska 2000).

Staphylococci generally has a benign or symbiotic relationship with their host,

however, they may develop into a pathogen if they gain entry into the host tissue through

breaking of cutaneous barrier, inoculation by needles or implantation of medical devices

(Heikens et al. 2005). CoNS has become increasingly important to accurately identify these

isolates to the species level in order to define the clinical significance of these bacteria, to

carry out a proper epidemiological surveillance, and to manage patients infected with CoNS

in case of relapse (Poyart et al. 2001).

A substantial increase in the frequency of oxacilin resistance (methicillin-resistant)

in CoNS isolates has occurred over the last decades (Ferreira et al. 2003). Between 50%

and 80%, depending on the species, are

mecA

positive or oxacilin resistance (John et al.

2002, Caierão et al. 2006).

The SENTRY Program, in Latin American and in Brazil, realized antimicrobial

surveillance program over a five-year period from 1997 to 2001. The results demonstrated

the resistance of

Staphylococcus

spp, in isolates of bloodstreams infections, in Brazil,

showed oxacilin susceptibility in

S. aureus

of 68.2% and 19.2% in CoNS (Sader et al.

2004).

S. epidermidis

and

S. haemolyticus

are the most frequent species in nosocomial

infection presenting a higher frequency of oxacilin resistance among CoNS clinical isolates

(Ferreira et al. 2002).

S. haemolyticus

have been reported to show multiple resistance to

antimicrobials and quite frequently with reduced susceptibility or fully resistant to

teicoplanin from clinical isolates (Raponi et al. 2005).

121

Vancomycin is usually considered the treatment of choice for infections caused by

these microorganisms. However, due to the emergence of vancomycin-resistant enterococci

(Marshall et al, 1998) and vancomycin-resistant staphylococci (Szarapinska-Kwaszewska

& Farkas 2003), reduction in the use of this drug has been recommended (Szewczyk &

Rozalska 2000).

A few reports have show that the mechanism of glycopeptide resistance in

S. epidermidis, S. haemolyticus, S. hominis is similar to that describe in VISA and hetero-

VISA strains (Nunes et al. 2006). In 09 de Julho Hospital, where study was occurred

therapy of teicoplanin is recommended. The objective of this study was evaluate 11

consecutives cases of bacteremias by CoNS methicillin-resistant in 09 de Julho Hospital

localized in São Paulo city, Brazil, occurred in 2005, and characterized

phenotypic/genotypic this isolates.

Materials and Methods

Bacterial isolates:

We tested 11 CoNS clinical isolates obtained from bloodstream,

from patients at in hospital localized in São Paulo City, Brazil between June and July 2005.

Identification:

Identification of the staphylococcal to the species level was carried

out by oxidation-fermentation test, detection of enzyme production: coagulase (Laborclin,

Paraná, Brazil), catalase, alkaline phospatase (diphosphato de fenoftaleína, Sigma Sigma-

Aldrich, Germany), ornithine (Merck) and urease (Oxoid, UK), PYR (pyrrolidinyl-

naphthylamide hydrolysis, Probac do Brasil, São Paulo), hemolytics properties on sheep

blood agar, acid production (aerobically) from carbohydrates: trehalose (Sigma-Aldrich,

Germany), mannitol (Nuclear, São Paulo), mannose (Vetec, Rio de Janeiro), sucrose

(Reagen), maltose (Sigma-Aldrich, Germany), lactose (Difco Detroit, Mich), cellobiose

(Sigma-Aldrich, Germany) and anaerobic growth in thioglicolate (Merck). Susceptibilities

to novobiocin (Oxoid, UK), polymyxin B (Oxoid, UK), bacitracina (CECON, São Paulo,

Brazil), desferrioxamine (Desferal, Ciba Geigy, Switzerland) and fosfomycin (Oxoid,UK)

were also determined. Isolates were kept frozen at –20°C in Skim Milk. (Difco, Detroit,

Mich). Bacteria to be tested were suspended in 0.5 ml of saline to a McFarland standard

and 50ul was added to each sugar carbohydrate tube. The acid production from

122

carbohydrates was evaluated after 24, 48 and 72hs of incubation at 35-37°C. The final

evaluation was at 7

day.

Antimicrobial susceptibility:

The isolates were tested by the agar disk diffusion

method with Mueller-Hinton agar plates (Difco, Laboratories, Detroit, Mich) according to

Clinical Laboratory and Standards Institute (CLSI 2005; formerly NCCLS)

recommendations and confirmed by E-test (AB Biodisk, Solna, Sweden). Also determined

susceptibility for novobiocin, polymyxin B, bacitracina, desferrioxamine and fosfomycin to

the according Monsen et al. (1998).

