ads:
Universidade Federal do Rio Grande Do Sul
Faculdade de Medicina
Programa de Pós-Graduação em Ciências Médicas: Endocrinologia
Mestrado e Doutorado
Carcinoma Medular de Tireóide Hereditário:
Aspectos Moleculares, Clínicos e Oncológicos
Marcia Khaled Puñales
Orientadora: Profa. Dra. Ana Luiza Maia
Porto Alegre, Dezembro de 2005
ads:
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
Universidade Federal do Rio Grande Do Sul
Faculdade de Medicina
Programa de Pós-Graduação em Ciências Médicas: Endocrinologia
Doutorado
Carcinoma Medular de Tireóide Hereditário:
Aspectos Moleculares, Clínicos e Oncológicos
Marcia Khaled Puñales
Orientadora: Profa. Dra. Ana Luiza Maia
Tese apresentada ao Programa de Pós-
Graduação em Ciências Médicas: Endocrinologia,
para obtenção do título de Doutor
Porto Alegre, Dezembro de 2005
2
ads:
3
A meus pais pelo incentivo inicial, fundamental
na minha formação.
A meus irmãos, Karina, Dina, Raphic e Layane
pela admiração e estimulo.
A meu noivo Boni, pelo apoio e carinho.
Agradecimentos
A minha mentora, a Profa. Dra. Ana Luiza Maia pelo incentivo a pesquisa,
ensinamentos, assistência e principalmente pela oportunidade de crescimento
pessoal e profissional nestes quase sete anos de dedicação, convivência e amizade.
Ao Prof. Dr. Jorge Luiz Gross pelo incentivo inicial, dedicação e colaboração
na realização deste trabalho.
Ao Prof. Dr. Hans Graf pelo impulso inicial em direção a “Tireóide” e
principalmente por haver me proporcionado conhecer e trabalhar com a minha
orientadora.
Aos colegas médicos e cirurgiões, por encaminharem os pacientes para a
análise genética do proto-oncogene RET.
Aos pacientes, pela contribuição e por tornarem possível a realização deste
trabalho.
A aluna de mestrado, Andréia Possatti da Rocha, pela amizade e atendimento
aos pacientes no ambulatório de câncer de tireóide.
A aluna de iniciação cientifica, Camila Meotti, importante na realização deste
trabalho durante estes anos.
As minhas amigas e colegas do laboratório, Érika Meyer, Lenara Golbert,
Renata Pavan, Paula Eichler, Emanuele Kuhn, Simone Wajner, Clarissa Capp e
Márcia Wagner pelo apoio, amizade e compreensão durante todos estes anos.
A meu noivo “Boni”, por todo o carinho e estimulo, principalmente nos
momentos difíceis e nas horas de trabalho requeridas. Seu apoio e paciência foram
primordiais na conclusão desta tese.
4
A minha família, meus pais (Karim e Nubya), meus irmãos (Kariana, Dina,
Raphic e Layane), sobrinhos (Raphael, Leonardo, Sophia e Pietra) e cunhados
(Eduardo, Farid, Leandro, Karla e Teodora) pelo carinho, amparo e apoio
principalmente nos momentos em que me mantive afastada dos compromissos
familiares.
As minhas grandes e fiéis amigas, Eliane Rozales Lopes e Adriane Maria
Rodrigues, pela força, admiração e encorajamento, mesmo que muitas vezes à
distância.
E a todos os meus amigos e colegas, que de certa forma, contribuíram para
realização deste trabalho.
5
Esta Tese de Doutorado segue o formato proposto pelo Programa de
Pós-Graduação em Ciências Médicas: Endocrinologia, Metabolismo e Nutrição,
Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, sendo
apresentada na forma de 2 manuscritos sobre o tema da Dissertação:
• Artigo de revisão geral do tema; aceito para publicação nos
Arquivos Brasileiros de Endocrinologia e Metabologia em 2005.
• Artigo (1) original referente ao trabalho de pesquisa propriamente
dito; publicado no Journal of Endocrinology and Metabolism
2003;88:2644-49.
• Artigo (2) original referente ao trabalho de pesquisa propriamente
dito; encaminhado para publicação em jornal científico de
circulação internacional.
6
Capítulo I
Carcinoma Medular de Tireóide:
Aspectos Moleculares, Clínico-Oncológicos e Terapêuticos
Artigo publicado nos Arquivos Brasileiros de Endocrinologia e Metabologia 2004;48:137-46
7
Carcinoma Medular de Tireóide:
Aspectos Moleculares, Clínico-Oncológicos e Terapêuticos
Marcia Khaled Puñales, Andreia Possatti da Rocha,
Jorge Luiz Gross, Ana Luiza Maia
Serviço de Endocrinologia, Hospital de Clínicas de Porto Alegre,
Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brasil
Título abreviado: Carcinoma Medular de Tireóide
Suporte Financeiro: Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq) e Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brasil.
Correspondência: Profa. Dra. Ana Luiza Maia, Serviço de Endocrinologia, Hospital de
Clínicas de Porto Alegre, Rua Ramiro Barcelos n° 2350, Porto Alegre, RS, Brasil, 90035-
003. Fone: 51 3332-5188, fax: 51 2101 8777. E-mail: [email protected]
8
Sinopse
O Carcinoma Medular de Tireóide (CMT) pode ocorrer na forma esporádica
ou na forma familiar. O CMT hereditário é parte das síndromes de Neoplasia
Endócrina Múltipla (NEM) 2A e 2B, Carcinoma Medular de Tireóide Familiar (CMTF)
ou outras formas. Mutações de linhagem germinativa do proto-oncogene RET
causam a forma hereditária da neoplasia e os testes genéticos atualmente
disponíveis formam a base para o manejo adequado da hereditariedade do tumor
visto que o diagnóstico precoce melhora significativamente o prognóstico no
indivíduo afetado e nos carreadores. O diagnóstico molecular do carcinoma medular
de tireóide foi implementado no Serviço de Endocrinologia do Hospital de Clínicas de
Porto Alegre em 1997, e desde então tivemos a oportunidade de analisar diferentes
famílias com um grande número de afetados. Nós observamos uma grande
variabilidade na apresentação clínica, mesmo entre indivíduos da mesma família. No
presente artigo, revisamos os avanços nos mecanismos moleculares, diagnóstico e
tratamento, bem como relatamos a nossa experiência no manejo dessa forma rara
de neoplasia tireoidiana.
Unitermos: CMT, proto-oncogene RET, MEN 2A, MEN 2B, CMTF
9
Summary
Medullary Carcinoma of the Thyroid (MTC) may be sporadic or may occur on
a hereditary basis. Hereditary MTC can occur either alone – familial MTC (FMTC) –
or as the thyroid manifestation of multiple endocrine neoplasia type 2 (MEN 2)
syndromes (MEN 2A and MEN 2B) or others. Germline mutations in RET cause
MEN 2 and genetic testing now available forms the basis for MTC screening
procedures. Our group established a protocol for molecular analysis of hereditary
MTC in 1997 and since then we have had the opportunity to study large kindred with
this disease. We observed a wide spectrum in clinical presentation and natural
course of the disease even among genetically-related individuals. Here we described
the recent advances in understanding the molecular mechanisms, diagnose and
treatment of this rare form of thyroid cancer.
Keywords: MTC, RET proto-oncogene, NEM 2A, NEM 2B, FMTC
10
Introdução
O Carcinoma Medular de Tireóide (CMT) é uma neoplasia das células C ou
parafoliculares da tireóide, correspondendo 5 – 8% dos tumores malignos da
glândula. O CMT apresenta-se como tumor esporádico (75-80%) ou na forma
hereditária (20-25%) (1). Na forma familiar é um dos componentes de uma síndrome
genética de herança autossômica dominante, apresentando-se isoladamente, na
forma de Carcinoma Medular de Tireóide Familiar (CMTF) ou como um dos
componentes das síndromes de Neoplasia Endócrina Múltipla (NEM) 2A ou 2B ou
outras formas hereditárias (2,3).
O proto-oncogene RET é o responsável pela forma hereditária da neoplasia
(4). Os testes moleculares, atualmente disponíveis formam a base para o manejo
adequado da hereditariedade do tumor, pois o diagnóstico e, consequentemente o
tratamento precoce melhoram significativamente o prognóstico no indivíduo afetado
e nos carreadores assintomáticos (5).
O diagnóstico molecular do carcinoma medular de tireóide foi implementado
no Serviço de Endocrinologia do Hospital de Clínicas de Porto Alegre em 1997, e
desde então o nosso serviço se tornou Centro de Referência para o screening
genético desse carcinoma. No presente artigo, revisamos os avanços nos
mecanismos moleculares, diagnóstico e tratamento, bem como relatamos a nossa
experiência no manejo dessa forma rara de neoplasia tireoidiana.
Epidemiologia, Classificação e Apresentação Clínica
O CMT é responsável por 5 a 8% das neoplasias malignas da tireóide, sendo
mais freqüente na forma esporádica (75-80%) do que na hereditária (20-25%) (1).
11
Na forma hereditária apresenta-se como um dos componentes das síndromes
clínicas de neoplasia endócrina múltipla tipo 2 (NEM2), sub-classificada como
Neoplasia Endócrina Múltipla Tipo 2A (NEM 2A), 2B (NEM 2B), Carcinoma Medular
de Tireóide Familiar (CMTF) e outras formas hereditárias (2,3) (Tabela 1).
Carcinoma Medular Esporádico
Na forma esporádica, o CMT se apresenta como um tumor unifocal e
unilateral, cujo diagnóstico ocorre na quinta ou sexta décadas de vida (5).
Clinicamente, o tumor se caracteriza como nódulo único ou massa tireoidiana
associada à linfadenopatia cervical ou a outros sintomas locais. Raramente pode
estar associado a diarréia, rubor ou doença metastática (1,5).
Carcinoma Medular Hereditário
O CMT hereditário manifesta-se clinicamente como um nódulo ou massa
cervical e, freqüentemente, os pacientes já apresentam comprometimento em
linfonodos cervicais ao diagnóstico. As metástases à distância e os sintomas
paraneoplásicos são eventos mais tardios na doença (5,6). O CMT hereditário é
usualmente precedido por hiperplasia celular e apresenta com maior freqüência uma
distribuição multifocal e multicêntrica. O pico de incidência ocorre na terceira e
quarta décadas de vida nas formas de NEM 2A e CMTF e mais precocemente na
NEM 2B, sendo diagnosticado na infância (2,3,6).
A síndrome genética NEM 2A se caracteriza por CMT (95%), feocromocitoma
(30 – 50%) e hiperparatireoidismo (10 – 20%) (2,3). A doença adrenomedular é
12
usualmente multicêntrica e bilateral, geralmente detectada após o aparecimento de
CMT e com taxa de malignidade inferior a 10% (2,3,6,7). O hiperparatireoidismo
ocorre em aproximadamente 10 a 20% dos indivíduos com NEM 2A, acometendo
geralmente todas as glândulas paratireóides (2,3,6). A lesão histológica mais
comumente observada nos estágios iniciais da doença é a hiperplasia da glândula,
porém se a doença é diagnosticada mais tardiamente a lesão adenomatosa se
superpõe à hiperplasia (1,6). A síndrome NEM 2A foi subdivida em três subtipos
fenotípicos, baseando-se na apresentação clínica (tabela 1): a) NEM 2A (1), que
consiste nos indivíduos que apresentam os três componentes da síndrome (CMT,
feocromocitoma e hiperparatireoidismo); b) NEM 2A (2), que incluí indivíduos que
apresentam CMT e feocromocitoma, sem hiperparatireoidismo; c) NEM 2A (3),
que está relacionado a indivíduos com CMT e hiperparatireoidismo, sem
feocromocitoma (2,3). Outras associações raras da NEM 2A incluem a associação
com uma lesão pruriginosa da região escapular caracterizada pela deposição de
amilóide, conhecida como líquen amilóide cutâneo (CLA) e a doença de
Hirschsprung (8-10).
A síndrome NEM 2B caracteriza-se por CMT (90%), feocromocitoma (45%),
ganglioneuromatose (100%) e hábitos marfanóides (65%) (2,3). Essa síndrome
caracteriza-se por um fenótipo único que incluí ganglioneuromatose difusa da língua,
lábios, olhos e do trato gastrointestinal (2,3,11). As fácies características são
precocemente reconhecidas durante a infância (neuromas da mucosa) (2,3,11). O
envolvimento gastrointestinal pode causar diarréia e constipação intermitente, dor
abdominal, megácolon e ocasionalmente obstrução intestinal (2,3,11). Outro aspecto
fenotípico da NEM 2B é o hábito marfanóide com dedos e extremidades longas,
hiperextensão de articulações e anormalidades epifisárias (2,3,11).
13
O CMTF consiste na presença de CMT isolado em pelo menos quatro
membros da mesma família e as outras formas de CMT hereditário, consistem no
acometimento de dois ou três membros da mesma família com CMT, sem a
presença de feocromocitoma ou hiperparatireoidismo (2,3).
Aspectos Bioquímicos
O CMT é um tumor cujas células C produzem uma variedade grande de
substâncias, incluindo: calcitonina (CT), calcitonin gene-related peptide (CGRP),
antígeno carcinoembrionário (CEA), amilóide, somatostatina, hormônio
adrenocorticotrófico (ACTH), peptídeo intestinal vasoativo (VIP), prostaglandinas,
serotonina e outras (12,13). A CT é o marcador mais importante sendo utilizado na
detecção, no manejo pós-cirúrgico dos indivíduos com CMT e na avaliação de
indivíduos afetados ou com risco de apresentar a doença. Visto que alguns
indivíduos apresentam níveis normais de CT, as vezes são necessários testes
provocativos para avaliar a sua secreção (12,13). Os testes de estímulo podem ser
realizados com a infusão de cálcio ou pentagastrina e mais recentemente com
omeprazole (12-14). Esses testes apresentam algumas dificuldades de realização,
bem como uma baixa especificidade e sensibilidade (falso-positivos e falso-
negativos podem ser observados de 5 a 18% dos casos) (5,6,12). Além da CT,
outras substâncias podem ser avaliadas nestes pacientes como o CEA e o CGRP
plasmático.
14
Aspectos Moleculares
Gene envolvido e Mutações
Em 1970, iniciaram os primeiros estudos para identificação da mutação
genética causadora do CMT (14-16). No entanto somente em 1993 foi identificado o
proto-oncogene RET como o gene causador da neoplasia (4). O proto-oncogene
RET apresenta 21 exons e codifica um receptor tirosino-quinase expresso nas
células derivadas da crista neural, incluindo tumores neuroendócrinos originados
dessas células (17). A proteína RET é constituída por 3 domínios: um domínio
extracelular que contêm o peptídeo sinalizador com regiões cadherin-like e regiões
ricas em cisteínas; um domínio transmembrana e uma porção intracelular contendo
dois domínios tirosino-quinase (TK1 e TK2) (Figura 1) (18,19).
O ligante do RET foi identificado em 1996, um peptídeo da superfamília do
TGF-β (transforming growth factor), denominado glial neurotrophic derived factor
(GNDF), atuando via receptores α-GDNF (20). O GNDF-α acoplado ao seu receptor
específico liga-se à porção extracelular do RET, causando a dimerização do receptor
com posterior autofosforilação dos resíduos tirosina-quinase, liberando fosfato, um
substrato importante na cadeia do crescimento e diferenciação celular. Mutações no
gene determinam uma ativação permanente do RET desencadeando o processo
neoplásico (21-23).
Mutações do tipo missense originárias da linhagem germinativa celular são
responsáveis pelo carcinoma medular de tireóide hereditário. Os exons mais
comumente afetados são os exons 10, 11 e 16, no entanto, mutações nos exons 13,
14 e 15 também foram descritas (24-29) (tabela 1). As mutações mais
15
frequentemente encontradas no CMTF e NEM 2A ocorrem nos resíduos de cisteína
do exon 10 (códon 609, 611, 618, 620) e do exon 11 (códon 634) (24-27). Nos
pacientes com CMTF as mutações estão distribuídas homogeneamente entre os
códons 618, 620 e 634, ao contrário dos pacientes com NEM 2A, cuja mutação mais
comum ocorre no códon 634 (24-27). Uma mutação específica no códon 918
(M918T), exon 16, está associada a 95% dos casos de NEM 2B (29). Recentemente
foi identificada uma nova mutação no exon 8 (1597G→T) correspondendo a uma
substituição glicina → cisteína no domínio extracelular do RET associado a CMTF
(30).