PFGE typing:

Chromosomal DNA from CoNS was prepared in agarose blocks and

cleaved with SmaI (New England BioLabs), as described elsewhere (Pfaller et al. 1992).

The isolates were run on a 1% agarose gel (Invitrogen) in a CHEF DRIII system (Bio-Rad)

under the following conditions: run time, 23 h; temperature, 13°C; voltage, 200 V; initial

forward time, 5’; final forward time, 60 s. The molecular weight markers (New England

BioLabs) were run in the first and in the last line. The gels were stained with ethidium

bromide, washed in water, and photographed under UV light by using the Gel Doc 1000

system (Bio-Rad). The gel patterns were read by visual inspection. The isolates were

classified as identical if they shared the same

band profile, and isolates differing by more

than six bands were considered to represent distinct DNA types (Tenover et al. 1995).

Results and discussion

A total of 11 CoNS strains belongings to five species were identified including

epidermidis

(5),

S. haemolyticus

(3),

S. hominis

(1),

S. warneri

(1)

and

S. cohnii

subsp

urealyticus

(1)

(Table 1). All isolates, except the number 20994, were identified to the

species level by the conventional method of Kloos and Banermann (Kloss & Banermann

1994, 1999). The isolate number 20994 could not be identified by the conventional method,

so it was identified for Vitek-2 (bioMèrieux S/A, Paris, France) at Hospital Albert Einstein,

São Paulo, Brazil) like

S. cohnii

subsp

urealyticus.

The two species most frequently encountered were

S. epidermidis

and

S. haemolyticus

, all the tests of the phenotypic tests were accomplished at least twice for

confirmation of the species of CoNS. All the phenotypic tests were accomplished in parallel

with a control positive

S. epidermidis

ATCC 12228.

123

The species of

S. epidermidis

and

S. hominis

were identified through the proof of

diffusion disk for desferrioxamine, this susceptibility testing just the two species. All the

other species of CoNS presented resistance the desferrioxamine through the diffusion disk,

turning like this, this proof of easy execution, a guide in the differentiation of species. The

reading of the halos of diffusion disk for desferrioxamine was 26 mm on average (25-

30mm) and of fosfomycin it was of 43 mm (40-45mm), for

S. epidermidis

To differentiate the two species with susceptibility of desferrioxamine,

S. epidermidis

and

S. hominis

, other phenotypic tests were used, as fermentation of the

trehalose (negative for

S. epidermidis

), alkaline phospatase (positive for

S. epidermidis

) and

growth in thioglicolate (positive for

S. epidermidis

The production of the enzyme urease test allowed the differentiation of

S. haemolyticus

(negative urease), of

S. epidermidis, S. hominis and S. warneri

that are

positive urease. Besides this proof the test of positive PYR together with the hemolytic

properties in sheep blood agar and fermentation of negative mannose also allowed the

differentiation of the second species more prevalent

S. haemolyticus

The clinical isolate 20994,

S. cohnii

subsp

urealyticus

, for being a species less

common of being isolated at the clinical laboratory, it was identified for the automated

system VITEK 2 (bioMèrieux S/A, Paris, France), and after for methods conventional,

confirming his identification. Classic proofs of resistance to the disk diffusion of

novobiocin, positive urease and fermentation negative of sucrose confirmed the

identification of the specie. There was discrepancy in the proof of the production of the

enzyme alkaline phospatase that negative stayed in the conventional test and positive in the

automated system.

All isolates were methicillin-resistant by disk diffusion test, with MICs ≥ 256

µg/ml confirmed by E-Test. In spite of

S. epidermidis

to be the species more prevalent

among

Staphylococcus spp,

other species see increasing her prevalence in the isolated ones

clinical, as well as the resistance to the used antimicrobials. In this study, two species (

epidermidis

and

S. haemolyticus

) presented reduced susceptibility to teicoplanin (Table 1),

the according with has also been reported in this species (Nunes et al. 2006). Strains with

this characteristic may be associated with treatment failures or may become precursors of

glycopeptide-resistant strains (Sieradzki et al. 1998).

124

S. cohnii

subsp

urealyticus

, is an unusual species that has been found in hospital

environment like pediatric ICUs, and this isolates may constitute a dangerous reservoirs of

resistance genes in a hospital (plasmids), presenting resistance to multiple antimicrobials

commonly used (Waldon et al. 2002, Szewczyk et al. 2004), as well as strains opportunist

in severe infections (Yamashita et al. 2005).

Among the five clinical isolates of

S. epidermidis

were found five different

patterns of PFGE, but the same not occurred between the three clinical isolates of

S. haemolyticus

where two isolates presented similar profile. These results demonstrated a

clonal diversity between the clinical isolates of

S. epidermidis

, evidencing that there was

not clonal dissemination among the clinical isolates of this same species (Figure 1). The

other isolates were not classified by PFGE because they belong to different species.

In the last years, CoNS has been winning a larger importance due to her

pathogenicity and involvement in human diseases. The importance of identifying all species

of CoNS in the clinical laboratories has been increasing; however it is not an easy task,

since phenotypic tests can present similar results, hindering the obtaining of a result, as well

as a great expense of time in the identification of the species than in commercial kits. Many

clinical laboratories use automated systems for identification of the species of

Staphylococcus

spp although the reliability for certain species not always it is satisfactory,

particularly for species of CoNS no-

epidermidis

Acknowledgement

The authors tank to Dra. Marines Martino of Laboratory Microbiology of Albert

Eistein to support technique and Fundação Faculdade Federal de Ciências Médicas de Porto

Alegre (FFFCMPA) of financial support.

125

References

Caierão J, Superti S, Dias CAG, d’Azevedo PA 2006. Automated systems in the identification

and determination of methicillin resistance among coagulase negative staphylococci.

Mem Inst Osw Cruz 101(3):277-279.

Drozenova J, Petras P 2000. Characteristics of coagulase-negative staphylococci isolated from

hemocultures. Epidemiol Mikrobiol Imunol 49 (2):51-58.

Ferreira RBR, Nunes APF, Kokis VM, Krepsky N, Fonseca LS, Bastos MCF, Marval

MG,Santos KRN 2002. Simultaneous detection of the mec A and ileS-2 genes in

coagulase-negative staphylococci isolated from Brazilian hospitals by multiplex PCR.

Diagn Microbiol Infect Dis 42: 205-212.

Ferreira RBR, Iorio N, Malvar K, Nunes A, Fonseca L, Bastos C, Santos K 2003. Coagulase-

negative Staphylococci: comparison of phenotypic and genotypic oxacilin sucseptibility

tests and evaluation of the Agar screening test by using different concentration of

oxacilin. J Clin Microbiol 41 (8): 3609-3614.

Heikens E, Paauw A, Florijn A, Fluit AC 2005. Comparison of genotypic and phenotypic

methods for species-level identification of clinical isolates of coagulase-negative.

Staphylococci. J Clin Microbiol 43 (5): 2286-2290.

John MA, Pletch C, Hussain Z 2002. In vitro activity of quinupristin/dalfopristin, linezolid,

telithromicyn and comparator antimicorbial agents against 13 species of coagulse-

negative Staphylococci. J Antimicrob Chemother 50: 933-938.

Kloos WE, Bannerman TL 1994. Update on clinical significance of coagulase-negative

staphylococci. Clin Microbiol Rev 7:117-140.

Kloos WE, Bannerman TL 1999. Staphylococcus and Micrococcus, In Murray PR, Baron EJ,

Pfaller MA, Tenover FC, Yolken RH (eds), Manual of Clinical Microbiology, 7th ed.,

ASM Press, Washington DC, 264 pp.

Marshall SA, Wilke WW, Pfaller MA, Jones RN 1998. Staphylococcus aureus and coagulase-

negative staphylococci from blood stream infections: frequency of occurrence,

antimicrobial susceptibility, and molecular (mecA) characterization of oxacillin

resistance in the SCOPE Program. Diag Microbiol Infect Dis 30:205-214.

Monsen T, Ronnmark M, Olofsson C, Wistrom J 1998. An inexpensive and reliable method for

routin identification of Staphylococcal species. Eur J Clin Microbiol Infect Dis 17: 327-

335.

NCCLS-National Committee for Clinical Laboratory Standards 2000. Performance Standards

for Antimicrobial Susceptibility Testing, 7

ed.M2-A7. Wayne, Pennsylvania.

Nunes APF, Teixeira LM, Iorio NLP, Bastos CC, Fonseca LS, Souto-Padrón T, Santos KRN

2006. Heterogeneous resistance to vancomycin in Staphylococcus epidermidis,

Staphylococcus haemolyticus and Staphylococcus warneri clinical strains:

126

characterisation of glycopeptide susceptibility profiles and cell wall thickening. Int J of

Antimicrol Agents 27: 307-315.

Pfaller MA, Hollis RJ, Sader HS 1992. Molecular biology–PFGE analysis of chromosomal

restriction fragments. In: HD Isenberg (ed). Clinical Microbiology Procedures

Handbook, American Society of Microbiology, Washington, D.C., p.10.5.c.1-10.5.c.11.

Poyart C, Quesne G, Boumaila C, Trieu-Cuot P 2001. Rapid and accurate species-level

identification of coagulase-negative Staphylococci by using the sod A gene as a target. J

Clin Microbiol 39(12): 4296-4301.