Correlações Clínicas e Moleculares
Nos últimos anos diferentes estudos têm sido realizados com o objetivo de
avaliar possíveis correlações entre mutações específicas e as diferentes
apresentações clínicas (2,3). Diferenças na intensidade da indução da dimerização
do receptor constitui uma explicação razoável na determinação dos diferentes
fenótipos resultantes de mutações nas diferentes cisteínas. De fato, em estudo
multicêntrico de mutações no RET que avaliou 477 famílias com NEM 2, observou-
se que mutações códon-específica do RET se correlacionavam com os diferentes os
fenótipos da NEM 2 (2). Mutações no códon 634, por exemplo, foram associadas à
presença de feocromocitoma e hiperparatireoidismo, sendo que o tipo de mutação
que ocorre de modo mais freqüente na NEM 2A, C634R, não foi detectada em
nenhum caso de CMTF. Mutações nos códons 768 e 804 foram identificadas
unicamente em casos de CMTF e no códon 918 especificamente na NEM 2B (2).
Nesse estudo, a síndrome de NEM 2A foi a mais freqüente e o CMTF foi
16
diagnosticado somente em 10% dos casos. No entanto, em um estudo similar
francês a prevalência de CMTF foi de aproximadamente 60% (31), sugerindo que
freqüência de determinadas mutações pode variar de acordo com o background
genético. A nossa casuística indica que a maioria das famílias brasileiras afetadas
apresenta o fenótipo 2A (32).
Alguns autores têm sugerido uma classificação de risco de acordo com a
localização das mutações, sendo que os códons 634 e 618 seriam considerados de
elevado risco de transformação neoplásica, os códons 790, 620 e 611 de risco
intermediário e os códons 804 e 768 de baixo risco de malignidade (6). Outros
estudos, no entanto, têm chamado a atenção para a ampla variabilidade clínica e
agressividade tumoral associadas a mutações no RET em códons classicamente
descritos como de baixa atividade (ex. 804), indicando que mutações idênticas
podem se comportar de modo diferente em um grupo com mesmo background
genético (33-36). Em estudo recente realizado em nosso serviço observamos que
pacientes com mutações no códon 634, consideradas de alto risco, também
apresentam uma grande heterogeneidade clínica da NEM 2A (32). Nesse estudo
também observamos que indivíduos com a mutação C634R apresentavam
significativamente mais metástases a distância que indivíduos com o genótipo
C634Y, sugerindo que trocas específicas de nucleotídeos nesse códon podem
alterar a evolução natural da doença na NEM 2A. Visto que a disfunção do gene
está presente desde o nascimento, ou seja, os indivíduos nascem com essa
alteração genética, assumimos que a idade do indivíduo ao diagnóstico indicaria o
período de exposição. A análise através de curvas de Kaplan-Meier quanto à
presença de metástases locais e à distância ao diagnóstico, comparando a troca de
aminoácido C634R e C634Y, demonstrou uma diferença significativa entre os 2
17
genótipos (Figura 2) (32). No entanto, recentemente um estudo multicêntrico
avaliando apenas carreadores idade inferior a 20 anos não encontrou diferenças na
progressão da hiperplasia das células C para carcinoma medular entre as diferentes
trocas de aminoácidos no códon 634 (3).
Um outro aspecto interessante descrito é o fenômeno denominado
“antecipação” da doença, ou seja, o aparecimento do CMT em indivíduos cada vez
mais jovens através das gerações, sugerindo a participação de outros eventos
moleculares no inicio do processo neoplásico. De fato, embora as mutações no RET
estejam diretamente implicadas no processo neoplásico na NEM 2, o motivo pelo
qual apenas um pequeno grupo celular no órgão afetado adquire o potencial
oncogênico ainda não foi elucidado (37). Outros mecanismos moleculares como a
trissomia do cromossoma 10 com duplicação do alelo mutante RET ou perda do
alelo wild-type têm sido sugeridos como co-responsáveis (38,39). Recentemente,
rearranjos do RET através de translocações, inversões ou alterações genômicas
extensas, com aumento na expressão do RET mutante também foi associado ao
processo neoplásico no CMT (40). Outros estudos sugerem a associação de
determinados polimorfismos como G691S (exon 11) e S904S (TCC-TCG, exon 15),
ao diagnóstico mais precoce do carcinoma hereditário (41).
Carcinoma Medular Esporádico
Os processos moleculares envolvidos na etiologia do carcinoma medular de
tireóide esporádico permanecem pouco compreendidos. Cerca de 50% dos CMT
esporádicos apresentam a mutação somática M918T (42-46). Esta mutação não
parece ser uniforme entre as várias subpopulações de células dentro de um mesmo
18
tumor ou das metástases, sugerindo que o CMT esporádico possa ter uma origem
policlonal ou que as mutações do proto-oncogene RET não sejam eventos iniciais na
tumorigênese do carcinoma (26,43).
Polimorfismos (variações genômicas que ocorrem em mais de 1% da
população) do RET foram identificados em pacientes com CMT esporádico e doença
de Hirschsprung (39,47-49). Gimm e cols. investigando variações genéticas que
levassem ao CMT esporádico, encontraram uma frequência significativamente maior
do polimorfismo no códon 836 (S836S; AGC/AGT) nos pacientes com CMT
esporádico com a mutação somática M918T comparada à população controle (47).
Mais tarde, Ruiz e colbs. confirmaram estes achados na população de origem
espanhola com CMT, encontrando um risco 2 a 3 vezes maior da neoplasia quando
a sequência variante S836S estava presente (48). Borrego e cols. observaram nos
pacientes com doença de Hirschsprung uma frequência maior dos polimorfismos
A45A e L769L comparada à população normal (49). Em adição, Wiench e cols.
observaram que o polimorfismo L769L era mais frequente nos pacientes jovens (<
30 anos) com CMT esporádico do que em paciente mais idosos (36 vs. 15%,
respectivamente), entretanto a relevância dos resultados para esta população não
foi determinada visto que o estudo não avaliou a frequência em um grupo de
indivíduos controle (40).
Apesar da série de estudos demonstrando a associação de tumores com
mutações somáticas do proto-oncogene RET, a dúvida quanto à gênese tumoral
permanece já que a mutação ocorre em apenas uma parcela dos casos. Embora o
CMT hereditário tenha os mecanismos moleculares bem definidos, o diagnóstico do
câncer parece ocorrer em idades mais precoces a cada geração, sugerindo que
19
fatores ambientais ou uma segunda alteração genética possam estar envolvidos
com este processo.
Rastreamento
A aplicação do screening genético para o manejo adequado da
hereditariedade do CMT possibilita o diagnóstico precoce e é de fundamental
importância, já que determina a conduta terapêutica e o prognóstico da doença no
indivíduo afetado e em seus familiares. Além disso, apresenta baixo custo e não
possuí efeitos colaterais como os observados com os testes provocativos como
elevado índice de falso-positivo e falso-negativo.
Um estudo comparativo entre o screening clínico e a análise de DNA em
famílias com NEM 2 concluiu que a diagnóstico molecular é superior na identificação
dos indivíduos carreadores e em risco para o desenvolvimento da síndrome (13). O
teste genético deve ser indicado em indivíduos afetados com a neoplasia,
independente da idade ao diagnóstico. Em caso de identificação da mutação os
ascendentes e descendentes diretos desse indivíduo devem ser analisados. Os
indivíduos RET negativos estão dispensados do acompanhamento médico, não
sendo necessário realizar screening para feocromocitoma e/ou hiperparatireoidismo.
Nos indivíduos testados positivamente para mutações no RET, está indicado a
tireoidectomia total (vide abaixo) e a avaliação bioquímica para o feocromocitoma e
hiperparatireoidismo.
No nosso Serviço foram detectadas mutações em 28 indivíduos carreadores
assintomáticos no total de 184 indivíduos analisados no período 1997-2003, sendo
identificadas mutações em todos aqueles com diagnóstico clínico e histopatológico
20
de CMT.
A avaliação molecular é indicada também nos casos de CMT esporádico,
no sentido de excluir doença familiar, já que, segundo alguns relatos, o CMT
hereditário pode existir em contexto aparentemente esporádico. De fato, dos 17
probandos identificados no nosso Serviço, três (18%) foram encaminhados como
portadores de carcinoma esporádico. Esses casos ilustram a necessidade do
rastreamento molecular nos casos de CMT aparentemente esporádico, confirmando
dados da literatura que demonstram que a análise genética pode identificar
mutações em até 25% dos casos esporádicos.
Aspectos Terapêuticos
Cirurgia:
A cirurgia é o procedimento de escolha no tratamento das doenças
relacionadas à NEM 2A. A possibilidade de cura do carcinoma medular de tireóide,
única neoplasia maligna da síndrome, depende principalmente do estadio tumoral ao
diagnóstico e da ressecção completa do tumor.
Carcinoma Medular de Tireóide: O tratamento primário recomendado é a
tireoidectomia total com dissecção dos linfonodos cervicais, compartimento central
(nível VI e VII) e cadeias cervicais bilaterais (níveis II, III, IV, V) (50,51). Os
linfonodos quando abordados de maneira meticulosa elevam as taxas de cura
bioquímica melhorando o prognóstico (52).
A recorrência da doença, ou seja, uma elevação nos níveis de calcitonina, é
um problema freqüente no acompanhamento destes pacientes. O quadro clínico
21
associado é o que melhor define a conduta nestes casos: (1) pacientes sintomáticos
ou com doença cervical progressiva mas sem evidências de metástases à distância
são candidatos a um novo procedimento cirúrgico; (2) pacientes com curso indolente
da doença, tratamento cirúrgico inicial adequado e métodos de imagem negativos
podem ser acompanhados de maneira conservadora (53).
Os familiares de pacientes com NEM 2 e carreadores da mutação devem
realizar tireoidectomia total com exploração da região cervical. No entanto, a
linfadenectomia do compartimento central não é consenso. O procedimento deve ser
indicado o mais precocemente possível na NEM 2B, sendo recomendado antes dos
6 meses de vida (54).
Nos indivíduos com NEM 2A, a indicação da tireoidectomia
depende do tipo de mutação (códon/nucleotídeo). Os indivíduos carreadores de
mutações nos códons 634 e 618, consideradas mais agressivas e diagnosticadas
mais precocemente, devem ser tireoidectomizados entre 5 - 7 anos (6,54-57). Para
mutações de risco intermediário (códons 611, 620 e 790) o procedimento é indicado
antes dos 14 anos, enquanto para as de baixo risco (códons 768 e 804) antes dos
20 anos de idade (6,54-57). Para o tratamento profilático, consideramos também o
tipo de troca de nucleotídeo ocorrida no códon 634, já que determinadas
substituições de aminoácidos podem determinar uma alteração no curso da doença
(32).
Feocromocitoma: A adrenalectomia bilateral é o procedimento mais
recomendado, porém existem algumas divergências quanto à conduta cirúrgica mais
adequada em pacientes com feocromocitoma associado à NEM tipo 2 (54,58,59).
Alguns autores preconizam a adrenalectomia bilateral devido ao elevado número de
recorrências (5). No entanto, a adrenalectomia unilateral diminui a necessidade e o
22
tempo de reposição de corticosteróides. Uma nova abordagem terapêutica é a
ressecção da medula com preservação do córtex adrenal, com resultados
promissores (60).
Hiperparatireoidismo: No hiperparatireoidismo associada a NEM 2A
geralmente ocorre um acometimento difuso das paratireóides (5). Não existe
consenso quanto à melhor técnica cirúrgica nestes casos. Os procedimentos
freqüentemente empregados são a paratireoidectomia total com autotransplante, a
paratireoidectomia subtotal preservando uma parte bem vascularizada de uma das
glândulas in situ ou a ressecção de uma única paratireóide (61).
Outros Tratamentos
Quimioterapia:
A quimioterapia apresenta resultados limitados no tratamento do carcinoma
medular de tireóide. Os estudos descritos na literatura, séries de casos, mostram
que os agentes quimioterápicos não alteram a sobrevida destes pacientes (62). Os
melhores resultados são descritos em termos de estabilização de doença,
geralmente durante períodos curtos, ou de resposta parcial, com taxas em torno de
15 a 30% (63-65). Desse modo a quimioterapia tem sido recomendada, com
restrições, a poucos pacientes com doença metastática rapidamente progressiva.
Uma variedade de drogas já foi utilizada nos protocolos de tratamento, incluindo
23
doxorrubicina, cisplatina, ciclofosfamida, bleomicina, vincristina, paclitaxel, 5-
fluorouracil e dacarbazina (63-65).
Radioterapia:
A resposta ao tratamento com radioterapia externa também é considerada
insatisfatória nos pacientes com carcinoma medular de tireóide. Alguns indivíduos
com tumores inoperáveis, especialmente aqueles com metástases ósseas, podem
se beneficiar com o tratamento radioterápico (66). Recentemente, Brierley e colbs.
avaliando pacientes de alto risco (doença residual microscópica, envolvimento de
linfonodos ou invasão extra-glandular) observaram uma menor freqüência de
recidiva local entre os tratados quando comparados com os não tratados com
radioterapia no pós-operatório (67). Possíveis complicações da radioterapia externa
sobre a região cervical incluem fibrose cervical, traqueíte actínica, disfagia crônica e
paraplegia (5).
Radiofármacos:
O emprego de
131
I MIBG e
90
Y-DOTA-D-Phe
1
-Tyr
3
-octreotídeo no tratamento
do carcinoma medular de tireóide tem demonstrado efeitos limitados (62,68). A
radioimunoterapia é uma nova modalidade terapêutica, na qual anticorpos
monoclonais anti-antígeno carcinoembriônico são utilizados para o tratamento do
CMT (68,69). Em um estudo de fase I, delineado para avaliar toxicidade de doses
24
escalonadas da droga, doze pacientes receberam
131
I anti-CEA Mab, sendo a
remissão parcial observada apenas em 1 e estabilização da doença em 10 pacientes
(69).
Modificadores de resposta biológica:
O octreotídeo e o α-interferon são utilizados em pacientes com doença
metastática avançada com o objetivo de reduzir os níveis de calcitonina e melhorar
os sintomas relacionados aos níveis elevados do hormônio, tais como o rubor e a
diarréia.
Não foram observadas alterações no tamanho tumoral com o uso destas
drogas (62).
Terapia gênica:
Ainda em fase experimental com modelos animais, a terapia gênica abre uma
perspectiva promissora para o tratamento do CMT (70). Distintas abordagens têm
sido utilizadas: introdução de genes supressores tumorais; transferência de genes
que determinam a ativação de drogas para formas tóxicas (genes suicidas);
transferência de genes que aumentam a resposta imunológica contra o câncer
(imunização gênica) e terapias combinadas (70-72).
25
Seguimento
As dosagens séricas de calcitonina e antígeno carcinoembrionário devem ser
obtidas em torno de 2 meses após a tireoidectomia, devido à meia-vida longa destes
marcadores na circulação sanguínea (52). Os níveis normais de calcitonina são
excelentes indicadores de uma ressecção curativa, enquanto que níveis elevados
desse marcador indicam a necessidade do rastreamento de metástases (6,12).
A ultrassonografia / tomografia computadorizada está indicada quando existir
suspeita de recidiva cervical. Disseminação local e metástases à distância podem
ser avaliadas por tomografia computadorizada ou ressonância nuclear magnética.
Cintilografia é recomendada na investigação de metástases ósseas. Uma variedade
de radioisótopos também são empregados, incluindo
131
I-MIBG,
111
In-octreotídeo,
99
Tc-DMSA,
131
I anti-CEA e anti-calcitonina (52,62). No entanto, nenhum dos exames
de imagem tem demonstrado sensibilidade na localização da doença oculta.
As técnicas diagnósticas mais invasivas parecem apresentar melhores
resultados. Dosagens de calcitonina obtidas através de cateterização seletiva são
úteis para orientar a remoção do tecido tumoral oculto (62). As micro-metástases
hepáticas têm sido demonstradas pela laparoscopia em muitos pacientes que
apresentam tomografia computadorizada e ressonância nuclear magnética normais
(53).
Os pacientes com NEM 2A devem ser investigados periodicamente para
doença adrenomedular e hiperparatireoidismo. Em nosso serviço, estes pacientes
além da dosagem de calcitonina e antígeno carcinoembriônico semestral, são
avaliados para o hiperparatireoidismo através das determinações séricas do cálcio e
PTH anualmente. Determinações das metanefrinas / catecolaminas urinárias, assim
26
como tomografia computadorizada de tórax, abdome e região cervical são realizadas
anualmente. O rastreamento com metaiodobenzilguanidina é indicado para
pacientes com níveis elevados de calcitonina e cuja doença não foi localizada pelos
exames radiológicos.
27
Referências Bibliográficas
1. Ponder BA. The phenotypes associated with RET mutations in the multiple
endocrine neoplasia type 2 syndromes. Cancer Res 1999;59:1736-42.
2. Eng C, Clayton D, Schuffenecker I, Lenoir G, Cote G, Gagel RF et al. The
relationship between specific RET proto-oncogene mutation and disease
phenotype in multiple endocrine neoplasia type 2. JAMA 1996;276:1575-79.
3. Mulligan LM, Marsh DJ, Robinson BG, Schuffeenecker I, Zedenius J, Lips CJM et
al. International RET mutation consortium. Genotype-phenotype correlation in
multiple endocrine neoplasia type 2: report of international RET mutation
consortium. J Intern Med 1995;238:343-46.
4. Mulligan LM, Kwok JB, Healey CS, Elsdon MJ, Eng C, Gardner E et al. Germ-line
mutation of the RET proto-oncogene in multiple endocrine neoplasia type 2a.
Nature 1993;363:458.
5. Heshmati HM, Gharib H, HeerdenJA, Sizemore GW. Advances and controversies
in the diagnosis and management of medullary thyroid carcinoma. Am J Med
1997;103:60-69.
6. Machens A, Gimm O, Hinze R, Hoppner W, Boehm BO, Dralle H. Genotype-
phenotype correlations in hereditary medullary thyroid carcinoma: oncological
features and biochemical properties. J Clin Endocrinol Metab 2001;86:1104-09.
7. Casanova S, Rosenberg-Bourgin M, Farkas D. Pheochromocytoma in multiple
endocrine neoplasia type 2a: survey of 100 cases. Cllin Endocrinol
1993;38:531-35.
28
8. Gagel R, Levy ML, Donovan DT, Alford BR, Wheeler B, Tschen JA. Multiple
endocrine neoplasia type 2
associated with cutaneous lichen amyloidosis. Ann
Intern Med 1989;111:802-06.
9. Nunziata V, Giannattasio R, Di Giovani G, D’Armiente MR, Mancini M. Hereditary
localized pruritus in affected members of a kindred with multiple endocrine
neoplasia type 2A (Sipple’s syndrome). Clin Endocrinol (Oxf) 1989; 30:57-63.
10. Eng C, Flier JS, Underhill LH. The RET proto-oncogene in multiple endocrine
neoplasia type 2 and Hirsprung’s disease. N Engl J Med 1996;335:943-51.
11. Eng C, Smith D, Healy CS, Mulligan L, Clayton D, Kwok JBJ et al. Point mutation
within the tyrosine kinase domain of the RET proto-oncogene in multiple
endocrine neoplasia type 2 B and related sporadic tumors. Hum Mol Genet
1994;3:237-41.
12. Lips CJM, Höppener JWM, Thijssen JHH. Medullary thyroid carcinoma: role of
genetic testing and calcitonin measurement. Ann Clin Biochem 2001;38:168-79.
13. Lips CJM, Landsvater RM, Hoppener JWM, Geerdink RA, Blijham G, Van Venn
JS et al. Clinical screening as compared with DNA analysis in families with
multiple endocrine neoplasia type 2 a. N Engl J Med 1994;331:828-35.
14. Simpson NE, Kidd KK, Goodfellow PJ, McDermid H, Myers S, Kidd JR et al.
Assignment of multiple endocrine neoplasia type 2a to chromosome 10 by
linkage. Nature 1987;328:528-30.
15. Mole SE, Mulligan LM, Healey CS. Localization of the gene for multiple endocrine
neoplasia type 2a to 480 kb region in chromosome band 10q112. Hum Mol
Genet 1987;2:247-51.
29
16. Mathew CG, Chin KS, Easton DF, Thorpe K, Carter C, Lion GI et al. A linked
genetic marker for multiple endocrine neoplasia type 2a on chromosome 10.
Nature 1987;328:527-28.
17. Takahashi M, Cooper GM. Cloning and expression of the RET proto-oncogene
encoding a tyrosine-kinase with two potential transmembrane domain. Oncogene
1988;3:571-76.
18. Kwok J, Gardner E, Warner JP, Bruce AJ, Mulligan LM. Structural analysis of the
human RET proto-oncogene using exon trapping. Oncogene 1993:8:2575-82.
19. Jing S, Wen D, Yu Y. GDNF-induced activation of the ret protein tyrosine kinase
is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell 1996:85:1113-16.
20. Durbec P, Gutirerrez MCV, Kikenny C. GNDF signaling through the RET receptor
tyrosine kinase. Nature 1996,381:789-92.
21. Santoro M, Mellilo RM, Carlomagno F, Fusco A, Vecchio G. Molecular
mechanism of RET activation in human cancer. Ann NY Acad Science 2002;
117-21.
22. Santoro M, Carlomagno F, Mellito RM, Billaud M, Vecchio G, Fusco A. Molecular
mechanisms of RET activation in human neoplasia. J Endocrinol Invest
1999;22:811-19.
23. Santoro M, Carlomagno F, Romano A, Bottaro DP, Dathan NA, Grieco M et al.
Activation of RET as a dominant transforming gene by germline mutations of
MEN 2A and MEN 2B. Science 1995;267:381-83.
24. Donis-Keller H, Dou S, Chi D, Carlson KM, Toshima K, Lairmore TC et al.
Mutation in the RET proto-oncogene are associated with MEN2A and CMTF.
Human Mol Genet 1993;2:851-56.
30
25. Quadro L, Panariello L, Salvatore D, Carlomagno F, Del Frete M, Nunziata V et
al. Frequent RET protooncogene mutations in multiple endocrine neoplasia type
2a. J Clin Endocrinol Metab 1994;79:590-94.
26. Eng C, Mulligan LM, Healey CS, Houghton C, Frilling A, Raue F et al.
Heterogeneous mutation of the RET proto-oncogene in subpopulations of
medullary thyroid carcinoma. Cancer Research 1996;56: 2167-70.
27. Hofstra RMW, Fattoruso O, Quadro L, Wu Y, Libroia A, VergaU, Calantuoni V,
Buys CHCM. A novel point mutation in the intracellular domain of RET proto-
oncogene in a family with medullary thyroid carcinoma. J Clin Endocrinol Metab
1997;82:4176-78.
28. Gimm O, Marsh DJ, Andrew SD, Frilling A, Dania PL, Mulligan LM. Germline
dinucleotide mutation in codon 883 of the RET proto-oncogene in multiple
endocrine neoplasia type 2b without codon 918 mutation. J Clin Endocrinol
Metab 1997;82:3902-04.
29. Eng C, Smith D, Healy CS, Mulligan L, Clayton D, Kwok JBJ et al. Point mutation
within the tyrosine kinase domain of the RET proto-oncogene in multiple
endocrine neoplasia type 2 B and related sporadic tumors. Hum Mol Genet
1994;3:237-41.
30. Silva AMA, Maciel RM, Silva MRD, Toledo SRC, Carvalho MB, Cerutti JM. A
novel germ-line point mutation in RET exon 8 (gly
533
cys) in a large kindred with
familial medullary thyroid carcinoma. J Clin Endocrinol Metab 2003;88:4862-66..
31. Niccoli-Sire P, Murat A, Rohmer V, Frank S, Chabrier G, Baldet L et al. The
French calcitonin tumors study group (GETC). Familial medullary thyroid
carcinoma with noncysteine RET mutations: phenotype-genotype relationship in a
large series of patients. J Clin Endocrinol Metab 2001;86:3746-53.
31
32. Punales MK, Graf H, Gross JL, Maia AL. RET codon 634 mutations in multiple
endocrine neoplasia type 2: variable clinical features and clinical outcome. J Clin
Endocrinol Metab 2003;88:2644-49.
33. Feldman GL, Edmonds MW, Ainsworth PJ, Schuffenecker I, Lenoir GM, Saxe AW
et al. Variable expressivity of familial medullary thyroid carcinoma (FMTC) due to
a RET V804M (GTG→ATG) mutation. Surgery 2000;128:93-98.
34. Machens A, Niccoli-Sire P, Hoegel J, Frank-Raue K, Van Vroonhoven TJ, Roeher
HD, Wahl RA, Lamesch P, Raue F, Conte-Devolx B, Dralle H; European Multiple
Endocrine Neoplasia (EUROMEN) Study Group. Early malignant progression of
hereditary medullary thyroid cancer. N Engl J Med 2003;16:1517-25.
35. Puñales MK, Graf H, Gross JL, Maia AL. Rastreamento genético do carcinoma
medular de tireóide: identificação de mutações no proto-oncogene RET. Arq
Bras Endocrinol & Metab 2002;46:632-39.
36. Lombardo F, Baudin E, Chiefari E, Arturi F, Bardet S, Caillou B et al. Familial
medullary thyroid carcinoma: clinical variability and low aggressiveness
associated with RET mutation at codon 804. J Clin Endocrinol Metab
2002;87:1674-80.
37. Huang SC, Koch CA, Vortmeyer AO, Pack SD, Lichtenauer, Mannan P et al.
Duplication of the mutant RET allele in trissony 10 or loss of the wild-type allele in
multiple endocrine neoplasia type 2-associated pheochromocytoma. Cancer Res
2000;60:6223-26.
38. Huang SC, Torres-Cruz J, Pack SD, Koch CA, Vortmeyer AO, Mannan P et al.
Amplification and overexpression of mutant RET in multiple endocrine neoplasia
type 2-associated medullary thyroid carcinoma. J Clin Endocrinol Metab 2003;
88:459-63.
32
39. Wiench M, Wygoda Z, Gubala E, Wloch J, Lisowska K, Krassowski J et al.
Estimation of risk of inherited medullary thyroid carcinoma in apparent sporadic
patients. J Clinical Oncology 2001;19:1374-80.
40. Robledo M, Gil L, Pollán M, Cebrián A, Ruíz S, Azañedo M et al. Polymorphisms
G691S/S904S of RET as genetic modifiers of men 2a. Cancer Res
2003;63:1814-17.
41. Eng C. RET proto-oncogene in the development of human cancer. J Clin
Oncology 1999;17:380-93.
42. Eng C, Thomas G, Neuberg DS, Mulligan LM, Healey CS, Houghton C et al.
Mutation of the RET proto-oncogene is correlated with RET Immunostaining of
cells in sporadic medullary carcinoma. J Clin Endocrinol Metab 1998;83:4210-
13.
43. Romei C, Elisei R, Pinchera A, Ceccherini I, Molinaro E, Mancusi F et al. Somatic
mutations of the RET proto-oncogene in sporadic medullary thyroid carcinoma
are not restricted to exon 16 and are associated with tumor recurrence. J Clin
Endocrinol Metab 1996;81:1619-22.
44. Komminoth P, Roth J, Mullleta-Feurer S, Saremaslani P, Seelentag WKF, Heitz
PU. RET proto-oncogene point mutations in sporadic neuroendocrine tumors. J
Clin Endocrinol Metab 1996;81:2041-46.
45. Hofstra RMW, Stelwagen T, Stulp RP, Jong D, Hulsbeek M, Kamsteeg E et al.
Extensive mutation scanning of RET in sporadic medullary thyroid carcinoma and
RET and VHL in sporadic pheochromocytoma reveals involviment of these genes
in only a minority of cases. J Clin Endocrinol Metab 1996;81:2881-84.
33
46. Eng C, Mulligan LM, Healey CS, Houghton C, Frilling A, Raue F et al.
Heterogeneous mutation of the RET proto-oncogene in subpopulations of
medullary thyroid carcinoma. Cancer Research 1996;56:2167-70.
47. Gimm O, Neuberg DS, Marsh DJ, Dahia PLM, Hoang-Vu C, Raue F et al. Over-
representation of a germline RET sequence variant in patients with sporadic
medullary thyroid carcinoma and somatic RET codon 918 mutation. Oncogene
1999;18:1369-73.
48. Ruiz A, Antiñolo G, Fernandez RM, Eng C, Marcos I, Borrego S. Germline
sequence variant S836S in the RET proto-onogene is associated with low level
predisposition to sporadic medullary thyroid carcinoma in the spanish population.
Clin Endocrinol 2001;55:399-402.
49. Borrego S, Saez ME, Ruiz A, Gimm O, Lopez-Alonso M, Antinolo G, Eng C.
Specific polymorphisms in the RET Proto-oncogene are over-represented in
patients with Hirschsprung disease and may represent loci modifying phenotypic
expression. J Med Genet 1999;36:771-74.
50. Cohen MS, Moley JF. Surgical treatment of medullary thyroid carcinoma. J Intern
Medicine 2003;253:616-26.
51. Scollo C, Baudin E, Travagli JP, Caillou B, Bellon N, Leboulleux S, Schlumberger
M. Rationale for central and bilateral lynph node dissection in sporadic and
hereditary medullary thyroid cancer. J Clin Endocrinol Metab 2003;88:2070-75.
52. Randolph GW, Maniar D. Medullary carcinoma of the thyroid. Cancer Control
2000;7:253-60.
53. Moley JF, Denedetti MK, Dilley WG, Tissel LE, Wells SA. Surgical management
of patients with persistent or recurrent medullary thyroid cancer. J Intern
Medicine 1998;243:521-26.
34
54. Brandi ML, Gagel RF, Angeli A, Bielezikian JP, Paolo BP, Bordi C, et al.
Guidelines for diagnosis and therapy of MEN type 1 and type 2. J Clin
Endocrinol Metab 2001;86:5658-71.
55. Cote GJ, Gagel R. Lessons learned from the management of a rare genetic
cancer. N Engl J Med 2003;349:1566-68.
56. Sanso GE, Domene HM, Rudaz MCG, Pusiol E, Mondino AK, Roque M, et al.
Very early detection of RET proto-ongogene mutation is crucial for preventive
thyroidectomy in multiple endocrine neoplasia type 2 children. Cancer
2002;94:323-30.
57. Hansen HS, Torring H, Godballe C, Jäger AC, Nielsen FC. Is thyroidectomy
necessary in RET mutations carriers of familial medullary thyroid carcinoma
syndrome? Cancer 2000;89:863-67.
58. Modigliani E, Vassen HM, Raue K, Dralle H, Frilling A, Gheri RG, et al, &
Euromen Study Group. Pheochromocytoma in multiple endocrine neoplasia type
2: European study. J Intern Medicine 1995;238:363-67.
59. Pacak K, Linehan M, Eisenhofer G, Walther MM, Goldstein DS. Recent advances
in genetics, diagnosis, localization and treatment of pheochromocytoma. Ann
Intern Med 2001;134:315-329.
60. Porpiglia F, Destefanis P, Bovio S, Allasino B, Orlandi F, et al. Cortical-sparing
laparoscopic adrenalectomy in a patient with multiple endocrine neoplasia type
IIA. Horm Res 2002;57:197-99.
61. Raue F, Kraimps JL, Dralle H, Cougard P, Proye C, et al. Primary
hyperparathyroidism in multiple endocrine neoplasia type 2A. J Internal
Medicine 1995;238:369-73.
35
62. Orlandi F, Caraci P, Mussa A, Saggiorato E, Pancani G, Angeli A. Treatment of
medullary thyroid carcinoma update. Endocrine-Related Cancer 2001;8:135-47.
63. De Besi P, Busnardo B, Toso S, Girelli ME, Nacamulli D, et al. Combined
chemotherapy with bleomycin, adriamycin, and platinum in advanced thyroid
cancer. J Endocrinol Invest 1991;14:475-80.
64. Schlumberger M, Abdelmoumene N, Delisle MJ, Couette JE, Group d’ Etude des
Tumeurs á Calcitonine (GETC). Treatment of advanced medullary thyroid cancer
with na alternating combination of 5 FU-streptozocin and 5 FU-dacarbazine. Br J
Cancer 1995;71:363-65.
65. Wu LT, Averbuch SD, Ball DW, De Bustros A, Baylin SB, Macguire III WP.
Treatment of advanced medullary thyroid carcinoma with combination
cyclophosphamide and dacarbazine. Cancer 1994; 73:432-36
66. Reinhardt M, Guttenberger R, Slanina J, Frommhold H, Moser E. Indications for
percutaneaus radiotherapy in carcinoma of the thyroid gland. Freiburg consensus.
Radiologie 1995;35:535-39.
67. Brierly J, Tsang R, Simpson WJ, Gospodarowicz M, Sutcliffe S, Panzarella T.
Medullary thyroid cancer: analysis of survival and prognostic factors and the role
of radiation therapy in local control. Thyroid 1996;6:305-10.
68. Olmos RAV, Hoefnagel CA, Bais E, Boot H, Tall B, Kraker J, Voute PA. Avances
terapéuticos de medicina nuclear en oncología. Rev Esp Med Nuclear
2001;20:547-57.