Raponi G, Ghezzi MC, Gherardi G, Dicuonzo G, Caputo D, Vendittu M, Rocco M, Micozzi A,

Mancini C 2005. Antimicrobial Susceptibility, Biochemical and Genetic profiles of

Staphylococccus haemolyticus strains isolates from the bloodstreams of patients

hospitalized in critical care units. J Chemother 17(93): 264-269.

Sader HS, Jones RN, Gales AC, Silva JB, Pignatari AC 2004. SENTRY Antimicrobial

Surveillance Program Report: Latin American and Brazilian Results for 1997 trough

2001. Braz J Infect Dis 8(1): 25-79.

Sieradzki K, Villari P, Tomasz A 1998. Decreased susceptibilities to teicoplanin and

vancomycin among coagulase-negative methicillin- resistant clinical isolates of

staphylococci. Antimicrob Agents Chemother 42:100-107.

Szarapinska-Kwaszewska J, Farkas LI 2003. Synthesis of siderophores by strains of

Staphylococcus cohnii isolated from various environments. Acta Microbiol Pol

52(3):261-269.

Szewczyk EM, Rozalska M 2000. Staphylococcus cohnii--resident of hospital environment:

cell-surface features and resistance to antibiotics. Acta Microbiol Pol49(2):121-133.

Szewczyk EM, Rozalska M, Cieslikowski T, Nowak T 2004. Plasmids of Staphylococcus

cohnii isolated from the intensive-care unit. Folia Microbiol, 49(2):123-131.

Tenover FC, Arbeit RD, Goering RV et al. 1995. Interpreting chromosomal DNA restriction

patterns produced by Pulsed-field gel electrophoresis: criteria for bacterial strain typing.

J Clin Microbiol 33:2233-2239.

Waldon E, Szewczyk EM 2002. Ability of Staphylococcus cohnii strains to adhere to epithelial

cells and solid surfaces in the hospital environment. Med Dosw Mikrobiol 54(2):109-

118.

Yamashita S, Yonemura K, Sumimoto R, Tokunaga M, Uchino M 2005. Staphylococcus cohnii

as a cause of multiple brain abscesses in Weber-Christian disease. J Neurol Sci 15(1-

2):97-100.

127

Table1. Coagulase-negative staphyloccci methicillin resistant isolates of patients with

bloodstream infections hospitalized in 09 de Julho Hospital (June/July 2005), São

Paulo, SP, Brazil.

Lane Specie

Clinical

isolate

Isolation

date

Unid

MIC Vanco

(µg/ml)

MIC Teico

(µg/ml)

Profile

S. epidermidis

21170 17/07/05 Leito 145 2.0 16.0 “A”

S. epidermidis

21169 11/07/05 Leito 1005 1.5 4.0 “B”

S. epidermidis

21168 20/07/05 Leito 307 1.5 4.0 “C”

S. epidermidis

20944 29/06/05 CTC 2.0 4.0 “D”

S. epidermidis

21171 01/07/05 onco 2.0 4.0 “E”

S. haemolyticus

20995 07/07/05 Leito 532 2.0 12.0 “G”

S. haemolyticus

21172 13/07/05 onco 1.5 4.0 “F”

S. hominis

20947 20/06/05 CTI 0.75 0.75 NC

S. warneri

20993 08/07/05 Leito 543 1.0 2.0 NC

S. haemolyticus

20946 24/06/05 onco 2.0 3.0 “F”

S. cohnii spp urealyticus

20994 06/07/05 Leito 394 1.0 3.0 NC

Figure 1 – PFGE profile of SmaI-digested chromosomal DNA of CoNS isolates, obtained from

patients in 9 de Julho Hospital in São Paulo city, Brazil. λ Lamba ladder DNA markers; lanes 1-5 S.

epidermidis; lanes 6,7 and 10: S. haemolyticus; lane 8: S. hominis; lane 9: S. warneri; lane 11: S.

cohnii subsp urealyticus.

128

ANEXO V________________________________________________________________

129

Bacteremia por Rhodococcus equi em paciente com síndrome da imunodeficiência

adquirida: relato de caso

Rhodococcus equi

bacteremia in a patient with acquired immunedeficiency syndrome: case

report

Carina Secchi

1,2

, Fabiana Pereira

, Leandro Réus Rodrigues Perez

, Pedro Alves

d’Azevedo

, Silvia da Silva Rios

Artigo publicado na revista “Revista da Sociedade Brasileira de Medicina Tropical”,

v.39(6), p.570-572, nov-dez 2006.

1. Weinmann Laboratório, Porto Alegre, RS. 2. Programa de Pós-Graduação em Ciências

Médicas da Fundação Faculdade Federal de Ciências Médicas de Porto Alegre, Porto

Alegre, RS. 3. Grupo Hospitalar Nossa Senhora da Conceição, Porto Alegre, RS.