69. Jeweid ME, Hajjar G, Stein R, Sharkey RM, Herskovic T, et al. Inicial experience
with high-dose radioimmunotherapy of metastatic medullary thyroid cancer using
131I-MN-14 F(Ab)2 anti-carcinoembryonic AHS. J Nucl Med 2000;41:93-103.
36
70. Barzon L, Bonaguro R, Palù G, Boscaro M. New perpectives for gene therapy in
endocrinology. European Journal Endocrinology 2000;143:447-66.
71. Schmutzler C; Koehrle J. Innovative strategies for the treatment of thyroid cancer.
European Journal Endocrinology 2000;143:15-24.
72. Drosten M, Putzer BM. Gene therapeutic approaches for medullary thyroid
carcinoma treatment. J Mol Med 2003;81:411-19.
37
Agradecimentos
Suporte Financeiro do Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq) e Coordenação de Aperfeiçoamento de Pessoal de Nível
Superior (CAPES), Brasil.
38
Tabela 1 - Classificação, incidência e mutações associadas ao Carcinoma Medular
de Tireóide.
Fenótipo Incidência Mutações Germinativas no
proto-oncogene RET
(Exon/códon )
Apresentação Clínica
CMT esporádico 80% CMT
NEM 2ª 11 / 634
2A(1) 4% CMT, feocromocitoma e
hiperparatireoidismo
2A(2) 4% CMT e feocromocitoma
2A(3) 1% CMT e hiperparatireoidismo
NEM 2B 3% 16 / 918 CMT, feocromocitoma e
ganglioneuromas
CMTF 1% 10,13,14,15/ 609,611,618,
620; 768,790,791; 804,883;
891.
CMT (pelo menos em 4
membros)
Outros 7% CMT (em 2 ou 3 membros)
Adapt
ado
(3)
39
Figura 1 - Proto-oncogene RET.
40
Adaptado
(55)
Domínio rico cisteína
Figura 2 - Proporção estimada de pacientes com mutações específicas no códon
634 e metástases à distância ao diagnóstico. O teste log rank foi utilizado para
comparar as curvas (p = 0,001).
41
Capítulo II
RET Codon 634 Mutations in Multiple Endocrine Neoplasia Type 2:
Variable Clinical Features and Clinical Outcome
Artigo publicado no Journal of Clinical Endocrinology and Metabolism 2003;88:2644-49
42
RET Codon 634 Mutations in Multiple Endocrine Neoplasia Type 2:
Variable Clinical Features and Clinical Outcome
Marcia K. Puñales, M.D., Hans Graf, M.D., Ph.D.
1
, Jorge L. Gross, M.D, PhD.,
Ana Luiza Maia, M.D., PhD.
Endocrine Division, Hospital de Clínicas de Porto Alegre,
Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, and Serviço de
Endocrinologia e Metabologia do Paraná (SEMPR),
Universidade Federal do Paraná, Curitiba, PR
1
, Brazil
Running title: RET proto-oncogene and MEN 2
Grant support: Programa Núcleos de Excelência (PRONEX), Coordenação de
Aperfeiçoamento de Pessoal (CAPES), and Fundo de Incentivo a Pesquisa do Hospital de
Clínicas de Porto Alegre (FIPE), Brazil.
Correspondence: Ana Luiza Maia, M.D., Ph.D. Serviço de Endocrinologia, Hospital de
Clínicas de Porto Alegre. Rua Ramiro Barcelos 2350, 4° andar, Porto Alegre, RS, Brazil,
90035-003. Phone: + 55 51 33325188; Fax: 55 51 21018777. E-mail: [email protected]
43
Abstract
Since the establishment of a protocol for molecular analysis of hereditary
medullary thyroid carcinoma (MTC) in southern Brazil, in 1997, 17 independent
families with RET germline mutation have been identified. Because neither molecular
diagnosis nor the pentagastrin test were available before the establishment of this
protocol, we had the opportunity to observe a large number of patients in whom the
disease has evolved naturally without medical intervention, namely prophylactic
thyroidectomy. We observed a wide spectrum in terms of clinical presentation and
natural course of the disease even among genetically-related individuals. Sixty-nine
individuals from 12 different families presented a codon 634 mutation, the most
prevailing missense mutation in our series. The specific mutations identified were
C634Y (n=49), C634R (n=13), and C634W (n=7). Individuals with the C634R
mutation presented significantly more distant metastases at diagnosis than subjects
with the C634Y or C634W mutations (54.5% vs. 19.4% vs. 14.3%, respectively,
P=0.03). Further analysis of the estimated cumulative frequency of lymph node
and/or distant metastases by Kaplan-Meier curves showed that the appearance of
lymph nodes and metastases occurred later in patients with C634Y than in those with
C634R (P=0.001). Our results suggest that specific nucleotide and amino acid
exchanges at codon 634 might have a direct impact on tumor aggressiveness in
MEN 2A syndrome.
Key words: MEN 2A, MEN 2B, CMTF, RET Proto-oncogene.
44
Introduction
Medullary thyroid carcinoma (MTC), a tumor of the parafollicular C cells of the
thyroid, may occur sporadically or as part of three clinically distinct dominantly
inherited cancer syndromes. In patients with familial MTC (FMTC) only the thyroid is
affected. Patients with multiple endocrine neoplasia (MEN) 2A develop MTC,
pheochromocytoma (pheo) and/or primary hyperparathyroidism (HPT) (1). In
contrast, MEN 2B patients have MTC, pheo, ganglioneuromas of the digestive tract,
mucosal neuromas and/or skeletal abnormalities (1).
The RET proto-oncogene is the susceptibility gene for hereditary MTC (2).
Germline mutations in MEN 2A and FMTC syndromes have been described in exons
10,11, 13, 14 and 15 of RET, while a single germline mutation in exon 16 has been
found in >95% of unrelated MEN 2B cases (1,3). Genetic testing for germline
mutations in the RET proto-oncogene has become available and today forms the
basis for MTC screening procedures. Molecular biology now allows early
identification of carriers of RET proto-oncogene germline mutations who will develop
MTC later in life. In these patients, early prophylactic thyroidectomy must be
considered to ensure definitive cure. In fact, early thyroidectomy may decrease the
mortality from hereditary MTC to less than 5% (4).
In the past few years, several genotype-phenotype correlations have focused
on the relationship between specific mutations and different MEN 2 syndrome
variants (5-7). The international RET mutation consortium analysis, which studied
477 independent MEN 2 families, found a statistically significant association between
the presence of any mutation at codon 634 and presence of pheo and HPT (5).
Contrariwise, mutations at codons 768 and 804 are thus far associated with FMTC,
45
while codon 918 mutations are MEN-2B-specific (5). It is interesting to note that while
the international RET mutation consortium analysis reported that only 10% of FMTC
families have germline mutations in the intracellular domain of the RET gene, the
French Calcitonin Tumors Study Group found that this kind of mutation is present in
about half of FMTC families (6), suggesting that the frequency of specific RET
mutations in MEN 2A phenotype may be influenced by the genetic background of the
studied population.
The international RET mutation consortium analysis did not include any
Brazilian families, but in 1997 our group established a protocol for molecular analysis
of MTC in southern Brazil. Until then, neither molecular diagnostic tools nor the
pentagastrin test had been available, and therefore we had the opportunity to
observe the natural evolution of the disease, without prophylactic interventions, in
large families harboring the codon 634 RET mutation. These observations have
allowed us to study the heterogeneity in phenotype and disease presentation
associated with this mutation and motivated us to describe our findings. Therefore,
the present report has two aims: first, to describe the frequency of the RET proto-
oncogene in a sample of Brazilian kindred with hereditary MTC; and second to
describe the natural course of the disease in 69 heterozygotes from 12 independent
families presenting the RET codon 634 mutation.
46
Materials and Methods
Patients
Patients with a diagnosis of medullary thyroid carcinoma attending the
Endocrine Division at Hospital de Clínicas de Porto Alegre were invited to participate
in the study. Our division is a reference center for molecular testing of germline RET
mutation in Brazil, and therefore patients referred to us by other Brazilian centers for
molecular investigation were also invited to participate.
A total of 88 patients with germline mutation of the RET proto-oncogene and /
or and immunohistochemistry diagnosis of MTC were identified. This sample
encompassed 17 index cases and 61 affected members of families with hereditary
MTC, plus 10 individuals with sporadic tumors. Before undergoing genetic testing, all
patients and/or their legal guardians gave their written informed consent, as required
by the institution’s Ethics Committee.
MEN 2A cases were classified following the International Consortium of MEN
Syndromes (5). Briefly, families with MTC, Pheo, and HPT were classified as MEN
2A(1); families with MTC and Pheo as MEN 2A(2); and families with MTC and HPT,
as MEN 2A(3). The classification of FMTC refers to families with a minimum of 4
members with MTC. Families with fewer than 4 members affected by MTC were
classified under the category others. The data collected for each family included the
clinical features of family members (association of other endocrine neoplasias), the
presence and type of RET mutations, and information on atypical features noted,
such as Hirschsprung’s disease or cutaneous lichen amyloidosis (CLA).
47
Patients with positive genetic screening underwent a complete clinical
examination, laboratory tests [levels of basal calcitonin (Calcitonin IRMA - DSL7700,
Diagnostic Systems Laboratories, Inc., Webster, TX, reference range < 10 pg/ml),
plasma calcium and parathyroid hormone (PTH) (Immulite 2000 Intact PTH,
Diagnostic Products, Los Angeles, CA)], and extensive diagnostic imaging
investigation that included cervical ultrasonography, cervical, thorax, and abdominal
computed tomography (CT). Selected patients were submitted to whole-body
metaiodobenzylguanidine (MIBG) scintigraphy to rule out pheo and/or local and
distant metastasis. Also, a punch biopsy of the skin was performed in selected
patients suspected of having CLA in an area clinically affected by a characteristic
lesion. Biopsy specimens were fixed in 10% formalin and stained with hematoxylin
and eosin, crystal violet, and congo red.
The regular follow-up of hereditary MTC in our Division consists of basal
calcitonin, serum calcium and PTH determinations every 6 months and of a yearly
abdominal and chest CT. We advocate a preventive total thyroidectomy for gene
carriers older than 5 years, associated with a standard systematic central cervical
lymph node dissection in those with suspected MTC or C cell disease on the basis of
increased calcitonin level. Study participants with pheo or HPT underwent specific
surgery. Tumor staging was performed according to the current UICC TNM
classification (8).
DNA Extraction and PCR amplification
Genomic DNA was prepared from white blood cells according to standard
protocols. Oligonucleotide primers for amplification of different RET exons were
48
designed on the intronic sequences flanking exons 10 (5'
AGGCTGAGTGGGCTACGTCTG 3' / 5' GTTGAGACCTCTGTGGGGCT 3'), 11 (5'
ATGAGGCAGAGCATACGCAGCC 3' / 5' CTTGAAGGCATCCACGGAGACC 3'), 13
(5' AACTTGGGCAAGGCGATGCA 3' / 5' AGAACAGGGCTGTATGGAGC 3'), 14 (5’
AAGACCCAAGCTGCCTGA 3’ / 5’ GCTGGGTGCAGAGCCATAT 3’), 15 (5
´-GACCGCTGTGCCTGGCCAT 3´ / 5´-GCAGGCAGTCCTTGGGAAGC 3´) and 16
(5' AGGGATAGGGCCTGGGCTTC 3' / 5' TAACCTCCACCCCAAGAGAG 3'). PCR
reactions were run in a final volume of 50 µL using 100 or 200 ng genomic DNA,
containing 20mM Tris HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 1
unit of Taq polymerase and 1 µM of specific primer. Genomic DNA was denatured for
3 min at 94
o
C prior to 35 cycles at 94, 65 and 72
o
C for 1 min at each temperature
followed by a 5 min 72
o
C step in a programmable thermal controller (MJ Research,
Inc). Following PCR, the amplicon sizes were analyzed in 1.5% agarose gel and the
products visualized by ethidium bromide staining.
Single strand conformational polymorphism analysis, restriction enzyme analysis and
direct sequencing
For single strand conformational polymorphism (SSCP) analysis of exons 10,
11, 13, 14 and 15, the amplified DNA fragments were denatured in formamide and
cooled in ice before gel loading. Separation was carried out in a vertical
electrophoresis apparatus in an 8-12% polyacrylamide-0.8% bis-acrylamide gel at
8
o
C, 45
o
C, 30
o
C or at room temperature for exons 10, 11, 13 and 14-15 respectively,
at 200-240 mV for 2-4h (9,10). DNA bands were visualized by silver staining
according to standard procedures (11). The bands presenting altered migration were
49
further analyzed by differential restriction enzymes (12) for 2h. The product was
examined on a 2.5% agarose gel and the bands were visualized by ethidium bromide
staining. Amplicons of exon 16 were directly screened for mutations by restriction
enzyme analysis with Fok I (12). Whenever necessary, the presence of the mutation
was confirmed by direct sequencing of the PCR product using the Sanger method in
an automated sequencer, according to the manufacturer’s instructions (Alf Express,
Amersham Pharmacia Biotech, etc).
Statistical Analysis
Results are expressed as mean ± SD unless otherwise specified. Baseline
characteristics were compared using the χ
2
test or Fisher’s exact test for qualitative
variables, or the Student’s t-test or Mann-Whitney’s U-test for quantitative variables.
The differences in cumulative lymph node and/or distant metastasis rates among
groups were tested by Kaplan Meier curves; comparisons between curves were
performed using the Log Rank test. The Statistical Package for the Social Sciences
7.5 (SPSS, Chicago, IL) was used for the statistical analysis. P values of less than
0.05 were considered as statistically significant.
50
Results
Sample description
We analyzed the RET proto-oncogene from 160 individuals, 150 from
members of 17 separate MEN 2 families and 10 from patients with apparently
sporadic medullary thyroid carcinoma. A total of 78 individuals with hereditary MTC
were enrolled in this study. Fifty-four of these individuals were identified based on
clinical signs of thyroid neoplasia and familial thyroid cancer or endocrine related
neoplasias. In addition, molecular screening identified another 24 individuals without
clinical evidence of disease but at risk because of an affected relative. A mutation
was identified in all kindred patients with documented germline transmission of MTC.
RET proto-oncogene mutations and disease phenotype
Table 1 summarizes the clinical and molecular data of the families with MEN
2. Of the 17 families with hereditary MTC analyzed, 8 were diagnosed with MEN 2A;
4 with MEN 2B; 3 with the rare syndrome of MEN 2A associated with CLA; 1 with
FMTC; and 1 was categorized as “others.” MEN 2A patients were further
subclassified into 3 operational categories based on the combination of disease
features identified (6).
We observed a wide spectrum of clinical presentation and natural course of
the disease among MEN 2A individuals. The presence of pheo/HPT ranged from
12.5 – 100%. Age at diagnosis also showed ample variation in both individuals
diagnosed based on the presence of palpable thyroid nodule (9 - 63 yr.) and in those
51
22 identified by molecular screening (2.5 – 73 yr.). Of the 8 families classified as
MEN 2A, all but one had a mutation at codon 634, exon 11. The identified mutations
were TGC→CGC (Cys→Arg, 42.8%), TAC (Cys→Tyr, 42.8%) and TGG (Cys→Trp,
14.2%).
Three families presented the rare syndrome of MEN 2A associated with CLA
and all of them presented a germline mutation at codon 634. Because of the stringent
operational definition of FMTC (2), only 1 family fell into this category. A mutation at
codon 634 was identified in the index case and in 4 other family members. One
family was included in the category “others.” The proband, a 43-yr. old male who
denied having a family history of thyroid cancer presented a TGC→TAC (Cys→Tyr)
change at codon 634 and 1 of his 2 offspring was also diagnosed with MTC at age 25
yr. The most prevalent mutation in our series was observed at codon 634, accounting
for 93% of cases.
Four patients with MEN 2B syndrome were identified. All individuals presented
the characteristic phenotype and de novo mutation at codon 918, exon 16, resulting
in the substitution of a methionine residue by threonine (M918T). As expected, these
patients presented very aggressive tumors, with cervical or distant metastases at the
time of diagnosis. One patient died at the age of 18 yr. as a consequence of
gastrointestinal bleeding.
RET 634 mutation heterozygotes
In view of the large number patients with a codon 634 mutation, we analyzed
the individual clinical and oncological features of these patients. Sixty-nine individuals
from 12 unrelated families were found to harbor the germline RET 634 mutation
52
(table 1). In 47 (68.1%) subjects, including index patients, the diagnosis was based
on clinical evidence through evaluation of a thyroid nodule (table 1). All of these
individuals presented elevated basal serum calcitonin. Molecular screening identified
another 22 (31.9%) patients without clinical signs of thyroid cancer. Serum basal
calcitonin was determined in 19 of these, and was elevated in 8 (42%). As expected,
the mean age at diagnosis was significantly lower in these individuals than in patients
with clinical evidence of disease (21.7 ± 21.6 vs. 29.8 ± 11.6 yr., P<0.04), although
both groups presented a wide age range (table 1).
In the group of individuals diagnosed by RET screening, we were surprised to
identify as gene carriers 3 women with ages 62, 65 and 73 years in a MEN 2A + CLA
kindred (family # 11, table 1). They had no clinical complaints and their thyroid
physical examination was considered normal. Thyroid ultrasonography displayed 1 or
more nodules (varying in diameter from 0.3 – 2 cm) and guided-fine needle aspiration
confirmed MTC. Serum basal calcitonin was elevated in all 3 patients (880 pg/ml,
1100 pg/ml and 37.0 pg/ml, respectively, reference range < 10 pg/m). The 65-year
old patient underwent surgery, and the histopathologic examination revealed a 2cm
nodule on each thyroid lobe, with C cell hyperplasia and MTC. No metastasis was
found in a total of 62 lymph nodes removed. The two other patients refused surgery.
None of them presented distant metastases.
The frequency of pheo in the group of patients with clinical disease was 38.3%
(n=18). Nine individuals (19.1%) presented HPT; in 7 of these patients, HPT was
associated with pheo and MTC while in 2 patients it was associated to MTC only. All
patients except for one presented MTC as the first disease manifestation.
A total of 50 patients underwent surgery, 43 with clinical disease and 7 gene
carriers. All patients presented C cell hyperplasia and/or MTC at histopathology. In
53
the group of patients with clinical disease (table 2), lymph node and distant
metastases were present in 45.8 and 25% of individuals, respectively. Only 1 out of 7
gene carriers presented lymph node metastases – a 27-year-old woman with a
C634Y germline mutation. Seven patients died of MTC, and all of them had
disseminated disease at diagnosis. Neither sex (P=0.109) nor associated endocrine
neoplasia, pheo (P=0.174) or HPT (P=0.92), were associated with mortality. In
contrast, age at diagnosis (40.9 ± 10.4 vs. 28.6 ± 10.5, P=0.007) and stage of
disease (P=0.001) were significantly associated with death.
We also analyzed the clinical and oncological features of 47 patients identified
based on clinical evidence, grouped by nucleotide and amino acid exchange at
codon 634 (table 2). The specific mutations were C634Y (n=49), C634R (n=13), and
C634W (n=7). In these patients, we did not find significant differences in age at
diagnosis (P=0.46), frequency of pheo (P=0.62) or HPT (P=0.61), and lymph node
metastasis (P=0.19) among individuals with the 3 genotypes analyzed. However, the
presence of distant metastases at diagnosis was significantly higher in C634R
heterozygotes (P=0.03).
Natural history of MEN 2A in codon 634 mutation heterozygotes
Based on the finding of a significant association between the C634R mutation
and the presence of distant metastases at diagnosis, we speculated that specific
changes in cysteine substitution at codon 634 could affect natural history of disease
in MEN 2A. As gene dysfunction is present since birth, we assumed that the
individual age at diagnosis would indicate the period of exposure, and thus we
performed additional analyses using the Kaplan Meier model. Indeed, Kaplan Meier
54
estimates of cumulative lymph node metastasis rate in the 50 patients who
underwent surgery yielded distinct curves for C634R and C634Y genotypes
(P=0.027). The presence of distant metastases at diagnosis as a function of age was
also analyzed. Kaplan Meier estimates of distant metastasis rates yielded
significantly different curves for C634R and C634Y heterozygotes (P=0.001) (Fig. 1).
Both events, lymph nodes and distant metastases, occurred earlier in individuals
harboring the C634R mutation. The youngest patient with lymph nodes and distant
metastases (a 15-year-old girl) presented a C634R germline mutation. On the other
hand, distant metastases were not diagnosed before age 30 year in individuals with
the C634Y mutation. Individuals with the C634W mutation were not analyzed
because of the small number patients/ events.
55
Discussion and Conclusions
We showed the frequency profile of RET proto-oncogene mutations in a
sample of 17 unrelated Brazilian families with hereditary MTC. Because of the lack of
genetic or clinical screening until recently, we had the unique opportunity to observe
the natural history of MEN 2A in a large number of individuals harboring codon 634
mutations, classically described as high risk. We observed a wide variance in
disease phenotype, age at onset and tumor behavior in different families. Individuals
with the C634R genotype had significantly more distant metastases than those with
the C634Y or C634W mutations, despite similar ages at diagnosis. Accordingly,
Kaplan-Meier estimates of cumulative lymph node and/or distant metastasis rates
demonstrated that these events occurred earlier in individuals harboring the C634R
mutations, indicating that nucleotide and amino acid exchange might have a direct
impact on tumor aggressiveness in MEN 2A syndrome.
The RET proto-oncogene is expressed in cells of neuronal and neuroepithelial
origin and encodes a receptor tyrosine kinase (13). Approximately 92% of the three
variants of MEN 2 are related to germline mutations of RET (3). Mutations on the
highly conserved extracellular cysteine ligand-binding domain encoded by exons 10
and 11 induce constitutive tyrosine kinase activity due to aberrant homodimerization
(14,15). The transforming capacity of the c-RET examined in transfected NIH-3T3
cells has been shown to be dependent on specific mutated codons with the C634R
(TGC→CGC) mutant showing a 3-to 5-fold higher transforming activity compared
with any exon 10 Cys mutants (16). Although the three-dimensional structure of the
RET extracellular domain is still unknown, these cysteines likely form intramolecular
disulfide bonds in the wild-type receptor, and the mutation results in an unpaired
56
cysteine, which forms an activating intermolecular bridge (17). Differences in
dimerization induction intensities are a reasonable explanation for the phenotypes
resulting from mutations of the different cysteines. In fact, the international RET
mutation consortium analysis studied 477 MEN 2 families from 18 tertiary referral
centers, which did not include any kindred from Brazil, and demonstrated that
specifically mutated RET codons correlate with MEN 2 variants (2).
Differences in the frequency of specific RET mutations in MEN 2A phenotypes
have been found in series from different countries, suggesting that the occurrence of
these mutations may be influenced by genetic background (5-7,18-20). In our series,
the most frequent phenotype was the MEN 2A syndrome with codon 634 mutation, in
agreement with the results of the International RET mutation consortium analysis. In
that study, this kind of mutation was found in 86% of all cases of MEN 2A(1) and
MEN 2A (2). One of our MEN 2A (2) families presented a C618R mutation, which
was observed in only 4% of the families in the RET consortium. The family with
FMTC presented the C634Y mutation, the most prevalent codon 634 specific
mutation associated with this phenotype in the RET consortium.
In general, there is an agreement to recommend total thyroidectomy in MEN 2
carriers. However, no universal consensus exists as to the optimal timing and extent
of prophylactic surgery in these patients. A recent study (7) has proposed a division
of hereditary MTC into three risk groups, based on age at disease onset and
genotype: high risk group, codon 634 and 618 mutations; intermediate risk group,
codon 790, 620 and 611 mutations; and low risk group, codon 768 and 804
mutations. However, some reports have also called attention to the clinical variability
and aggressiveness associated with RET mutation at codons that are classically
described as having weakly activation, such as codon 804. Such reports indicate that
57
identical RET mutations behave differently, even in the same genetic background
(21,22).
We studied 47 patients with codon 634 mutation in whom the disease has
naturally evolved without medical interference (prophylactic or therapeutic
thyroidectomy) and we have also observed a wide spectrum in the clinical
presentation. Particularly, we studied a family harboring a C634Y mutation in which
we identified, by molecular screening, members ages 62, 65 and 73 yrs. who were
not aware of their condition and presented no clinical signs of disease, except for a
thyroid nodule measuring less than 2 cm in diameter detected by ultrasonography.
An interesting aspect was that the 65-year old patient – who was submitted to
surgery – had elevated basal serum calcitonin and MTC at histopathological
examination, but no lymph node or distant metastases, despite the advanced age,
indicating low tumor aggressiveness. Although we do not have histopathological data
about lymph node metastases for the 62 and 73 year-old patients because they have
refused surgery so far, both also seem to have an indolent disease. The observation
of such unexpected clinical course of MCT in patients harboring the classically
described high-risk 634 mutation suggested to us that nucleotide and amino acid
exchange at this codon could have an impact on the oncological features of MEN 2A.
Indeed, patients harboring the C634R mutation presented significantly more
distant metastases at diagnosis than subjects with C634Y or C634W,
notwithstanding similar age at diagnosis. Accordingly, Kaplan Meier estimates of
cumulative lymph nodes and distant metastasis rates yielded distinct curves,
indicating that these events occur earlier in individuals with the C634R genotype.
These findings probably explain the significant association of this genotype with
mortality in our series. Differences in oncological features nowadays are often difficult
58
to detect since gene carriers have thyroidectomy even before MTC has emerged.
Ours results suggest that there might be differences in the type of nucleotide and
amino acid exchange at codon 634 that affect the pace of malignant progression and
that may ultimately lead to widespread metastatic MTC. In agreement with our
findings, the youngest patients with hereditary MTC and lymph node metastasis
reported in the literature outside a MEN 2B setting was a 5-year old girl with the
C634R (Cys→Arg) missense change at codon 634 (23). Recently, the presence of
MTC has been reported in a prophylactic thyroidectomy specimen obtained from a
17-month old girl harboring the same mutation (24). The latter study also identified a
75 year-old gene-carrier with the C634Y genotype.
In our series, we identified three kindreds with the rare syndrome of MEN 2A
associated with CLA. CLA was first associated with MEN 2A by Gagel et al in 1989
(25), although Nunziata and colleagues had had previously reported the presence of
a pruritus in affected members of a particular kindred (26). So far, this association
has been reported in a total of only 19 families (3, 25-29). As in our study, these
families were distributed along the operational phenotypic categories, with an
apparent excess of MEN 2A(2) cases, all of which presented 634 mutations.
In conclusion, our results showed the frequency profile of proto-oncogene
RET mutations of MEN 2A in 17 Brazilian families. In addition, we have
demonstrated that families with hereditary thyroid carcinoma exhibit a highly variable
disease presentation and that even high-risk mutations, such as those at codon 634,
could present an indolent course depending on the type of nucleotide and amino acid
substitution. Individuals harboring C634R, the most prevailing missense change at
codon 634, seem to have a more aggressive disease, as demonstrated by more
frequent distant metastases at diagnosis. They also seem to develop lymph nodes
59
and distant metastasis at an earlier age, according to Kaplan Meier analyses. In
contrast, the C634Y genotype appears to have an indolent behavior, with low
potential for spreading the disease in some individuals. Based on these results, we
suggest that the timely prophylactic thyroidectomy advocated for codon 634
heterozygotes should take into account specific amino acid exchanges. The most
significant drawback of our observations is the limitation in the number of
patients/families. Considering the relatively small number of families with each
genotype studied, and the fact that a large number of the individuals analyzed as
unit-genotype belong to the same kindred, we cannot rule out the possibility of
interference of other hereditary molecular events in our conclusions. Finally, it is our
opinion that other information, in addition to the RET mutation, is still needed to allow
understanding of disease mechanisms and to clarify the process leading to
development of the full syndrome phenotype. Until such information is available, the
best therapeutic approach in gene carriers of hereditary medullary thyroid carcinoma
is still a matter of debate.
60
References
1. Ponder BA. The phenotypes associated with RET mutations in the multiple
endocrine neoplasia type 2 syndromes. Cancer Res 1999; 59:1736-42.
2. Mulligan LM, Kwok JB, Healey CS, Elsdon MJ, Eng C, Gardner E, Love DR, Mole
SE, Moore JK, Papi L, ponder MA, Telenius H, Tunnacliffe A, Ponder BA. Germ-
line mutation of the RET proto-oncogene in multiple endocrine neoplasia type 2 A.
Nature, 363:458, 1993.
3. Eng C, Clayton D, Schuffenecker I, Lenoir G, Cote G, Gagel RF, Van Amstel
HKP, Lips CJM, Nishisho I, Takai SI, Marsh DJ, Robinson BG, Frank-Raue K,
Raue F, Xue F, Noll WW, Romei C, Pacini F, Fink M, Niederle B, Zedenius J,
Nordenskjõld M, Komminoth P, Hendy GN, Gharib H, Thibodeau SN, Lacroix A,
Frilling A. The relationship between specific RET proto-oncogene mutation and
disease phenotype in multiple endocrine neoplasia type 2. JAMA 1996; 276:1575-
79.
4. Brandi ML, Gagel RF, Angelli A, Bilezikian JP, Beck-Peccoz P, Bordi C, Conte-
Devolx B, Falchetti A, Gheri R, Libroia A, Lips CJM, Lombardi G, Mannelli M,
Pacini F, Ponder BAJ, Raue F, Skogseid B, Tamburrano G, Thakker RV,
Thompson NW, Tomassetti P, Tonelli F, Wells Jr SA, Marx SJ. Consensus:
guidelines for diagnosis and therapy of MEN type 1 and type 2. J Clin Endocrinol
Metab 2001; 86:5658-71.
5. Mulligan LM, Marsh DJ, Robinson BG, Schuffeenecker I, Zedenius J, Lips CJM,
Gagel RF, Takai SI, Noll WW, Fink M, Raue F, Lacroix A, Thibodeau SN, Frilling
A, Ponder BAJ, Eng C. International RET mutation consortium. Genotype-
61
phenotype correlation in multiple endocrine neoplasia type 2: report of
international RET mutation consortium. J Intern Med 1995; 238:343-46.
6. Niccoli-Sire P, Murat A, Rohmer V, Frank S, Chabrier G, Baldet L, Maes B,
Savagner F, Giraud S, Bezieau S, Kottler M, Morange, Conte-Devolx B. The
French calcitonin tumors study group (GETC). Familial medullary thyroid
carcinoma with noncysteine RET mutations: phenotype-genotype relationship in a
large series of patients. J Clin Endocrinol Metab 2001; 86:3746-3753.
7. Machens A, Gimm O, Hinze R, Hoppner W, Boehm BO, Dralle H. Genotype-
phenotype correlations in hereditary medullary thyroid carcinoma: oncological
features and biochemical properties. J Clin Endocrinol Metab 2001; 86:1104-09.
8. Greene FL, Sobin LH. The TNM system: our language for cancer care. J Surg
Oncol 2002; 80:119-20.
9. Ceccherini I, Hofstra RMW, Luo Y, Stulp RP, Barone V, Stelwagwn T. DNA
polymorphisms and conditions for SSCP analysis of the 20 exons of the RET
proto-oncogene. Oncogene 1994; 9:3025-29.
10. Tsai MS, Ledger GA, Khosla S. Identification of multiple endocrine neoplasia,
type 2 gene carriers using linkage analysis and analysis of the RET proto-
oncogene. J Clin Endocrinol Metab 1994; 78:1261-67.
11. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual. 2
nd
Edition. Cold Spring Harbor Laboratory Press 1989; 18:56-57.
12.Wohllk N, Cote GJ, Evans DB, Goepfert H, Ordonez NG, Gagel RF. Application of
genetic screening information to the management of medullary thyroid carcinoma
and multiple endocrine neoplasia type 2. End Metab Clin Am North 1996; 25:1-24.
62
13. Takahashi M, Cooper GM. Cloning and expression of the RET proto-oncogene
encoding a tyrosine-kinase with two potential transmembrane domain. Oncogene
1988; 3:571-76.
14. Santoro M, Carlomagno F, Romano A, Bottaro DP, Dathan NA, Grieco M, Fusco
A, Vecchio G, Matoskova B, Kraus MH, Difiore PP. Activation of RET as a
dominant transforming gene by germline mutations of MEN 2A and MEN 2B.
Science 1995; 267:381-83.
15.Chappuis-Flament S, Pasini A, De Vita G, Segouffin-Cariou C, Fusco A, Attie T,
Lenoir GM, Santoro M, Billaud M. Dual effect on the RET receptor of MEN 2
mutations affecting specific extracytoplasmic cysteines. Oncogene 1998;
17:2851-61.
16. Ito S, Iwashita T, Murakami H, Iwata Y, Sobue-Ku and Takahashi M. Biological
properties of RET with cysteine mutations correlate with multiple endocrine
neoplasia type 2A, familial thyroid carcinoma, and Hirschsprung’s disease
phenotype. Cancer Res 1997; 14:2870-72.
17. Santoro M, Mellilo RM, Carlomagno F, Fusco A, Vecchio G. Molecular
mechanism of RET activation in human cancer. Ann NY Acad Science 2002; 117-
21.