Address to:

Dra.Carina Secchi,. Weinmann Laboratório. Rua Ramiro Barcellos 910, 5º andar, CEP:

90035001. Porto Alegre, RS.

Tel: 55 51 3314-3838

e-mail: csecchi@weinmann.com.br

130

Resumo

Rhodococcus equi

é um importante agente de infecções zoonóticas, podendo causar sérias

infecções em humanos, principalmente em pacientes imunocomprometidos. Neste estudo,

nós relatamos o caso de uma bacteremia fatal devido a R. equi em paciente com síndrome

da imunodeficiência adquirida (HIV positivo).

Palavras-chaves: Rhodococcus equi. Bacteremia. Imunocomprometidos. HIV.

Abstract

Rhodococcus equi

is an important agent of zoonotic infections, being able to cause serious

infections in humans, mainly in immunocompromissed patients. In this study, we related a

fatal bacteremia due R. equi in patient with human immunodeficiency virus (positive HIV).

Key words: Rhodococcus equi. Bacteremia. Imunocompromissed. HIV.

131

Rhodococcus equi

(R. equi) é reconhecido como um microrganismo intracelular

facultativo, ubíquo, de caráter oportunista, associado as diferentes afecções no homem e

animais. É um cocobacilo pleomórfico, gram-positivo, aeróbio, parcialmente ácido-

resistente, não formador de esporos, imóvel e amplamente distribuído na natureza. Foi

primariamente relatado em infecções zoonóticas em 1923, em eqüinos que apresentaram

pneumonia granulomatosa crônica

. O primeiro caso em humanos foi relatado em 1967 em

paciente com abscesso pulmonar

, desde então muitos casos foram descritos na literatura

1 8

No homem, a rodococose é apontada como doença emergente, freqüentemente relacionada

a indivíduos severamente comprometidos, incluindo pacientes convalescentes de

transplantes, com neoplasias malignas, sob terapia imunossupressiva ou em alcoólatras. Em

anos recentes, grande parte da casuística de infecções humanas pelo R. equi tem sido

relatada em pessoas acometidas pela síndrome da imunodeficiência adquirida (HIV

positivos) ou mesmo em pessoas saudáveis

1 7

. A mortalidade, associada à infecção, varia

segundo a condição do hospedeiro, sendo de aproximadamente 11% em imunocompetentes,

20 a 25% em pacientes imunocomprometidos não-HIV e 50 a 55% em pacientes HIV

positivos (AIDS)

. A transmissão do R. equi, para o homem, deriva da exposição ao agente

no ambiente, geralmente secundária a lesões transcutâneas, ou do contato recente com

animais, principalmente eqüinos

1 6

. Pode causar infecções pulmonares, feridas, abscessos,

peritonite, meningite, pericardite, osteomielite, entre outras. O início da doença pode ser

insidioso e com características semelhantes ao observado para os gêneros Mycobacterium,

Actinomyces e Nocardia

Determinados fatores de virulência conferem ao R. equi mecanismos de evasão do

sistema imune, possibilitando ao microrganismo multiplicar-se no interior de fagócitos,

como neutrófilos e macrófagos, dificultando assim o estabelecimento de resposta imune

adequada e induzindo lesões do tipo piogranulomatosa

. Esse tipo especial de inflamação

na rodococose leva a processos de difícil resolução tecidual, refratários à terapia

antimicrobiana convencional

2 10

. Considerando a disseminação hematogênica, o R. equi

pode infectar qualquer órgão, mas, o pulmão é afetado com maior freqüência, apresentando

algum comprometimento em 80-97% dos pacientes imunocomprometidos e em torno de

40% em imunocompetentes

. As limitações do sucesso terapêutico nas infecções por R.

equi, no homem e em animais, fundamentado na utilização de antimicrobianos, têm

132

motivado diferentes estudos de suscetibilidade do agente, ensaios com novas drogas e suas

associações. A refratariedade do agente à terapia antimicrobiana convencional decorre do

desenvolvimento de resistência natural (simples ou múltipla), de resistência adquirida ao

longo da terapia, da descontinuidade do tratamento ou da limitação de certas drogas ao

acesso intracelular e/ou do foco piogranulomatoso. Os diferentes estudos conduzidos na

investigação da suscetibilidade do R. equi, de origem animal, apontam que as drogas de

maior efetividade, in vitro, incluem antimicrobianos do grupo dos macrolídeos

(eritromicina), quinolonas (enrofloxacina, ciprofloxacina), aminoglicosídeos (gentamicina,

neomicina, amicacina), cefalosporinas, vancomicina, imipenem e rifampicina, além de

associações, como a rifampicina e eritromicina, considerada de eleição no tratamento de

infecções causadas pelo R. equi

6 10

Relato de Caso

Paciente masculino de 34 anos, internado no serviço de Infectologia do Hospital Nossa