18. Quadro L, Panariello L, Salvatore D, Carlomagno F, Del Frete M, Nunziata V,
Colantuoni V, Di Giovanni G, Brandi ML, Mannelli M, Gheri R, Verga U, Libroia A,
Berger N, Fusco A, Grieco M, Santoro M. Frequent RET protooncogene
mutations in multiple endocrine neoplasia type 2a. J Clin Endocrinol Metab 1994;
79:590-94.
63
19. Hansen HS, Torring H, Godballe C, Jãger AC, Nielsen FC. Is thyroidectomy
necessary in RET mutations carriers of the familial medullary thyroid carcinoma
syndrome? Cancer 2000; 89:863-67.
20.Klein I, Ésik O, Homolya V, Szeri F, Váradi A. Molecular genetic diagnostic
program of multiple endocrine neoplasia type 2a and familial medullary thyroid
carcinoma syndromes in Hungary. J Endocrinol 2001; 170: 661-66.
21. Feldman GL, Edmonds MW, Ainsworth PJ, Schuffenecker I, Lenoir GM, Saxe
AW, Talpos GB, Roberson J, Petrucelli N, Jackson CE. Variable expressivity of
familial medullary thyroid carcinoma (FMTC) due to a RET V804M (GTG→ATG)
mutation. Surgery 2000; 128:93-98.
22. Lombardo F, Baudin E, Chiefari E, Arturi F, Bardet S, Caillou B, Conte C,
Dallapiccola B, Giuffrida D, Bidart JM, Schlumberger M, Filetti S. Familial
medullary thyroid carcinoma: clinical variability and low aggressiveness
associated with RET mutation at codon 804. J Clin Endocrinol Metab 2002;
87:1674-80.
23.Gill JR, Reyes-Múgica M, Iyengar S, Kidd KK, Touloukian J, Smith C, Keller MS,
Genel M. Early presentation of metastatic medullary carcinoma in multiple
endocrine neoplasia, type 2a. J Pediatr 1996; 31:459-64.
24. Sanso GE, Domene HM, Rudaz MCG, Pusiol E, Mondino AK, Roque M, Ring A,
Perinetti H, Elsner B, Iorcansky S, Barontini M. Very early detection of RET proto-
oncogene mutation is crucial for preventive thyroidectomy in multiple endocrine
neoplasia type 2 children. Cancer 2002; 94:323-30.
25. Gagel R, Levy ML, Donovan DT, Alford BR, Wheeler B, Tschen JA. Multiple
endocrine neoplasia type 2
associated with cutaneous lichen amyloidosis. Ann
Intern Med 1989; 111:802-06.
64
26. Nunziata V, Giannattasio R, Di Giovani G, D’Armiente MR, Mancini M. Hereditary
localized pruritus in affected members of a kindred with multiple endocrine
neoplasia type 2A (Sipple’s syndrome). Clin Endocrinol (Oxf) 1989; 30:57-63.
27. Lemos MC, Carilho F, Rodrigues FJ, Santos P, Carvalheiro M, Ruas MA,
Regateiro FJ. Early onset of medullary thyroid carcinoma in a kindred with
multiple endocrine neoplasia type 2A associated with cutaneous lichen
amyloidosis. Endocr Pract 2002; 8:19-22.
28. Seri M, Celli I, Betsos N, Claudiani F, Camera G, Romeo G. A cys634gly
substitution of the RET proto-oncogene in a family with recurrence of multiple
endocrine neoplasia type 2a and cutaneous lichen amyloidosis. Clin Genet 1997;
51:86-90.
29. Ceccherini I, Romei C, Barone V, Pacini F, Martino E, Loviselli A, Pinchera A,
Romeo G. Identification of a cys634→tyr mutation of the RET proto-oncogene in
a pedigree with multiple endocrine neoplasia type 2a and localized cutaneous
lichen amyloidosis. J Endocrinol Invest 1994; 17:201-04.
65
Acknowledgments
We are thankful to Dr. Alberto Molinari (Hospital Nossa Senhora da
Conceição, Porto Alegre, RS) and to Dr. José Gastão (Hospital de Clínicas, UFPR,
Curitiba, PR) for referring patients for the present study. We also thanks to the
surgeons of our Hospital, Dr. Alceu Migliavacca and Dr. José Ricardo Guimarães, for
surgical management of our patients
66
Table 1 - Clinical characteristics and RET mutations in families with Multiple Endocrine Neoplasia Type 2.
Phenotype (%) N families Individuals
analyzed/
affected
Codon/
Amino acid
substitution
Age of
proband at
diagnosis (yr)
Pheo HPT Age range
Individuals with
clinical disease
(n)
Individuals
without clinical
disease (n)
MEN 2A 47.0
MEN 2A (1) 1
2
3
4
13/8
29/12
5/2
12/7
C634Y
C634Y
C634R
C634W
19
36
25
36
(1)
(6)
(1)
(3)
(2)
(1)
(1)
(1)
18 - 50 (6)
11 - 36 (9)
25 (1)
9 - 37 (7)
2.5 - 43 (2)
7 - 20 (3)
5.5 (1)
MEN 2A (2)
5
6
7
5/3
3/3
6/2
C634R
C634Y
C634R
42
45
29
(2)
(1)
(2)
(1)
(-)
(-)
35 - 42 (1)
27 - 46 (2)
29 (1)
8 (1)
7 (1)
5 (1)
8 6/5 C618R 34 (1) (-) 34 - 63 (3) 7 - 12 (2)
MEN
2A+CLA
17.6 9
10
11
3/2
7/4
36/20
C634R
C634R
C634Y
25
28
43
(-)
(1)
(1)
(-)
(-)
(-)
15 - 25 (2)
22 - 50 (4)
16 - 43 (7) 3 - 73 (13)
FMTC 5.8 12 7/4 C634Y 55 (-) (-) 19 - 55 (4)
Other forms 5.8 13 3/2 C634Y 43 (-) (-) 25 - 43 (2)
MEN 2B 23.5 14
15
16
17
4/1
4/1
3/1
4/1
M918T
M918T
M918T
M918T
14
11
21
14
(1)
(-)
(-)
(-)
(-)
(-)
(-)
(-)
MEN 2A(1): families with MTC, Pheo, and HPT; MEN 2A(2): families with MTC and Pheo; FMTC: families with a minimum of 4
members with MTC; Others: families with fewer than 4 individuals with MTC; CLA: cutaneous lichen amyloidosis. Histological
proof of MTC, pheo, and HPT was required.
Table 2 - Clinical and oncological features of Multiple Endocrine Neoplasia 2A
grouped by nucleotide / amino acid exchange.
634 C634W C634Y C634R P
N (total) 47 7 30 10
Sex (% female) 55.3 85.7 43.3 70.0 0.07
Mean age (yr.) 29.8 ± 11.6 24.3 ± 12.1 30.6 ± 11.8 31.0 ± 10.5 0.46
Age range (yr.) 5 – 65 9 - 37 11- 55 15 - 50
% Pheo 38.3 42.9 33.3 50 0.62
% HPT 19.1 14.3 16.7 30 0.61
PN1 (%) 51.2 42.9 44.4 77.8 0.19
PM1 (%) 31.1 14.3 24.1 66.7 0.03*
68
Figure 1 - Kaplan Meier estimates of the proportion of patients with specific codon
634 mutation and distant metastases at diagnosis. The log rank test was used to
compared curves (P=0.01).
69
Capítulo III
Malignant Progression of Hereditary Medullary Thyroid Carcinoma
in Children and Young Adults
Artigo submetido à publicação
70
Malignant Progression of Hereditary Medullary Thyroid Carcinoma
in Children and Young Adults
Marcia K. Puñales, M.D., Andreia Possatti da Rocha, M.D., Camila Meotti,
Jorge L. Gross, M.D, Ph.D. and Ana Luiza Maia, M.D., Ph.D.
Endocrine Division, Hospital de Clínicas de Porto Alegre,
Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil
Running title: Gene Carriers and Thyroidectomy
Grant support: Programa Núcleos de Excelência (PRONEX), Coordenação de
Aperfeiçoamento de Pessoal (CAPES), and Fundo de Incentivo a Pesquisa do Hospital de
Clínicas de Porto Alegre (FIPE), Brazil.
Correspondence: Ana Luiza Maia, M.D., Ph.D. Serviço de Endocrinologia, Hospital de
Clínicas de Porto Alegre. Rua Ramiro Barcelos 2350, 4° andar, Porto Alegre, RS, Brazil,
90035-003. Phone: + 55 51 21018127; Fax: 55 51 21018777. E-mail: [email protected]
71
Abstract
Medullary thyroid carcinoma (MTC) may occur sporadically or as component
of the Multiple Endocrine Neoplasia Type 2 syndrome. The DNA-based RET
genotype analysis enables the identification of gene carriers at risk of developing
MTC. However, no universal consensus exists as to the optimal timing of the
prophylactic procedure. Here we described the clinical and oncology features of 51
Brazilian children and young adults under 25 years of age harboring RET mutations.
In 22 patients, the diagnosis was established based on clinical evidences of MTC
while RET screening was able to identify other 29 asymotomatic gene carriers. Forty-
two patients underwent total thyroidectomy, 22 therapeutically and 20
prophylactically. The mean age at surgery was significantly higher in the group of
patients with clinical disease than in those identified by RET analysis (17.9 ± 5.5 vs.
13.5 ± 5.8 years, P=0.018). C-cell hyperplasia associated to MTC was observed 69%
at thyroidectomy specimens. The group of patients who underwent therapeutic
surgery presented more advanced disease based on the TNM classification than
those in the prophylactic group (P<0.001). A positive correlation between age at
surgery and TNM stages was observed (P=0.0013). In the therapeutic group, after a
follow up period of 10.4 years, 11% died and 22% have persistent disease. In contrast,
all patients of the prophylactic surgery are considered cured based on basal serum
calcitonin. In conclusion, our data showed a time-dependent MTC progression, further
demonstrating the importance of early diagnosis and intervention on the
management of this hereditary neoplasia.
Key words: RET Proto-oncogene, Gene carriers. Prophylactic Thyroidectomy
72
Introduction
Medullary thyroid carcinoma (MTC) may occur sporadically or as a
manifestation of an autossomal-dominant inherited syndrome Multiple Endocrine
Neoplasia Type 2 (MEN 2), characterized by the presence of various endocrine
tumors in variable clinical expression (1). Features of MEN 2A include MTC,
pheochromocytoma (PHEO), and hyperparathyroidism (HPT). MEN 2B presents a
specific phenotype that encompasses MTC, neuromas of lips, tongue, and
gastrointestinal tract, marfanoid habitus and/or skeletal anomalies. The presence of
isolated MTC in at least 4 members characterizes the familiar medullary thyroid
carcinoma (FMTC) (2-5). MEN 2A can also be associated with the rare syndrome of
cutaneous lichen amyloidosis (CLA) and Hirschsprung disease (5-8).
The malignant transformation of the C-cell begins very early in life among the
hereditary form of MTC. Patients with MEN 2B generally develop MTC earlier and
presents a more aggressive tumor than MEN 2A. FMTC usually having a later age at
onset and exhibits a less aggressive behavior (9-11). Nearly 100% of hereditary
forms of MTC are associated with germline mutation of the RET proto-oncogene
(RET) (2,3,10,12). The various mechanism of RET activation might determine the
pace of malignant transformation from C-cell hyperplasia to MTC, the first and most
commonly fatal neoplasm among RET gene carriers (13,14).
The DNA-based RET genotype analysis gained worldwide acceptance and the
identification of asymptomatic gene carriers at risk of developing hereditary MTC has
allowed early prophylactic thyroidectomy (10,14-17). Perhaps the most important
consideration related to genetic testing is when to perform total thyroidectomy in
asymptomatic gene carriers (18). Early prophylactic procedure will most likely obviate
73
the need for the potentially more radical approach to MTC, which requires systematic
dissection of the central cervical lymph-node compartment (10,18,19). Most of the
authors agree that RET carriers of mutations at codon 918 and 922 should undergo
prophylactic thyroidectomy preferably within the first 6 months of life while surgery
can be deferred until the age of 5 years for asymptomatic carriers of the other RET
mutations (10,14-17). Exceptions may include specific carriers of mutations at
codons 630 and 634 who may require earlier surgical intervention (20). In other
mutations, thyroidectomy may be performed between the ages of 5 to 10 years old.
Meanwhile, when to perform an additional central lymph node dissection is still
controversial. The lag period between the appearance of node-negative MTC and the
evolution of lymph node metastases is estimated to be of 6.6 years for carriers of
RET mutations at codon 634 (10). Nodal metastases are uncommon before the age
of 10 years in 630 and 634 mutations and before the age of 20 years in 609, 611,
618, 620, 768, 790, 791, 804, and 891 mutations (10,15). Nevertheless, the
unpredictability of the malignant transformation has prompted to offer prophylactic
surgery on asymptomatic RET gene carriers despite normal basal and stimulated
calcitonin levels (10,21-24).
Close surveillance of patients prophylactically thyroidectomized during
childhood will be of a great help in order to define the best time to perform and for
evaluating the effectiveness of this procedure. A recent study has reported a lower
incidence of persistent or recurrent disease in children who underwent total
thyroidectomy before 8 years of age and who had no metastases to cervical lymph
nodes (25).
74
Here we described the clinical presentation, time-dependent MTC progression,
and oncology features of 51 Brazilian children and young adults harboring RET
mutations.
75
Patients and Methods
Subjects
Patients with the diagnosis of MCT attending the Endocrine Division at
Hospital de Clínicas de Porto Alegre were invited to participate in the study. Our
division is a reference center for molecular testing of germline RET mutation in
southern Brazil and patients from other Brazilian medical centers referred to us for
molecular investigation were also invited to participate. A total of 130 patients with
germline mutation of the RET proto-oncogene and/or histological and
immunohistochemistry diagnosis of MTC were included. This sample was initially
formed from index cases and affected members of 22 families with hereditary MTC.
Before undergoing genetic analysis, all patients and/or their legal guardians had
given informed consent in accordance with institutional Ethics Committee.
MEN 2A classification used in this study was according to the International
Consortium of MEN 2 Syndromes (3). Patients with MTC, pheochromocytoma
(PHEO), and hyperparathyroidism (HPT) were classified as MEN 2A(1), families with
MTC and PHEO as MEN 2A(2), and families with MTC and HPT, as MEN 2A(3);
FMTC correspond to families with a minimum of 4 members with MTC and others,
families with fewer than 4 individuals with MTC. Data provided from each family
include clinical features of family members (association of other endocrine
neoplasias), presence and type of RET mutations, and information of atypical
features noted, such as Hirschsprung’s disease or cutaneous lichen amyloidosis
(CLA).
76
Patients with positive genetic screening underwent a complete clinical
examination, laboratory tests (Until 2004, basal calcitonin (VR. 10 pg/dl, Calcitonin
IRMA - DSL7700, Diagnostic Systems Laboratories, Inc., Webster, TX, USA) and
after, January 2004 (VR. Male < 12.0 pg/dl and female < 6.0 pg/dl, Immulite 2000,
Diagnostic Products Corporation, Los Angeles, CA, USA), carcinoembrionary antigen
(cea), plasma calcium and parathyroid hormone (PTH) levels (Immulite 2000 Intact
PTH, Diagnostic Products, Los Angeles, CA, USA), and extensive diagnostic imaging
investigation that included cervical ultrasonography, cervical, thorax, and abdominal
computed tomography (CT), whole-body metaiodobenzylguanidine (MIBG)
scintigraphy (selected patients) to rule out PHEO and/or local and distant metastasis.
In selected patients suspected to have CLA a punch-biopsy of the skin was
performed in an area clinically affected by a lesion. Biopsy specimens were fixed in
10% formalin and stained with hematoxylin and eosin, crystal violet, and congo red.
The standard follow up of MTC in our Division consists of the determination of
basal serum calcitonin, cea, serum calcium and PTH (every 6 months) and,
abdominal and chest CT (every year). We advocate a preventive total thyroidectomy
for gene carriers older than 5 years, associated with a standard systematic central
cervical lymph node dissection in those with suspected medullary thyroid carcinoma
or C-cell disease on the basis of increased calcitonin level. Patients with PHEO or
HPT underwent specific surgery. Tumor staging was performed according to the
current UICC TNM classification (26).