Senhora da Conceição de Porto Alegre, RS, com queixa de perda ponderal, astenia, febre e

icterícia há 30 dias. Vinha fazendo uso da associação RHZ (Rifampicina, Isoniazida e

Pirazinamida) há duas semanas devido a diagnóstico preliminar de tuberculose pulmonar

realizado em posto de saúde na capital. Apresentava lesões ulceradas de pele há

aproximadamente um mês. Foram solicitadas hemoculturas e biópsia de pele, bem como

outros exames laboratoriais complementares como hemograma com resultados de: 8,9g/dL

de hemoglobina, 27% de hematócrito, 5.200 leucócitos/µL e diferencial (6% de bastões,

86,5% de segmentados, 0,5% de basófilos e 3,6% de linfócitos). O resultado do teste anti-

HIV foi positivo (Abbott, Illinois, USA) com CD4+ 01 células/mL e carga viral de 112.194

cópias/mL. Apresentava látex criptocócico (IMMY, Norman, USA) não-reagente no

sangue, Anti-HCV (Abbott, Illinois, USA) não-reagente e pesquisa para bacilo álcool-

resistente (BAAR) negativo no escarro. Também foram realizados outros exames

complementares como Raios-X de tórax com ampla lesão cavitada no lobo inferior direito e

ecografia abdominal com aumento do fígado e baço. Os frascos de hemocultura positivos

foram enviados ao Weinmann Laboratório, setores de Bacteriologia/Biologia Molecular

para identificação de bacilos gram-positivos com ramificações. O microrganismo

observado pela coloração de Gram, a partir dos frascos de hemocultura com crescimento,

133

foi um bacilo gram-positivo com ramificações e com coloração de Ziehl-Neelsen negativa

para bacilos álcool-ácido resistente (BAAR). A amostra de sangue foi semeada em agar-

sangue de carneiro (bioMérieux, Marcy l’Etoile, France) incubado a 35°C em

microaerofilia e em anaerobiose por aproximadamente 48 horas. Após incubação, houve

crescimento em aerobiose de colônias lisas, irregulares, brilhosas, mucóides que com o

passar do tempo adquiriram cor vermelho-alaranjado. A coloração de Gram, a partir das

colônias, revelou cocobacilos gram-positivos. Testes adicionais foram realizados como a

prova da oxidase (negativa), da urease (positiva) e teste de suscetibilidade aos

antimicrobianos. O microrganismo foi submetido também ao sistema automatizado VITEK,

cartão GPI (bioMérieux, Marcy l’Etoile, France), que não identificou a bactéria e ao kit

API Coryne (bioMérieux, Marcy l’Etoile, France) cujos resultados de algumas provas

foram duvidosos, não possibilitando uma correta identificação. Posteriormente, a

identificação da bactéria foi realizada pela técnica da reação da polimerase em cadeia

(PCR) através da amplificação do gene 16S rRNA (ca. 1.500bp) utilizando “primers” 285 e

261

. Os produtos do PCR obtidos com diferentes “primers” foram purificados e as

primeiras 500 bases determinadas pelo seqüenciamento utilizando o “primer” 16S (5’ –

TATTACCGCRGCTGCTGG – 3’) e o kit BigDye Terminator (Applied Biosystems, Foster

City, USA) conforme instruções do fabricante.

Discussão

R. equi

é um patógeno oportunista emergente, especialmente em pacientes

infectados pela síndrome da imunodeficiência adquirida, conforme paciente relatado neste

caso. Outros problemas relatados neste paciente foram: pneumonia cavitada, hepatite

medicamentosa ao RHZ e lesões de pele que foram identificadas como Paracoccidiodes

brasiliensis. Como tratamento, o paciente recebeu benzilpenicilina potássica, oxacilina e

anfotericina B, mas seu quadro evoluiu a óbito.

R. equi

é usualmente suscetível a eritromicina, ciprofloxacina, vancomicina,

aminoglicosídeos, rifampicina, carbapenêmicos, embora o organismo pareça suscetível aos

-lactâmicos in vitro, estudos demonstram resistência adquirida durante o tratamento com

estas drogas. No teste realizado no laboratório o microrganismo apresentou concordância

com a literatura: suscetibilidade aos antimicrobianos acima citados e resistência aos

134

lactâmicos (teste de suscetibilidade não-padronizado). A diferenciação clínica de lesões

pulmonares com micobacterioses e nocardioses deve envolver também a suspeita de R.

equi, como também laboratorialmente entre difteróides e outros microrganismos álcool-

ácido-resistentes a fim de realizar a correta identificação do germe para melhor escolha dos

antimicrobianos já que R. equi apresenta alta taxa de mortalidade.

R. equi deve ser suspeitado em pacientes imunocomprometidos ou HIV positivos

que apresentam infecção respiratória de curso não-habitual (pneumonia lentamente

evolutiva)

. É importante o estudo da suscetibilidade aos antimicrobianos para o correto

manejo do paciente, visto que, em geral, o tratamento específico desta infecção é

prolongado.

Agradecimentos

Os autores desejam agradecer aos médicos, Renato Cassol F. da Silva e Teresinha

Joana Dossin, ao serviço de Controle de Infecção e ao Laboratório de Bacteriologia do

Grupo Hospitalar Conceição pelo envio da amostra e dados do paciente relatado nesse caso.

135

Referências Bibliográficas

1. Barsotti M, Cupisti A, Morelli E, Meola M, Barsotti G. Sepsis from Rhodococcus

equi successfully treated in a kidney transplant recipient. Nephrology Dialysis

Transplantation 12:2002-2004, 1997.

2. Brown JM, MacNeil M.M. Nocardia, Rhodococcus, Gordonia, Actinomadura,

Streptomyces, and other Aerobic Actinomycetes. In: Murray P, Baron EJ,

Jorgensen JH, Pfaller MA, Yolken RH. (eds). Manual of Clinical Microbiology

8ed., American Society of Microbiology, Washington DC, p.502-531, 2003.

3. Golub B, Falk G, Spink WW. Lung abscess due to Corynebacterium equi: report of

the first human infection. Annals Internal Medicine. 66: 1174-11747, 1967.

4. Kirschner P, Meier A, Böttger EC. Genotypic identification and detection of

mycobacteria – facing novel and uncultured pathogens. In: Persing DH, Smith TF,

Tenover FC, White TJ (eds.). Diagnostic molecular microbiology principles and

applications. American Society for Microbiology, Washington. p.173-190, 1993.

5. Magnusson H. Pneumonie beim Fohlen Ein neuer Eitererreger beim Pferd. Archiv

fur Wissenschaftliche und Praktische Tierheilkunde. 50:22-37, 1923.

6. Napoleão F, Damasco PV, Ferreira TC, Camello TCF, Vale MD, Andrade AFB,

Hirata R, Guaraldi ALM. Pyogenic Liver abscess due to Rhodococcus equi in an

Immunocompetent Host. Journal Clinical Microbiology. 43:1002-1004, 2005.

7. Rabagliati BR, Morales SA, Baudrand BR, Jorquera JA, oddó DB, Garcia PC,

Carmona MCP, Cisternas MM, Huete AG. Neumonía cavitada por Rhodococcus

equi em paciente inmunocomprometido no infectado por vírus de

inmunodeficiencia humana. Caso clínico y revisión. Revista Chilena de Infetologia.

22: 155-160, 2005.

8. Sellon DC, Besser TE, Vivrette SL, McConnico RS Comparison of nucleic acid

amplification, serology, and microbiologic culture for diagnosis of Rhodococcus

equi pneumonia in foals. Journal Clinical Microbiology. 39:1289-1293, 2001.

9. Severo LC, Ritter P, Petrillo VF, Dias CAG, Porto NS. Infecção pulmonar por

Rhodococcus equi: relato dos dois primeiros casos brasileiros. Jornal de

Pneumologia. 27:158-162, 2001.

10. Tortosa-Torres M., Arrizabalaga, J, Villanueva JL, Gálvez J, Leyes M, Valencia E,

Flores J, Peña JM, Pérez-Cecilia E, Quereda C. Prognosis and Clinical Evaluation

of infection caused by Rhodococcus equi in HIV-infected patients. Chest 123:1970-

1976, 2003.

136

ANEXO VI_______________________________________________________________

Abstracts enviados e aceitos para ASM Meeting of American Society of Microbiology,

Toronto, Canadá, maio de 2007.

137

Identification and Detection of Methicilin Resistance among Coagulase-negative

Staphylococci Others than S.epidermidis

Author Block

C. Secchi

1,2

V. V. Cantarelli

, A. L. S. Antunes

, L. R. R. Perez

, P. A.

d'Azevedo

;

Fundacao Faculdade Federal de Ciencias Medicas Porto Alegre, Porto

Alegre-RS, BRAZIL,

Weinmann Laboratory, Porto Alegre-RS, BRAZIL.

Abstract:

In 2004 the Clinical and Laboratory Standards Institute (CLSI) proposed the use of

cefoxitin disks to predict resistance mediated by the mecA gene in coagulase-negative

staphylococci (CoNS). Since then, several studies have been performed to validate this

method. Our main goal was to identify all CoNS to the species level and compare the use of

cefoxitin disks with oxacillin disk and oxacillin agar dilution to detect

mecA-

mediated

oxacillin resistance in "non-epidermidis” CoNS. The sample consists of 238 "non-

epidermidis" CoNS isolated from positive blood cultures, representing 16 different species.

Species identification was performed by conventional phenotipic methods and, whenever

necessary, complemented with automated and/or molecular (sodA sequencing) methods.

Susceptibility of cefoxitin and oxacillin was detected by the disk-diffusion (DD) and agar

dilution (oxacillin only) tests and interpreted according to the CLSI (2005). The mecA gene

was detected by PCR and was considered the "gold standard".The most common "non-

epidermidis" staphylococci species detected were

Staphylococcus haemolyticus

(42%),

hominis-hominis

(29.4%),

S. warneri

(7.5%). Others species accounted for 21% of the

isolates. The mecA gene was detected in 71% (169/238) of the strains. The sensitivities of

the cefoxitin and oxacillin disks for all "non-epidermidis" CoNS were both 100%, whereas

the specificities were 100% and 91%, respectively. The sensitivity and specificity of the

agar dilution test for oxacillin were 100% and 88%, respectively. Nine strains, representing

S. sciuri

), S. saprophyticus

(2) and

S. cohnii-cohnii

(3) showed false resistance for

oxacillin with the oxacillin DD and agar dilution tests. In this study, cefoxitin DD test

demonstrated equal sensitivity and a superior specificy, PPV, NPV, and accuracy to that of

oxacillin DD and agar dilution tests, when compared to the presence of mecA gene in these

strains. Overall, our results indicate that the cefoxitin DD test is an excellent alternative to

detect mecA-mediated oxacillin resistance in species of "non-epidermidis" CoNS.

Financial support: CNPq

138

Staphylococcus hominis subsp. novobiosepticus Strains Causing Nosocomial Infection

in Brazil

Author Block

I. C. V. Palazzo1, P. A. d'Azevedo2, C. Secchi2, A. C. C. Pignatari3,

A. C.

Darini

Faculdade de Ciências Farmacêuticas de Ribeirão Preto - USP e Faculdade de Medicina de

Ribeirão Preto - USP, Ribeirao Preto, BRAZIL,

Fundação Faculdade de Ciências Médicas

de Porto Alegre - FFCMPA, Porto Alegre, BRAZIL,

Universidade Federal de São Paulo,

UNIFESP, Laboratório Especial de Microbiologia Clínica, São Paulo, BRAZIL,

Faculdade

de Ciências Farmacêuticas de Ribeirão Preto - USP, Ribeirao Preto, BRAZIL.

Abstract:

The role of coagulase-negative staphylococci (CoNS) strains in nosocomial infections has

increased dramatically. Although

Staphylococcus epidermidis

accounts for a majority of

CoNS infections, many others species are associated with human infections. Six

hominis

subsp.

novobiosepticus

(SHN) were recovered from 6 patients at different hospitals in the

cities of São Paulo and Porto Alegre, Brazil. Biochemical methods and

sodA

gene

sequencing were employed for species identification. Susceptibility profiles indicated that

the majority of strains (five) are multi drug resistant including gentamicin, ofloxacin,

ciprofloxacin, clindamycin, cefoxitin, oxacillin and show low-level resistance to

vancomycin (MIC = 4 and 6 µg/mL) as determined by agar dilution and the Etest. In

addition, these strains showed vancomycin MIC values of 12 to 24 µg/mL after growing for

10 days in BHI broth with 4 µ g/mL of vancomycin. Overlapping and multiplex PCR

indicated that five out of six strains harbored SCC

mec

type IIIA with class A

mec

and type

ccr

. Only one SHN strain was oxacillin susceptible. Molecular epidemiology indicated

that the nosocomial infection in at least 5 patients in both hospitals was caused by a single

clone of SHN and just one strain was unrelated. Data about the horizontal transfer of SCC

mec

in nosocomial strains was emphasized by molecular epidemiology because the

unrelated SHN strain harbored the same type of SCC

mec

as the other SHN strains isolated.

A predominant PFGE profile encountered in part of these isolates was also shown by the

oxacillin susceptible SHN strain. A vertical and horizontal transfer during this period was

probably responsible for the strains acquirement of the resistance element. In summary, our

data shows that SHN is an important cause of nosocomial infection. Furthermore, the

pattern of multi drug resistance showed by these strains has important clinical implications

complicated by emergence of vancomycin resistance. Financial support: FAPESP (Process

nº 2005/50273-7), CNPq and Pró-Reitoria de Pesquisa USP.

139

ANEXO VII______________________________________________________________

140

COMITÊ DE ÉTICA_______________________________________________________

Livros Grátis
( http://www.livrosgratis.com.br )
 
Milhares de Livros para Download:
 
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas

Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
 
 