77
DNA Analysis
Genomic DNA was prepared from peripheral blood leukocytes by standard
procedures (27). Exons 10, 11, 13, 14, 15 and 16 were amplified using specific
primers by polymerase chain reaction (PCR) as described previously (28). RET
mutations were screened by single-strand conformational polymorphism (SSCP)
and/or restriction enzyme digestion and/or direct sequencing, according to the
manufacturer’s instructions (Alf Express, Amersham Pharmacia Biotech, etc). All
PCR reactions were performed in 50 µL volume using 100 or 200 ng genomic DNA,
containing 20mM Tris HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 1
unit of Taq polymerase and 1 µM of specific primer. Genomic DNA was denatured for
3 min at 94
o
C prior to 35 cycles at 94, 65 and 72
o
C for 1 min at each temperature
followed by a 5 min 72
o
C step in a programmable thermal controller (MJ Research,
Inc). Following PCR, the amplicon sizes were analyzed in 1.5% agarose gel and the
products visualized by ethidium bromide staining.
Statistical Analysis
Results are expressed as mean ± SD unless otherwise specified. Baseline
characteristics were compared using the χ
2
test or Fisher’s exact test for qualitative
variables, or the Student’s t-test or Mann-Whitney’s U-test for quantitative variables.
The Statistical Package for the Social Sciences 12.0 (SPSS, Chicago, IL) was used
for the statistical analysis. P values of less than 0.05 were considered as statistically
significant.
78
Results
Sample Description
We analyzed RET proto-oncogene of 181 members of 22 independent MEN 2
families, and a total of 97 individuals with hereditary MTC were enrolled. Fifty-eight of
these individuals were identified based on clinical signs of thyroid neoplasia and
familial thyroid cancer or endocrine related neoplasias. In addition, molecular
screening identified 39 individuals as RET gene carriers. Mutations were identified in
all patients with documented germline transmission of MTC.
MCT progression in patients under 25 years-old
The clinical and oncological features of 51 individuals 25 years of age or
younger from 21 independent MEN 2 families are summarized in Table 1. Of them,
10 kindred were classified as MEN 2A (26 individuals), 3 with MEN 2A associated
CLA (14 individuals), 1 MEN 2A associated to Hirschsprung disease (1 individual), 6
with MEN 2B (9 individuals), and 1 family was classified as others (1 individual).
Twenty-two individuals were identified based on clinical signs of thyroid
neoplasia and further confirmed by RET analysis and twenty-nine individuals
identified as gene carriers, being all diagnosed by molecular screening, except 1 who
was identified by pentagastrin stimulated testing at the age of 5 years (Table 1). The
identified RET mutations were as follows: C634Y (27 individuals), C634R (8
individuals), C634W (4 individuals), C618R (3 individuals) and M918T (9 individuals).
79
Three families presented the rare syndrome of MEN 2A associated to CLA (30
individuals) and all of them presented a germline mutation at codon 634, 2 harboring
the genotype C634R and one C634Y. One family was classified as MEN 2A
associated to Hirschsprung disease. The index patient was a 35 year-old woman
who harbor a C618R mutation and one of 4 siblings also presented RET mutation,
without any clinical of Hirschsprung disease. Only 1 family was included in the
category of “others”, being 2 individuals affected with isolated MTC.
Six patients with MEN 2B syndrome were identified. Five individuals presented
the characteristic phenotype and de novo mutation at codon 918 in exon 16, resulting
in the substitution of a methionine residue by threonine (M918T). As expected, these
patients presented very aggressive tumors, with cervical or distant metastases at the
time of diagnosis. One patient died at the age of 18 years, as a consequence of
metastatic MTC and gastrointestinal bleeding. Only 1 family with MEN 2B presented
6 affected individuals. The index case was a 9-year-old boy who complained of
ganglioneuromatosis of the oral mucosa and was attended at the genetic division of
our hospital because oral neuromas. His mother (26-year-old), 3-year-old sister, and
aunt (18-year-old) were then diagnosed by molecular screening. Clinical examination
revealed neuromas at oral mucosa and tongue in all of them. Past medical history
revealed that his grandmother underwent total thyroidectomy for MTC (T2N0M0) at
the age of 31 years old and abdominal surgery for unilateral left pheochromocytoma.
Another aunt died at the age of 16 years old, 2 years after a diagnosis of metastatic
MTC associated to unilateral pheochromocytoma.
The mean age at diagnosis of the 51 patients was 13.7 ± 6.2 years (from 1.75
to 25 years of age). Patients diagnosed by molecular screening were younger than
those with clinical signs of MTC (11.2 ± 6.4 vs.16.9 ± 4.4 years, P < 0.001).
80
Pheochromocytoma was diagnosed in 5 individuals (4 unilateral and 1
bilateral), 3 with MEN 2B and 2 MEN 2A. Adrenal disease was the first manifestation
in 1 patient. Three individuals presented hyperparathyroidism, 2 with histological
examination demonstrating adenoma of the parathyroid gland and one an apparently
normal gland but elevated intact PTH levels.
Serum calcitonin was determined in 32 patients. Twenty-one patients (65.6%)
presented elevated serum basal calcitonin levels at diagnosis and 2 individuals
showed abnormal pentagastrin test. Of note, all patients with normal basal calcitonin
(9 individuals) that underwent thyroidectomy were classified as stage I and presented
thyroid nodules less than 1.0 cm at histological examination.
Thyroid ultrasound (US) was performed in 43 patients and demonstrated the
presence of one or more nodule in 32 (74.4%). US failed to detect thyroid nodules in
11 individuals (25.6%) who presented histological diagnosis of medullary carcinoma
associated or not to C-cell hyperplasia. All these patients were classified as stage I
and presented tumors less than 1.0 cm at histological examination. Fine needle
aspiration biopsy was performed in 24 cases. The results were as follows: MTC in 17
(70.8%), suspicious of MTC in 4 (16.6%), and not satisfactory in 3 (12.5%) cases.
Therapeutic vs. Prophylactic Thyroidectomy
Forty-two patients underwent total thyroidectomy (Table 2). The mean age at
the surgery was 15.8 ± 6.0 years, ranging from 5.0 to 29.5 years. Patients who
underwent therapeutic thyroidectomy (22 individuals) were significantly older than
patients (20 individuals) who underwent prophylactic procedure (17.9 ± 5.5 vs. 13.5 ±
5.8 years, P=0.018).
81
C-cell hyperplasia associated to MTC was observed in 29 of 42 patients (69%)
at thyroidectomy specimens (table 2). Twelve individuals (28.6%) presented multifocal
MTC, most of them in the group of individuals submitted to therapeutic surgery (10
patients, 83%). Only 2 patients in the group diagnosed by RET analysis presented
multifocal disease. Interesting, 1 patient despite unilateral and unique thyroid nodule
associated to C-cell hyperplasia.
In the group of patients who underwent therapeutic thyroidectomy, metastases
to regional nodes were found in 4 patients with MEN 2A (mean age of 21.4 ± 1.6
years) and 1 associated to CLA (29.5 years). Distant metastases were identified in 2
patients (15 and 25 years at diagnosis) with MEN 2A associated to CLA and in 3
individuals with MEN 2B. No patients identified by molecular screening presented local
or distant metastases. No patient younger than 15 years of age, excluding those with
MEN 2B, presented metastatic disease at diagnosis.
The TNM classification in the group submitted to therapeutic thyroidectomy was
as follows (Figure 1): 4 of 22 patients (18.2%) were classified as stage I (13.4 ± 4.4
years); 8 individuals (36.4%) as stage II (17.3 ± 4.7 years), 5 (22.7%) as stage III (22.7 ±
4.3 years) and 5 (22.7%) as stage IV; (18.0 ± 6.2 years). Three of 5 patients classified
as stage IV presented MEN 2B syndrome. Tumoral sizes in these patients were ≤ 1.0
cm in 4 individuals (18.2%). Fourteen individuals (63.6%) presented tumor sizes >
1.0 and ≤ 4.0 cm. Four individuals (18.2%) presented tumor sizes larger than 4.0 cm,
one of them associated to MEN 2B syndrome.
The TNM classification in the group submitted to prophylactic thyroidectomy was
significantly different from that in the therapeutic group (P<0.001). Most patients were
classified as stage I (17 of 20, 85%; mean age 12.5 ± 5.8 years). Three patients (15%)
82
were at stage II (18.9 ± 4.7 years). No patient in this group was classified as stage III
or IV. Tumoral sizes in these patients were ≤ 1.0 cm in 17 patients (85%) and > 1.0
and ≤ 4.0 cm in 3 individuals. No patient diagnosed by molecular screening had
tumor larger than 4.0 cm.
As expected, we observed a positive correlation between age at surgery and
TNM stages (r2= 0.33, P=0.0013). Indeed, the ages at thyroidectomy was significant
different among both groups (P= 0.018). The mean age at surgery at each stage was
similar in both groups.
Data on follow up and outcome are available in 18 of 22 patients who
underwent therapeutic thyroidectomy. The mean follow up period was 10.4 ± 7.1
years (from 1 to 29 years). Two individuals with MEN 2B died at 16 and 21 years of
age, 2 and 7 years after the diagnosis, respectively. The postoperative serum
calcium levels were evaluated at least once year postoperatively in all patients who
underwent total thyroidectomy. Twelve individuals out of 16 are biochemically cured
and 4 have persistent disease (25%). Six patients (37.5%) developed permanent
hypoparathyroidism, requiring calcium and vitamin D supplements to maintain the
serum calcium levels within or near the normal.
In the group of patients submitted to prophylactic procedure, the mean follow
up period was 3 years (from 5 months to 13 years). None of them died. All patients
all biochemically cured, based on serum normal basal calcitonin. One patient (9 year-
old girl) developed permanent hypoparathyroidism.
83
Discussion and Conclusion
In the present study, we report the molecular, clinical and oncological features
of 51 children and young adults with hereditary MTC. In 22 of these individuals, the
diagnosis was established based on clinical evidences of disease and therapeutic
thyroidectomy was performed. Molecular screening was able to identify other 29
children and young adults without any clinical manifestation of MTC and prophylactic
thyroidectomy indicated. The observed differences in the TNM stages between these
2 groups of patients, mainly determined by the age at surgery, are overwhelming to
demonstrate the importance of the early diagnosis and intervention in the
management of this aggressive hereditary disease.
The Multicenter European Multiple Endocrine Neoplasia (EUROMEN) study
confirmed preliminary data from large institutions of an age-dependent and codon-
specific progression of early medullar carcinoma (10). A significant age-related
progression from C-cell hyperplasia to MTC and, ultimately, nodal metastasis in
patients grouped by extracellular and intracellular domain mutations was observed
(10). The authors reported that malignant progression from C-cell hyperplasia to
MTC may occur during the first years of life in asymptomatic carriers of germ-line 634
codon mutations in RET and nodal metastasis occur approximately 6.6 years after
the malignant transformation, being a very rare event before the age of 14 years (10).
As a substantial lag interval exists before medullar carcinoma progresses from C-cell
hyperplasia, genetic diagnosis of RET mutations is unique in offering the opportunity
of preemption by codon orientated prophylactic thyroidectomy before medullar
carcinoma arises and codon orientated prophylactic surgery marks the transition from
curative to truly prophylactic surgery, ushering in the new era of DNA-based
84
management of MEN 2. The earlier medullary thyroid carcinoma is kept from
progressing along the pathway of tumor cell dissemination, the better are the
chances of surgical cure (25). Total thyroidectomy and node resection is the only
curative therapeutic method of MTC (14,15,28,29). Survival rates are reported to be
about 65% in 10 year of follow up and are directly associated to the age at onset,
presence of lymph node disease, metastases at presentation and the extent of the
thyroid surgery (31,32).
Data about the experience with MEN 2 syndromes in South America are
limited (23,28,33). Recently, the evaluation of histological findings and prophylactic
thyroidectomy in MEN 2 Chilean population were reported (32). In agreement with
other studies, the authors observed that the tumor is often preceded by biochemical
detection of the disease and that the prophylactic procedure should be done early in
life because the age-dependent progression from C-cell hyperplasia to MTC. Here
we described the molecular and clinical data from 51 patients with 25 years of age or
younger from 21 unrelated MEN 2 kindred (Table 1). Genetic screening identified 29
asymptomatic gene carriers and 22 individuals were diagnosed based on clinical
signs of medullary thyroid carcinoma. Mutations were identified in all patients with
documented germline transmission of MTC. Serum basal calcitonin and/or
pentagastrin test was elevated in about 75% of patients. Interestingly, all patients
with normal basal calcitonin were classified as stage I at histological specimens, with
thyroid nodules less than 1.0 cm, demonstrating the correlation between tumor size
and calcitonin levels. Thyroid ultrasound was able to identify one or more nodules in
74.4% of the cases but failed in 11 cases, all of them with tumor sizes less than 1.0
cm. Fine needle aspiration biopsy was able to establish the diagnosis in about 71%
of the cases and was suspicious for MTC in other 20%.
85
In our series, 42 individuals underwent thyroidectomy, 22 of them
therapeutically and 20 prophylactically. As expected, the mean age at surgery was
significantly lower in the group of patients identified on basis of molecular diagnosis
than in those with clinical disease (Table 2). Most of the patients with clinical disease
presented multifocal medullary thyroid carcinoma at histological examination
compared to only 4.8% of patients diagnosed by molecular screening. In agreement
with the EUROMEN study, no patient younger than 15 years of age presented nodal
or distant metastases. However the owing to unpredictability of the timing of somatic
“hits” required for malignant progression, there may be a small risk of earlier
progression to medullary thyroid carcinoma beyond data delineated in the different
series of patients reported.
The most important consideration to take account related to genetic testing is
the ideal timing of total thyroidectomy in asymptomatic carriers (30). Systematic
dissection of the central cervical lymph-node compartment and a more aggressive
approach of MTC could be avoided by an early prophylactic procedure (10,18,19,33).
In fact, we observed that the TNM stages in the group of patients who underwent
therapeutic thyroidectomy were significantly different from those observed in the
prophylactic group (Table 2). In agreement with the above statements, the age at the
procedure appeared to be the most determinant factor. There was a time-dependent
progression of MTC, with an advance of age according to the progression of TNM
stages. It is interesting to note that the mean age at surgery at each stage was similar
between the groups (Figure 1).
A recent study evaluated the effect of early thyroidectomy in young patients
identified by direct DNA analysis as carriers of a RET mutation characteristic of MEN 2A
(25). The authors reported that after a mean follow up period of 5 years of the
86
prophylactic surgery, no evidence of persistent or recurrent MTC were found in patients
submitted to thyroidectomy before 8 years of age (25). Although, it should be stressed
that a longer period of evaluation is still necessary to confirm that they are cured, these
results indicate an extremely high chance of cure when early thyroidectomy is
performed. In our sample, we had the opportunity to compare the effect of the
intervention timing between 2 groups of children and young adults. The only difference
between these children was the availability of the molecular screening allowing pre-
clinical diagnosis. The results on disease outcome reflect the importance of early
intervention. In the group of patients submitted to therapeutic surgery 2 individuals died
(9%) and 4 (18%) have persistent disease after a mean follow up period of 10 years. In
contrast, all patients who underwent prophylactic thyroidectomy are considered cured
based on serum basal calcitonin. However, we should call attention for the relatively
short follow up period (mean of 3 years, ranging from 5 months to 13 years) and for
the fact that a pentagastrin testing was not performed in these individuals.
In our division, we advocate total thyroidectomy in MEN 2 carriers harboring
RET mutations at codons described as the most aggressive, represented mainly by
codon 918 and associated to MEN 2B, as soon as possible. While, in patients
harboring mutations at extracellular domain especially mutations at codon 634, at the
age of 5 years. And, those harboring mutations at the intracellular domains and
associated to FMTC or MEN 2A, presenting a less aggressive behavior, between 5
to 10 years.
In conclusion, the data analysis from 42 thyroidectomized children and young
adults harboring RET mutations demonstrate that early diagnosis and thyroidectomy
are essential to the hereditary MTC prognosis. The understanding of other
mechanisms associated to tumorigenesis and RET activation to clarify the process
87
involved in the pace of malignant progression and that may ultimately lead to
widespread metastatic MTC, will help to define the best therapeutic approach,
namely the ideal timing to perform the prophylactic thyroidectomy.
88
References
1. Ponder BA. The phenotypes associated with RET mutations in the multiple
endocrine neoplasia type 2 syndromes. Cancer Res 1999; 59:1736-42.
2. Eng C, Clayton D, Schuffenecker I, Lenoir G, Cote G, Gagel RF, Van Amstel
HKP, Lips CJM, Nishisho I, Takai SI, Marsh DJ, Robinson BG, Frank-Raue K,
Raue F, Xue F, Noll WW, Romei C, Pacini F, Fink M, Niederle B, Zedenius J,
Nordenskjõld M, Komminoth P, Hendy GN, Gharib H, Thibodeau SN, Lacroix
A, Frilling A. The relationship between specific RET proto-oncogene mutation
and disease phenotype in multiple endocrine neoplasia type 2. JAMA
1996;276:1575-79.
3. Mulligan LM, Marsh DJ, Robinson BG, Schuffeenecker I, Zedenius J, Lips
CJM, Gagel RF, Takai SI, Noll WW, Fink M, Raue F, Lacroix A, Thibodeau
SN, Frilling A, Ponder BAJ, Eng C. International RET mutation consortium.
Genotype-phenotype correlation in multiple endocrine neoplasia type 2: report
of international RET mutation consortium. J Intern Med 1995;238:343-46.
4. Machens A, Gimm O, Hinze R, Hoppner W, Boehm BO, Dralle H. Genotype-
phenotype correlations in hereditary medullary thyroid carcinoma: oncological
features and biochemical properties. J Clin Endocrinol Metab 2001;86:1104-
09.
5. Gagel R, Levy ML, Donovan DT, Alford BR, Wheeler B, Tschen JA. Multiple
endocrine neoplasia type 2
associated with cutaneous lichen amyloidosis. Ann
Intern Med 1989;111:802-06.
6. Nunziata V, Giannattasio R, Di Giovani G, D’Armiente MR, Mancini M.
Hereditary localized pruritus in affected members of a kindred with multiple
89
endocrine neoplasia type 2A (Sipple’s syndrome). Clin Endocrinol (Oxf)
1989;30:57-63.
7. Eng C, Flier JS, Underhill LH. The RET proto-oncogene in multiple endocrine
neoplasia type 2 and Hirsprung’s disease. N Engl J Med 1996;335:943-51.
8. Caron P, Attié T, David D, Amiel J, Brousset F, Roger P, Munnich A, Lyonnet
S. C618R mutation in exon 10 of the RET proto-oncogene in a kindred with
multiple endocrine neoplasia type 2A and Hirschsprung’s disease. J Clin
Endocrinol Metab 1996;81:2731-33.
9. Heshmati H, Gharib H, van Heerden JA, Sizemore GW. Advances and
controversies in the diagnosis and management of medullary thyroid
carcinoma. Am J Med 1997;103:60-69.
10.Machens A, Niccoli-Sire P, Hoegel J, Frank-Raue K, Van Vroonhoven TJ,
Roeher HD, Wahl RA, Lamesch P, Raue F, Conte-Devolx B, Dralle H;
European Multiple Endocrine Neoplasia (EUROMEN) Study Group. Early
malignant progression of hereditary medullary thyroid cancer. N Engl J Med
2003;16:1517-25.
11.Gill JR, Reyes-Múgica M, Iyengar S, Kidd KK, Touloukian J, Smith C, Keller
MS, Genel M. Early presentation of metastatic medullary carcinoma in multiple
endocrine neoplasia, type 2a. J Pediatr 1996; 31:459-64.
12. Kouvaraki MA, Shapiro SE, Perrier ND, Cote GJ, Gagel RF, Hoff AO,
Sherman SI, Lee JE, Evans DB. RET proto-oncogene: a review and update of
genotype-phenotype correlations in hereditary medullary thyroid cancer and
associated endocrine tumors. Thyroid 2005;15:531-44.
90
13. Wells SA, Chi DD, Toshima K, Dehner LP, Coffin CM, Dowton SB, et al.
Predictive DNA testing and prophylactic thyroidectomy in patients at risk for
multiple endocrine neoplasia type 2 a. Ann Surg 1994;220:237-50.
14.Brandi ML, Gagel RF, Angelli A, Bilezikian JP, Beck-Peccoz P, Bordi C,
Conte-Devolx B, Falchetti A, Gheri R, Libroia A, Lips CJM, Lombardi G,
Mannelli M, Pacini F, Ponder BAJ, Raue F, Skogseid B, Tamburrano G,
Thakker RV, Thompson NW, Tomassetti P, Tonelli F, Wells Jr SA, Marx SJ.
Consensus: guidelines for diagnosis and therapy of MEN type 1 and type 2. J
Clin Endocrinol Metab 2001; 86:5658-71.
15.Machens A, Ukkat J, Brauckhoff M, Gimm O, Dralle H. Advances in the
management of hereditary medullary thyroid cancer. J Int Med 2005;257:50-
59.
16.Machens A, Holzhausen HJ, Thanh PN, Dralle H. Malignant progression from
C-cell hyperplasia to medullary thyroid carcinoma in 167 carriers of RET
germline mutations. Surgery 2003;134:425-31.
17. Dralle H, Gimm G, Simon D, Frank-Raue K, Güinter G, Niederle B, Wahl RA,
Koch B, Walgenbach S, Hampel R, Ritter MM, Spelsberg F, Heiss A, Hinze R,
Hoppner W. Prophylactic thyroidectomy in 75 children and adolescents with
hereditary medullary thyroid carcinoma: German and Austrian experience.
World J Surg 1998;22;744–51.
18. Decker RA, Peacock ML. Update on the profile of multiple endocrine
neoplasia type 2a RET mutations: practical issues and implications for genetic
testing. Cancer 1997;80:557-68.
91
19. Kebebew E, Ituarte PH, Siperstein AE, Duh QY, Clark OH. Medullary thyroid
carcinoma. Clinical characteristics, treatment, prognostic factors, and a
comparison of staging systems. Cancer 2000;88:1139-48.
20.Machens A, Schneyer U, Holzhausen HJ, Raue F, Dralle H. Emergence of
medullary thyroid carcinoma in a family with the Cys630Arg RET germline
mutation. Surgery 2004;136:1083–7.
21. Machens A, Schneyer U, Holzhausen HJ, Dralle H. Prospects of remission in
medullary thyroid carcinoma according to basal calcitonin levels. J Endocrinol
Metab 2005;90:2029-33.
22.Cote GJ, Gagel R. Lessons learned from the management of a rare genetic
cancer. N Engl J Med 2003;349:1566-68.
23. Sanso GE, Domene HM, Rudaz MCG, Pusiol E, Mondino AK, Roque M, Ring
A, Perinetti H, Elsner B, Iorcansky S, Barontini M. Very early detection of RET
proto-oncogene mutation is crucial for preventive thyroidectomy in multiple
endocrine neoplasia type 2 children. Cancer 2002;94:323-30.
24. Hansen HS, Torring H, Godballe C, Jäger AC, Nielsen FC. Is thyroidectomy
necessary in RET mutations carriers of familial medullary thyroid carcinoma
syndrome? Cancer 2000;89:863-67.
25. Skinner MA, Moley JA, Dilley WG, Owzar K, Debenedetti MK, Wells SA Jr.
Prophylactic thyroidectomy in multiple endocrine neoplasia type 2A. J Clin
Endocrinol Metab 2005,353;1105-13.
26.O’Sullivan B, Shah J. New TNM Staging Criteria for Head and Neck Tumors.
Sem Surg Oncol 2003;21:30–42.
27. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual.
2
nd
Edition. Cold Spring Harbor Laboratory Press 1989;18:56-57.
92
28. Puñales MK, Graf H, Gross JL, Maia AL. RET codon 634 mutations in multiple
endocrine neoplasia type 2: variable clinical features and clinical outcome. J
Clin Endocrinol Metab 2003;88:2644-49.
29.Cohen MS, Moley JF. Surgical treatment of medullary thyroid carcinoma. J
Intern Medicine 2003;253:616-26.
30. Moley JF, Debenedetti MK, Dilley WG, Tisell, L. E, Wells SA. Surgical
management of patients with persistent or recurrent medullary thyroid cancer.
J Intern Med 1998;243:521-26.
31. Hyer SL, Vini L, A’Hern R, Harmer C. Medullary thyroid cancer: multivariate
analysis of prognostic factors influencing survival. Eur J Surg Oncol 2000; 26:
686-90.
32. Modigliani E. Cohen R, Campos J, M, Conte-Devolx B, Maes B, Boneu A,
Schlumberger M, Bigorgne JC, Dumontier P, Leclerc L, Corcuff B, Guilhem I.
Prognostic factors for survival and biochemical cure in medullary thyroid
carcinoma: results in 899 patients. Clin Endocrinol 1998;48:265-73.
33. Ramos SC, Ojeda SD, Cohn MD, Wohllk GN. Prophylactic thyroidectomy in
children and young people with hereditary medullary thyroid carcinoma: A
Chilean experience. Rev Med Chil 2005;133:1029-36.
93
Acknowledgments: We are thankful to the physicians who sent patients to molecular
analysis and the surgeons of our Hospital, Dr. Alceu Migliavacca and Dr. José
Ricardo Guimarães, for surgical management of our patients.
Current mailing address of all authors:
Serviço de Endocrinologia
Hospital de Clínicas de Porto Alegre
Rua Ramiro Barcelos 2350
90035 –003 Porto Alegre, RS, Brazil
94
Table 1 - Clinical characteristics and RET mutations in 51 Children and Young Adults with Multiple Endocrine Neoplasia Type 2:
Age at
Diagnosis
(y)
Surg Age at
Surgery
(y)
Diagnosis
Screening
Clinical
Diagnosis
PHEO HPT PTH Ca CT CT
(R.V)
CEA US
Nodule
Tumor
size
Local
Meta
Distant
Meta
Tumor
Stage
Lymph
Ressec
Mutation Phenotype
1 1,75 No . Yes No No No . 3,9 NL . No . . . . C634R MEN 2A
2 2,5 Yes 5,75 Yes No No No 29,44 17 NL 0,32 No 1 0 0 1 9-/9 C634Y MEN 2A
3 3 Yes 6,5 Yes No No No 36,2 69 High 2,18 1 0 0 1 11-/11 C634Y CLA
4 3 No . Yes No No No . 16 High 3,89 . . . . M918T MEN 2B
5 5 Yes 5 Yes No No No . 30 PG . No 1 0 0 1 No C634R MEN 2A
6 5,5 Yes 6,5 Yes No No No . 9,0 37,5 High . No 1 0 0 1 No C634R MEN 2A
7 6 No . Yes No No No . . . . . . . . C634Y MEN 2A
8 6,75 Yes 9 Yes No No No 36,2 8,9 9,5 NL 1,08 No 1 0 0 1 19-/19 C634Y CLA
9 7 No . Yes No No No . . . . . . . . C634Y MEN 2A
10 7 No . Yes No No No . . . . . . . . C634R MEN 2A
11 7 Yes 9,75 Yes No No No . 0,7 NL . No 1 0 0 1 9-/9 C618R MEN 2A
12 8 No . Yes No No No . . . . . . . . C634Y MEN 2A
13 9 Yes 9 No Yes No No . . . . 1 0 0 1 C634W MEN 2A
14 9 Yes 9,5 Yes No No No . 3 NL . No 1 0 0 1 C634R MEN 2A
15 9,25 Yes 11,75 Yes No No No 28,08 28 NL 6,07 No 1 0 0 1 C634Y CLA
16 9,25 Yes 10 Yes Yes No No - 9,2 47 NL 1,97 Yes 1 0 0 1 17-/17 M918T MEN 2B
17 11 Yes 11 No Yes No No . 100 High . Yes 1 0 0 1 No C634Y MEN 2A
18 11 Yes 11 No Yes Yes No . 1200 High . Yes 2 0 0 2 M918T MEN 2B
19 12 Yes 15,75 Yes No No No . 12,9 NL . Yes 1 0 0 1 11-/11 C618R MEN 2A
20 12,5 Yes 13,25 Yes No No No . 9,4 9,98 High . Yes 1 0 0 1 13-/13 C634Y CLA
21 12,75 Yes 13,75 Yes No No No . 28 High 0,86 No 1 0 0 1 25-/25 C634Y CLA
22 13 Yes 13,5 No Yes No No . . . . Yes 2 0 0 2 C634W MEN 2A
23 13,25 Yes 14,75 Yes No No Yes 75,8 *4,3 39 High 1,53 No 1 0 0 1 20-/20 C634Y CLA
24 13,75 Yes 14,75 Yes No No No 25,6 9,5 55 High 3,6 No 1 0 0 1 9-/9 C634Y CLA
25 14 Yes 14 No Yes No No . . . . Yes 2 0 0 2 C634W MEN 2A
26 14 Yes 16 No Yes Yes No . 9,2 642,3 High . Yes 2 1 1 4 M918T MEN 2B
27 14 Yes 14 No Yes Yes No . . . . Yes . 1 1 4 M918T MEN 2B
28 14,8 Yes 15 No Yes No No . 685
High
. Yes 2 1 1 4 3+/36 M918T MEN 2B
29 15 Yes 15 No Yes No Yes . 540
High
. Yes 1 0 0 1 9-/9 C634Y MEN 2A
30 15 Yes 16 No Yes No No . 3500
High
. Yes 2 1 1 4 C634R CLA
95
31 15 Yes 15 No Yes No No . . . . Yes 2 0 0 2 M918T MEN 2B
32 16 No . Yes No No No . . . . . . . . C634Y MEN 2A
33 16 Yes 17,25 Yes No No No 29,57 10,0 518
High
7,15 Yes 2 0 0 2 21-/21 C634Y CLA
34 16,5 Yes 17,5 Yes Yes No No 27,3 *4,0 410,9
High
. Yes 2 0 0 2 17-/17 C634Y CLA
35 18 Yes 19,75 No Yes No Yes . 30 PG . Yes 2 0 0 2 C634Y MEN 2A
36 18 Yes 18 No Yes No No . . . . Yes 4 1 0 3 2+/36 C634Y MEN 2A
37 18 No . Yes No No No . . . . . . . . C618R HIRS
38 18,5 No . Yes No No No . . . . . . . . M918T MEN 2B
39 19 Yes 19 No Yes No No . 80 High . Yes 1 0 0 1 No C634Y MEN 2A
40 19 Yes 19 No Yes No No . . . . Yes 2 0 0 2 C634W MEN 2A
41 19 Yes 29,5 Yes Yes Yes No . 7,0 882,5 High . Yes 2 1 0 3 2+/36 C634Y CLA
42 19 Yes 22,75 No Yes No No . . . 24,4 Yes 2 1 0 3 3+/36 C634Y MEN 2A
43 20 Yes 21,25 Yes No No No . 788
High
. Yes 1 0 0 1 C634Y MEN 2A
44 20 Yes 20,75 Yes No No No 52,9 *4,6 77
High
2,79 Yes 1 0 0 1 28-/28 C634Y CLA
45 20 Yes 20 No Yes No No . 3579
High
. Yes 3 0 0 3 C634Y MEN 2A
46 21 Yes 21 No Yes No No . . . . Yes 2 0 0 2 M918T MEN 2B
47 21,75 Yes 22 Yes Yes No No 14,8 9,5 2200 High Yes 2 0 0 2 20-/20 C634R CLA
48 23 Yes 23,25 No Yes No No . . . . Yes . 1 0 3 C634Y MEN 2A
49 25 Yes 25 No Yes Yes No . 46 High . Yes 2 0 0 2 C634Y MEN 2A
50 25 Yes 25 Yes Yes No No . . . . Yes 1 0 0 1 C634Y Others
51 25 Yes 29 No Yes No No . 1600 High . Yes 2 1 1 4 C634R CLA
Surg; Surgery, PHEO: pheochromocytoma, HPT: hyperparathyroidism, PTH: intact paratohormone, Ca: total serum calcium and *ionic calcium, CT:
basal calcitonin, CT (V.R): calcitonin reference value, NL: normal, PG: pentagastrin stimulated testing, CEA: carcinoembrionary antigen, US Nodule:
presence of thyroid nodule at ultrasound, Local Meta: presence of local metastasis, Distant Meta: presence of distant metastasis, Lymph Ressec:
number of lymph nodes ressected during surgery and number of positive or negative lymph/total lymph ressected.
96
Table 2 - The histological findings of 42 patients who underwent total thyroidectomy:
Age at Therapeutic
Thyroidectomy (n)
Age at Prophylactic
Thyroidectomy (n)
Extracellular and Intracellular
Mutations
17.9 ± 5.5y (22) 13.5 ± 5.8y (20)
MEN 2A extracellular Mutations
Codon 618 and 634
(16) (19)
C-Cell Hyperplasia + Multifocal MTC
18.5 ± 6.4y (10) 14.0 ± 6.0y (17)
Multifocal MTC
19.8 ± 5.5y (6)
5.75 y (1)
C-Cell Hyperplasia + Unilateral MTC (0) 15.75y (1)
MEN 2B intracellular Mutations
Codon 918
(6) (1)
C-Cell Hyperplasia + Multifocal MTC 15 y (2) (0)
Multifocal MTC
15.5 ± 4.2y (4)
10y (1)
97
Figure 1 - Correlation between age at surgery and TNM stage of patients who
underwent therapeutic or prophylactic thyroidectomy.
98
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo
